Ингибиторы протеазы вируса гепатита с и их применение



Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение
Ингибиторы протеазы вируса гепатита с и их применение

 


Владельцы патента RU 2515318:

АВИЛА ТЕРАПЬЮТИКС, ИНК. (US)

Изобретение относится к соединениям, которые могут использоваться в качестве ингибиторов протеазы вируса гепатита С, к фармацевтическим композициям, которые содержат указанные соединения, и способам их применения для лечения заболеваний, опосредованных протеазой вируса гепатита С. 11 н. и 26 з.п. ф-лы, 22 ил., 7 табл., 34 пр.

 

ПЕРЕКРЕСТНЫЕ ССЫЛКИ НА РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Настоящее изобретение испрашивает приоритет согласно предварительной заявке на патент США №61/016,110, поданной 21 декабря, 2007, предварительной заявке на патент США №61/016,473, поданной 23 декабря, 2007, предварительной заявке на патент США №61/060,371, поданной 10 июня, 2008, и предварительной заявке на патент США №61/098,668, поданной 19 сентября, 2008, содержание которых полностью включено в настоящий документ посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ

[0002] Настоящее изобретение относится к соединениям, которые могут быть полезны в качестве ингибиторов протеазы вируса гепатита С. Также в настоящем изобретении предложены фармацевтически приемлемые композиции, содержащие соединения согласно настоящему изобретению, и способы применения указанных композиций для лечения различных заболеваний.

УРОВЕНЬ ТЕХНИКИ

[0003] По оценкам исследователей, около 170 миллионов людей по всему миру поражены вирусом гепатита С (ВГС). ВГС представляет собой доминирующий серотип, составляющий 3% по всему миру, и является основной причиной большинства случаев заболевания гепатитами, отличными от гепатитов А и В (Alberti, A. et al., J. Hepatology 31., (Suppl. 1): 17-24, 1999). Хотя у некоторых пациентов симптомы острого гепатита ослабевают, по меньшей мере, в 85% случаев инфекция, вызванная ВГС, переходит в хроническую форму, и у 20% инфицированных развивается цирроз печени. Уровень выживаемости через четыре года после постановки диагноза цирроза печени составляет менее 50%. Хроническая инфекция ВГС также ассоциирована с увеличением случаев заболеванием гепатоцеллюлярной карциномой.

[0004] ВГС относится к вирусам, содержащим «+-цепь» РНК, геном которого кодирует полипротеин, состоящий, приблизительно, из 3000 аминокислотных остатков. После процессинга этого белка-предшественника образуется, по меньшей мере, 10 вирусных структурных и не структурных белков: С, E1, E2, р7, NS2, NS3, NS4A, NS4B, NS5A и NS5B (Blight, K.J., et al., Antiviral Ther. 3, Suppl. 3: 71-81, 1998). He структурные (NS) белки ВГС образуются в результате протеолитического расщепления полипротеина, и предполагают, что они обеспечивают основные белки, катализирующие репликацию вируса.

[0005] NS3 представляет собой белок размером, приблизительно, 68 KDa, содержащий в своем N-концевом домене сериновую протеазу, и домен РНК-зависимой АТФ-азы на С-конце. Было показано, что белок NS4A выполняет функции ко-фактора активности NS3 в качестве сериновой протеазы. NS3 функционирует как протеолитический фермент, высвобождающий другие не структурные белки, необходимые для репликации ВГС, и является полезной терапевтической мишенью для антивирусной терапии.

[0006] В настоящее время не существует вакцин против ВГС, а разработанная терапия, предусматривающая лечение интерфероном, эффективна только в 15-20% случаев (Wetland, О., FEMS Microbiol. Rev. 14: 279-88. 1994), и имеет значительные побочные эффекты (Walker, M.A., et al., DDT4: 518-29, 1999; Moradpour, D., et al., Eva. J. Gastroenterol. Hepatol. 11: 1199-1202, 1999). Хотя существующий стандарт ухода за больными, представляющий собой терапию пэгилированным интерфероном α в сочетании с рибавирином, является более эффективным, и, похоже, снижает вероятность развития гепатоцеллюлярной карциномы у пациентов, страдающих циррозом, ассоциированным с ВГС (Hung, C.H., et al., J Viral Hepatitis 11 (6): 409-414, 2006), у этого способа лечения также выявили побочные эффекты, такие как развитие дисфункции щитовидной железы (Huang, J.F., et al., J Viral Hepatitis 13 (6): 396-401, 2006).

[0007] Неблагоприятный прогноз для пациентов, страдающих от инфекции ВГС, и существующий в настоящее время недостаток эффективных, одобренных способов лечения, указывают на существующую потребность в новых ингибиторах протеазы ВГС NS3.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0008] Было обнаружено, что соединения согласно настоящему изобретению и фармацевтически приемлемые композиции, содержащие в составе указанные соединения, эффективны в качестве ингибиторов протеазы ВГС. Такие соединения имеют общую структуру формулы I

или предусмотрена фармацевтически приемлемая соль указанного соединения, где R1, R1', R2a, R3, R4, Rw, Rx, Rx', и Ry соответствуют определенному в настоящем описании.

[0009] Соединения согласно настоящему изобретению и фармацевтически приемлемые композиции, которые содержат указанные соединения, эффективны для лечения множества заболеваний, нарушений и состояний, ассоциированных с ВГС. Такие заболевания, нарушения и состояния включают описанные в тексте настоящей заявки.

[0010] Соединения согласно настоящему изобретению также полезны в исследовании значения протеазы ВГС в биологических и патологических процессах; в исследовании путей внутриклеточной передачи сигнала, опосредуемых протеазой ВГС; и для сравнительной оценки новых ингибиторов протеазы ВГС.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0011] На Фигуре 1 приведены результаты масс-спектрального анализа домена, кодирующего протеазу ВГС NS3/4A дикого типа, или варианта ВГС C159S в присутствии тестового соединения (I-3).

[0012] На Фигуре 2 приведены результаты масс-спектрального анализа мутанта ВГС NS3/4A A156S в присутствии тестового соединения (I-3).

[0013] На Фигуре 3 приведены результаты масс-спектрального анализа мутанта ВГС NS3/4A А156Т в присутствии тестового соединения (I-3).

[0014] На Фигуре 4 приведены результаты масс-спектрального анализа мутанта ВГС NS3/4A D168A в присутствии тестового соединения (I-3).

[0015] На Фигуре 5 приведены результаты масс-спектрального анализа мутанта ВГС NS3/4A D168V в присутствии тестового соединения (I-3).

[0016] На Фигуре 6 приведены результаты масс-спектрального анализа ВГС NS3/4A дикого типа в присутствии тестового соединения (I-7).

[0017] На Фигуре 7 приведены результаты масс-спектрального анализа ВГС NS3/4A дикого типа в присутствии тестового соединения (I-8).

[0018] На Фигуре 8 приведены результаты масс-спектрального анализа NS3/4A дикого типа в присутствии тестового соединения (I-4).

[0019] На Фигуре 9 приведены результаты масс-спектрального анализа ВГС NS3/4A дикого типа в присутствии тестового соединения I-9.

[0020] На Фигуре 10 приведены результаты масс-спектрального анализа ВГС NS3/4A дикого типа в присутствии тестового соединения I-12.

[0021] На Фигурах 11, 11А и 11В приведены результаты масс-спектрального анализа ВГС NS3/4A дикого типа в присутствии тестового соединения I-3 в сравнении с его аналогом с обратимым действием - соединением IR-3, а также результаты в отсутствие тестового соединения.

[0022] На Фигурах 12 и 12А приведены результаты масс-спектрального анализа триптического гидролизата NS3/4A дикого типа в присутствии тестового соединения I-3.

[0023] На Фигуре 13 приведены результаты масс-спектрального анализа NS3/4A дикого типа в присутствии тестового соединения I-73.

[0024] На Фигуре 14 приведены результаты масс-спектрального анализа NS3/4A дикого типа в присутствии тестового соединения I-75.

[0025] На Фигурах 15 и 16 приведены результаты для активности люциферазы, полученные в ходе анализа репликонов, в присутствии различных концентраций двух ингибиторов протеазы ВГС, соединения I-R и соединения I-50, измеренные во временных точках: 24 часа, 48 часов и 96 часов. Соединение I-R представляет собой не ковалентный ингибитор, в то время как соединение I-50 является необратимым ковалентным ингибитором. Несмотря на различия в механизмах действия на протеазу для указанных двух соединений, анализ репликонов демонстрирует сходные результаты из-за непрямого характера считывания данных при указанном анализе.

[0026] На Фигуре 17 приведены два необратимых ковалентных ингибитора (соединения I-96 и I-102) протеазы NS3, для которых показано длительное ингибирование активности протеазы NS3 в клетках, несущих репликон дикого типа, которое определяли через величину автопротеолиза после удаления соединений. Соединения инкубировали с клетками, несущими репликон, в течение 16 часов, после чего их удаляли из реакционной среды (временная точка 0). Даже через 48 часов после удаления ковалентных ингибиторов NS3 автопротеолитическая активность NS3 ингибируется по меньшей мере на 50%, тогда как препарат с обратимым действием показал практически полное восстановление активности уже через 4 часа после удаления препарата.

[0027] Фигура 18, на которой приведены результаты для другого ковалентного ингибитора протеазы NS3, отображает длительное ингибирование активности протеазы NS3 в клетках дикого типа, несущих репликон, которое определяли через величину автопротеолиза в течение 24 часа после удаления соединения. Необратимый ковалентный ингибитор I-54 демонстрирует практически полное ингибирование в течение 24 часов после удаления соединения, тогда как препарат с обратимым действием демонстрирует полное восстановление активности уже через 4 часа после удаления препарата.

[0028] Фигура 19, на которой приведены результаты для ковалентного ингибитора протеазы I-54, отображает длительное ингибирование активности протеазы NS3 в системе с модифицированным репликоном, в которой протеаза NS3 несет клинически значимую мутацию с заменой аминокислоты аргинина на лизин в положении 155 (R155K). Такая мутация ведет к появлению устойчивости к ингибиторам протеазы в клинических условиях. Фигура 19 показывает, что, даже при условии наличия такой мутации, препараты необратимого ковалентного ингибитора могут ингибировать активность мутантной протеазы по меньшей мере в течение 24 часов после удаления их из среды.

ПОДРОБНОЕ ОПИСАНИЕ НЕКОТОРЫХ ВАРИАНТОВ РЕАЛИЗАЦИИ

1. Общее описание соединений согласно настоящему изобретению.

