Терапевтическое восстановление и усиление увлажнения поверхности глаза



Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза
Терапевтическое восстановление и усиление увлажнения поверхности глаза

 


Владельцы патента RU 2510274:

ШЕПЕНЗ АЙ РИСЕРЧ ИНСТИТЬЮТ (US)
ДЗЕ РЕДЖЕНТС ОФ ДЗЕ ЮНИВЕРСИТИ ОФ КАЛИФОРНИЯ (US)

Группа изобретений относится к фармацевтической композиции и способам ее применения в лечении недостатка глазной граничной смазки, симптомов, с этим связанных, или нежелательных состояний, которые связаны с недостатком граничной смазки на поверхности глаза. Фармацевтическая композиция содержит человеческий белок PRG4, его увлажняющий фрагмент, гомолог или изоформу, суспендированную в офтальмологически приемлемом сбалансированном солевом растворе. Фармацевтическая композиция может также включать один или более офтальмологически приемлемый агент, выбранный из группы, состоящей из офтальмологически приемлемого успокоительного, эксципиента, вяжущего, сосудосуживающего, смягчающего средства, гиалуроната натрия, гиалуроновой кислоты и поверхностно-активных фосфолипидов, в фармацевтически приемлемом носителе для местного введения. Группа изобретений обеспечивает лечение заболеваний, связанных с нарушением увлажнения поверхности роговицы и конъюнктивы. 2 н. и 13 з.п. ф-лы, 10 ил., 3 пр.

 

Отсылка к родственным заявкам

[001] Данная патентная заявка претендует на привилегии, предоставляемые в связи с подачей предварительной заявки США №61/051, 112, поданной 7 мая 2008, которая включена в данную заявку посредством ссылки.

Область изобретения

[002] Данное изобретение относится к организации увлажнения (смазки) глаза. В частности, данное изобретение относится к фармацевтическим композициям и способу их применения в лечении заболеваний, связанных с нарушением увлажнения поверхностей роговицы и конъюнктивы.

Уровень изобретения

[003] Ген протеогликана 4 (prg4) кодирует сильно гликозилированные белки, так называемые фактор стимуляции мегакариоцитов (MSF, megakaryocyte stimulating factor), любрицин (lubricin) и белок поверхностной зоны (SZP, superficial zone protein) (1). Любрицин впервые выделили из синовиальной жидкости и продемонстрировали in vitro его увлажняющую способность, схожую с синовиальной жидкостью, на границе раздела хрящ-стекло (2). Позднее Jay et al. (3-9) идентифицировали любрицин как продукт синовиальных фибробластов (3), а также показали, что он обладает граничной увлажняющей способностью на границе раздела латекс-стекло. Впоследствии было показано, что O-связанные β(1-3) Gal-GalNAc олигосахариды внутри большого муцин-подобного домена из 940 аминокислот (10), закодированного в экзоне 6, в частности, опосредуют эту граничную увлажняющую способность (8). SZP впервые был локализован на поверхности эксплантата хряща в его поверхностной зоне и выделен из кондиционированной среды (11). SZP также продемонстрировал увлажняющую способность на границе раздела хрящ-стекло (12). Эти молекулы вместе относятся к так называемым PRG4. Также было показано, что PRG4 присутствует на поверхности синовиальной оболочки (58), сухожилий (13) и менисков (14). Кроме того, было показано, что PRG4 участвует, как в физиологических, так и в патофизиологических концентрациях, в обеспечении граничного увлажнения соединяющихся суставных хрящевых поверхностей (59).

[004] Функциональное значение prg4 было показано с помощью мутаций, которые вызывают у людей САСР-синдром (камптодактилия - артропатия - соха vara - перикардит). САСР проявляется камптодактилией, невоспалительной артропатией и гипертрофическим синовиитом, деформацией шейки бедра соха vara, перикардитом и плевритом (15). Кроме того, у мышей без PRG4 наблюдалось разрушение хряща и последующее повреждение суставов (16). Таким образом, экспрессия PRG4 является необходимым компонентом здоровых синовиальных суставов.

[005] PRG4 является членом семейства муцинов, которые обычно в большом количестве встречаются на эпителиальных выстилках и обеспечивают многие функции, включая увлажнение и защиту от проникновения микроорганизмов (17). Функциональные свойства муцинов, как правило, определяются специализированными моделями гликозилирования и их способностью формировать мультимеры с помощью межмолекулярных дисульфидных связей (18); и то, и другое изменяется при хронических заболеваниях (например, при муковисцидозе, бронхиальной астме) (17). Биохимические характеристики PRG4, выделенного из синовиальной жидкости (2, 19), демонстрируют молекулярную неоднородность в O-гликозилировании, что, по-видимому, влияет на увлажняющие свойства (8). Недавно было показано, что PRG4 из бычьей синовиальной жидкости в дополнение к мономерным формам существует в виде дисульфид-связанных димеров, по-видимому, за счет консервативных цистеин-богатых доменов на N- и С-концах наряду с непарным цистеином на С-конце (20).

[006] В тканях, таких как синовиальные суставы, физико-химические режимы увлажнения были классифицированы как жидкая пленка или граничная смазка. Действующий режим увлажнения зависит от нормальных и касательных сил, действующих на сочленяющиеся ткани, от относительной скорости касательного движения этих поверхностей, а также от времени нагрузки и движения. Коэффициент трения, µ, является количественной мерой и определяется как отношение касательной силы трения к нормальной силе. Один тип режима увлажнения, опосредованный жидкостью, является гидростатическим. В начале нагрузки и, как правило, в течение длительного времени межклеточная жидкость в хряще находится под давлением в связи с двухфазной природой ткани; жидкость также может подвергаться давлению в неровностях между сочленяющимися поверхностями по механизму просачивания. Таким образом, находящаяся под давлением межклеточная жидкость и задержанный увлажняющий пул могут внести значительный вклад в поддержание нормальной нагрузки с небольшим сопротивлением силе сдвига за счет очень низкого µ. Кроме того, в начале нагрузки и/или движения появляется сжатая пленка, гидродинамический и упругогидродинамический типы жидкой увлажняющей пленки, с повышением давления, движением и деформацией, действующими на движение вязкой смазки от и/или через промежуток между двумя поверхностями при относительном движении.

[007] Соответствующие границы, в которых классически возникает давление жидкости/пленки против граничной смазки, зависит от ряда факторов (31). Когда увлажняющая пленка может протечь между соответствующими скользящими поверхностями, которые могут упруго деформироваться, возникает упругогидродинамическая смазка. Давление, шероховатость поверхностей и относительная скорость скольжения определяют, когда полная жидкая смазка начинает разрушаться, и смазка вступает в новый режим. Когда скорость уменьшается, увлажняющая пленка, прилипшая к сочленяющимся поверхностям, начинает способствовать появлению смешанного режима смазки. Если скорость уменьшается еще сильнее, и остается только ультратонкий слой смазки, состоящий из нескольких молекул, то возникает граничная смазка. Поэтому граничный режим смазки обозначается коэффициентом трения (отношением измеренной силы трения между двумя контактирующими поверхностями при относительном движении к приложенной нормальной силе) при постоянном скольжении, независимом от факторов, которые влияют на формирование жидкой пленки, таких как относительная скорость скольжения и осевая нагрузка (35). Для суставного хряща был сделан вывод, что граничная смазка, несомненно, возникает, хотя и дополняется повышением давления под жидкостью и другими механизмами (36-39).

[008] В граничной смазке нагрузка поддерживается контактом поверхность-поверхность, а связанные фрикционные свойства определяются поверхностными молекулами смазки. Предположительно, этот режим важен потому, что противоположные слои хряща контактируют примерно на 10% от общей площади, и это может быть в той части, где происходит наибольшее трение (30). Кроме того, с увеличением времени нагрузки и рассеяния гидростатического давления покрытые смазкой поверхности несут все более высокие нагрузки по сравнению с давлением под жидкостью, и, следовательно, этот режим может становиться все более доминирующим (31, 32). Граничная смазка, в сущности, смягчает скачкообразные движения при трении (31), и поэтому заявляется как уменьшающая сопротивление и при постоянном движении, и в начале движения. Последняя ситуация имеет отношение к нагрузке, которую несут сочленяющиеся поверхности после длительной сжимающей нагрузки (например, при сидении или стоянии in vivo) (33). Типичные модели износа хряща поверхностей (34) также показывают, что граничная смазка хрящевых поверхностей имеет решающее значение для защиты и поддержания структуры суставной поверхности.

[009] С увеличением времени нагрузки и рассеяния гидростатического давления поверхности, покрытые смазкой, несут все более высокие нагрузки по сравнению с давлением под жидкостью, и, следовательно, µ может становиться все более доминирующим при этом режиме смазки. Граничный режим смазки обозначается значениями µ при постоянном скольжении, независимом от факторов, которые влияют на формирование жидкой пленки, таких как относительная скорость скольжения и осевая нагрузка. Граничная смазка, в сущности, смягчает скачкообразные движения при трении, и поэтому заявляется как уменьшающая сопротивление и при постоянном движении, и в начале движения.

[0010] Накопление PRG4 в синовиальной жидкости и на суставной поверхности, вероятно, является ключевой функциональной детерминантой граничной увлажняющей способности PRG4. Недавно было показано, что в результате динамической нагрузки сдвига культивированных хрящевых эксплантов возникает значительная, трехкратная секреция PRG4 по сравнению со свободно набухающими или статично сжатыми культурами (27). Этот синтез PRG4 и секреция хондроцитами могли бы значительно увеличивать концентрацию PRG4 в синовиальной жидкости, как в гомеостатических, так и в патологических условиях, когда присутствуют физиологические регуляторы (23). Хотя количество PRG4, связанного с поверхностью, по-видимому, не коррелирует с уровнем секреции, предыдущие исследования показывают, что связанные с поверхностью PRG4 могут меняться с эндогенными PRG4 в синовиальной жидкости (25), особенно под влиянием механических волнений (26, 27). Разъяснение пространственных и временных аспектов метаболизма PRG4 в суставе, особенно на суставной поверхности, будет также способствовать пониманию вклада PRG4 в формирование низкого коэффициента трения на суставном хряще и, возможно, приведет к лечению, предотвращающему потерю его функции (40, 41). Многое еще предстоит узнать о процессинге и о потенциальных дополнительных или альтернативных функциях различных молекул PRG4 различного молекулярного веса (10, 27, 28, 61). Кроме того, сочетание химических и механических факторов для стимуляции экспрессии PRG4 в хондроцитах вблизи суставной поверхности может быть полезным для создания ткани хряща, созданной из изолированных субпопуляций (29), с поверхностью, которая является биологически активной и функциональной в плане увлажнения.

[0011] Точные механизмы граничной смазки на биологических границах раздела в настоящее время неизвестны. Тем не менее, протеогликан 4 (PRG4) может играть решающую роль в качестве граничной смазки в шарнирных суставах. По-видимому, этот секретируемый гликопротеин защищает хрящевые поверхности от сил трения, клеточной адгезии и белковых отложений. Были выделены и охарактеризованы различные природные и рекомбинантные белки любрицины и их изоформы. Например, патенты США №№5326558, 6433142; 7,030223 и 7361738 раскрывают семейство человеческих факторов стимуляции мегакариоцитов (MSF) и фармацевтические композиции, содержащие один или более такой MSF, для лечения болезненных состояний или расстройств, таких как недостаток тромбоцитов. Патенты США №№6960562 и 6743774 также раскрывают увлажняющий полипептид, трибонектин, включающий практически чистые фрагменты MSF, и способы увлажнения суставов или других тканей путем введения трибонектина системно или непосредственно в ткани.

Сущность изобретения

[0012] Данное изобретение предлагает в различных воплощениях фармацевтические композиции и способы их применения для управления увлажнением (смазкой) глаза, в том числе терапевтическое восстановление и усиление молекул граничной смазки на поверхности глаза. В некоторых воплощениях данного изобретения описано наблюдение, что мРНК PRG4 экспрессируется в эпителиальных клетках человеческой роговицы и конъюнктивы, а также в слезных и мейбомиевых железах мыши, обозначающее, что белок PRG4 представлен в этих тканях на поверхности глаза. В некоторых вариантах данного изобретения описано наблюдение, что роль белка PRG4, находящегося на глазной поверхности, состоит в защите роговицы и конъюнктивы от значительных сил сдвига, возникающих при мигании века, ношении контактных линз и в других нежелательных условиях. Влияние на слезную пленку, в том числе влияние воспаления, провоспалительных цитокинов, дисбаланса половых стероидов и протеаз на состав и функцию пленки, позволяет предложить курс терапии для глазных тканей, который улучшает граничную смазку.

[0013] В некоторых воплощениях данное изобретение предлагает фармацевтическую композицию, пригодную для местного применения на глазной поверхности, которая содержит терапевтически эффективную концентрацию белка PRG4, суспендированного в офтальмологически приемлемом сбалансированном солевом растворе. Фармацевтическая композиция данного изобретения может также содержать один или более офтальмологически приемлемый агент, выбранный из группы, состоящей из офтальмологически приемлемого успокоительного средства, офтальмологически приемлемого эксципиента, офтальмологически приемлемого вяжущего средства, офтальмологически приемлемого сосудосуживающего средства и офтальмологически приемлемого смягчающего средства.