[0029] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы I

или фармацевтически приемлемая соль указанного соединения, где:

R1 и R1' независимо представляют собой водород или возможно содержащий заместители C1-6 алифатический углеводород, или R1 и R1' совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо;

R2a представляет собой -ОН или -NHSO2R2;

R2 представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из следующих: С3-7 циклоалкил, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатома, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероцикл, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород, возможно содержащий заместители C1-6 алифатический углеводород, или:

два R у одного и того же атома азота совместно с атомом азота, к которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу, или:

R3 и R1 совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 10-12-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное образованное ими кольцо включает головную группу; или

R3 и кольцо, образованное R1 и R1' совместно с находящимися между ними атомами, образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное образованное ими кольцо включает головную группу;

Rw представляет собой водород или возможно содержащую заместители группу, выбранную из следующих: C1-6 алифатический углеводород, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатома, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероарил, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы; или

Rw и Rx совместно образуют возможно содержащее заместители С3-7 кольцо, содержащего 0-2 гетероатома, которые независимо выбраны из азота, кислорода или серы, или:

Rw и Ry совместно образуют возможно содержащее заместители С3-7 кольцо, содержащее 0-2 гетероатома, которые независимо выбраны из азота, кислорода или серы;

Rx представляет собой -T-R7, где:

Т представляет собой ковалентную связь или бивалентную C1-6 углеводородную цепь, причем одна или две метиленовые структурные единицы в составе Т могут быть независимо заменены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -OC(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2-, или -SO2N(R)-; и

R7 представляет собой водород или возможно содержащую заместители группу, выбранную из следующих: C1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический арил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода, или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Rx' представляет собой водород, или Rx' и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители спиро-соединенное 5-7-членное кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Ry представляет собой водород, или Rx и Ry совместно образуют возможно содержащее заместители С3-7 кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, , боковую группу природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители, насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Каждый R5 независимо представляет собой -N(R)2 или, возможно содержащую заместители, группу, выбранную из следующих: C1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R6 представляет собой, возможно содержащую заместители, группу, выбранную из следующих: С1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы; и

R7 представляет собой, возможно содержащую заместители, группу, выбранную из следующих: алифатический углеводород C1-6, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

2. Соединения и определения.

[0030] Соединения согласно настоящему изобретению включают соединения, в общих чертах описанные выше, а также далее приведенные в качестве примеров в настоящей заявке классы, подклассы и виды. В настоящем описании будут использоваться приведенные ниже определения, за исключением оговоренных особо случаев. В контексте настоящего изобретения определения химических элементов приведены в соответствии с периодической системой элементов, версия CAS, Handbook of Chemistry and Physics, 75th Ed. В дополнение, общие принципы органической химии описаны в "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, и "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001, описание которых полностью включено в настоящий документ посредством ссылки.

[0031] Термины "алифатический углеводород" или "алифатическая группа", используемые в настоящем описании, относятся к прямой (т.е. неразветвленной) или разветвленной углеводородной цепи, содержащей или не содержащей заместители, полностью насыщенной или включающей один или более ненасыщенных участков, а также к моноциклическому или бициклическому углеводороду, полностью насыщенному или включающему один или более ненасыщенных участков, но не являющемуся ароматическим (это определение также относится к употребляемым в настоящем описании терминам "карбоцикл", "циклоалифатический углеводород" или "циклоалкил"), имеющему одну точку связывания с остальной молекулой. За исключением оговоренных особо случаев, алифатическая группа включает 1-6 алифатических атомов углерода. В некоторых вариантах реализации, алифатическая группа включает 1-5 алифатических атомов углерода. В других вариантах реализации, алифатическая группа включает 1-4 алифатических атомов углерода. В других вариантах реализации, алифатическая группа включает 1-3 алифатических атомов углерода, также существуют варианты реализации, согласно которым алифатические группы включают 1-2 алифатических атомов углерода. В некоторых вариантах реализации, "циклоалифатический углеводород" (или "карбоцикл", или "циклоалкил") относится к моноциклическому углеводороду С36, полностью насыщенному или содержащему один или более ненасыщенных участков, но не являющемуся ароматическим, имеющему одну точку связывания с остальной молекулой. Подходящие алифатические группы включают, но не ограничиваются следующими примерами: линейные или разветвленные, содержащие или не содержащие заместители алкильные, алкенильные, алкинильные группы и их комбинации, такие как (циклоалкил)алкил, (пиклоалкенил)алкил, или (циклоалкил)алкенил.

[0032] Термин "бициклический углеводород, соединенный (связанный) мостиком", употребляемый в настоящем описании, относится к любой системе, состоящей из двух колец, т.е. карбоциклической или гетероциклической, насыщенной или включающей ненасыщенные участки, содержащей, по меньшей мере, один мостик. Как определено по номенклатуре IUPAC, "мостиком" является неразветвленная цепь атомов или атом, или валентная связь, связывающая два атома в голове мостика, где "атом в голове мостика" является любым атомом углеводородного скелета циклической системы, связанный с тремя или более атомами скелета (исключая водород). В некоторых вариантах реализации, бициклическая группа, связанная мостиком, содержит 7-12 атомов в составе кольца и 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы. Такие бициклические группы, связанные мостиком, хорошо известны в данной области и включают группы, приведенные ниже, где каждая из групп присоединена к остальной молекуле у любого атома углерода или азота, к которому может быть присоединен заместитель. За исключением оговоренных особо случаев, бициклическая группа, соединенная мостиком, возможно содержит один или более заместителей, как описано для алифатических групп. Дополнительно или как альтернативный вариант, любой атом азота бициклической группы, к которому может быть присоединен заместитель, связанной мостиком, может содержать заместители. Примеры бициклов, связанных мостиком, включают следующие:

[0033] Термин "низший алкил" относится к прямой или разветвленной алкильной группе С1-4. Примерами низших алкильных групп являются метил, этил, пропил, изопропил, бутил, изобутил и трет-бутил.

[0034] Термин "низший галоалкил" относится к прямой или разветвленной алкильной группе С1-4, содержащей в качестве заместителей один или более атомов галогена.

[0035] Термин "гетероатом" обозначает один или более из следующих: кислород, сера, азот, фосфор или кремний (включая любую окисленную форму азота, серы, фосфора или кремния; четвертичную форму любого азотистого основания или азот гетероциклического кольца, к которому может быть присоединен заместитель, например, N (как в составе 3,4-дигидро-2H-пирролила), NH (как в составе пирролидинила) или NR+ (как в составе N-з-пирролидинила)).

[0036] Термин "ненасыщенный" в тексте настоящей заявки относится к группе, содержащей одну или более ненасыщенных областей.

[0037] Термин "бивалентная насыщенная или ненасыщенная, разветвленная или не разветвленная углеводородная цепь C1-8 (или C1-6)", в тексте настоящей заявки относится к прямым или разветвленным, как определено в настоящем описании, бивалентным алкиленовым, алкениленовым и алкиниленовым цепям.

[0038] Термин "алкилен" относится в бивалентной алкильной группе. "Алкиленовая цепь" представляет собой полиметиленовую группу, т.е. -(CH2)n-, где n является положительным значением, предпочтительно, находящимся в интервале от 1 до 6, от 1 до 4, от 1 до 3, от 1 до 2 или от 2 до 3. Алкиленовая цепь, содержащая заместители, представляет собой полиметиленовую группу, в которой вместо одного или более атомов водорода в составе метиленовой группы содержится заместитель. Подходящие заместители включают заместители, описанные ниже для алифатической группы.

[0039] Термин "алкенилен" относится к бивалентной алкенильной группе. Алкениленовая цепь, содержащая заместители, представляет собой полиметиленовую группу, содержащую, по меньшей мере, одну двойную связь, при которой вместо одного или более атомов водорода в молекуле содержится заместитель. Подходящие заместители включают заместители, описанные ниже для алифатической группы.

[0040] Термин "циклопропиленил" в настоящем описании относится к бивалентной циклопропильной группе, имеющую структуру, описываемую следующей схемой:

[0041] Термин "галоген" относится к атомам F, Cl, Br, или I.

[0042] Термин "арил", употребляемый отдельно или в качестве составной части в названии группы большего размера, таких как "аралкил", "аралкокси" или "арилоксиалкил", относится к моноциклической или бициклической системе, общее число атомов в которой равно от пяти до четырнадцати, в которой, по меньшей мере, одно кольцо является ароматическим, и каждое кольцо состоит из 3-7 атомов. Термины "арил" и "арильное кольцо" могут использоваться взаимозаменяемо.

[0043] Термин "арил", употребляемый отдельно или в качестве составной части в названии групп большего размера, таких как "аралкил," "аралкокси" или "арилоксиалкил", относится к моноциклической или бициклической системе, общее число атомов в которой равно от пяти до четырнадцати, в которой, по меньшей мере, одно кольцо является ароматическим, и каждое кольцо состоит из 3-7 атомов. Термины "арил" и "арильное кольцо" могут использоваться взаимозаменяемо. В некоторых вариантах реализации настоящего изобретения, "арил" относится к ароматической замкнутой в кольцо системе, включая, но не ограничиваясь следующими примерами: фенил, дифенил, нафтил, антрацил и подобные им соединения, которые могут содержать один или более заместителей. Также в настоящем описании термин "арил" может означать группу, в которой ароматическое кольцо конденсировано с одним или более не ароматическим кольцом, например инданил, фталимидил, нафтимидил, фенантридинил или тетрагидронафтил и им подобные.

[0044] Термины "гетероарил" и "гетероар-", употребляемый отдельно или в качестве составной части в названии группы большего размера, таких как "гетероаралкил" или "гетероаралкокси", относится к группам, состоящим из 5-10 атомов, замкнутых в кольцо, предпочтительно из 5, 6, или 9 атомов, замкнутых в кольцо; имеющих 6, 10 или 14 электронов, распределенных по циклической системе; и содержащим, помимо атомов углерода, от одного до пяти гетероатомов. Термин "гетероатом" относится к азоту, кислороду или сере, а также к любой окисленной форме азота или серы и к любой четвертичной форме азотистого основания. Гетероарильные группы включают, но не ограничиваются следующими примерами: тиенил, фуранил, пирролил, имидазолил, пиразолил, триазолил, тетразолил, оксазолил, изоксазолил, оксадиазолил, тиазолил, изотиазолил, тиадиазолил, пиридил, пиридазинил, пиримидинил, пиразинил, индолизинил, пиринил, нафтиридинил, иптеридинил. Значение терминов "гетероарил" и "гетероар-", употребляемых в настоящем описании, также включает группы, в составе которых гетероароматическое кольцо конденсировано с одним или более арильным, циклоалифатическим или гетероциклическими кольцами таким образом, что радикал или точка соединения находится на гетероароматическом кольце. Примеры таких соединений не ограничиваются следующими соединениями: индолил, изоиндолил, бензотиенил, бензофуранил, дибензофуранил, индазолил, бензимидазолил, бензтиазолил, квинолил, изоквинолил, циннолинил, фталазинил, квиназолинил, квиноксалинил, 4Н-квинолизинил, карбазолил, акридинил, феназинил, фенотиазинил, феноксазинил, тетрагидроквинолинил, тетрагидроизоквинолинил и пиридо-[2,3-b]-1,4-оксазин-3(4Н)-он. Гетероарильная группа может быть моно- или бициклической. Термины "гетероарил", "гетероарильное кольцо", "гетероарильная группа" или "гетероароматический углеводород" могут использоваться взаимозаменяемо, и значение любого из перечисленных терминов включает циклические системы, возможно содержащие заместители. Терцин "гетероаралкил" относится к алкильной группе, содержащей в качестве заместителя гетероарил, где алкильный и гетероарильный участки возможно содержат заместители.

[0045] Термины "гетероцикл", "гетероциклил" "гетероциклический радикал" и "гетероциклическое кольцо", используемые в настоящем описании, употребляются взаимозаменяемо и относятся к устойчивым 5-7-членным моноциклическим или 7-10-членным бициклическим гетероциклическим молекулам, которые могут быть как насыщенными, так и содержать ненасыщенные участки, и содержащим, помимо атомов углерода, один или более, предпочтительно от одного до четырех, гетероатомов, как описано выше. Значение термина "азот", употребляемого в отношении атома кольца гетероцикла, включает азот, содержащий заместители. В качестве примера, в насыщенном или содержащем ненасыщенные участки кольце, содержащем 0-3 гетероатомов, выбранных из кислорода, серы или азота, азот может находится в следующих формах: N (как в составе 3,4-дигидро-2H-пирролила), NH (как в составе пирролидинила) или +NR (как в составе N-замещенного пирролидинила).

[0046] Гетероциклическое кольцо может быть соединено с его концевой группой у любого гетероатома или атома углерода, обеспечивающего стабильную структуру, и любой из атомов кольца может содержать заместители. Примеры таких насыщенных или содержащих ненасыщенные участки гетероциклических радикалов включают, но не ограничиваются следующими: тетрагидрофуранил, тетрагидротиофенил пирролидинил, пиперидинил, пирролинил, тетрагидроквинолинил, тетрагидроизоквинолинил, декагидроквинолинил, оксазолидинил, пиперазинил, диоксанил, диоксоланил, диазепинил, оксазепинил, тиазепинил, морфолинил и квинуклидинил. Термины "гетероцикл", "гетероциклил", "гетероциклильное кольцо", "гетероциклическая группа", "гетероциклическая молекула" и "гетероциклический радикал" используются в настоящем описании взаимозаменяемо и также включают группы, в составе которых гетероциклильное кольцо конденсировано с одним или более арильным, гетероарильным или циклоалифатическими кольцами, такими как индолинил, 3H-индолил, хроманил или тетрагидроквинолинил, где радикал или точка соединения находится на гетероциклильном кольце. Термин "гетероциклилалкил" относится к алкильной группе, содержащей в качестве заместителя гетероциклил, в которой алкильные и гетероциклильные участки независимо возможно содержат заместители.

[0047] Термин "частично ненасыщенный", используемый в настоящем описании, относится к кольцевой молекуле, содержащей, по меньшей мере, одну двойную или тройную связь. Термин "частично ненасыщенный" употребляется для определения колец, содержащих несколько ненасыщенных участков, но его значение не включает арильные или гетероарильные молекулы, как определено в настоящем описании.

[0048] Фраза "группа боковой цепи (боковая группа) природной аминокислоты", употребляемая в настоящем описании, относится к группе боковой цепи любой из 20 аминокислот, встречающихся в природе в составе белков. Такие природные аминокислоты включают неполярные, или гидрофобные аминокислоты, глицин, аланин, валин, лейцин, изолейцин, метионин, фенилаланин, триптофан и пролин. Цистеин в некоторых случаях относят к неполярным, или гидрофобным аминокислотам, в других случаях - к полярным. Природные аминокислоты также включают полярные, или гидрофильные аминокислоты, такие как тирозин, серин, треонин, аспарагиновая кислота (также называемая аспартатом, в заряженном состоянии), глутаминовая кислота (также называемая глутаматом, в заряженном состоянии), аспарагин и глутамин. Некоторые полярные, или гидрофильные, аминокислоты содержат заряженные боковые цепи. Такие заряженные аминокислоты включают лизин, аргинин и гистидин. Обычному специалисту в данной области понятно, что защита боковой цепи полярной или гидрофильной аминокислоты может перевести такую аминокислоту в неполярную форму. К примеру, подходящим образом защищенная гидроксильная группа тирозина может перевести этот тирозин в неполярную и гидрофобную форму благодаря защите гидроксильной группы.

[0049] Фраза "группа боковой цепи неприродной аминокислоты", употребляемая в настоящем описании, относится к группе боковой цепи аминокислоты, не входящей в список 20 аминокислот, встречающихся в природе в составе белков, приведенных выше. Такие аминокислоты включают D-изомеры любой из 20 аминокислот, встречающихся в природе. Неприродные аминокислоты могут включать гомосерин, орнитин, норлейцин и тироксин. Боковые цепи других неприродных аминокислот широко известны обычным специалистам в данной области и включают неприродные алифатические боковые цепи. Также к неприродным аминокислотам относятся модифицированные аминокислоты, включая N-алкилированные, циклизованные, фосфорилированные, ацетилированные, амидированные, азидилированные, аминокислоты, в которые внесены метки, и т.д. В некоторых вариантах реализации, неприродная аминокислота представляет собой D-изомер. В некоторых вариантах реализации, неприродная аминокислота представляет собой L-изомер.

[0050] Как описано в тексте настоящей заявки, соединения согласно изобретению могут содержать группы, "возможно содержащие заместители". В общем, термин "содержащий заместители", как предваряемый термином "возможно", так и нет, означает, что один или более водородов указанной группы заменены на подходящий заместитель. За исключением оговоренных особо случаев, группа, "возможно содержащая заместители" может содержать подходящий заместитель в любом положении, в котором возможно присоединение заместителя, и в случаях, когда один или более заместителей, выбранных из подходящей группы, можно ввести в одном или более положений в любой данной структуре, заместители могут быть как одинаковыми во всех положениях, так и различными. Комбинации заместителей, предусмотренные настоящим изобретением, предпочтительно являются способствующими формированию устойчивых и химически приемлемых веществ. Термин "устойчивый", используемый в настоящем описании, относится к соединениям, существенно не изменяющимся под влиянием условий, требуемых для их производства, определения и, в некоторых вариантах реализации, их выделения, очистки и применения для одной или нескольких целей, приведенных в настоящем описании.

[0051] Подходящие одновалентные заместители у подходящего атома углерода в составе группы, "возможно содержащей заместители", независимо представляют собой водород; -(CH2)0-4R°; -(CH2)0-4OR°; -O(CH2)0-4R°, -O-(СН2)0-4C(O)OR°; -(CH2)0-4CH(OR°)2; -(CH2)0-4SR°; -(СН2)0-4Ph, которые могут содержать в качестве заместителей R°; -(CH2)0-4O(CH2)0-1Ph, которые могут содержать в качестве заместителей R°; -CH=CHPh, который может содержать в качестве заместителей R°; (СН2)0-4O(СН2)0-1-пиридил, который может содержать в качестве заместителей R°; -NO2; -CN; -N3; -(CH2)0-4(R°)2; -(CH2)0-4N(R°)C(O)R°; -N(R°)C(S)R°; -(CH2)0-4N(R°)C(O)NR°2; -N(R°)C(S)NR°2; -(CH2)0-4N(R°)C(O)OR°; N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)NR°2; -N(R°)N(R°)C(O)OR°; -(CH2)0-4C(O)R°; -C(S)R°; -(СН2)0-4С(O)OR°; -(CH2)0-4C(O)SR°; -(CH2)0-4C(O)OSiR°3; -(CH2)0-4OC(O)R°; -OC(O)(CH2)0-4SR-, SC(S)SR°; -(CH2)0-4SC(O)R°; -(CH2)0-4C(O)NR°2; -C(S)NR°2; -C(S)SR°; -SC(S)SR°, -(CH2)0-4OC(O)NR°2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)R°; -C(NOR°)R°; -(CH2)0-4SSR°; -(CH2)0-4S(O)2OR°; -(CH2)0-4OS(O)2OR°; -(CH2)0-4OS(O)2R°; -S(O)2NR°2; -(CH2)0-4S(O)R°; -N(R°)S(O)2NR°2; -N(R°)S(O)2R°; -N(OR°)R°; -C(NH)NR°2; -P(O)2R°; -P(O)R°2; -OP(O)R°2; -OP(O)(OR°)2; SiR°3; -(C1-4неразветвленный или разветвленный алкилен)O-N(R°)2 или -(С1-4неразветвленный или разветвленный алкилен)С(O)O-N(R°)2, где каждый R° может содержать заместители, согласно описанному выше, и независимо представляет собой водород, C1-6 алифатический углеводород, -CH2Ph, -O(CH2)0-1Ph, -СН2-(5-6-членное гетероарильное кольцо), или 5-6-членное насыщенное, частично ненасыщенное, или арильное кольцо, содержащее 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы, или, вне зависимости от определенного выше, два независимых R°, вместе с их промежуточными атомами, формируют 3-12-членное насыщенное, частично ненасыщенное, или арильное моно- или бициклическое кольцо, содержащее 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы, которое может содержать заместители, как описано ниже.

[0052] Подходящие одновалентные заместители у R° (или кольца, сформированного двумя независимыми R° вместе с их промежуточными атомами), независимо представляют собой водород, -(CH2)0-2R, -(галоR), -(СН2)0-2OH, -(CH2)0-2OR, -(CH2)0-2CH(OR)2; -O(галоR), -CN, -N3, -(CH2)0-2C(O)R, -(CH2)0-2C(O)OH, -(CH2)0-2C(O)OR, -(CH2)0-2SR, -(CH2)0-2SH, -(CH2)0-2NH2, -(CH2)0-2NHR, -(CH2)0-2NR2, -NO2, -SiR3, -OSiR3, -C(O)SR, -(C1-4 неразветвленный или разветвленный алкилен)С(O)OR или -SSR, где каждый R является не замещенным, или, в случаях, когда в его названии есть приставка "гало", содержит в качестве заместителей только один или более атомов галогенов и независимо выбран из следующих групп: C1-4 алифатический углеводород, -CH2Ph, -O(CH2)0-1Ph, или 5-6-членное насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы. Подходящие бивалентные заместители у насыщенного атома углерода R° включают =O и =S.

[0053] Подходящие бивалентные заместители у атома углерода группы, "возможно содержащей заместители", включают следующие: =O, =S, =NNR2, =NNHC(O)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =NOR*, -O(С(R*2))2-3О- или -S(C(R*2))2-3S-, где каждый независимый вариант реализации R* выбран из водорода, C1-6 алифатического углеводорода, возможно содержащего заместители согласно описанному ниже, или не содержащего заместители 5-6-членного насыщенного, частично ненасыщенного или арильного кольца, содержащего 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы. Подходящие бивалентные заместители, связанные с соседними атомами углерода группы, к которым может быть присоединен заместитель, "возможно содержащей заместители", включают: -O(CR*2)2-3O-, где каждый независимый вариант реализации R* выбран из водорода, С1-6 алифатического углеводорода, возможно содержащего заместители согласно описанному ниже или не содержащего заместители 5-6-членного насыщенного, частично ненасыщенного или арильного кольца, содержащего 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы.

[0054] Подходящие заместители у алифатической группы R* включают: галоген, -R, -(галоR), -ОН, -OR, -O(галоR), -CN, -C(O)OH, -C(O)OR, -NH2, -NHR, -NR2 или -NO2, где каждый R не содержит заместителей, или в случаях, когда в его названии есть приставка "гало", содержит в качестве заместителей только один или более атомов галогенов и независимо выбран из следующих групп: C1-4 алифатический углеводород, -CH2Ph, -O(CH2)0-1Ph или 5-6-членный насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы.

[0055] Подходящие заместители у азота в составе группы, "возможно содержащей заместители", включают -R, -NR2, -C(O)R, -C(O)OR, -C(O)C(O)R, -C(O)CH2C(O)R, -S(O)2R, -S(O)2NR2, -C(S)NR2, -C(NH)NR2 или -N(R)S(O)2R; где каждый R независимо представляет собой водород или C1-6 алифатический углеводород, возможно содержащий заместители, как описано выше, не содержащий заместители -OPh, или не содержащее заместители 5-6-членное насыщенное, частично ненасыщенное, или арильное кольцо, содержащее 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы, или, вне зависимости от определенного выше, два независимых варианта R совместно с находящимися между ними атомами образуют не содержащее заместители 3-12-членное насыщенное, частично ненасыщенное или арильное моно- или бициклическое кольцо, содержащее 0-4 гетероатомов, независимо выбранных из азота, кислорода или серы.