[0014] Примеры офтальмологически приемлемых успокоительных, предусмотренных в данном изобретении, включают карбоксиметилцеллюлозу натрия (например, примерно от 0,2 до 2,5% масс./об.), гидроксиэтилцеллюлозу (например, примерно от 0,2 до 2,5% масс./об.), гипромеллозу (например, примерно от 0,2 до 2,5% масс./об.), метил целлюлозу (например, примерно от 0,2 до 2,5% масс./об.), декстран 70 (например, примерно 0,1% масс./об.), желатин (например, примерно 0,01% масс./об.), глицерин (например, примерно от 0,2 до 1% масс./об.), полиэтиленгликоль 300 (например, примерно от 0,2 до 1% масс./об.), полиэтиленгликоль 400 (например, примерно от 0,2 до 1% масс./об.), полисорбат 80 (например, примерно от 0,2 до 1% масс./об.), пропиленгликоль (например, примерно от 0,2 до 1% масс./об.), поливиниловый спирт (например, примерно от 0,1 до 4% масс./об.), повидон (например, примерно от 0,1 до 2% масс./об.), но не ограничиваются ими. Типичные офтальмологически приемлемые эксципиенты/смягчающие средства, предусмотренные в данном изобретении, включают безводный ланолин (например, примерно от 1 до 10% масс./об.), ланолин (например, примерно от 1 до 10% масс./об.), легкое минеральное масло (например, ≤ примерно 50% масс./об.), минеральное масло (например, ≤ примерно 50% масс./об.), парафин (например, ≤ примерно 5% масс./об.), вазелин (например, ≤ примерно 100% масс./об.), белую мазь (например, ≤ примерно 100% масс./об.), белый вазелин (например, ≤ примерно 100% масс./об.), белый воск (например, ≤ примерно 5% масс./об.), желтый воск (например, и примерно 5% масс./об.), но не ограничиваются ими. Типичные офтальмологически приемлемые вяжущие средства, предусмотренные в данном изобретении, включают сульфат цинка (например, примерно 0,25% масс./об.), но не ограничиваются им. Типичные офтальмологически приемлемые сосудосуживающие средства, предусмотренные в данном изобретении, включают эфедрина гидрохлорид (например, примерно 0,123% масс./об.), нафазолина гидрохлорид (например, от примерно 0,01 до примерно 0,03% масс./об.), фенилэфрина гидрохлорид (например, от примерно 0,08 до примерно 0,2% масс./об.) и тетрагидрозолина гидрохлорид (например, от примерно 0,01 до примерно 0,05% масс./об.), но не ограничиваются ими.

[0015] В некоторых из этих воплощений успокоительные средства, эксципиенты, вяжущие, сосудосуживающие, смягчающие средства и электролиты являются средствами доставки белка PRG4 офтальмологически приемлемым образом. Офтальмологически приемлемые композиции подходят для местного применения на глазной поверхности, если они не обладают неприемлемой для глаза токсичностью, при нанесении не вызывают жжение, зуд, слипание, нечеткость зрения и т.д.

[0016] В некоторых воплощениях фармацевтическая композиция данного изобретения также содержит терапевтически эффективную концентрацию одного или более дополнительного терапевтического агента, в том числе гиалуронат натрия, гиалуроновую кислоту и фосфолипиды, но не ограничиваясь ими. Типичные фосфолипиды включают L-α-дипальмитоилфосфатидилхолин, фосфатидилхолин, фосфатидилэтаноламин и сфингомиелин, но не ограничиваются ими.

[0017] В некоторых воплощениях данное изобретение предлагает фармацевтическую композицию, пригодную для местного применения на глазной поверхности, содержащую терапевтически эффективную концентрацию белка PRG4, суспендированного в офтальмологически приемлемом сбалансированном солевом растворе, содержащем по меньшей мере три электролита, в том числе, но не ограничиваясь ими, хлорид натрия (NaCl) 0,64%, хлорид калия (KCl) 0,075%, дигидрат хлорида кальция (CaCl2·2H2O) 0,048%, гексагидрат хлорида магния (MgCl2·6H2O) 0,03%, тригидрат ацетата натрия (C2H3NaO2·3Н2О) 0,39%, дигидрат цитрат натрия (C6H5Na3O7·2H2O) 0,17%, гидроксид натрия и/или соляную кислоту (для коррекции рН до примерно 7,5) с осмолярностью примерно 300 мОсм/л.

[0018] В некоторых воплощениях данное изобретение предлагает фармацевтическую композицию, пригодную для местного применения на глазной поверхности, содержащую терапевтически эффективную концентрацию белка PRG4, суспендированного в офтальмологически приемлемом сбалансированном солевом растворе, содержащем примерно 128 мМ натрия (Na+), примерно 24 мМ калия (K+), примерно 113 мМ хлорида (Cl-), примерно 0,4 мМ кальция (Са2+), примерно 0,3 мМ магния (Mg2+), примерно 5 мМ НСО3-, примерно 1 мМ цитрата, примерно 14 мМ фосфата, примерно 15 мМ ацетата и гидроксид натрия и/или соляную кислоту (для коррекции рН до примерно 7,5) с осмолярностью примерно 300 мОсм/л.

[0019] Данное изобретение также предлагает способ лечения недостаточного увлажнения глаза или симптомов, с ним связанных, у нуждающихся в этом людей. Способ включает в себя местное введение на глазную поверхность нуждающегося в этом индивидуума фармацевтической композиции, содержащей терапевтически эффективную концентрацию белка PRG4. В некоторых воплощениях фармацевтическую композицию, содержащую белок PRG4, вводят в сочетании с офтальмологически приемлемым составом, содержащим один или более офтальмологически приемлемый агент, выбранный из группы, состоящей из офтальмологически приемлемого успокоительного средства, офтальмологически приемлемого эксципиента, офтальмологически приемлемого вяжущего средства, офтальмологически приемлемого сосудосуживающего средства и офтальмологически приемлемого смягчающего средства.

[0020] В некоторых воплощениях фармацевтическую композицию, содержащую белок PRG4, вводят в сочетании с офтальмологически приемлемым раствором, содержащим терапевтически эффективную концентрацию гиалуроната натрия или гиалуроновой кислоты или поверхностно-активных фосфолипидов, о которых говорилось выше. Еще в некоторых воплощениях фармацевтическую композицию, содержащую белок PRG4, вводят в сочетании с фосфатно-солевым буферным раствором или офтальмологически приемлемым сбалансированным солевым раствором, содержащим один или более электролит, о котором говорилось выше.

[0021] Данное изобретение предлагает способ лечения недостаточного увлажнения глаза или симптомов, с ним связанных, которые возникают из-за потери слезы или нестабильной слезной пленки в границах глазного контура, например при андрогенной недостаточности, синдроме Шегрена и сухом кератоконъюнктивите (KCS). Такой способ включает в себя местное введение на глазную поверхность нуждающегося в этом пациента фармацевтической композиции данного изобретения.

[0022] В некоторых воплощениях данное изобретение также предлагает способ ухода и лечения состояний, связанных с неблагоприятной или недостаточной глазной смазкой. Типичные состояния включают болезнь сухого глаза из-за дефицита жидкости или испарения, синдром Шегрена, сухой кератоконъюнктивит, андрогенную недостаточность, заболевания мейбомиевых желез, заместительную терапию эстрогенами, ношение контактных линз, рефракционную хирургию, аллергию, снижение времени разрушения слезной пленки, аллергии, заболевания поверхности глаза, повышение уровня протеаз в слезной пленке и на поверхности глаза, хронические воспаления, гиперосмолярность и старение, но не ограничиваются ими.

Краткое описание графических материалов

[0023] Фиг.1 представляет обратные связи для глазной поверхностной граничной смазки.

[0024] Фиг.2 показывает экспрессию мРНК PRG4 в человеческих эпителиальных клетках роговицы. Человеческие эпителиальные клетки роговицы выделяли из корнеосклеральной каймы доноров мужского и женского пола. Амплифицированные образцы проверяли на наличие продуктов PRG4 с помощью анализатора Agilent 2100 Bioanalyzer. Вертикальные полосы включают; L. маркер молекулярных весов; 1. Контроль без образца; 2. Ткань роговицы от 33-летней женщины; 4. Культивированные эпителиальные клетки роговицы от 70-летней женщины; 6. Культивированные эпителиальные клетки роговицы от 53-летнего мужчины.

[0025] Фиг.3 показывает экспрессию мРНК PRG4 в человеческих эпителиальных клетках роговицы. Человеческие эпителиальные клетки роговицы выделяли из корнеосклеральной каймы доноров мужского и женского пола. Амплифицированные образцы проверяли на наличие продуктов PRG4 с помощью электрофореза в агарозном геле. Вертикальные полосы включают: 1. маркер молекулярных весов; 2. Контроль без образца; 4. Человеческую женскую конъюнктиву; 5. Человеческую мужскую конъюнктиву.

[0026] Фиг.4 показывает экспрессию мРНК PRG4 в человеческих эпителиальных клетках роговицы. Человеческие эпителиальные клетки роговицы выделяли из корнеосклеральной каймы доноров мужского и женского пола. Амплифицированные образцы проверяли на наличие продуктов PRG4 с помощью анализатора Agilent 2100 Bioanalyzer. Вертикальные полосы включают; маркер молекулярных весов; 1. стандарт кДНК печени человека; 2. Ткань корнеосклеральной каймы от 24-летней женщины; 3. Ткань корнеосклеральной каймы от 51-летней женщины; 4. Человеческие эпителиальные клетки конъюнктивы.

[0027] Фиг.5 показывает экспрессию мРНК PRG4 в человеческих образцах конъюнктивы, полученных с помощью импрессионной цитологии. Образцы конъюнктивы, полученные с помощью импрессионной цитологии, брали у доноров мужского и женского пола. Амплифицированные образцы проверяли на наличие продуктов PRG4 с помощью анализатора Agilent 2100 Bioanalyzer. Вертикальные полосы включают: L. маркер молекулярных весов; 1-9. Образцы конъюнктивы, полученные с помощью импрессионной цитологии; 10. Повторение человеческих конъюнктивальных эпителиальных клеток (линия 4 на фиг.3).

[0028] Фиг.6 иллюстрирует схему испытания трением. Глазную поверхность роговицы (605) прикрепляли к сферическому концу инертного непроницаемого полужесткого резинового цилиндра-заглушки (603) (радиус r=6 мм). Цилиндр-заглушку (603) присоединяли к вращательному приводу механической машины для тестирования (Bose ELF 3200), образуя нижнюю суставную поверхность. Кольцо (601) (внешний радиус = 3,2 мм, внутренний радиус = 1,5 мм) штамповали из века (604). Кольцо (601) присоединяли к линейному приводу, сцепленному с датчиками осевой нагрузки (N) и торсионной нагрузки (т), образуя верхнюю суставную поверхность. Ванну для смазки (602) формировали путем закрепления инертной трубки вокруг цилиндра-заглушки (603). ω обозначает угловую частоту.

[0029] Фиг.7 иллюстрирует уменьшение in vitro кинетического трения веко/роговица при добавлении белка PRG4 (любрицина).

[0030] Фиг.8 иллюстрирует уменьшение in vitro кинетического трения веко/роговица, измеренного через 1 минуту после добавления белка PRG4 (любрицина).

[0031] Фиг.9 иллюстрирует уменьшение in vitro кинетического трения веко/роговица через 5 минут после добавления белка PRG4 (любрицина).

[0032] Фиг.10 иллюстрирует уменьшение in vitro кинетического трения веко/роговица стечением времени после добавления белка PRG4 (любрицина).

Подробное описание изобретения

[0033] В некоторых воплощениях в данном документе предложен способ лечения недостаточного увлажнения глаза (например, недостаточности глазной граничной смазки) или симптомов, связанных с ним, у нуждающихся в этом людей, включающий местное введение на глазную поверхность индивидуума фармацевтической композиции, содержащей терапевтически эффективное количество белка PRG4. Также в некоторых воплощениях в данном документе предложены фармацевтические композиции, содержащие белок PRG4 в офтальмологически приемлемом составе. В конкретных воплощениях в данном документе предложена фармацевтическая композиция, пригодная для местного применения на поверхности глаза, содержащая терапевтически эффективное количество PRG4, суспендированного в офтальмологически приемлемом сбалансированном солевом растворе, а также возможно в сочетании с одним или более офтальмологически приемлемым агентом, выбранным из группы, состоящей из офтальмологически приемлемого успокоительного средства, офтальмологически приемлемого эксципиента, офтальмологически приемлемого вяжущего, офтальмологически приемлемого сосудосуживающего и офтальмологически приемлемого смягчающего средства.

[0034] В некоторых воплощениях в данном документе предложены фармацевтические композиции и способы их применения для лечения недостаточного увлажнения глаза на глазной поверхности (например, недостаточности глазной граничной смазки, например, ее уменьшение или нестабильность). Фармацевтическая композиция в некоторых воплощениях данного изобретения содержит выделенный или очищенный белок PRG4, суспендированный в офтальмологически приемлемом сбалансированном солевом растворе в сочетании с одним или более офтальмологическим агентом, выбранным из группы, состоящей из офтальмологического успокоительного, эксципиента, вяжущего, сосудосуживающего и смягчающего средств. В некоторых воплощениях любая фармацевтическая композиция, предложенная в данном документе, также содержит один или более дополнительный терапевтический агент, выбранный из группы, состоящей из гиалуроната натрия, поверхностно-активных фосфолипидов и электролитов, в фармацевтически приемлемом носителе для местного введения.