[0056] Подходящие заместители у алифатической группы R независимо представляют собой галоген, -R, -(галоR), -ОН, -OR, -O(галоR), -CN, -С(O)ОН, -C(O)OR, -NH2, -NHR, -NR2, или -NO2, где каждый R не содержит заместителей, или, когда в его названии присутствует приставка "гало", содержит в качестве заместителей только один или более атомов галогена, и независимо представляет собой алифатический углеводород С1-4, -CH2Ph, -O(CH2)0-1Ph или 5-6-членное насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[0057] Термин "фармацевтически приемлемая соль", используемый в настоящем описании, относится к солям, являющимися, в рациональных пределах с медицинской точки зрения, подходящими для применения в контакте с тканями человека и животных, не обладающими токсичностью, не вызывающими раздражения и аллергических ответов и т.д. и имеющим подходящий приемлемый коэффициент риска. Фармацевтически приемлемые соли широко известны в данной области. Например, S.М.Berge et al. подробно описывают фармацевтически приемлемые соли в J. Pharmaceutical Sciences, 1977, 66, 1-19, включенном в настоящий документ посредством ссылки. Фармацевтически приемлемые соли соединений согласно настоящему изобретению включают соли, полученные из подходящих неорганических и органических кислот и оснований. Примерами фармацевтически приемлемых, нетоксичных кислотно-аддитивных солей являются соли аминогрупп, полученные посредством добавления неорганических кислот, таких как соляная кислота, бромистоводородная кислота, фосфорная кислота, серная и хлорная кислоты, или посредством добавления органических кислот, таких как уксусная кислота, щавелевая кислота, малеиновая кислота, винная кислота, лимонная кислота, янтарная кислота или малоновая кислота, или при помощи других методов, применяемых в данной области, таких как ионный обмен. Другие фармацевтически приемлемые соли включают адипат, альгинат, аскорбат, аспартат, бензолсульфонат, бензоат, бисульфат, борат, бутират, камфорат, камфорсульфонат, цитрат, циклопентан пропионат, диглюконат, додецилсульфат, этансульфонат, формат, фумарат, глюкогептонат, глицерофосфат, глюконат, гемисульфат, гептаноат, гексаноат, гидроидид, 2-гидроксиэтансульфонат, лактобиосукцинат, лактат, лаурат, лаурилсульфат, малат, малеат, малонат, матансульфонат, 2-нафталинсульфонат, никотинат, нитрат, олеат, оксалат, пальмитат, памоат, пектинат, персульфат, 3-фенилпропионат, фосфат, пивалат, пропионат, стеарат, сукцинат, сульфат, тартрат, тиоцианат, п-толуол сульфонат, ундеканоат, соли валериановой кислоты и им подобные.

[0058] Соли, полученные путем взаимодействия с подходящими основаниями, включают соли щелочных металлов, щелочноземельных металлов, соли аммония и N+ (C1-4 алкил)4. Примеры солей щелочных или щелочноземельных металлов включают соли натрия, лития, калия, кальция, магния и им подобных. Далее, фармацевтически приемлемые соли включают, когда это целесообразно, нетоксичные соли аммиака, четвертичные аммонийные соли и катионы аминов, образованные при помощи таких противоинов как галид, гидроксид, карбоксилат, сульфат, фосфат, нитрат, сульфонаты низших алкилов и арил сульфонат.

[0059] За исключением оговоренных особо исключением случаев, приведенные в настоящем описании химические структуры также подразумевают под собой все изомерные (например, энантиомерные, диастериомерные и геометрические (или конформационные) формы; например, R и S конфигурации для каждого центра асимметрии, Z и Е изомеры вокруг двойной связи и Z и Е конформационные изомеры. Таким образом, объем настоящего изобретения охватывает стереохимические изомеры, а также энантиомеры, диастериомеры и геометрические (и конформационные) смеси соединений согласно изобретению. За исключением оговоренных особо случаев, объем настоящего изобретения охватывает все таутомерные формы указанных соединений. Также, за исключением оговоренных особо случаев, химические структуры, приведенные в настоящем описании, также предназначены для обозначения соединений, различающихся между собой только присутствием одного или более изотопически обогащенных атомов. Например, объем настоящего изобретения охватывает соединения, имеющие приведенную в настоящем описании структуру, включая замещение водорода на дейтерий или тритий, или замещение углерода на 13С- или 14C-обогащенный углерод. Такие соединения могут быть полезны, например, в качестве аналитического инструмента, в качестве зондов в биологических анализах или в качестве терапевтических агентов согласно настоящему изобретению. В некоторых вариантах реализации, головная группа, R3 или соединение согласно изобретению содержит один или более атом дейтерия.

[0060] Термин "необратимый" или "необратимый ингибитор", используемый в настоящем изобретении, относится к ингибитору (т.е. к соединению), способному ковалентно связываться с протеазой ВГС, по существу, необратимым способом. Тогда как обратимый ингибитор способен присоединяться к протеазе ВГС (но обычно не способен образовать с ней ковалентную связь) и, таким образом, может диссоциировать от протеазы ВГС, необратимый ингибитор после образования ковалентной связи остается связанным с протеазой ВГС. Необратимые ингибиторы обычно проявляют временную зависимость, при которой степень ингибирования возрастает в зависимости от времени, в течение которого ингибитор находится в контакте с ферментом. В некоторых вариантах реализации, необратимый ингибитор остается, по существу, связанным с протеазой после формирования ковалентной связи, и остается связанным с ней в течение периода времени, более долгого, чем время жизни белка.

[0061] Способы определения способности соединения выступать в роли необратимого ингибитора известны обычному специалисту в данной области. Такие способы включают, но не ограничиваются им, кинетический анализ профиля ингибирования соединением протеазы ВГС в ферментативной реакции, применением масс-спектрометрии препарата белка-мишени, модифицированного в присутствии соединения - ингибитора, экспериментами с периодическим воздействием, также известным как "перфузия (отмывка)" и внесением меток, например, внесением радиоактивной метки в состав ингибитора, для исследования ковалентной модификации фермента, а также другими способами, известными специалисту в данной области.

[0062] Обыкновенному специалисту в данной области будет понятно, что некоторые реакционно-способные функциональные группы могут выступать в роли "головных групп." Термин "головная группа", используемый в настоящем описании, относится к функциональной группе, входящей в состав соединения согласно изобретению, обладающей способностью ковалентным образом связываться с аминокислотным остатком (например, с цистеином, лизином, гистидином или с другими аминокислотными остатками, подверженными ковалентной модификации), расположенной в области связывающего "кармана" белка-мишени, и, таким образом, необратимо ингибирующей белок. Следует понимать, что под группой -L-Y, согласно определенному и описанному в тексте настоящей заявки, подразумеваются такие головные группы, обеспечивающие ковалентное и необратимое ингибирование белка.

[0063] Термин "ингибитор" в настоящем описании определяется как вещество, в значительной мере связывающееся с протеазой ВГС и/или ингибирующее ее. В некоторых вариантах реализации, значения IC50 и/или константы связывания ингибитора составляют меньше приблизительно 50 нМ, меньше приблизительно 1 нМ, меньше приблизительно 500 нМ, меньше приблизительно 100 нМ, меньше приблизительно, 10 нМ или меньше приблизительно 1 нМ.

[0064] Соединение согласно настоящему изобретению можно связать с детектируемым веществом. Специалисту в данной области будет понятно, что детектируемое вещество можно присоединять к соединению согласно настоящему изобретению посредством подходящей замещающей группы. Термин "подходящая замещающая группа", используемый в настоящем описании, относится к функциональной группе, способной ковалентно присоединяться к детектируемому веществу. Такие функциональные группы хорошо известны обыкновенным специалистам в данной области и включают содержащие, например, карбоксилатную группу, аминогруппу, тиоловую группу или гидроксильную группу и другие. Следует понимать, что такие группы можно присоединять непосредственно к соединению согласно настоящему изобретению, либо при помощи связывающей группы, например, бивалентной насыщенной или ненасыщенной углеводородной цепи. Согласно некоторым вариантам реализации, такие группы можно присоединять при помощи реакций Click-химии. Согласно другим вариантам реализации, такие группы можно присоединять при помощи 1,3-циклоприсоединения азида с алкином, возможно в присутствии медного катализатора. Способы применения реакций Click-химии известны в данной области и включают способы, описанные в Rostovtsev et al., Angew. Chem. Int. Ed. 2002, 41, 2596-99 и Sun et al., Bioconjugate Chem., 2006, 17, 52-57.

[0065] Термин "контрастное вещество", используемый в настоящем описании, употребляется взаимозаменяемо с термином "метка" и относится к группе, которую возможно детектировать, например к первичным меткам и вторичным меткам. Первичные метки, такие как радиоизотопы (например, тритий, 32P, 33Р, 35S или 14С), масс-метки и флуоресцентные метки, являются передающими сигнал "репортерными" группами, которые можно детектировать без дальнейших модификаций. Детектируемые группы также включают люминесцентные и фосфоресцентные группы.

[0066] Термин "вторичная метка", используемый в настоящем описании, относится к таким группам, как биотин и различные антигены белковой природы, нуждающиеся в присутствии вторичных интермедиатов для генерации детектируемого сигнала. Для биотина вторичные интермедиа™ могут включать конъюгаты стрептавидин-фермент. Для антигенных меток вторичные интермедиа™ могут включать конъюгаты фермент-антитело. Некоторые флуоресцентные группы выступают в роли вторичных меток, так как в процессе резонансного переноса энергии флуоресценции (FRET, РПЭП) они переносят заряд на другую функциональную группу, и детектируемый сигнал генерируется второй группой.

[0067] Термины "флуоресцентная метка", "флуоресцентный краситель" и "флуорофор", используемые в настоящем описании, относятся к группам, поглощающим энергию излучения при определенной длине волны возбуждения и излучающим световую энергию на другой длине волны. Примеры флуоресцентных меток включают, но не ограничиваются следующими: Alexa Fluor dyes (Alexa Fluor 350, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 660 и Alexa Fluor 680), AMCA, AMCA-S, BODIPY dyes (BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665), карбоксиродамин 6G, карбокси-Х-родамин (ROX), Cascade Blue, Cascade Yellow, кумарин 343, цианиновые красители (Cy3, Cy5, Cy3.5, Cy5.5), дансил, дапоксил, диалкиламинокумарин, 4',5'-дихлор-2',7'-диметокси-флуоресцин, DM-NERF, эозин, эритрозин, флуоресцин, FAM, гидроксикумарин, IR Dyes (IRD 40, IRD 700, IRD 800), JOE, лиссамин-родамин В, Marina Blue, метоксикумарин, нафтофлуоресцин, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, PyMPO, пирен, родамин В, родамин 6G, родаминовый зеленый, родаминовый красный, родол зеленый, 2',4',5',7'-тетра-бромсульфон-флуоресцин, тетраметил-родамин (TMR), карбокситетраметилродамин (TAMRA), Texas Red, Texas Red-X.

[0068] Термин "масс-метка", используемый в настоящем описании, относится к любой группе, которую возможно однозначно детектировать на основании ее массы при помощи масс-спектрометрических (МС) методов детекции. Примеры масс-меток включают метки с электрофорным высвобождением, такие как N-[3-[4'-[(п-метокситетрафторобензил)окси] фенил]-3-метилглицеронил]изонипекотиновая кислота, 4'-[2,3,5,6-тетрафтор-4-(пентафторфеноксил)]метилацетофенон и их производные. Синтез и применение таких масс-меток описаны в патентах США №4,650,750, 4,709,016, 5,360,8191, 5,516,931, 5,602,273, 5,604,104, 5,610,020 и 5,650,270. Другие примеры масс-меток включают, но не ограничиваются следующими: нуклеотиды, дидезоксинуклеотиды, олигонуклеотиды различной длины и нуклеотидного состава, олигопептиды, олигосахариды и другие синтетические полимеры различной длины и мономерного состава. Также в качестве масс-меток можно применять большое разнообразие органических молекул, как не заряженных, так и несущих заряд (биомолекулы или синтетические соединения), масса которых находится в диапазоне (100-2000 Дальтонов).