[0035] Данное изобретение в некоторых воплощениях предлагает новый подход к управлению увлажнением глаза, в том числе терапевтическое восстановление и усиление молекул граничной смазки на поверхности глаза. Следует отметить, что значение и механизм глазной граничной смазки до сих пор не были выяснены в офтальмологическом сообществе. В течение многих лет научный консенсус в ортопедическом научно-исследовательском сообществе заключался в том, что гидродинамическая смазка является доминирующим способом увлажнения суставных хрящей, а о граничной смазке думают в последнюю очередь. Более того, те исследователи, которые изучали граничную смазку на хрящевых поверхностях, предполагали, что граничная смазка, по-видимому, является важной только при «большой нагрузке и низкой скорости», которые противоположны условиям на поверхности глаза, где возникают относительно низкие осевые нагрузки и относительно высокие скорости скольжения. См., например, (54). Кроме того, граничная смазка с участием гликокаликса роговицы до сих пор не рассматривалась. Jay et al. сравнили очищенный увлажняющий фактор из бычьей синовиальной жидкости с «муцинозным гликопротеином из человеческой слюны подчелюстной слюнной железы и стимулированной слезы» и пришли к выводу, что «муцин, секретируемый слезной железой, не увлажняет», пропуская возможность того, что эпителий роговицы был источником смазки, или что граничная смазка была важным фактором на глазной поверхности. См., например, (55). Последние математические модели динамики слезной пленки также игнорируют возможность граничной смазки, заявляя о «приближении смазки» до предела слезной пленки так, что «слой слизи на роговице может обеспечить нескользящую поверхность для водной пленки», и что «следует отметить, что модель только предсказывает развитие до достижения [слезной пленкой] толщины некоторого критически малого значения, при котором модель выходит из строя». См., например, (57).

[0036] Существует необходимость управления увлажнением глаза и защиты роговицы и конъюнктивы от значительных сил сдвига, возникающих в нежелательных условиях, описанных в данном документе, в том числе, в качестве неограничивающего примера, при болезни сухого глаза из-за дефицита жидкости или испарения, при синдроме Шегрена, сухом кератоконъюнктивите, андрогенной недостаточности, заболеваниях мейбомиевых желез, заместительной терапии эстрогенами, ношении контактных линз, рефракционной хирургии, аллергии, снижении времени разрушения слезной пленки, аллергии, заболеваниях поверхности глаза, повышении уровня протеаз в слезной пленке и на поверхности глаза, хронических воспалениях, гиперосмолярности и старении.

[0037] В некоторых случаях в нагрузке на роговицу и конъюнктиву, по-видимому, доминируют силы сдвига. В некоторых случаях, при мигании века, а также ношении контактных линз, создается значительная нагрузка на эпителиальные клетки поверхности глаза, и это особенно верно в присутствии нарушенной слезной пленки. Как показано на фиг.1, предполагается, что увеличение напряжения сдвига приводит к нестабильности слезной пленки, потере слезы за счет испарения, гиперосмолярности, изменению давления набухания и повышению напряжения сдвига по механизму обратной связи. В некоторых случаях увеличение напряжения сдвига также усиливает воспаление, андрогенную недостаточность и снижает экспрессию протеогликанов. В некоторых случаях увеличение напряжение сдвига и его последствия могут со временем привести к потере граничной смазки на поверхности глаза.

[0038] Недостаточное увлажнение глаза и симптомы, связанные с ним, можно выявить с помощью любого подходящего способа. В некоторых случаях недостаточное увлажнение глаза и симптомы, связанные с ним, выявляют либо качественно (например, при ощущении слабой смазки, сухости глаза, дискомфорте и т.д.) или количественно (например, путем измерения с помощью механических, биохимических, электрических, оптических или других способов количественного анализа).

[0039] В некоторых случаях в условиях, неблагоприятных для глазной граничной смазки, например таких, которые возникают в результате болезни сухого глаза из-за дефицита жидкости или испарения, в результате синдрома Шегрена, сухого кератоконъюнктивита, андрогенной недостаточности, заболеваний мейбомиевых желез, заместительной терапии эстрогенами, ношения контактных линз, рефракционной хирургии, аллергии, снижения времени разрушения слезной пленки, аллергии, заболеваний поверхности глаза, повышения уровня протеаз в слезной пленке и на поверхности глаза, хронических воспалений, гиперосмолярности и старения, будет наблюдаться нарушение слезной пленки. В некоторых из этих ситуаций повышенное испарение может препятствовать эффективной жидкой увлажняющей пленке, но способствует граничной смазке и молекулярному расходуемому механизму снижения напряжения сдвига на клеточной поверхности. В некоторых воплощениях данного изобретения предусматривается, что терапевтическое восстановление и усиление молекул граничной смазки на поверхности глаза могло бы прервать цепь обратной связи, через которую неблагоприятные условия, связанные с недостаточным увлажнением глаза, содействуют патологическому состоянию глазной поверхности.

[0040] В некоторых случаях, и как предусмотрено в данном документе, белок PRG4 играет важную роль для глаза в качестве граничной смазки. В некоторых случаях этот секретируемый гликопротеин защищает поверхность глаза, защищая роговицу и конъюнктиву от значительных сил сдвига, возникающих при мигании века, ношении контактных линз и в других случаях неподходящей граничной смазки, вызванных хроническим воспалением и гиперосмолярностью, которые возникают в результате болезни сухого глаза, андрогенной недостаточности, заместительной терапии эстрогенами, нарушенной слезной пленки, аллергии, старения, заболеваний поверхности глаза и повышения уровня протеаз в слезной пленке и на поверхности глаза. Учитывая связь между осмотическим давлением и электромеханическими взаимодействиями между заряженными молекулами, данное изобретение предлагает в некоторых воплощениях фармацевтическую композицию для управления недостаточным увлажнением глаза путем модуляции гиперосмолярности или осмолярности на поверхности глаза за счет прерывания механизмов обратной связи, что предотвращает выделение компонентов за счет уменьшения коэффициентов трения и смягчения напряжения сдвига.

[0041] В другом примере воплощения данное изобретение отличается расходуемым механизмом граничной смазки глаза, когда связанные с поверхностью рецепторы обратимо связывают одну или более гелеобразующую или поверхностно-активную структуру. В некоторых случаях гелеобразующая или поверхностно-активная структура отрывается во время сдвига, тем самым предотвращая достижение напряжения сдвига (или уменьшая напряжение сдвига) на эпителиальной поверхности. В некоторых воплощениях после кратковременных сдвигов гелеобразующие или поверхностно-активные структуры могут вернуться к их ненарушенному равновесию, повторно связаться с рецепторами, связанными с поверхностью. В некоторых воплощениях вся конструкция может оторваться во время сдвига. В определенных случаях можно представить, что термодинамика этого равновесия приведет к увеличению вероятности высвобождения из рецепторов с увеличением амплитуды сдвига, но что любая ассоциация является легко обратимой.

[0042] В одном воплощении данного изобретения фармацевтическая композиция, содержащая белок PRG4, суспендированный в офтальмологически приемлемом сбалансированном растворе, применяется местно на поверхности глаза, к которой белок PRG4 присоединяется или с которой связывается. В некоторых случаях данного воплощения PRG4 выступает в качестве рецептора, связанного с поверхностью, который может взаимодействовать с эндогенными белками и протеогликанами в слезной пленке, устанавливая расходуемый механизм для уменьшения трения при мигании века на поверхности глаза, предотвращая адсорбцию белков на глазной поверхности и уменьшая сухие пятна, вызванные нестабильностью слезной пленки.

[0043] В другом воплощении данного изобретения PRG4 применяется местно и присоединен или связан с поверхностью глаза в сочетании с одним или более веществом среди гиалуроновой кислоты и фосфолипидных конструкций. В некоторых случаях данного воплощения PRG4 выступает в качестве связанного с поверхностью рецептора, который взаимодействует с экзогенно поставляемой гиалуроновой кислотой и/или фосфолипидами, устанавливая расходуемый механизм для уменьшения трения при мигании века на поверхности глаза, предотвращая адсорбцию белков на глазной поверхности и уменьшая сухие пятна, вызванные нестабильностью слезной пленки. В этом воплощении гиалуроновая кислота и фосфолипидные конструкции диссоциируют от PRG4 во время сдвига. В еще одном воплощении вся конструкция отделяется во время сдвига для предотвращения напряжения сдвига на эпителии.

[0044] В другом воплощении функциональные фрагменты, многомеры (например, димеры, тримеры, тетрамеры и т.д.), гомологи или ортологи PRG4 действуют в качестве поверхностных рецепторов и/или гелеобрузующих конструкций в расходуемом механизме. К функциональным фрагментам и гомологам PRG4 относятся те, у которых меньшее количество повторов в центральном муцин-подобном домене с КЕРАРТТ-повтором (SEQ ID NO:4), гликозилированные и негликозилированные формы белка, варианты сплайсинга, рекомбинантные формы и т.п. Увлажняющий фрагмент PRG4 демонстрирует по меньшей мере 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или 95% от увлажняющего глаз эффекта человеческого PRG4, измеренного с помощью качественного, механического, оптического, электрического или биохимического анализа.

[0045] Используемый в данном документе термин «PRG4», «белок PRG4» или «белок протеогликан 4» используется наравне с термином «белок любрицин». Термин «PRG4», используемый в данном документе, также охватывает термин «фактор стимуляции мегакариоцитов (MSF)», который был принят в номенклатуре базы данных генов человека UCL/HGNC/HUGO, а также белок поверхностной зоны (SZP). Термины «PRG4» или «белок любрицин», используемые в данном документе, относятся к любому выделенному или очищенному нативному или рекомбинантному белку любрицину, его гомологу, функциональному фрагменту или мотиву, изоформе и/или мутанту. В некоторых воплощениях выделенный или очищенный белок PRG4 содержит аминокислотную последовательность человеческого природного или рекомбинантного белка любрицина. В других воплощениях выделенный или очищенный белок PRG4 включает аминокислотную последовательность, кодируемую экзонами гена prg4, которые кодируют первичные структуры белка PRG4 полной длины или его изоформ. Ген протеогликана 4 (prg4) содержит 12 экзонов. Белок PRG4, упоминаемый в данном документе, состоит из аминокислотной последовательности, кодируемой экзонами гена prg4 1-12, более предпочтительно экзонами 6-12 и наиболее предпочтительно экзонами 9-12.

[0046] В данном документе белок PRG4 включает любые белки PRG4, известные в настоящее время, или которые будут описаны позже. В некоторых воплощениях предпочтительная аминокислотная последовательность белка PRG4 приведена в SEQ ID NO:1. Белок PRG4 имеет первичную аминокислотную структуру любого известного белка PRG4 или его изоформы, по меньшей мере на 60% гомологичной, предпочтительно на 75% гомологичной, более предпочтительно на 85%, 90%, 95%, 96%, 97%, 98%, 99% или более гомологичной. В некоторых воплощениях предпочтительный белок PRG4 имеет среднюю молярную массу от 50 кДа до 400 кДа, состоит из одной или более биологически активной части белка PRG4 или его функциональных фрагментов, таких как увлажняющий фрагмент, или его гомологов.

[0047] В данном документе белок PRG4 содержит биологически активную часть белка. Используемый в данном документе термин «биологически активная часть» белка PRG4 включает функциональный фрагмент белка, содержащий аминокислотную последовательность, достаточно гомологичную или полученную из аминокислотной последовательности белка, которая включает в себя меньше аминокислот, чем белок полной длины, и демонстрирует по меньшей мере однократную активность белка полной длины. Обычно биологически активная часть включает функциональный домен или мотив по меньшей с однократной активностью белка. Биологически активная часть белка может быть полипептидом, который содержит, например, 10, 25, 50, 100, 200 или более аминокислот. В одном воплощении биологически активная часть белка PRG4 может быть использована в качестве терапевтического агента в монотерапии или в комбинации с другими терапевтическими агентами для лечения неподходящей или сниженной глазной граничной смазки.

[0048] Нуклеиновокислотная и аминокислотная последовательности нескольких нативных и рекомбинантных белков PRG4 или любрицина, а также характеристика белков PRG4 и его различных изоформ раскрыты, например, в патентах США №№5326558, 6433142, 7030223, 7361738 Turner et al. и в патентах США №№6743774 и 6960562 Jay et al. Публикация США №20070191268 Flannery et al. также раскрывает молекулы рекомбинантного PRG4 или любрицина, упоминаемые в данном изобретении.

[0049] Способы выделения, очистки и рекомбинантной экспрессии белка PRG4 хорошо известны в данной области. В некоторых воплощениях способ начинается с клонирования и выделения мРНК и кДНК, кодирующей белки PRG4 или их изоформы, с использованием стандартных методик молекулярной биологии, таких как ПЦР или ОТ-ПЦР. Выделенную кДНК, кодирующую белок PRG4 или его изоформы, затем клонируют в вектор экспрессии, а в дальнейшем трансформируют и экспрессируют в принимающей клетке (клетке-хозяине) для получения рекомбинантного белка PRG4.