[0069] Термины "значительная способность" и "ингибирует в значительной степени", используемые в настоящем описании, означают изменение, подверженное измерению, в активности протеазы ВГС в образце, содержащем соединение согласно изобретению или композицию таких соединений и протеазу ВГС, относительно активности протеазы ВГС в составе равноценного образца, не содержащего указанных соединений или их композиции.

3. Описание примеров соединений.

[0070] Согласно некоторым вариантам реализации, предложено соединение формулы I

или фармацевтически приемлемая соль указанного соединения, где

R1 и R1' независимо представляют собой водород или возможно содержащий заместители C1-6 алифатический углеводород, или R1 и R1' совместно образуют, возможно содержащее заместители, 3-7-членное карбоциклическое кольцо;

R2a представляет собой -ОН или -NHSO2R2;

R представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из следующих примеров: С3-7циклоалкил, связанный мостиком бицикл, 6-10-членный циклоарил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероцикл, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород, возможно содержащий заместители C1-6 алифатический углеводород, или:

два R совместно с атомом азота, к которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой -L-Y, где

L представляет собой ковалентную связь или бивалентную, насыщенную или ненасыщенную, неразветвленную или разветвленную C1-8 углеводородную цепь, причем одна, две или три метиленовые структурные единицы L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(=S)-, -C(=NR)-, -N-N- или -C(=N2)-;

Y представляет собой водород, алифатический C1-6 углеводород, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное, частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1-4 группы Re; и

каждый Re независимо выбран из следующих примеров: -Q-Z, оксогруппа, NO2, галоген, CN, подходящая уходящая группа или С1-6 алифатический углеводород, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN, где

Q представляет собой бивалентную, насыщенную или ненасыщенную, неразветвленную или разветвленную углеводородную цепь С1-6, где одна, две или три метиленовые структурные единицы Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO-, или -SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и Z представляет собой водород или C1-6 алифатический углеводород, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

R3 и R1 совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем сформированное кольцо содержит -L-Y; или

R3 и кольцо, сформированное R1 и R1' совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где сформированное кольцо содержит головную группу;

Rw представляет собой водород или, возможно содержащую заместители группу, выбранную из следующих: алифатический C1-6 углеводород, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, 1-2 гетероатомов, которые выбраны из азота, кислорода или серы; или

Rw и Rx совместно образуют, возможно содержащее заместители, С3-7 кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы; или

Rw и Ry совместно образуют, возможно содержащее заместители, С3-7 кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Rx представляет собой -T-Rz, где

Т представляет собой ковалентную связь или бивалентную C1-6 углеводородную цепь, причем одна или две метиленовые структурные в составе Т могут быть независимо замещены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -ОС(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или -SO2N(R)-; и

Rz представляет собой, возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Rx' представляет собой водород, или Rx' и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители спиро-соединенное 5-7-членное кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Ry представляет собой водород, или Rx и Ry совместно образуют возможно содержащее заместители С3-7 кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, , боковую группу природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R5 независимо представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R6 представляет собой возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы; и

R7 представляет собой возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатический углеводород, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[0071] В некоторых вариантах реализации, L представляет собой ковалентную связь.

[0072] В некоторых вариантах реализации, L представляет собой бивалентную, насыщенную или ненасыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или три метиленовые единицы в составе L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -С(=S)-, -C(=NR)-, -N=N- или -C(=N2)-.

[0073] В некоторых вариантах реализации, L представляет собой бивалентную насыщенную или ненасыщенную, неразветвленную или разветвленную C1-8 углеводородную цепь. В некоторых вариантах реализации, L представляет собой -СН2-.

[0074] В некоторых вариантах реализации, L представляет собой ковалентную связь, -СН2-, -NH-, -CH2NH-, -NHCH2-,

-NHC(O)-, -NHC(O)CH2OC(O)-, -CH2NHC(O)-, -NHSO2-, -NHSO2CH2-, -NHC(O)CH2OC(O)- или -SO2NH-.

[0075] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и одна или две дополнительные метиленовые структурные единицы L могут быть независимо замещены на -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)-, -C(O)O-, -O-, -N(R)- или -C(O)-.

[0076] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица L замещена на -С(O)-, -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)- или -С(O)O-, и одна или две дополнительные метиленовые структурные единицы L, могут быть независимо замещены на циклопропилен, -O-, -N(R)- или -С(O)-.

[0077] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица L замещена на -С(O)-, и одна или две дополнительные метиленовые структурные единицы L могут быть независимо замещены на циклопропилен, -O-, -N(R)-или -С(O)-.

[0078] Согласно описанному выше, в некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь. Обыкновенному специалисту в данной области будет понятно, что такая двойная связь может находиться внутри углеводородной цепи, а может быть "экзо-связью" по отношению к углеводородному скелету, и формировать, таким образом, алкилиденовую группу. В качестве примера можно привести указанную группу L, содержащую алкилиденовую разветвленную цепь, включающую -СН2С(=СН2)СН2-. Таким образом, в некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную углеводородную цепь С2-8, где L содержит по меньшей мере одну алкилидениловую двойную связь. Примеры групп L включают -NHC(O)C(=CH2)CH2-.

[0079] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица L замещена на -С(O)-. В некоторых вариантах реализации, L представляет собой -С(O)СН-СН(СН3)-, -С(O)СН=CHCH2NH(СН3)-, -С(O)СН=СН(СН3)-, -С(O)СН=СН-, -СН2С(O)СН=СН-, -CH2C(О)СН=CH(СН3)-, -СН2СН2С(O)СН=СН-, -СН2СН2С(O)СН=СНСН2-, -СН2СН2С(O)СН=CHCH2NH(СН3)-, или -СН2СН2С(O)СН=СН(СН3)- или -CH(CH3)OC(O)CH=CH-.

[0080] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь и по меньшей мере одна метиленовая структурная единица L замещена на -ОС(O)-.

[0081] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь и по меньшей мере одна метиленовая структурная единица L замещена на -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)- или -С(O)O-, и одна или две дополнительные метиленовые структурные единицы L могут быть независимо замещены на циклопропилен, -O-, -N(R)- или -С(O)-. В некоторых вариантах реализации, L представляет собой -CH2OC(O)СН=СНСН2-, -СН2-ОС(O)СН=СН- или -СН(СН-СН2)ОС(O)СН=СН-.

[0082] В некоторых вариантах реализации, L представляет собой -NRC(O)CH=CH-, -NRC(O)CH=CHCH2N(CH3)-, -NRC(O)CH-CHCH2O-, -CH2NRC(O)CH=CH-, -NRSO2CH=CH-, -NRSO2CH=CHCH2-, -NRC(O)(C=N2)C(O)-, -NRC(O)CH=CHCH2N(CH3)-, -NRSO2CH=CH-, -NRSO2CH=CHCH2-, NRC(O)CH=CHCH2O-, -NRC(O)C(=CH2)CH2-, -CH2NRC(O)-, -CH2NRC(O)CH=CH-, -CH2CH2NRC(O)- или -CH2NRC(O)циклопропилен-, причем каждый R независимо представляет собой водород или возможно содержащий заместители C1-6 алифатический углеводород.

[0083] В некоторых вариантах реализации, L представляет собой -NHC(O)CH=CH-, -NHC(O)СН=CHCH2N(СН3)-, -NHC(O)СН=CHCH2O-, -CH2NHC(O)CH=CH-, -NHSO2CH=CH-, -NHSO2CH=CHCH2-, -NHC(O)(C=N2)C(O)-, -NHC(O)CH=CHCH2N(CH3)-, -NHSO2CH=CH-, -NHSO2CH=CHCH2-, NHC(O)CH=CHCH2O-, -NHC(O)C(=CH2)CH2, -CH2NHC(O)-, -CH2NHC(O)CH=CH-, -CH2CH2NHC(O)- или -CH2NHC(O)циклопропилен-.

[0084]. В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну тройную связь. В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем L содержит по меньшей мере одну тройную связь, и одна или две дополнительные метиленовые структурные единицы L могут быть независимо замещены на -NRC(O)-, -C(O)NR-, -S-, -S(O)-, -SO2-, -C(-S)-, -C(=NR)-, -O-, -N(R)- или -C(O)-. В некоторых вариантах реализации, L содержит по меньшей мере одну тройную связь, и по меньшей мере одна метиленовая структурная единица L замещена на -N(R)-, -N(R)C(O)-, -С(O)-, -С(O)O- или -ОС(O)- или -O-.

[0085] Примеры групп L включают -С≡С-, -С≡CCH2N(изопропил)-, -NHC(O)C≡CCH2CH2-, -СН2-С≡С-СН2-, -С≡CCH2O-, -СН2С(O)С≡С-, -С(O)С≡С- или -CH2OC(=O)C≡C-.

[0086] В некоторых вариантах реализации, L представляет собой бивалентную неразветвленную или разветвленную C2-8 углеводородную цепь, причем одна метиленовая единица L замещена на циклопропилен, и одна или две дополнительные метиленовые структурные единицы L независимо замещены на -С(O)-, -NRC(O)-, -C(O)NR-, -N(R)SO2- или -SO2N(R)-. Примеры групп L включают -NHC(O)-циклопропилен-SO2- и -NHC(O)-циклопропилен-.

[0087] Как в общих чертах было определено выше, Y представляет собой водород, С1-6 алифатический углеводород, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1-4 группы Re, причем каждый Re независимо выбран из следующих примеров: -Q-Z, оксоруппа, NO2, галоген, CN, подходящая уходящая группа или C1-6 алифатическая группа, где Q представляет собой ковалентную связь или бивалентную насыщенную или ненасыщенную, неразветвленную или разветвленную C1-6 углеводородную цепь, причем одна или две метиленовые структурные единицы Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO- или -SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и Z представляет собой водород или C1-6 углеводородную цепь, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[0088] В некоторых вариантах реализации Y представляет собой водород.

[0089] В некоторых вариантах реализации Y представляет собой C1-6 алифатическую группу, возможно содержащую в качестве заместителей: оксогруппу, галоген, NO2 или CN. В некоторых вариантах реализации Y представляет собой C2-6 алкенил, возможно содержащий в качестве заместителей: оксогруппу, галоген, NO2 или CN. В других вариантах реализации Y представляет собой C2-6 алкинил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN. В некоторых вариантах реализации Y представляет собой С2-6 алкенил. В других вариантах реализации Y представляет собой C2-4 алкинил.

[0090] В других вариантах реализации Y представляет собой C1-6 алкил, содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN. Указанные группы Y включают -CH2F, -CH2Cl, -CH2CN и -CH2NO2.

[0091] В некоторых вариантах реализации, Y представляет собой насыщенное 3-6-членное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем Y содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки.

[0092] В некоторых вариантах реализации, Y представляет собой насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, который выбран из кислорода или азота, причем указанное кольцо содержит в качестве заместителей 1-2 групп Re, причем каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. Примерами таких колец являются эпоксидные и окситановые кольца, причем каждое кольцо содержит в качестве заместителей 1-2 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки.

[0093] В других вариантах реализации Y представляет собой насыщенное 5-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые выбраны из кислорода и азота, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. Примеры таких колец включают пиперидиновые и пирролидиновые кольца, причем каждое кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой , или , где каждый R, О, Z, и Re соответствует определенному выше и описанному в тексте настоящей заявки.

[0094] В некоторых вариантах реализации Y представляет собой насыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой циклопропил, циклобутил, циклопентил, или циклогексил, где каждое кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой , где Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой циклопропил, возможно содержащий в качестве заместителей галоген, CN или NO2.

[0095] В некоторых вариантах реализации, Y представляет собой частично ненасыщенное 3-6-членное моноциклическое кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки.

[0096] В некоторых вариантах реализации, Y представляет собой частично ненасыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой циклопропенил, циклобутенил, циклопентенил, или циклогексенил, причем каждое кольцо содержит в качестве заместителей 1 -4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой , где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки.

[0097] В некоторых вариантах реализации, Y представляет собой частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y выбран из следующих соединений:

где каждый R и Re соответствует определенному выше и описанному в тексте настоящей заявки.

[0098] В некоторых вариантах реализации, Y представляет собой 6-членное ароматическое кольцо, содержащее 0-2 атомов азота, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой фенил, пиридил, или пиримидинил, причем каждое кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа R6 соответствует определенному выше и описанному в тексте настоящей заявки.

[0099] В некоторых вариантах реализации, Y выбран из следующих групп:

где каждый Re соответствует определенному выше и описанному в тексте настоящей заявки.

[00100] В других вариантах реализации, Y представляет собой 5-членное гетероарильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-3 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y представляет собой 5-членное частично ненасыщенное или арильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. Примеры таких колец включают изоксазолил, оксадиазол, тиазолил, имидазолил, пиразолил, пирролил, фуранил, тиенил, триазол, тиадиазол и оксадиазол, где каждое кольцо содержит в качестве заместителей 1-3 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. В некоторых вариантах реализации, Y выбран из следующих соединений:

где каждый R и Re соответствует определенному выше и описанному в тексте настоящей заявки.

[00101] В некоторых вариантах реализации, Y представляет собой 8-10-членное бициклическое, насыщенное, частично ненасыщеное или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. Согласно другому аспекту, Y представляет собой 9-10-членное бициклическое, частично ненасыщенное или арильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, причем каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки. Примеры таких бициклических колец включают 2,3-дигидробензо[d]изотиазол, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки.

[00102] Как в общих чертах было определено выше, каждая группа Re независимо выбрана из следующих: -Q-Z, оксогруппа, NO2, галоген, CN, подходящая уходящая группа, или алифатическая группа C1-6, возможно содержащая в качестве заместителей оксогруппу, галоген, NO2 или CN, где Q представляет собой ковалентную связь или бивалентную насыщенную или ненасыщенную, неразветвленную или разветвленную С1-6 углеводородную цепь, причем одна или две метиленовые структурные единицы в составе Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO- или -SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, или -SO2N(R)-; и Z представляет собой водород или алифатическую группу C1-6, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00103] В некоторых вариантах реализации, Re представляет собой C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2, или CN. В других вариантах реализации, Re представляет собой оксогруппу, NO2, галоген или CN.

[00104] В некоторых вариантах реализации, Re представляет собой -Q-Z, где Q представляет собой ковалентную связь и Z представляет собой водород (т.е. Re является водородом). В других вариантах реализации, R6 представляет собой -Q-Z, причем Q является бивалентной насыщенной или ненасыщенной, неразветвленной или разветвленной С1-6 углеводородной цепью, и одна или две метиленовые единицы в составе Q, могут быть независимо замещены на -NR-, -NRC(O)-, -C(O)NR-, -S-, -O-, -С(O)-, -SO- или -SO2-. Также существуют варианты реализации, согласно которым Q представляет собой бивалентную неразветвленную или разветвленную С2-6 углеводородную цепь, содержащую по меньшей мере одну двойную связь, причем одна или две метиленовые единицы в составе Q могут быть независимо замещены на -NR-, -NRC(O)-, -C(O)NR-, -S-, -O-, -С(O)-, -SO- или -SO2-. В некоторых вариантах реализации, функциональная часть Z группы Re представляет собой водород. В некоторых вариантах реализации, -Q-Z представляет собой -NHC(O)CH=CH2 или -С(O)СН=СН2.

[00105] В некоторых вариантах реализации, каждый Re независимо выбран из следующих групп: оксогруппа, NO2, CN, фтор-, хлор-, -NHC(O)CH=CH2, -C(O)CH=CH2, -СН2СН=СН2, -С≡СН, -С(O)OCH2Cl, -C(O)OCH2F, -C(O)OCH2CN, -C(O)CH2Cl, -C(O)CH2F, -C(O)CH2CN или -СН2С(O)СН3.

[00106] В некоторых вариантах реализации, R6 представляет собой подходящую уходящую группу, т.е. группу, которую подвергают нуклеофильному замещению. "Подходящей уходящей группой" является химическая группа, которую с легкостью можно заместить на требуемую приходящую химическую функциональную группу, например на тиоловую группу или на цистеин, согласно настоящему изобретению. Подходящие уходящие группы хорошо известны в данной области, например, см. "Advanced Organic Chemistry," Jerry March, 5th Ed., pp.351-357, John Wiley and Sons, N.Y. Такие уходящие группы включают, но не ограничиваются следующими примерами: галоген, алкокси-, сульфонилокси-; возможно содержащая заместители алкилсульфонилокси-; возможно содержащая заместители алкенилсульфонилокси-; возможно содержащая заместители арилсульфонилоксигруппа, ацильная и диазонийная функциональные группы. Примеры подходящих уходящих групп включают также следующие: хлор-, йод-, бром-, фтор-, ацетокси-, метансульфонилокси- (мезилокси-), тозилокси-, трифлилокси-, нитро-фенилсульфонилокси- (нозилокси-) и бром-фенилсульфонилокси-(брозилокси-группу).

[00107] В некоторых вариантах реализации, применяют следующие варианты осуществления и комбинации -L-Y:

(a) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и одна или две дополнительные метиленовые структурные единицы в составе L, могут быть независимо замещены на -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)-, -C(O)O-, циклопропилен, -O-, -N(R)- или -C(O)-; и Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(b) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица в составе L замещена на -С(O)-, -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)- или -С(O)O-, и одна или две дополнительные метиленовые структурные единицы в составе L могут быть независимо замещены на циклопропилен, -O-, -N(R)- или -С(O)-; и Y представляет собой водород или С1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(c) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица в составе L замещена на -С(O)-, и одна или две дополнительные метиленовые структурные единицы в составе L, могут быть независимо замещены на циклопропилен, -O-, -N(R)- или -С(O)-; и Y представляет собой водород или С1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(d) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица в составе L замещена на -С(O)-; и Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(e) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одна метиленовая структурная единица в составе L замещена на -ОС(O)-; и Y представляет собой водород, или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(f) L представляет собой -NRC(O)CH=CH-, -NRC(O)CH=CHCH2N(CH3)-, -NRC(O)CH-CHCH2O-, -CH2NRC(O)CH=CH-, -NRSO2CH=CH-, -NRSO2CH-CHCH2-, -NRC(O)(C=N2)-, -NRC(O)(C=N2)C(O)-, -NRC(O)CH=CHCH2N(CH3)-, -NRSO2CH=CH-, -NRSO2CH=CHCH2-, -NRC(O)CH=CHCH2O-, -NRC(O)C(-CH2)CH2-, -CH2NRC(O)-, -CH2NRC(O)CH=CH-, -CH2CH2NRC(O)- или -CH2NRC(O)циклопропилен-; где R представляет собой H или С1-6 алифатическую группу, возможно содержащую заместители; и Y представляет собой водород, или С1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NО2 или CN; или

(g) L представляет собой -NHC(O)CH=CH-, -NHC(O)CH=CHCH2N(CH3)-, -NHC(O)CH=CHCH2O-, -CH2NHC(O)CH=CH-, -NHSO2CH=CH-, -NHSO2CH=CHCH2-, -NHC(O)(C=N2)-, -NHC(O)(C=N2)C(O)-, -NHC(O)CH=CHCH2N(CH3)-, -NHSO2CH=CH-, -NHSO2CH=CHCH2-, -NHC(O)CH=CHCH2O-, -NHC(O)C(=CH2)CH2-, -CH2NHC(O)-, -CH2NHC(O)CH=CH-, -CH2CH2NHC(O)- или -CH2NHC(O)циклопропилен-; и Y представляет собой водород или С1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(h) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну алкилидениловую двойную связь, и по меньшей мере одна метиленовая структурная единица в составе L замещена на -С(O)-, -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)- или -C(O)O-, и одна или две дополнительные метиленовые структурные единицы в составе L могут быть независимо замещены на циклопропилен, -O-, -N(R)- или -С(O)-; и Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

i) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем L содержит по меньшей мере одну тройную связь, и одна или две дополнительные метиленовые структурные единицы в составе L могут быть независимо замещены на -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)- или -С(O)O-, и Y представляет собой водород или С1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

j) L представляет собой -С≡С-, -С≡CCH2N(изопропил)-, NHC(O)C≡CCH2CH2-, -СН2-С≡С-СН2-, -С≡CCH2O-, -СН2С(O)С≡С-, -C(O)C≡C- или -CH2OC(=O)С≡С-; и Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(k) L представляет собой бивалентную неразветвленную или разветвленную С2-8 углеводородную цепь, причем одна метиленовая единица в составе L замещена на циклопропилен, и одна или две дополнительные метиленовые структурные единицы в составе L независимо замещены на -NRC(O)-, -C(O)NR-, -N(R)SO2-, -SO2N(R)-, -S-, -S(O)-, -SO2-, -OC(O)- или -С(O)O-; и Y представляет собой водород или алифатическую группу C1-6, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN; или

l) L представляет собой ковалентную связь, и Y выбран из следующих примеров:

(i) C1-6алкил, содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN;

(ii) С2-6 алкенил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iii) С2-6 алкинил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iv) насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, который выбран из кислорода и азота, причем указанное кольцо возможно содержит в качестве заместителей 1-2 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(v) насыщенное 5-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатрмов, которые выбраны из кислорода из азота, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vi) или , где каждый из R, Q, Z и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vii) насыщенное 3-6-членное карбоциклическое кольцо, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(viii) частично ненасыщенное 3-6-членное моноциклическое кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(ix) частично ненасыщенное 3-6-членное карбоциклическое кольцо, указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(x) , где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xi) частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы, гдеуказанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xii)

где каждая группа R и R соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiii) 6-членное ароматическое кольцо, содержащее 0-2 атомов азота, причем указанное кольцо содержит в качестве заместителей 1-4 групп Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки;

или

(xiv)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xv) 5-членное гетероарильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-3 групп Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки;

или

(xvi)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvii) 8-10-членное бициклическое, насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки;

(m) L представляет собой -С(O)- и Y выбран из следующих примеров:

(i) C1-6алкил, содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(ii) C1-6 алкенил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iii) C2-6 алкинил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iv) насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, который выбран из кислорода и азота, причем указанное кольцо содержит в качестве заместителей 1-2 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(v) насыщенное 5-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые выбраны из кислорода и азота, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vi) , где каждая из групп R, Q, Z и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vii) насыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы R, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(viii) частично ненасыщенное 3-6-членное моноцикличнеское кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(ix) частично ненасыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(х) , где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xi) частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xii) или

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiii) 6-членное ароматическое кольцо, содержащее 0-2 атомов азота, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiv)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xv) 5-членное гетероарильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-3 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvi)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvii) 8-10-членное бициклическое насыщенное, частично ненасыщенное, или арильное кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа R6 соответствует определенному выше и описанному в тексте настоящей заявки;