[0050] Используемый в данном документе термин «рекомбинантный» относится к полинуклеотиду, синтезированному или иным образом регулируемому in vitro (например, к «рекомбинантному полинуклеотиду»), к способам применения рекомбинантных полинуклеотидов для продукции генных продуктов в клетках или других биологических системах, или к полипептиду («рекомбинантному белку»), кодируемому рекомбинантным полинуклеотидом. Термин «рекомбинантный» также включает связывание нуклеиновых кислот, имеющих различные кодирующие области или домены или промоторные последовательности из различных источников, в экспрессионную кассету или вектор экспрессии, например, индуцибельной или конститутивной экспрессии белка слияния, содержащего активный домен гена PRG4 и нуклеиновокислотную последовательность, амплифицированную с помощью праймера изобретения.

[0051] В некоторых воплощениях нуклеиновая кислота, кодирующая белок PRG4, может содержать одну или более мутацию, делецию или вставку. В таких воплощениях нуклеиновая кислота, кодирующая белок PRG4, по меньшей мере на 60% гомологична, предпочтительно на 75% гомологична, более предпочтительно на 85%, 90%, 95%, 96%, 97%, 98%, 99% или более гомологична нуклеиновой кислоте, кодирующей белок PRG4 дикого типа.

[0052] Используемый в данном документе термин «кДНК» включает ДНК, которые комплементарны молекулам мРНК, присутствующим в клетке или организме, по которым можно собрать кДНК с помощью фермента, такого как обратная транскриптаза. В некоторых воплощениях кДНК, кодирующая белок PRG4, получена из мРНК PRG4, экспрессированной в человеческих эпителиальных клетках роговицы или конъюнктивы, с использованием способа ОТ-ПЦР, хорошо известного в данной области.

[0053] Используемые в данном документе термины «полинуклеотид», «нуклеиновая кислота/нуклеотид» и «олигонуклеотид» используются взаимозаменяемо и включают полимерные формы нуклеотидов любой длины, дезоксирибонуклеотидов или рибонуклеотидов, или их аналогов. Полинуклеотиды могут иметь любую трехмерную структуру и могут выполнять любую функцию, известную или неизвестную. Ниже приведены неограничивающие примеры полинуклеотидов: ген или фрагмент гена, экзоны, интроны, матричная РНК (мРНК), транспортная РНК, рибосомная РНК, рибозимы, ДНК, кДНК, геномная ДНК, рекомбинантные полинуклеотиды, разветвленные полинуклеотиды, плазмиды, векторы, выделенная ДНК любой последовательности, выделенная РНК любой последовательности, нуклеиновокислотные зонды и праймеры. Полинуклеотиды могут быть получены с помощью природного, синтетического, рекомбинантного способов или любой их комбинации.

[0054] Полинуклеотид может содержать модифицированные нуклеотиды, такие как метилированные нуклеотиды и нуклеотидные аналоги. При наличии изменений в нуклеотидной структуре они могут быть проведены до или после сборки полимера. Последовательность нуклеотидов может быть прервана ненуклеотидными компонентами. Полинуклеотид также может быть изменен после полимеризации, например, путем конъюгации с маркерным компонентом. Этот термин также включает двух- и одноцепочечные молекулы. Если нет иного указания или требования, любое воплощение данного изобретения, которое является полинуклеотидом, охватывает как двухцепочечную форму, так и каждую из двух комплементарных одноцепочечных форм, известных или прогнозируемых для составления двухцепочечной формы.

[0055] Используемый в данном документе термин «полинуклеотидная последовательность» является буквенным представлением молекулы полинуклеотида. Полинуклеотид состоит из определенной последовательности четырех нуклеотидных оснований: аденина (А); цитозина (С); гуанина (G); тимина (Т); и урацила (U) вместо тимина в случае, когда полинуклеотидом является РНК, а не ДНК. Это буквенное представление может быть введено в базу данных в компьютер и использовано для приложений биоинформатики, таких как, например, функциональная геномика и поиск гомологии.

[0056] Используемый в данном документе термин «выделенный полинуклеотид/кДНК» включает полинуклеотидные молекулы, которые отделены от других полинуклеотидных молекул, которые присутствуют в природном источнике полинуклеотида. Например, в связи с геномной ДНК термин «выделенная» включает полинуклеотидные молекулы, которые отделены от хромосомы, с которой геномная ДНК связана в природе. Предпочтительно «выделенный» Полинуклеотид свободен от последовательностей, которые в природе граничат с полинуклеотидом (т.е. от последовательностей, расположенных на 5'- и 3'-концах целевого полинуклеотида) в геномной ДНК организма, из которого получен полинуклеотид. Например, в различных воплощениях выделенная полинуклеотидная молекула, кодирующая упоминаемый в изобретении белок PRG4, может содержать по меньшей мере 5 Кб, 4 Кб, 3 Кб, 2 Кб, 1 Кб, 0,5 Кб или 0,1 Кб нуклеотидных последовательностей, которые в природе граничат с молекулой полинуклеотида в геномной ДНК клетки, из которой получен полинуклеотид. Кроме того, «выделенная» молекула полинуклеотида, такая как молекула кДНК, может быть существенно свободной от другого клеточного материала или питательной среды, если она получена с помощью рекомбинантных методик, или существенно свободной от химических предшественников или других химических веществ, если она синтезирована химически.

[0057] Используемый в данном документе термин «ген» включает полинуклеотид, содержащий по меньшей мере одну открытую рамку считывания, которая способна кодировать конкретный полипептид или белок после транскрипции и трансляции. Любая из полинуклеотидных последовательностей, описанных в данном документе, может быть также использована для выявления кодирующих последовательностей более крупных фрагментов гена или полной длины гена, с которым они связаны. Способы выделения последовательностей более крупных фрагментов известны специалистам в данной области. Используемый в данном документе термин «нативная» молекула полинуклеотида или молекула полинуклеотида «природного происхождения» относится, например, к молекулам РНК или ДНК, имеющим нуклеотидную последовательность, которая наблюдается в природе (например, кодирует природный белок).

[0058] Используемые в данном документе термины «полипептид» или «белок» являются взаимозаменяемыми и включают соединение из двух или более субъединиц аминокислот, аналогов аминокислот или пептидомиметиков. Субъединицы могут быть связаны пептидными связями. В другом воплощении субъединицы могут быть связаны другими связями, например, сложноэфирными, эфирными и т.д. Используемый в данном документе термин «аминокислота» включает природные и/или неприродные, или синтетические, аминокислоты, в том числе глицин, как D-, так и или L-оптические изомеры, а также аминокислотные аналоги и пептидомиметики. Пептид из трех или более аминокислот обычно называют олигопептидом. Пептидные цепи из более чем трех аминокислот называют полипептидами или белками.

[0059] В некоторых воплощениях термин «белок PRG4», используемый в данном документе, обозначает белки PRG4 или его различные гомологи или изоформы, которые природно или рекомбинантно экспрессированы у человека или в других принимающих клетках. Используемые в данном документе термины «экспрессированный» или «экспрессия» включают процесс, посредством которого полинуклеотиды транскрибируются в РНК и/или транслируются в полипептиды. Если полинуклеотид получен из геномной ДНК, экспрессия может включать сплайсинг РНК, если выбран соответствующий эукариотический хозяин. Регуляторные элементы, необходимые для экспрессии, включают промоторные последовательности для связи с РНК-полимеразой и последовательности инициации транскрипции для связывания рибосомы. Например, бактериальный вектор экспрессии содержит промотор, такой как lac-промотор, и последовательность Шайна-Дальгарно и старт-кодон AUG для инициации транскрипции. Аналогичным образом эукариотический вектор экспрессии включает гетерологичный или гомологичный промотор для РНК-полимеразы II, ниже расположенный сигнал полиаденилирования, старт-кодон AUG и кодон терминации для отсоединения рибосомы. Такие векторы могут быть получены коммерческим образом или собраны из описанных последовательностей с помощью способов, хорошо известных в данной области, например описанных ниже способов для построения векторов вообще. Используемый в данном документе термин «вектор» включает самовоспроизводящуюся молекулу нуклеиновой кислоты, которая переносит вставляемый полинуклеотид в и/или между принимающими клетками. Термин используется для векторов вставки, которые в первую очередь служат для вставки молекулы нуклеиновой кислоты в клетку, векторов репликации, которые в первую очередь служат для репликации нуклеиновых кислот, и векторов экспрессии, которые служат для транскрипции и/или трансляции ДНК или РНК. Также он используется для векторов, которые обеспечивают более чем одну из перечисленных выше функций.

[0060] Используемый в данном документе термин «принимающая клетка (клетка-хозяин)» включает любую отдельную клетку или клеточную культуру, которая может быть или уже является реципиентом для векторов или для вставления экзогенных полинуклеотидов и/или полипептидов. Он также охватывает потомство одной клетки. Потомство не обязательно является полностью идентичным (морфологически или по комплементарности геномной или тотальной ДНК) исходной родительской клетке в результате природных, случайных или преднамеренных мутаций. Клетки могут быть прокариотическими или эукариотическими и включают, но не ограничиваясь ими, бактериальные клетки, дрожжевые клетки, клетки насекомых, клетки животных и клетки млекопитающих, в том числе, но не ограничиваясь ими, клетки мыши, крысы, обезьяны или человека. Используемый в данном документе термин «принимающая клетка (клетка-хозяин)» также включает генетически модифицированные клетки. Термин «генетически модифицированные клетки» включает клетки, содержащие и/или экспрессирующие чужой или экзогенный ген или полинуклеотидную последовательность, которые, в свою очередь, изменяют генотип или фенотип клетки или ее потомства. Термин «генетически модифицированная» также включает клетку, содержащую или экспрессирующую ген или полинуклеотидную последовательность, которые были введены в клетку. Например, в данном воплощении в генетически модифицированную клетку была введен ген, который также является эндогенным для этой клетки. Термин «генетически модифицированный» также включает любое добавление, удаление или разрыв в эндогенных нуклеотидах клетки. Используемый в данном документе термин «принимающая клетка (клетка-хозяин)» может быть любой клеткой, экспрессирующей человеческий белок PRG4.

[0061] Используемый в данном документе термин «гомологи» определяется здесь как две нуклеиновые кислоты или два пептида, которые имеют аналогичные или в значительной степени идентичные нуклеиновокислотные или аминокислотные последовательности, соответственно. Термин «гомолог» также охватывает молекулы нуклеиновых кислот, которые отличаются по нуклеотидным последовательностям из-за вырожденности генетического кода и кодируют, таким образом, одинаковые аминокислотные последовательности. В одном из предпочтительных воплощений гомологи включают аллельные варианты, ортологи, паралоги, агонисты и антагонисты нуклеиновых кислот, кодирующих белок PRG4 (например, SEQ ID NO:1).

[0062] Используемый в данном документе термин «ортолог» относится к двум нуклеиновым кислотам разного вида, которые произошли от общего предкового гена путем видообразования. Как правило, ортологи кодируют пептиды, имеющие одинаковые или аналогичные функции. В частности, ортологи данного изобретения обычно имеют последовательность, которая по меньшей мере на 80-85%, более предпочтительно на 85-90% или 90-95%, а наиболее предпочтительно на 95%, 96%, 97%, 98% или даже на 99% идентична или на 100% идентична всей или части аминокислотной последовательности какого-либо из известных белков PRG4 (например, SEQ ID NO:1), его изоформ или аналогов, и будут проявлять функции, схожие с этими пептидами. Кроме того, используемый в данном документе термин «паралог» относится к двум нуклеиновым кислотам, которые связаны путем удвоения в геноме. Паралоги, как правило, имеют различные функции, но эти функции могут быть связаны между собой.

[0063] Для установления процента идентичности двух аминокислотных последовательностей их выравнивают с целью оптимального сравнения (например, в последовательность могут быть введены делеции из одного полипептида для оптимального согласования с другим полипептидом или нуклеиновой кислотой). Затем сравниваются аминокислотные остатки в соответствующих позициях аминокислот. Когда позиция в одной последовательности занята таким же аминокислотным остатком, как и соответствующая позиция в другой последовательности, то молекулы идентичны в этой позиции. Сравнение того же типа можно провести между двумя нуклеиновокислотными последовательностями. Процент идентичности двух последовательностей является функцией числа одинаковых позиций в последовательностях (т.е. процент идентичности последовательности = число идентичных позиций/общее число позиций × 100). Предпочтительно выделенные аминокислотные гомологи, включенные в данное изобретение, по меньшей мере примерно на 50-60%, предпочтительно по меньшей мере примерно на 60-70%, более предпочтительно по меньшей мере примерно на 70-75%, 75-80%, 80-85%, 85-90% или 90-95%, а наиболее предпочтительно по меньшей мере примерно на 96%, 97%, 98%, 99% или более идентичны всей аминокислотной последовательности любого известного белка PRG4 (например SEQ ID NO:1).