(n) L представляет собой -N(R)C(O)- и Y выбран из следующих примеров:

(i) C1-6алкил, содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(ii) С2-6алкенил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iii) С2-6алкинил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iv) насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, который выбран из кислорода или азота, где указанное кольцо содержит в качестве заместителей 1-2 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(у) насыщенное 5-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые выбраны из кислорода и азота, где указанное кольцо содержит в качестве заместителей 1-4 группы Re где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vi) или , где каждая из групп R, Q, Z и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vii) насыщенное 3-6-членное карбоциклическое кольцо, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(viii) частично ненасыщенное 3-6-членное моноциклическое кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(ix) частично ненасыщенное 3-6-членное карбоциклическое кольцо, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(x) , где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xi) частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1 -4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xii)

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiii) 6-членное ароматическое кольцо, содержащее 0-2 атомов азота, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiv)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xv) 5-членное гетероарильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-3 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvi)

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvii) 8-10-членное бициклическое насыщенное, частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки;

(о) L представляет собой бивалентную насыщенную или ненасыщенную, неразветвленную или разветвленную С1-8 углеводородную цепь; и Y выбран из следующих примеров:

(i) C1-6алкил, содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN;

(ii) С2-6 алкенил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iii) С2-6 алкинил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iv) насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, который выбран из кислорода и азота, причем указанное кольцо содержит в качестве заместителей 1-2 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(v) насыщенное 5-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые выбраны из кислорода и азота, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vi) или где каждая из групп R, Q, Z и Re оответствует определенному выше и описанному в тексте настоящей заявки; или

(vii) наыщенное 3-6-членное карбоциклическое кольцо, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(viii) частично ненасыщенное 3-6-членное моноциклическое кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(ix) частично ненасыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(х) где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xi) частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiv)

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiii) 6-членное ароматическое кольцо, содержащее 0-2 атомов азота, причем указанное кольцо содержит в качестве заместителей 1-4 групп Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiv)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xv) 5-членное гетероарильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-3 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvi)

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvii) 8-10-членное бициклическое насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа R6 соответствует определенному выше и описанному в тексте настоящей заявки;

(р) L представляет собой ковалентную связь, -CH2-, -NH-, -С(O)-, -CH2NH-, -NHCH2-, -NHC(O)-, -NHC(O)CH2OC(O)-, -CH2NHC(O)-, -NHSO2-, -NHSO2CH2-, -NHC(O)CH2OC(O)- или -SO2NH-; и Y выбран из следующих примеров:

(i) C1-6алкил, содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(ii) С2-6 алкенил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iii) С2-6 алкинил, возможно содержащий в качестве заместителей оксогруппу, галоген, NO2 или CN; или

(iv) насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, который выбран из кислорода и азота, причем указанное кольцо содержит в качестве заместителей 1-2 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(v) насыщенное 5-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые выбраны из кислорода и азота, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vi) , где каждая из групп R, Q, Z и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(vii) насыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(viii) частично ненасыщенное 3-6-членное моноциклическое кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 групп Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(ix) частично ненасыщенное 3-6-членное карбоциклическое кольцо, указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(х) , где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xi) частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xii)

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiii) 6-членное ароматическое кольцо, содержащее 0-2 атомов азота, где указанное кольцо содержит в качестве заместителей 1-4 группы Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xiv)

где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xv) 5-членное гетероарильное кольцо, содержащее 1-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-3 групп Re, где каждая группа Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvi)

где каждая из групп R и Re соответствует определенному выше и описанному в тексте настоящей заявки; или

(xvii) 8-10-членное бициклическое насыщенное, частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re, где группа Re соответствует определенному выше и описанному в тексте настоящей заявки.

В некоторых вариантах реализации настоящего изобретения, группа Y формулы I выбрана из групп, представленных в Таблице 1, приведенной ниже, где каждая волнистая линия обозначает точку присоединения к остальной части молекулы.

Таблица 1. Примеры Групп Y формулы I:

где каждый Re независимо представляет собой подходящую уходящую группу, NO2, CN или оксогруппу.

[00108] В некоторых вариантах реализации, группа R формулы I выбрана из групп, представленных в Таблице 2, приведенной ниже, где каждая волнистая линия обозначает точку пркрепления к остальной части молекулы.

Таблица 2. Примеры Групп R3:

где каждый R6 независимо представляет собой подходящую уходящую группу, NO2, CN или оксогруппу.

[00109] В некоторых вариантах реализации, группа Rx формулы I представляет собой -T-Rz и Rx' представляет собой водород. В некоторых вариантах реализации, группа Т формулы I представляет собой ковалентную связь. В некоторых вариантах реализации, Т является бивалентной C1-6 углеводородной цепью, причем одна или две метиленовые структурные единицы в составе Т могут быть независимо замещены на -O-, -S-, -N(R)-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или -SO2N(R)-.

[00110] В некоторых вариантах реализации, Т является бивалентной C1-6 углеводородной цепью, где одна или две метиленовые структурные единицы в составе Т, могут быть независимо замещены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -ОС(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или -SO2N(R)-, где атомом Т, связанным с пролиновым кольцом формулы I, является атом углерода, кислорода или серы.

[00111] В некоторых вариантах реализации, группа Т является бивалентной С1-4 углеводородной цепью, причем одна или две метиленовые структурные единицы в составе Т могут быть независимо замещены на -O-, -S-, -N(R)- или -С(O)-. В других вариантах реализации, Т представляет собой -O-СН2-. В других вариантах реализации, Т представляет собой -O-. В некоторых вариантах реализации, Т представляет собой -S-.

[00112] В некоторых вариантах реализации, Т не является валентной связью, когда Rz представляет собой 5-10-членное моноциклическое или бициклическое гетероарильное кольцо или 4-7-членное гетероциклическое кольцо, как определено в настоящем описании.

[00113] В некоторых вариантах реализации, Т является бивалентной C2-3 углеводородной цепью, где одна или две метиленовые структурные единицы в составе Т могут быть независимо замещены на -O-, -S-, -N(R)- или -С(O)-. В некоторых вариантах реализации, Т представляет собой -СН2С(O)-, -ОС(O)-, или -NHC(O)-. Существуют варианты реализации, где Т представляет собой -ОС(O)-, и Rz представляет собой 8-10-членное бициклическое кольцо, содержащее по меньшей мере один атом азота.

[00114] В некоторых вариантах реализации, Т представляет собой -О- или -O-(CH2)1-2-, и R2 предстаквляет собой возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Т представляетсобой -О- или -СН2-, и Rz представляет собой, возможно содержащую заместители группу, выбранную из следующих примеров: 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Т представляет собой -O-СН2-, и Rz представляет собой фенил.

В других вариантах реализации, Т представляет собой ковалентную связь, и Rz представляет собой

В некоторых вариантах реализации, Т представляет собой -ОС(O)-, и Rz представляет собой

В некоторых вариантах реализации, Т представляет собой ковалентную связь или -O-.

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

[00115] В некоторых вариантах реализации, Rz представляет собой

[00116] В некоторых вариантах реализации, группы Rx и Rx' формулы I совместно образуют возможно содержащее заместители, спиро-соединенное 5-7-членное кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Rx и Rx' совместно образуют спиро-соединенное 5-6-членное кольцо, содержащее 1-2 гетероатомов, которые выбраны из -О- и -S-. В других вариантах реализации, Rx и Rx' совместно образуют

[00117] В некоторых вариантах реализации, группы R1 и R1' формулы I независимо представляют собой водород или возможно содержащую заместители C1-6 алифатическую группу. В некоторых вариантах реализации, R1 представляет собой водород, и R1' представляет собой С1-4 алифатическую группу. В других вариантах реализации, R1 представляет собой водород, и R1' представляет собой n-пропил.

[00118] В некоторых вариантах реализации, группы R1 и R1' формулы I совместно образуют, возможно содержащее заместители, 3-7-членное карбоциклическое кольцо. В некоторых вариантах реализации, группы R1 и R1' формулы I совместно образуют, возможно содержащее заместители циклопропильное кольцо. В некоторых вариантах реализации, группы R1 и R1' формулы I совместно образуют циклопропильное кольцо, содержащее в качестве заместителей этил или винил.

[00119] В некоторых вариантах реализации, R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, ; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00120] В некоторых вариантах реализации, группа R4 формулы I представляет собой -NHC(O)R5. В некоторых вариантах реализации, группа R4 формулы I представляет собой -NHC(O)OR6. В других вариантах реализации, группа R4 формулы I представляет собой . В некоторых вариантах реализации, группа R4 формулы I является водородом.

[00121] Существуют варианты реализации, согласно которым, если R4 представляет собой -NHC(O)R5, R5 представляет собой C1-6 алифатическую группу, или, возможно содержащую заместители группу, выбранную из следующих примеров: связанный мостиком бицикл, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероцикл, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00122] В некоторых вариантах реализации, при условии, что R4 является группой -NHC(O)OR6, R6 представляет собой C1-6 алифатическую группу или возможно содержащую заместители группу, выбранную из следующих примеров: связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероцикл, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы.

[00123] В некоторых вариантах реализации, группа R4 формулы I представляет собой боковую группу аминокислоты. В некоторых вариантах реализации, группа R4 формулы I представляет собой боковую группу неприродной аминокислоты. В некоторых вариантах реализации, группа R4 формулы I представляет собой алифатическую боковую группу неприродной аминокислоты. В некоторых вариантах реализации, группа R4 формулы I представляет собой боковую группу неприродного аланина, содержащего в качестве заместителей одну, две или три группы R°, где каждый R° соответствует определенному выше. В некоторых вариантах реализации, группа R4 формулы I представляет собой боковую группу природной аминокислоты.

[00124] В отдельных вариантах реализации, группа R4 формулы I представляет собой боковую группу природного аланина (т.е. R4 представляет собой метил). В некоторых вариантах реализации, группа R4 формулы I боковую группу природного D-аланина. Существуют варианты реализации, согласно которым группа R4 формулы I представляет собой боковую группу природного L-аланина.

[00125] В других вариантах реализации, группа R4 формулы I представляет собой боковую группу природного валина. В некоторых вариантах реализации, группа R4 формулы I представляет собой боковую группу природного остака D-валина. В некоторых вариантах реализации, группа R4 формулы I представляет собой боковую группу природного L-валина.

[00126] В некоторых вариантах реализации, группа R4 формулы I состоит из смеси боковых групп аминокислот как в D-, так и в L- конфигурациях. Такие группы R4 именуются в настоящем описании "D,L-смешанные боковые группы аминокислот". В некоторых вариантах реализации, соотношение D-конфигураций боковых групп аминокислот и L-конфигурациий выбрано из следующих соотношений: 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4; 1:5 и 1:6. Таким образом, в некоторых вариантах реализации, группа R формулы I является D,L-смешанной боковой группой аланина. В других вариантах реализации, группа R4 формулы I является D,L-смешанной боковой группой валина.

[00127] Без ограничения какой-либо конкретной теорией, считают, что, для соединений формулы I, боковые группы аминокислот в которых находятся в D-конфигурации, целесообразно допускать принятие соединением пространственной ориентации, способствующей связыванию протеазы ВГС.

[00128] В некоторых вариантах реализации, группы R5 и R7 формулы I независимо представляют собой, возможно содержащие заместители, группы, выбранные из следующих примеров: возможно содержащая заместители, C1-6 алифатическая группа, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, R5 представляет собой возможно содержащий заместители 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и R7 представляет собой возможно содержащую заместители C1-6алифатическую группу. Существуют варианты реализации, в которых R5 представляет собой и R7 является циклогексилом.