[0064] В некоторых воплощениях выделенный нуклеиновокислотный гомолог, кодирующий белок PRG4, включает нуклеотидную последовательность, которая по меньшей мере на 40-60%, предпочтительно по меньшей мере примерно на 60-70%, более предпочтительно по меньшей мере примерно на 70-75%, 75 -80%, 80-85%, 85-90% или 90-95%, и даже более предпочтительно по меньшей мере примерно на 95%, 96%, 97%, 98%, 99% или более совпадает с нуклеотидной последовательностью, кодирующей аминокислотную последовательность такого белка PRG4 (например, SEQ ID NO:1).

[0065] Определение процента идентичности двух нуклеиновокислотных или пептидных последовательностей хорошо известно в данной области. Например, для определения процента идентичности двух нуклеиновокислотных или пептидных последовательностей может быть использован пакет программного обеспечения Vector NTI 6,0 (PC) (InforMax, Бетесда, Мэриленд). В этом способе для определения процента идентичности двух нуклеиновых кислот используется штраф за внесение делеции 15 и штраф за удлинение делеции 6,66. Для определения процента идентичности двух полипептидов используется штраф за внесение делеции 10 и штраф за удлинение делеции 0,1. Все остальные параметры задаются в настройках по умолчанию. Для множественного выравнивания (алгоритм Clustal W) штраф за внесение делеции составляет 10, а штраф за удлинение делеции составляет 0,05 с матрицей blosum62. Следует понимать, что при определении идентичности последовательностей для сравнения последовательности ДНК с последовательностью РНК нуклеотид тимидин эквивалентен нуклеотиду урацилу.

[0066] Кроме того, белок PRG4, упоминаемый в данном документе, включает белок PRG4, кодируемый полинуклеотидом, который гибридизуется в жестких условиях с полинуклеотидом, кодирующим белок PRG4. Используемый в данном документе термин «гибридизация» включает в себя реакцию, в которой один или более полинуклеотид реагирует с образованием комплекса, который стабилизируется за счет водородных связей между основаниями нуклеотидных остатков. Водородная связь может возникать по правилу спаривания оснований Уотсона и Крика, за счет связывания Хугстина или любым другим образом, основанным на специфичности последовательностей. Комплекс может состоять из двух цепей, образующих дуплексную структуру, трех или более цепей, образующих многоцепочечный комплекс, одной самостоятельно гибридизированной цепи или любой их комбинации. Реакция гибридизации может представлять собой этап в рамках более широкого процесса, такого как инициация ПЦР или ферментативное расщепление полинуклеотида рибозимом.

[0067] Реакции гибридизации можно выполнять в условиях различной жесткости. Данное изобретение включает полинуклеотиды, способные к гибридизации в условиях пониженной жесткости, более предпочтительно в жестких условиях, и наиболее предпочтительно в весьма жестких условиях, с полинуклеотидами, кодирующими описанный в данном документе белок PRG4. Используемый в данном документе термин «жесткие условия» относится к гибридизации в течение ночи при 60°С в 10× растворе Денхарта, 6× SSC, 0,5% SDS и 100 мг/мл денатурированной ДНК спермы лосося. Блоты промывают последовательно при 62°С, каждый раз в течение 30 минут, в 3× SSC/0,1% SDS, затем в 1× SSC/0,1% SDS, и наконец в 0,1× SSC/0,1% SDS. Кроме того, используемая в некоторых воплощениях фраза «жесткие условия» относится к гибридизации в 6× растворе SSC при температуре 65°С. В других воплощениях термин «весьма жесткие условия» относится к гибридизации в течение ночи при 65°С в 10× растворе Денхарта, 6× SSC, 0,5% SDS и 100 мг/мл денатурированной ДНК спермы лосося. Блоты промывают последовательно при 65°С, каждый раз в течение 30 минут, в 3× SSC/0,1% SDS, затем в 1× SSC/0,1% SDS, и наконец в 0,1× SSC/0,1% SDS. Способы гибридизации нуклеиновых кислот хорошо известны в данной области. Соответственно, белки PRG4, кодируемые упоминаемыми в данном документе нуклеиновыми кислотами, включают нуклеиновые кислоты, которые по меньшей мере на 60% гомологичны, предпочтительно на 75% гомологичны, более предпочтительно на 85%, более предпочтительно на 90%, наиболее предпочтительно на 95%, 96%, 97%, 98%, 99% гомологичны полинуклеотидной последовательности, которая кодирует человеческий белок PRG4 (например, SEQ ID NO:1) или его специфичные изоформы или гомологи.

[0068] Кроме того, белки PRG4, упоминаемые в данном документе, также могут быть химерными белками, или белками слияния. Используемый в данном документе термин «химерный белок» или «белок слияния» включает в себя первый полипептид, оперативно связанный со вторым полипептидом. Химерные белки, возможно, могут содержать третий, четвертый или пятый или другой полипептид, оперативно связанный с первым или вторым полипептидом. Химерные белки могут состоять из двух или более различных полипептидов. Химерные белки могут содержать множественные копии одного и того же полипептида. Химерные белки могут также содержать одну или более мутацию в одном или более полипептиде. Способы создания химерных белков хорошо известны в данной области. В некоторых воплощениях данного изобретения химерный белок является химерой белка PRG4 с другими изоформами белка PRG4.

[0069] Используемый в данном документе термин «выделенный» или «очищенный» обозначает белок, полинуклеотид или молекулу, которые выделены из среды, в которой они находятся в природе, или которые являются существенно свободными от клеточного материала, такого как другие загрязняющие белки из клеточного или тканевого источника, из которого получен полинуклеотид, белок или молекула, или существенно свободными от химических предшественников или других химических веществ, если они химически синтезированы. Выражение «существенно свободны от клеточного материала» включает препараты, отделенные от клеточных компонентов клеток, из которых они выделены или рекомбинантно получены или синтезированы. В некоторых воплощениях выражение «существенно свободны от клеточного материала» включает препараты белка PRG4, имеющие менее примерно 30% (сухого веса) других белков (также называемых в данном документе «загрязняющими белками»), более предпочтительно менее примерно 20%, еще более предпочтительно менее примерно 10%, а наиболее предпочтительно менее примерно 5% других белков. Когда белок или полинуклеотид получены рекомбинантно, предпочтительно они также существенно свободны от культуральной среды, т.е. культуральная среда составляет менее примерно 20%, более предпочтительно менее примерно 10%, а наиболее предпочтительно менее примерно 5% от объема препарата целевого белка.

[0070] В некоторых воплощениях данное изобретение предлагает фармацевтическую композицию, подходящую для местного введения на глазную поверхность нуждающегося в этом человека фармацевтически эффективной концентрации белка PRG4, суспендированного в офтальмологически приемлемом сбалансированном солевом растворе и в сочетании с одним или более офтальмологически приемлемым агентом. Офтальмологически приемлемые агенты могут быть выбраны из группы, состоящей из офтальмологически приемлемого успокоительного средства, эксципиента, вяжущего, сосудосуживающего и смягчающего средств. Используемый в данном документе термин «эффективная концентрация или количество» или «терапевтически эффективная концентрация или количество» предназначен для обозначения нетоксичной, но достаточной концентрации или количества белка PRG4 или других терапевтических агентов для обеспечения желаемых терапевтических эффектов. Концентрация или количество, которое является эффективным, будет меняться от раза к разу в зависимости от возраста и общего состояния человека, конкретных агентов и т.п. Таким образом, не всегда возможно указать точную эффективную концентрацию или количество. Тем не менее, специалист в данной области с помощью обычных экспериментов сможет определить соответствующую эффективную концентрацию или количество в каждом конкретном случае. Кроме того, точная эффективная концентрация или количество белка PRG4 и других терапевтических агентов, включенных в композицию или лекарственную форму данного изобретения, не является критической, пока она находится в диапазоне, достаточном для того, чтобы при применении готового раствора или состава доставить количество белка PRG4 и других активных веществ в терапевтически эффективном диапазоне.

[0071] В некоторых воплощениях фармацевтически эффективная концентрация белка PRG4 находится в диапазоне 10-10000 мкг/мл, предпочтительно 50-500 мг/мл и более предпочтительно 100-300 мг/мл. Упоминаемые в данном документе офтальмологически приемлемые агенты включают офтальмологически приемлемые успокоительные средства, эксципиенты, вяжущие, сосудосуживающие и смягчающие средства, которые полностью определены в Своде федеральных нормативных документов 21CFR349.

[0072] Используемый в данном документе термин «местное введение» используется в его обычном смысле для обозначения доставки композиции, содержащей белок PRG4 и один или более чем один офтальмологически приемлемый агент, к глазу. Обычно местное введение достигается с помощью жидкого состава для закапывания в глаз или промывания и обеспечивает местный эффект.

[0073] В некоторых воплощениях любая фармацевтическая композиция, описанная в данном документе, содержит вышеупомянутые офтальмологически приемлемые агенты, которые представляют собой или могут сочетаться с одним или более веществом среди карбоксиметилцеллюлозы натрия (например, от примерно 0,2 до примерно 2,5% масс./об.), гидроксиэтилцеллюлозы (например, от примерно 0,2 до примерно 2,5% масс./об.), гипромеллозы (например, от примерно 0,2 до примерно 2,5% масс./об.), метилцеллюлозы (например, от примерно 0,2 до примерно 2,5% масс./об.), декстрана 70 (например, примерно 0,1% масс./об.), желатина (например, примерно 0,01% масс./об.), глицерина (например, от примерно 0,2 до примерно 1% масс./об.), полиэтиленгликоля 300 (например, от примерно 0,2 до примерно 1% масс./об.), полиэтиленгликоля 400 (например, от примерно 0,2 до примерно 1% масс./об.), полисорбата 80 (например, от примерно 0,2 до примерно 1% масс./об.), пропиленгликоля (например, от примерно 0,2 до примерно 1% масс./об.), поливинилового спирта (например, от примерно 0,1 до примерно 4% масс./об.), повидона (например, от примерно от 0,1 до примерно 2% масс./об.), сульфата цинка (например, примерно 0,25% масс./об.), безводного ланолина (например, от примерно 1 до примерно 10% масс./об.), ланолина (например, от примерно 1 до примерно 10% масс./об.), легкого минерального масла (например, ≤ примерно 50% масс./об,), минерального масла (например, ≤ примерно 50% масс./об.), парафина (например, ≤ примерно 5% масс./об.), вазелина (например, ≤ примерно 100% масс./об.), белой мази (например, ≤ примерно 100% масс./об.), белого вазелина (например, ≤ примерно 100% масс./об.), белого воска (например, ≤ примерно 5% масс./об.), желтого воска (например, и примерно 5% масс./об.), эфедрина гидрохлорида (например, примерно 0,123% масс./об.), нафтизина гидрохлорида (например, от примерно 0,01 до примерно 0,03 масс./об.), фенилэфрина гидрохлорида (например, от примерно 0,08 до примерно 0,2% масс./об.) и тетрагидрозолина гидрохлорида (например, от примерно 0,01 до примерно 0,05% масс./об.). В некоторых случаях значения процентов, используемые здесь, являются значениями процентов по весу.

[0074] В других воплощениях фармацевтическая композиция данного изобретения, содержащая белок PRG4 в сочетании с одним или более описанным ранее офтальмологически приемлемым агентом, также дополнительно содержит терапевтически эффективную концентрацию гиалуроновой кислоты или гиалуроната натрия в диапазоне 10-100000 мкг/мл, предпочтительно 500-5000 мг/мл. Кроме того, фармацевтическая композиция данного изобретения также содержит один или более поверхностно-активный фосфолипид в диапазоне 10-10000 мкг/мл, такой как поверхностно-активные фосфолипиды, которые включают, но не ограничиваясь ими, L-α-дипальмитоилфосфатидилхолин (DPPC), фосфатидилхолин (PC), фосфатидилэтаноламин (РЕ) и сфингомиелин (Sp) или другие нейтральные и полярные липиды.

[0075] Фармацевтическая композиция данного изобретения может также содержать один или более фармацевтически приемлемый носитель или транспортер, содержащий какие-либо приемлемые материалы, и/или одну или более добавку, известную в данной области. Используемый в данном документе термин «носитель» или «транспортер» относится к материалам-носителям, пригодным для местного применения препарата. Носители или транспортеры, упоминаемые в данном документе, включают любые такие материалы, известные в данной области, которые не токсичны и не взаимодействуют с другими компонентами композиции неблагоприятным образом. В состав могут быть включены различные добавки, известные специалистам в данной области. Например, для растворения некоторых лекарственных веществ могут быть использованы растворители, в том числе относительно небольшое количество спирта. Другие дополнительные добавки включают перламутровые добавки, антиоксиданты, ароматизаторы, красители, гелеобразующие средства, загустители, стабилизаторы, поверхностно-активные вещества и т.п. Также могут быть добавлены другие агенты, например, противомикробные агенты для предотвращения порчи при хранении, т.е. для подавления роста микроорганизмов, таких как дрожжи и плесневые грибы. Подходящие противомикробные препараты, как правило, выбирают из группы, состоящей из метилового и пропилового эфиров парагидроксибензойной кислоты (например метил- и пропилпарабена), бензоата натрия, сорбиновой кислоты, имидуреи и их комбинаций. В фармацевтическую композицию данного изобретения также могут быть включены добавки, усиливающие проницаемость и/или смягчающие раздражение.

[0076] В некоторых воплощениях фармацевтическую композицию данного изобретения изготавливают в фармацевтически приемлемом носителе, таком как фосфатно-солевой буфер или осмотически сбалансированный солевой раствор электролитов слезы, в том числе одно или более вещество среди хлорида натрия в мольной доле от примерно 44% до примерно 54%, хлорида калия в мольной доле от примерно 8% до примерно 14%, бикарбоната натрия в мольной доле от примерно 8% до примерно 18%, бикарбоната калия в мольной доле от примерно 0% до примерно 4%, хлорида кальция в мольной доле от примерно 0% до примерно 4%, хлорида магния в мольной доле от примерно 0% до примерно 4%, трехзамещенного цитрата натрия в мольной доле от примерно 0% до примерно 4% и соляной кислоты в мольной доле от примерно 0% до примерно 20% или гидроксида натрия в мольной доле от примерно 0% до примерно 20%. В некоторых воплощениях фармацевтический носитель может быть использован для получения водного раствора электролита в диапазоне примерно 150-200 мМ. Другие подходящие составы, такие как мази, кремы, гели, пасты и т.п., подходящие для местного введения, также рассматриваются в данном изобретении. В некоторых воплощениях в сочетании с PRG4 электролиты обеспечивают надлежащий осмотический баланс, чтобы сделать раствор офтальмологически приемлемым.

[0077] Данное изобретение предлагает способ лечения у нуждающихся в этом людей сниженной или неблагоприятной глазной граничной смазки, симптомов, с ней связанных, или условий, которые связаны или являются причиной недостаточного увлажнения глаза, включающий местное введение на глазную поверхность нуждающихся в этом людей фармацевтической композиции, содержащей терапевтически эффективное количество белка PRG4. В одном воплощении способ данного изобретения включает местное введение фармацевтической композиции, содержащей терапевтически эффективное количество белка PRG4, который суспендирован в фосфатно-солевом буферном растворе или офтальмологически приемлемом сбалансированном солевом растворе, содержащем один или более электролит. В другом воплощении способ данного изобретения, включающий местное введение фармацевтической композиции, содержащей белок PRG4, собран в офтальмологически приемлемый состав, содержащий один или более дополнительный офтальмологически приемлемый агент, описанный выше.

[0078] Используемый в данном документе термин «лечение» означает уменьшение тяжести и/или частоты симптомов, устранение симптомов и/или истинных причин, предотвращение появления симптомов и/или их истинных причин и улучшение или восстановление после повреждения. Термин «лечение» также включает в себя как предотвращение расстройств у предрасположенных лиц, так и лечение расстройств у лиц с клинической симптоматикой.

[0079] В некоторых воплощениях уменьшенная глазная граничная смазка обусловлена увеличением потерь слезы за счет испарения или нестабильностью слезной пленки в границах глазного контура. Такая уменьшенная или неблагоприятная глазная граничная смазка связана с болезнью сухого глаза из-за дефицита жидкости или испарения, синдромом Шегрена, сухим кератоконъюнктивитом, андрогенной недостаточностью, заболеваниями мейбомиевых желез, заместительной терапией эстрогенами, ношением контактных линз, рефракционной хирургией, аллергией, снижением времени разрушения слезной пленки, нарушением слезной пленки, заболеваниями поверхности глаза, повышением уровня протеаз в слезной пленке и на поверхности глаза, хроническим воспалением, гиперосмолярностью и старением. Как уже говорилось выше, увеличение напряжения сдвига приводит к нестабильности слезной пленки, потерям слезы за счет испарения, гиперосмолярности, изменениям давления набухания и повышением напряжением сдвига по механизму обратной связи. Увеличение напряжения сдвига также способствует воспалению, андрогенной недостаточности и сниженной экспрессии протеогликанов. С течением времени повышение напряжения сдвига и его последствия приводят к потере граничной смазки на поверхности глаза. Соответственно, данное изобретение предлагает способ снижения напряжения сдвига путем восстановления и усиления экспрессии протеогликанов, таких как белок PRG4, на поверхности глаза, с тем чтобы сохранить или увеличить глазную граничную смазку.

[0080] На всем протяжении данной заявки имеются ссылки на различные публикации. Раскрытие всех этих публикаций и те ссылки, которые цитируются в этих публикациях, во всей их полноте включены путем ссылки в данную заявку, с тем чтобы более полно описать уровень техники, к которому относится изобретение.

[0081] Следует также понимать, что все вышеизложенное относится к предпочтительным воплощениям данного изобретения, и что в нем могут быть сделаны многие изменения без отхода от объема изобретения. Изобретение также проиллюстрировано следующими примерами, которые ни в каком случае не следует рассматривать как ограничивающие его сферу. Напротив, необходимо четко понимать, что возможно обращение к различным другим воплощениям, модификациям и их эквивалентам, которые после прочтения описания в данном документе сможет предложить специалист в данной области, не отступая от характера данного изобретения и/или рамок прикрепленной формулы изобретения.

[0082] Другие особенности и преимущества изобретения будут очевидны из последующего описания предпочтительных воплощений и из формулы изобретения. Эти и многие другие варианты и воплощения изобретения будут очевидны для специалиста в данной области при обзоре прикрепленного описания и примеров.

Примеры

Пример 1

Экспрессия мРНК PRG4 в человеческих эпителиальных клетках роговицы и конъюнктивы

[0083] Человеческие эпителиальные клетки роговицы выделяли из корнеосклеральной каймы доноров мужского и женского пола. Клетки либо обрабатывали непосредственно (n=8), либо вначале культивировали в кератиноцитной бессывороточной среде без фенола красного (n=2). В ходе хирургических процедур получали образцы бульбарной конъюнктивы (n=2), образцы конъюнктивы, полученные с помощью импрессионной цитологии (n=9), иммортализованные человеческие конъюнктивальные эпителиальные клетки после культивирования (n=1), слезные железы от NOD-мышей (n=5 взрослых мышей каждого пола, 10 желез/образцов) и мейбомиевы железы от BALB/c мышей (n=7 взрослых мышей каждого пола, железы от 28 век/образцов). Эти образцы обрабатывали для анализа мРНК PRG4 с помощью прежде всего ОТ-ПЦР (n=18 человек, все мыши) и Affymetrix GeneChips (n=4 человеческие роговицы). Праймеры для ПЦР с PRG4 перекрывали последовательность интрона более 1 kbp, чтобы подавить амплификацию загрязняющей хромосомной ДНК (таб. 1). Амплифицированные образцы проверяли на наличие продуктов PRG4 с помощью электрофореза в агарозном геле и анализатора Agilent 2100 Bioanalyzer. Для подтверждения идентичности ампликонов ПЦР-продукты от образцов роговицы (n=2), эпителиальных клеток конъюнктивы (n=1) и стандарта человеческой печени (n=1) секвенировали с помощью анализатора 3100 Genetic Analyzer в Massachusetts Eye and Ear Infirmary DNA Sequencing Center for Vision Research (Бостон, Массачусетс), а полученные данные анализировали с помощью программы BLASTn из базы данных GenBank.

Таблица 1.
Олигонуклеотидные праймеры, созданные для анализа ОТ-ПЦР мРНК PRG4
Вид Направление Нуклеотидная последовательность (5'- 3') Экзон ампликон Размер (bp)
Человек Прямая GATGCAGGGTACCCCAAA (SEQ ID NO:2) 9-12 526
Обратная CAGACTTTGGATAAGGTCTGCC (SEQ ID NO:3)

[0084] Было показано, что мРНК PRG4 присутствует во всех человеческих эпителиальных клетках роговицы и конъюнктивы и образцах, полученных с помощью импрессионной цитологии. Идентичность ПЦР-продуктов PRG4 подтверждали с помощью анализа последовательности ДНК (таб. 2). Результаты показали, что PRG4 транскрибируется в человеческих эпителиальных клетках роговицы и конъюнктивы.

Таблица 2.
Идентификация последовательностей ампликона от образцов человеческой роговицы, конъюнктивы и печени
Направление секвенирования Выровненные пары оснований с человеческим PRG4 Общее число пар оснований из ампликона Идентичность по BLASTn
Стандарт печень человека
А Прямое 495 500 Человеческий PRG4
А Обратное 488 491 Человеческий PRG4
В Прямое 496 499 Человеческий PRG4
В Обратное 498 500 Человеческий PRG4
Человеческая роговица (24-летнаяя женщина)
А Прямое 497 499 Человеческий PRG4
А Обратное 490 492 Человеческий PRG4
В Прямое 500 504 Человеческий PRG4
В Обратное 498 501 Человеческий PRG4
Человеческая роговица (51-летнаяя женщина)
А Прямое 498 499 Человеческий PRG4
А Обратное 474 489 Человеческий PRG4
В Прямое 496 498 Человеческий PRG4
В Обратное 490 491 Человеческий PRG4
Человеческие эпителиальные клетки конъюнктивы
А Прямое 496 499 Человеческий PRG4
А Обратное 490 492 Человеческий PRG4
В Прямое 495 499 Человеческий PRG4
В Обратное 474 491 Человеческий PRG4

Два различных образца (А и В) каждого препарата секвенировали в прямом и обратном направлениях. Образцы человеческой роговицы представляли собой эпителиальные клетки из корнеосклеральной каймы доноров женского пола. Идентификационным номером гена человеческого PRG4 является NM_005807.

Пример 2

Уменьшение трения in vitro при добавлении PRG4 (любрицина)

[0085] Ниже описано испытание трением in vitro с клинически значимыми границами раздела, такими как граница раздела глазная поверхность - глазное веко и граница раздела глазная поверхность - контактная линза. Клинически значимых способов, позволяющих количественно оценить увлажняющую способность искусственных слез, в настоящее время нет. Испытания трением с синтетическими (например, латекс и стекло) или не глазными «природными» поверхностями (например, сегментами вены пупочного канатика) могут способствовать некоторым, но, вероятно, не всем молекулярным взаимодействиям, которые возникают при сочленении/мигании века. Действительно, актуальность данных, полученных с нетканевыми границами раздела, неясна.

[0086] Было показано, что конфигурация ротационного испытания с кольцом на диске идеально подходит для изучения граничной смазки на границе раздела суставной хрящ - хрящ. Граничный режим смазки обозначается кинетическим трением, не зависимым от факторов, которые влияют на формирование жидкой пленки, таких как скорость скольжения и осевая нагрузка. Это происходит из-за того, что возникает контакт поверхность-поверхность, и связанные с поверхностью молекулы способствуют увлажнению (за счет уменьшения трения и износа). Было обнаружено, что граничная смазка является одним из важнейших и эффективных механизмов на поверхности глаза, как и на суставной поверхности хряща. Таким образом, испытание трением in vitro, ранее разработанное и описанное для изучения граничной смазки на границе раздела суставной хрящ - хрящ, было модифицировано для исследования границ раздела поверхность глаза - веко и поверхность глаза - контактная линза.

[0087] Для определения условий испытания, в которых граничная смазка является доминирующей на границах раздела поверхность глаза - веко и поверхность глаза - контактная линза, была рассмотрена зависимость фрикционных свойств от осевой нагрузки и скорости скольжения. Нормальные свежие человеческие глазные поверхности (резецированные роговицы с примерно 3 мм склеры) получали из Lions Eye Bank of Alberta. Резецированные роговицы хранили в Optisol-GS при 4°С и использовали в течение 2 недель. Веки (от людей возраста 60-80 лет) получали из University of Calgary Body Donation Program в течение 1-3 дней после смерти и использовали сразу или хранили при температуре -20°С в физиологическом растворе в течение не более 2 недель до их использования. Смазка для сравнения состояла из стерильного физиологического раствора Lens Plus Sterile Saline Solution (Advanced Medical Optics) в качестве отрицательного контроля; в качестве анализируемых смазочных материалов использовали глазные капли Systane® Lubricant Eye Drops (Alcon Laboratories), Aquify® Long Lasting Comfort Drops (CIBA Vision) и Blink® Tears Lubricant Eye Drops (Advanced Medical Optics).

[0088] Испытание трением схематически показано на фиг.6. Роговицу глазной поверхности (605) прикрепляли к сферическому концу инертного непроницаемого полужесткого цилиндра-заглушки (603) (радиус r=6 мм) с помощью суперклея к склере. Этот цилиндр-заглушку (603) присоединяли к вращательному приводу механической машины для тестирования (Bose ELF 3200), формируя таким образом нижнюю суставную поверхность. Кольцо (601) (внешний радиус = 3,2 мм, внутренний радиус = 1,5 мм) штамповали из века (604) и присоединяли к линейному приводу, сцепленному с датчиками осевой нагрузки (N) и торсионной нагрузки (т), образуя верхнюю суставную поверхность. Ванну для смазки 602 формировали путем закрепления инертной трубки вокруг цилиндра-заглушки (603).

[0089] Образцы вначале испытывали в физиологическом растворе, затем в одном из трех (3) тестируемых смазочных материалов. Ванну заполняли примерно 0,3 мл смазки, и суставные поверхности уравновешивали со смазкой. Поверхности образцов медленно (0,05 мм/с) вводили в контакт и сжимали до тех пор, пока сферическая заглушка не выравнивалась, и вся кольцевая поверхность века не входила в контакт с роговицей (605). Полученное нормальное напряжение (рассчитанное из осевой нагрузки в единицах МПа как N/[π[r2внеш-r2внутр]) можно изменить с помощью резиновых заглушек различной жесткости, чтобы имитировать физиологическое напряжение примерно 5 кПа. Последовательность испытаний начинали с предварительной подготовки образца путем поворота на +4 оборота (об) и возвращения на -4 оборота с физиологически соответствующей эффективной линейной скоростью скольжения, Vэфф=30 мм/с (где Vэфф=ωRэфф, ω обозначает угловую частоту, а Rэфф=2,4 мм является эффективным радиусом, рассчитанным путем интегрирования распределения напряжения сдвига по кольцевым контактным площадям). Затем образцы тестировали путем поворота на +4 оборота, сразу после на -4 оборота с Vэфф=30, 10, 1, 0,3 и 30 мм/с, с временем задержки 12 секунд между каждым оборотом. Затем повторяли последовательность анализа в обратном направлении вращения.

[0090] Для оценки увлажнения глазной поверхности выше были описаны два коэффициента трения (µ) формулы µ=τ/(RэффN)), где τ является вращающим моментом, Rэфф является эффективным радиусом, а N является осевой нагрузкой. Коэффициент трения покоя, который отражает сопротивление началу движения, µстат, рассчитывали как пиковое значение µ сразу после начала вращения (в пределах примерно 10°). Средний кинетический коэффициент трения, который отражает сопротивление стационарному движению, <µкин>, рассчитывали из µ, усредненного за время третьего и четвертого полного оборота при испытании. Оба коэффициента, µстат и <µкин> усредняли для + и - оборотов в каждом испытании для подсчета потенциального направленного воздействия на измерения τ. Данные собирали при частоте 20 Гц.

[0091] Результаты добавления любрицина (PRG4) на поверхность роговицы в концентрации в диапазоне 100-300 мкг/мл показаны на фиг.7. Любрицин имел эффект снижения трения на поверхности века, с точки зрения как кинетического трения, так и трения покоя, на всех скоростях. При концентрации гиалуроновой кислоты 1/10 от физиологической любрицин был похож на глазные капли Blink® Tears Lubricant Eye Drops, которые содержат гиалуроновую кислоту. В сочетании друг с другом эти два смазочных средства лучше, чем каждое по отдельности.

[0092] Фиг.8 демонстрирует снижение in vitro кинетического трения роговица/веко, измеренного в течение первой минуты после добавления любрицина, по сравнению с глазными каплями Aquify®. Между испытаниями смазочные материалы тщательно смывали с глазной поверхности с помощью физиологического раствора. Когда Aquify® (с гиалуроновой кислотой) сочетали с любрицином, был очевиден синергетический эффект (снижение µкин сильнее, чем у каждого по отдельности). После промывания физиологическим раствором кинетическое трение было ниже, чем в контроле с изначальным использованием физиологического раствора. Это показывает сохранение эффекта любрицина даже после промывания физиологическим раствором, позволяя предположить, что молекулы связываются с поверхностью глаза, и что любрицин демонстрирует превосходное время сохранения эффекта по сравнению с гиалуронатом натрия в одиночку.

[0093] Фиг.9 демонстрирует снижение in vitro кинетического трения роговица/веко, измеренного в течение пяти минут после добавления любрицина, по сравнению с глазными каплями Aquify®. Когда Aquify® (с гиалуроновой кислотой) сочетали с любрицином, был очевиден синергетический эффект (снижение µкин сильнее, чем у каждого по отдельности). Коэффициент трения с Aquify® стал статистически эквивалентен коэффициенту трения с физиологическим раствором через 5 минут, в то время как с любрицином он оставался сниженным, равно как и при сочетании любрицина с гиалуроновой кислотой.

[0094] На фиг.10 показано уменьшение кинетического коэффициента трения с течением времени после добавления любрицина. Снова непрекращающееся снижение позволяет предположить связывание с поверхностью глаза.

Пример 3

Лечение недостатка глазной граничной смазки in vivo

[0095] Пациента, жалующегося на раздражение поверхности глаза, проверяли на предмет увлажнения глаза или условий, связанных с недостаточным увлажнением глаза, путем измерения симптомов, имеющих больше 2 положительных ответов в опроснике McMonnies, набравших больше 5 баллов в опроснике «Индекс заболевания поверхности глаза» (OSDI), или путем подтверждения некоторых симптомов по визуально-аналоговой шкале, в сочетании с объективными признаками, включающими один или более среди снижения времени распада слезной пленки (менее примерно 10 секунд), осмолярности нижнего бокового слезного мениска больше 308 мОсм/л, низкого значения полосы Ширмера (менее примерно 10 мм), окрашивания роговицы или конъюнктивы флуоресцеином натрия (оценки > 0 в нескольких макропунктатах), значительного засорения в результате импрессионной цитологии, дисфункции мейбомиевых желез, снижения скорости смещения контактной линзы после моргания, изменения в пространственно-временной передающей функции контактной линзы после серии импульсов давления, снижения скорости интерферометрической релаксации слезной пленки после моргания, увеличения концентрации провоспалительных цитокинов, снижения концентрации лактоферрина и лизоцима или увеличения скорости декогеренции функции рассеяния точки после моргания.

[0096] Пациенту на поверхность каждого глаза вводили от 1 до 2 капель раствора, содержащего 200 мкг/мл белка PGR4, суспендированного в офтальмологически приемлемом сбалансированном солевом растворе. Пациент получал указание закрыть глаза на 10 секунд.

[0097] В последующие визиты можно отслеживать уменьшение осмолярности нижнего бокового слезного мениска, увеличение времени разрушения слезной пленки или другие вышеупомянутые признаки. В частности, если осмолярность слезной пленки снижается с ненормального значения (возможно 330 мОсм/л) до более близкого к нормальному значению (возможно 304 мОсм/л), то терапевтические модуляции и восстановление увлажнения глазной поверхности можно считать успешными.

Ссылки

1. G.D. Jay, Curr Opin Orthop 15, 355 (2004).

2. D.A. Swann, R.B. Hendren, E.L. Radin, S.L. Sotman, E.A. Duda, Arthritis Rheum 24, 22 (1981).

3. G.D. Jay, D.E. Britt, D.-J. Cha, J Rheumatol 27, 594 (2000).

4. G.D. Jay, Connect Tissue Res 28, 71 (1992).

5. G.D. Jay, В.P. Lane, L. Sokoloff, Connect Tissue Res 28, 245 (1992).

6. G.D. Jay, B.-S. Hong, Connect Tissue Res 28, 89 (1992).

7. G.D. Jay, K. Haberstroh, C.-J. Cha, J Biomed Mater Res 40, 414 (1998).

8. G.D. Jay, D.A. Harris, C.-J. Cha, Glycoconj J 18, 807 (2001).

9. G.D. Jay, U. Tantravahi, D.E. Britt, H.J. Barrach, C.J. Cha, J Orthop Res 19, 677 (2001),

10. С.R. Flannery et al,, Biochem Biophys Res Commun 254, 535 (1999).

11. В.L. Schumacher, J.A. Block, T.M. Schmid, M.B. Aydelotte, K.E. Kuettner, Arch Biochem Biophys 311, 144 (1994).

12. T. Schmid, V. Soloveychik, K. Kuettner, B. Schumacher, Trans Orthop ResSoc 26, 178 (2001).

13. S.G. Rees et al., Matrix Biology 21, 593 (2002).

14. Schumacher BL, Schmidt ТА, Voegtiine MS, Chen AC, Sah RL. Proteoglycan 4 (PRG4) synthesis and immunolocalization in bovine meniscus. J Orthop Res. 2005 May; 23(3):562-8.

15. J. Marcelino et al., Nat Genet 23, 319 (1999).

16. D.K. Rhee et al., J Clin Invest 115, 622 (2005).

17. B. Xia, J.A. Royall, G. Damera, G.P. Sachdev, R.D. Cummings, Glycobiology 15, 747 (Aug, 2005).

18. K. Godl et al., J Biol Chem 277, 47248 (Dec 6, 2002).

19. D.A. Swann, S. Sotman, M. Dixon, C. Brooks, Biochem J 161, 473 (1977).

20. Schmidt ТА, Plaas АН, Sandy JD. Disulfide-bonded multimers of proteoglycan 4 (PRG4) are present in normal synovial fluids. Biochim Biophys Acta. 2009 Mar 27.

21. K.A. Elsaid, G. D. Jay, M. L. Warman, D. K. Rhee, C. O. Chichester, Arthritis Rheum 52, 1746 (Jun, 2005).

22. G.D. Jay et al., J Rheumatol 31, 557 (2004).

23. A.M. Malfait et al., J Rheumatol 21, 314 (Feb, 1994).

24. Т.A. Schmidt et al., in Physical Regulation of Skeletal Repair R.K. Aaron, M.E. Bolander, Eds. (American Academy of Orthopaedic Surgeons, Chicago, 2005) pp.151-162.

25. Nugent-Derfus GE, Chan AH, Schumacher BL, Sah RL. PRG4 exchange between the articular cartilage surface and synovial fluid. J Orthop Res. 2007 Oct; 25(10):1269-76.

26. Т.A. Schmidt, В.L. Schumacher, G.E. Nugent, N.S. Gastelum, R.L. Sah, Trans Orthop Res Soc 30, 900 (2005).

27. Nugent GE, Aneloski NM, Schmidt ТА, Schumacher BL, Voegtiine MS, Sah RL. Dynamic shear stimulation of bovine cartilage biosynthesis of proteoglycan 4. Arthritis Rheum. 2006 Jun; 54(6):1888-96.

28. D.K. Rhee et al., J Biol Chem 280, 31325 (2005).

29. Т.J. Klein et al., Osteoarthritis Cartilage 11, 595 (2003).

30. K.С. Morrell, W.A. Hodge, D.E. Krebs, R.W. Mann, Proc Natl Acad Sci USA 102, 14819 (Oct 11, 2005).

31. E. Meyer, R.M. Overney, K. Dransfeld, T. Gyalog, Nanoscience: Friction and Rheology on the Nanometer Scale (World Scientific Publishing Co. Pte. Ltd, River Edge, New Jersey, 2002), pp.373.

32. С.W. McCutchen, Fed Proceedings 25, 1061 (1966).

33. T. Murakami, Y. Sawae, M. Ihara, JSME Int J Series C-Mechanical Systems Machine Elements & Manufacturing 46, 594 (2003).

34. G. Meachim, Ann Rheum Dis 31, 457 (1972).

35. D. Dowson, Proc Inst Mech Eng [H] 215, 335 (2001).

36. G.A. Ateshian, V.С. Mow, in Basic Orthopaedic Biomechanics and Mechano-Biology V.C. Mow, R. Huiskes, Eds. (Lippincott Williams & Wilkins, Philadelphia, 2005) pp.447-494.

37. F. Guilak, Arthritis Rheum 52, 1632 (Jun, 2005).

38. K.С. Morell, W.A. Hodge, D.E. Krebs, R.W. Mann, Proc Natl Acad Sci USA 102, 14819 (Oct 11, 2005).

39. S. A. V. Swanson, in Adult Articular Cartilage M. A. R. Freeman, Ed. (Pitman Medical, Tunbridge Wells, England, 1979) pp.415-460.

40. Elsaid KA, Jay GD, Chichester CO. Reduced expression and proteolytic susceptibility of lubricin/superficial zone protein may explain early elevation in the coefficient of friction in the joints of rats with antigen-induced arthritis. Arthritis Rheum 2007; 56:108-116.

41. Elsaid KA, Jay GD, Warman ML, Rhee DK, Chichester CO. Association of articular cartilage degradation and loss of boundary-lubricating ability of synovial fluid following injury and inflammatory arthritis. Arthritis Rheum 2005; 52:1746-1755.

42. Cutolo M, Capellino S, Sulli A, Serioli B, Secchi ME, Villaggio B, Straub RH. Estrogens and autoimmune diseases. Ann N Y Acad Sci 2006; 1089:538-547.

43. Cutolo M, Sulli A, Capellino S, Villaggio B, Montagna P, Pizzorni C, Paolino S, Seriolo B, Felli L, Straub RH. Anti-TNF and sex hormones. Ann N Y Acad Sci 2006; 1069:391-400.

44. Schmidt M, Naumann H, Weidler C, Schellenberg M, Anders S, Straub RH. Inflammation and sex hormone metabolism. Ann N Y Acad Sci 2006; 1069:236-246.

45. Rontzsch A, Thoss K, Petrow PK, Henzgen S, Brauer R. Amelioration of murine antigen-induced arthritis by dehydroepiandrosterone (DHEA). Inflamm Res 2004; 53:189-198.

46. Zierhut M, Dana MR, Stern ME, Sullivan DA. Immunology of the Lacrimal Gland and Ocular Tear Film. Trends Immunol 2002; 23:333-335

47. Stern ME, Gao J, Siemasko KF, Beuerman RW, Pflugfelder SC. The role of the lacrimal functional unit in the pathophysiology of dry eye. Exp Eye Res 2004; 78:409-416.

48. Tomlinson A, Khanal S, Ramaesh K, Diaper C, McFadyen A. Tear film osmolarity: determination of a referent for dry eye diagnosis. Invest Ophthalmol Vis Sci 2006; 47:4309-4315.

49. Sullivan DA, Sullivan BD, Evans JE, Schirra F, Yamagami H, Liu M, Richards SM, Suzuki T, Schaumberg DA, Sullivan RM, Dana MR. Androgen deficiency, meibomian gland dysfunction and evaporative dry eye. Ann NY Acad Sci 2002; 966:211-222.

50. Sullivan DA. Tearful relationships? Sex, hormones and aqueous-deficient dry eye. Ocular Surface 2004; 2:92-123.

51. Schaumberg DA, Buring JE, Sullivan DA, Dana MR. Hormone replacement therapy and dry eye syndrome. JAMA 2001; 286:2114-2119.

52. de Souza GA, Godoy LM, Mann M. Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors. Genome Biol. 2006; 7:R72. Epub 2006.

53. Schirra F, Suzuki T, Dickinson DP, Townsend DJ, Gipson IK, Sullivan DA. Identification of steroidogenic enzyme mRNAs in the human lacrimal gland, meibomian gland, cornea and conjunctiva. Cornea 2006; 25:438-42.

54. Schwarz IM, Hills BA, Br. J. Rheum. 1998; 37:21-26.

55. Jay GD, Hong BS. Connect Tissue Res, 1992; 28(1-2):89-98.

56. Matnelli F, Argueso P, Curr Opin Allergy Clin Immuno, 2008; 8(5):477-483.

57. Jones MB. et. al. Mathematical Medicine and Biology 2005; 22, 265.

58. Schumacher BL, Hughes СЕ, Kuettner KE, Caterson B, Aydelotte MB. Immunodetection and partial cDNA sequence of the proteoglycan, superficial zone protein, synthesized by cells lining synovial joints. J Orthop Res. 1999 Jan; 17(1):110-20.

59. Schmidt ТА, Gastelum NS, Nguyen QT, Schumacher BL, Sah RL. Boundary lubrication of articular cartilage: role of synovial fluid constituents. Arthritis Rheum. 2007 Mar; 56(3):882-91.

60. Schmidt ТА, Plaas AH, Sandy JD. Disulfide-bonded multimers of proteoglycan 4 (PRG4) are present in normal synovial fluids. Biochim Biophys Acta. 2009 Mar 27.

61. Sullivan DA. The definition and classification of dry eye disease: report of the Definition and Classification Subcommittee of the International Dry Eye Workshop (2007). Ocular Surface. 2007 Apr; 5(2):75-92.

1. Фармацевтическая композиция, подходящая для местного применения на глазной поверхности, содержащая терапевтически эффективную концентрацию протеогликана 4 (PRG4), суспендированного в офтальмологически приемлемом сбалансированном солевом растворе.

2. Фармацевтическая композиция по п.1, содержащая один или более чем один офтальмологически приемлемый агент, выбранный из группы, состоящей из офтальмологически приемлемого успокоительного, офтальмологически приемлемого эксципиента, офтальмологически приемлемого вяжущего, офтальмологически приемлемого сосудосуживающего и офтальмологически приемлемого смягчающего средства.

3. Фармацевтическая композиция по п.1, где фармацевтическая композиция содержит PRG4 в терапевтически эффективной концентрации 10-10000 мкг/мл.

4. Фармацевтическая композиция по п.1, где фармацевтическая композиция содержит PRG4 в терапевтически эффективной концентрации 50-500 мкг/мл.

5. Фармацевтическая композиция по п.1, также содержащая терапевтически эффективную концентрацию гиалуроната натрия или гиалуроновой кислоты.

6. Фармацевтическая композиция по п.5, где фармацевтическая композиция содержит гиалуронат натрия или гиалуроновую кислоту в терапевтически эффективной концентрации 10-100000 мкг/мл.

7. Фармацевтическая композиция по п.5, где фармацевтическая композиция содержит гиалуронат натрия или гиалуроновую кислоту в терапевтически эффективной концентрации 500-5000 мкг/мл.

8. Фармацевтическая композиция по п.1, также содержащая терапевтически эффективную концентрацию поверхностно-активного фосфолипида, выбранного из группы, состоящей из L-α-дипальмитоилфосфатидилхолина, фосфатидилхолина, фосфатидилэтаноламина и сфингомиелина.

9. Фармацевтическая композиция по п.8, где фармацевтическая композиция содержит поверхностно-активный фосфолипид в терапевтически эффективной концентрации 10-10000 мкг/мл.

10. Фармацевтическая композиция по п.1, где офтальмологически приемлемый сбалансированный солевой раствор содержит по меньшей мере три различных электролита, выбранных из группы, состоящей из фосфата натрия, хлорида натрия, хлорида калия, бикарбоната натрия, бикарбоната калия, хлорида кальция, хлорида магния, ацетата натрия, цитрата натрия, соляной кислоты и гидроксида натрия.

11. Фармацевтическая композиция по п.1, где PRG4 является очищенным белком PRG4 природного происхождения или рекомбинантным белком PRG4, включающим его увлажняющий фрагмент, мультимер или гомолог, и имеет среднюю молярную массу менее 400 кДа.

12. Применение фармацевтической композиции любого из пп.1-11 для производства лекарства для лечения нуждающегося в этом индивидуума от недостаточного увлажнения глаза, состояний, связанных с недостаточным увлажнением глаза или вызывающих недостаточное увлажнение глаза, или симптомов, с ним связанных.

13. Применение фармацевтической композиции по п.12, где нуждающийся в этом индивидуум страдает от недостатка глазной граничной смазки, который связан с болезнью сухого глаза из-за дефицита жидкости или испарения, синдромом Шегрена, сухим кератоконъюнктивитом, андрогенной недостаточностью, заболеванием мейбомиевой железы, заместительной терапией эстрогенами, ношением контактных линз, рефракционной хирургией, аллергией, снижением времени разрушения слезной пленки, нарушением слезной пленки, аллергией, заболеваниями поверхности глаза, повышением уровня протеаз в слезной пленке и на поверхности глаза, хроническим воспалением, гиперосмолярностью, старением и их сочетанием.

14. Применение фармацевтической композиции по п.12, где состояние, которое связано или является причиной недостаточного увлажнения глаза, выбрано из группы, включающей болезнь сухого глаза из-за дефицита жидкости или испарения, синдром Шегрена, сухой кератоконъюнктивит, андрогенную недостаточность, заболевание мейбомиевой железы, заместительную терапию эстрогенами, ношение контактных линз, рефракционную хирургию, аллергию, снижение времени разрушения слезной пленки, нарушение слезной пленки, аллергию, заболевания поверхности глаза, повышение уровня протеаз в слезной пленке и на поверхности глаза, хронические воспаления, гиперосмолярность и старение и их комбинации.

15. Применение фармацевтической композиции по п.12, где фармацевтическую композицию вводят в сочетании с офтальмологически приемлемым составом, включающим один или более чем один офтальмологически приемлемый агент, выбранный из группы, состоящей из офтальмологически приемлемого успокоительного, офтальмологически приемлемого эксципиента, офтальмологически приемлемого вяжущего, офтальмологически приемлемого сосудосуживающего, офтальмологически приемлемого смягчающего средства, офтальмологически приемлемого электролита, офтальмологически приемлемого гиалуроната натрия или гиалуроновой кислоты и офтальмологически приемлемого поверхностно-активного фосфолипида.



 

Похожие патенты:

Предложен способ подавления физиологических нарушений, связанных с измененным ангиогенезом, выбранных из ретинопатии, диабетической ретинопатии, макулярной дегенерации, ретролентальной фиброплазии, возрастной макулярной дегенерации, опухоли поджелудочной железы и глиомы, включающий введение эффективного количества 3-[(5-(2,3-диметокси-6-метил-1,4-бензохинонил)]-2-нонил-2-пропеновой кислоты (Е3330) или ее фармацевтически приемлемых солей или сольватов.

Изобретение относится к медицине, а именно к глазным каплям, и предназначено для лечения синдрома сухого глаза, а также бактериальных конъюнктивитов и/или блефаритов.
Изобретение относится к медицине, а именно к офтальмологии. Способ включает проведение трансэпителиального кросслинкинга роговичного коллагена.

Изобретение относится к медицине, офтальмологии. Способ включает проведение синустрабекулоэктомии, локальной склерэктомии с доставкой лекарственного средства к заднему полюсу глаза и последующую восстановительную терапию.

Изобретение относится к медицине, а именно к офтальмологическим препаратам в виде капель, и предназначено для лечения синдрома сухого глаза и бактериальных конъюнктивитов.
Изобретение относится к медицине, в частности к офтальмологии, и может быть использовано для лечения воспалительных и дистрофических заболеваний глаза. При заболеваниях переднего отрезка глаза лекарственные средства вводят подкожно в височную область на 1,8-2,2 см выше середины скуловой кости в зону скопления лимфатических капилляров.
Изобретение относится к области медицины, в частности к офтальмологии. Осуществляют комплексное лечение, включающее однократное воздействие на макулярную зону субпороговым микроимпульсным воздействием инфракрасным лазером.
Изобретение относится к медицине, а именно к офтальмологии, и предназначено для лечения широкого круга воспалительных заболеваний глаз: бактериальных, аллергических, инфекционно-аллергических: конъюнктивитов, блефаритов, кератитов и других.

Группа изобретений относится к области фармакологии и медицины и касается пролонгированной доставки аналога компстатина, и также, возможно, дополнительного активного агента, при высвобождении его из макроскопического гелеподобного включения, формирующегося при введении жидкого состава, содержащего аналог компстатина, во внесосудистое пространство, такое как стекловидная камера глазного яблока, в теле млекопитающего.
Изобретение относится к глазным каплям, которые содержат 1-3 мас.% таурина, 0,01-0,1 мас.% дексаметазона, 0,4-0,6 мас.% борной кислоты, 0,4-0,6 мас.% гидроксипропилметилцеллюлозы и воду.

Изобретение относится к фармацевтической промышленности, а именно к способу получения водорастворимых фракций маннопротеинов и β-глюкана. Способ получения водорастворимых фракций маннопротеинов и β-глюкана, заключающийся в том, что биомассу дрожжей предварительно подвергают механической активации в активаторах или мельницах, к полученному механокомпозиту добавляют раствор ферментного комплекса, проявляющий β-глюканазную или протеазную активность, проводят гидролиз, полученный гидролизат разделяют на маннопротеиновую и β-глюкановую фракции, которые подвергают последующей очистке, при определенных условиях.
Изобретение относится к медицине и фармакологии и представляет собой применение водорастворимых гибридных макромолекулярных соединений: О-(3-(3,5-ди-трет-бутил-4-гидроксифенил) пропионил)-(1 6)- -D-глюкана, полиэтиленгликоля бис-3-(3,5-ди-трет-бутил-4-гидроксифенил)-пропионата в качестве средств, повышающих выживаемость при травматическом шоке.
Изобретение относится к медицине, конкретно к фармакологии, и касается средств, применяемых в терапии при отравлении фенилгидразином. .
Изобретение относится к химико-фармацевтической промышленности и касается препарата для влажного заживления ран и предотвращения адгезии повязки к ране, содержащего фармакологически приемлемый хитозан-глюкановый комплекс или его соль, в комбинации с одним или более другим полисахаридом или их соответствующими солями, и антисептик, причем хитозан-глюкановый комплекс обладает динамической вязкостью 2.5 Па·с-30 Пa·c при концентрации раствора 2.5% при 25°С и угловой скорости вращения 0.0314 рад/сек, и содержанием глюкозамина в диапазоне от 0.05 (n/n) до 20 (n/n).

Изобретение относится к медицине, а именно к лекарственным препаратам в форме мази, и может найти применение при лечении атопического дерматита. .
Изобретение относится к медицине, а именно к дерматологии, и может быть использовано для лечения генерализованных васкулитов при нейроинфекциях у детей. .
Изобретение относится к медицине, а именно - к рефлексотерапии. .
Изобретение относится к медицине, в частности к акушерству, и касается профилактики тяжелых осложнений беременности у пациенток с тромбофилией. .

Изобретение относится к медицине, а именно к иммунологии, и описывает набор для консервации нативных эритроцитов, применяющихся для выявления антител к антигенам эритроцитов, состоит из двух растворов: водного раствора для кратковременного пребывания эритроцитов, содержащего 9,0-11,0 г/л глюкозы, 0,2-0,3 г/л цитрата натрия, 0,01-0,02 г/л лимонной кислоты и 0,95-1,05 г/л бычьего сывороточного альбумина, и водного раствора для хранения эритроцитов, включающего 0,2-0,4 г/л аденина, 25,0-35,0 г/л глюкозы, 6,0-8,0 г/л маннитола, 0,2-0,3 г/л цитрата натрия, 0,05-0,07 г/л лимонной кислоты и 0,95-1,05 г/л бычьего сывороточного альбумина. Изобретение обеспечивает сохранение способности антигенов мембраны консервированных нативных эритроцитов связываться с соответствующими клинически значимыми антителами на срок не менее 2 месяцев. 2 з.п. ф-лы, 1 табл.
Наверх