[00129] В некоторых вариантах реализации, Rx и Rx' совместно образуют возможно содержащее заместители спиро-соединенное 5-7-членное кольцо, содержащее 0-2 гетероатома, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Rx и Rx' совместно образуют спиро-соединенное 5-6-членное кольцо, содержащее 1-2 гетероатома, которые выбраны из -О- и -S-. В других вариантах реализации, Rx и Rx' совместно образуют

[00130] В некоторых вариантах реализации, группа Rw формулы I является водородом или, возможно содержащей заместители группой, выбранной из следующих примеров: С1-6 алифатическая группа, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Rw и Rx совместно образуют возможно содержащее заместители С3-7 кольцо, содержащее 0-2 гетероатома, которые независимо выбраны из азота, кислорода или серы. В других вариантах реализации, Rw и Ry совместно образуют возможно содержащее заместители С3-7 кольцо, содержащее 0-2 гетероатома, которые независимо выбраны из азота, кислорода или серы.

[00131] В некоторых вариантах реализации, группа Rw формулы I представляет собой водород. В других вариантах реализации, группа Rw формулы I представляет собой, возможно содержащую заместители C1-6 алифатическую группу.

[00132] В некоторых вариантах реализации, группа R2a формулы I представляет собой -ОН. В других вариантах реализации, группа R2a формулы I представляет собой -NHSO2R2, где R2 соответствует определенному выше и описанному в тексте настоящей заявки. Таким образом, согласно настоящему изобретению предложено соединение формулы I-а или I-b

или фармацевтически приемлемые соли указанных соединений, где каждый из R1, R1', R2, R3, R4, Rw, Rx, Rx', и Ry соответствует определенному выше для формулы I и описаниям классов и подклассов, приведенным в тексте настоящей заявки.

[00133] В отдельных вариантах реализации, группа R2 формулы I-b представляет собой -N(R)2. В других вариантах реализации, группа R2 формулы I-b представляет собой возможно содержащую заместители группу, выбранную из следующих примеров: С3-7 циклоалкил, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, R2 представляет собой С3-7 циклоалкил или 6-10-членный арил. В некоторых вариантах реализации, R представляет собой возможно содержащий заместители 6-10-членный арил. В некоторых вариантах реализации, R2 представляет собой фенил. Существуют варианты реализации, согласно которым R2 представляет собой циклопропил.

[00134] В отдельных вариантах реализации, R2 выбран из следующих примеров: циклоалкил С3-7, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы.

[00135] В отельных вариантах реализации, группа R3 формулы I является головной группой. Существуют варианты реализации, согласно которым группы R3 и R1 формулы I совместно с находящимися между ними атомами образуют, возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где сформированное кольцо содержит головную группу. В некоторых вариантах реализации, R3 и кольцо, образованное R1 и R1' совместно с находящимися между ними атомами, образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где сформированное кольцо содержит головную группу.

[00136] Согласно определенному в общих чертах выше, кольцо, образованное группами R3 и R1 формулы I, содержит головную группу. Фраза "содержит головную группу", употребляемая в настоящем описании, может означать как то, что кольцо, образованное R3 и R1, содержит головную группу в качестве заместителя, так и то, что такая группа находится внутри самого кольца. Например, кольцо, образованное R3 и R1, может содержать в качестве заместителя головную группу -L-Y, где группы -L-Y соответствуют описаному выше. В качестве альтернативного варианта, кольцо, образованное R3 и R1, обладает свойствами головной группы, помещенной внутрь кольца. Например, кольцо, образованное R3 и R1, может включать один или более ненасыщенных участков и возможных заместителей и/или гетероатомов, что, в комбинации, приводит к формированию группы, способной к ковалентному связыванию протеазы ВГС согласно настоящему изобретению. В некоторых вариантах реализации, кольцо, образованное R3 и R1, возможно, содержит заместители в α-, β-, γ- или δ-положении относительно атома углерода, к которому присоединена группа R4.

[00137] Следует понимать, что когда R3 и R1 связывают вместе с образованием возможно содержащего заместители насыщенного или ненасыщенного 12-18-членного кольца, содержащего 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы, такие соединения включают соединения, образованные путем связывания R3 и кольца, сформированного R1 и R1'.

[00138] Примеры соединений формулы I, где R3 и кольцо, образованное R1 и R, связаны вместе, включают соединения формул I-с-1, I-c-2, I-c-3, I-c-4, I-c-5- и I-с-6

или фармацевтически приемлемые соли указанных соединений, где каждый из R2a, R4, Rw, Rx, Rx', и Ry соответствует определенному выше, а также описанию классов и подклассов, приведенному в тексте настоящей заявки. Следует понимать, что, хотя на формулах I-c-1, I-c-2, I-c-3, I-c-4, I-c-5, и I-c-6 изображено циклопропильное кольцо, образованное R1 и R1', указанная группа приведена в качестве примера, и, таким образом, согласно настоящему описанию предусмотрены и другие группы R1 и R1'.

[00139] Примеры указанных соединений включают соединения, приведенные ниже в Таблице 3.

[00140] Хотя соединения формул I-c-1, I-c-2, I-c-3, I-c-4, I-c-5, и I-c-6 изображены в форме Z-стереоизомеров по двойной связи в макроциклическом кольце, следует понимать, что, в некоторых вариантах реализации соединения формул I-c-1, I-c-2, I-c-3, I-c-4, I-c-5, и I-c-6 могут находиться и в Е-стереоизомерном состоянии по двойной связи в макроциклическом кольце. Существуют также варианты реализации, согласно которым предложены смеси обоих стереоизомеров. В других вариантах реализации, соединения формул I-c-1, I-c-2, I-c-3, I-c-4, I-c-5, и I-c-6 возможно приводить в подходящие условия с насыщением двойной связи.

[00141] В отдельных вариантах реализации, R1 и R1' совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо. В некоторых вариантах реализации такие соединения имеют структуру, приведенную на формуле I-d

или фармацевтически приемлемой соли указанных соединений, где каждый из R2a, R3, R4, R°, Rx, Rx', и Ry соответствует определенному для формулы I и описаниям классов и подклассов, приведенным в тексте настоящей заявки.

[00142] В некоторых вариантах реализации, R° представляет собой, возможно содержащую заместители группу, выбранную из C1-6 алифатических групп. В некоторых вариантах реализации, R° представляет собой этил. В других вариантах реализации, R° представляет собой винил.

[00143] Примеры групп R3 формулы I-d включают группы, описанные выше и приведенные в тексте настоящей заявки, а также группы, приведенные в Таблице 3 ниже.

[00144] В отдельных вариантах реализации, группы R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, ненасыщенное 18-22-членное кольцо, содержащее 3-5 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации кольцо, образованное R4 и Rx, содержит в качестве заместителей одну или более групп Rm, где каждый вариант Rm независимо представляет собой галоген, -OR°; -CN; -SCN; -SR°; -SOR°; -SO2R°; -NO2; -N(R°)2; -NHC(O)R°, или, возможно содержащую заместители группу, выбранную из C1-6 алифатических групп и циклоалкильных групп С3-7. В некоторых вариантах реализации, согласно настоящему изобретению предложены соединения формулы I-е или I-f

или фармацевтически приемлемые соли указанных соединений, где R2a, R3, и R° соответствуют определенному для формулы I и описанию классов и подклассов, приведенному в тексте настоящей заявки;

р может принимать целые значения от 1 до 6, включительно; и

каждый вариант Rm независимо представляет собой галоген, -OR°; -CN; -N(R°)2; или, возможно содержащую заместители группу, выбранную из C1-6 алифатических групп и С3-7 циклоалкильных групп.

В некоторых вариантах реализации, значение р составляет 1. В некоторых вариантах реализации, значение р составляет 2.

[00145] Согласно некоторым вариантам реализации, Rm представляет собой С1-6 алифатическую группу. В некоторых вариантах реализации, Rm представляет собой метил.

[00146] В некоторых вариантах реализации, R° является возможно содержащей заместители группой, выбранной из C1-6 алифатических групп. Существуют варианты реализации, согласно которым R° представляет собой этил. В других вариантах реализации, R° представляет собой винил.

[00147] Примеры групп R3 формул I-е и I-f включают группы, описанные в настоящем тексте и приведенные ниже, в Таблице 3.

[00148] Несмотря на то, что соединения формул I-е и I-f изображены как в Z-, так и в Е-конформациях по двойной связи в макроциклическом кольце, следует понимать, что, в некоторых вариантах реализации, соединения формул I-е и I-f могут находиться в Е-стереоизомерном состоянии по двойной связи в макроциклическом кольце. В некоторых вариантах реализации, соединения формул I-е и I-f могут находится в Z-стереоизомерном состоянии по двойной связи в макроциклическом кольце. Согласно некоторым вариантам реализации, предложена смесь обоих стереоизомеров. В других вариантах реализации, соединения формул I-е и I-f можно подвергать воздействию подходящих условий с образований соединений формулы I-g или I-h

или фармацевтически приемлемых солей указанных соединений.

[00149] В некоторых вариантах реализации, R4 и Rx связаны вместе согласно описанному выше, и R3 и кольцо, образованное R1 и R1', связаны вместе согласно описанному выше, с образованием новых бимакроциклических соединений. В некоторых вариантах реализации, кольцо, образованное R4 и Rx, содержит в качестве заместителей одну или более группу Rm согласно описанному выше для формул I-е и I-f. В некоторых вариантах реализации, макроциклическое кольцо, образованное R3 и кольцом, образованным R1 и R1', содержит в качестве заместителя головную группу -L-Y с образованием соединений формулы I-j или I-k

или фармацевтически приемлемой соли указанных соединений; где каждая- - -независимо обозначает одну двойную связь. Способы получения указаных соединений, в дополнение к способам синтеза макроциклов и соединений, содержащих головную группу, описанных в тексте настоящей заявки, включают также описанные у McCauley, J.A. et al., Angew. Chem. Int. Ed., 2008, 47, pp.9104-7.

[00150] В некоторых вариантах реализации, метиленовая единица в составе кольца, образованного R3 и кольцом, образованным R1 и R1', замещена на группу L-Y с получением соединений формулы I-m или I-n

или фармацевтически приемлемых солей указанных соединений; где каждая независимо обозначает одну двойную связь.

[00151] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы II-а или II-b

или фармацевтически приемлемая соль указанного соединения, где:

R1 и R1' независимо представляют собой водород или, возможно содержащую заместители C1-6 алифатическую группу, или R1 и R1' совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо;

R2 представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из следующих: С3-7 циклоалкил, связанный мостиком 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород или возможно содержащую заместители C1-6 алифатическую группу, или два Ry совместно с атомом азота, к которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащеее 1-2 гетероатома, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу;

Rx представляет собой -T-Rz, где

Т является ковалентной связью или бивалентной C1-6 углеводородной цепью, где одна или две метиленовые единицы в составе Т могут быть независимо замещены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -ОС(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или SO2N(R)-; и

Rz представляет собой водород или возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Ry представляет собой водород, или Rx и Ry совместно образуют, возможно содержащий заместители, С3-7 карбоциклил;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6 или боковую цепь природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители, насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R5 независимо представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы; и

R6 представляет собой, возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00152] В некоторых вариантах реализации настоящего изобретения, предложено соединение формулы II-а или II-b, или его фармацевтически приемлемая соль, где каждый из R1, R1', R2, R3, R4, Rx, и Ry соответствует определенному выше и где

R3 представляет собой -L-Y, где

L представляет собой ковалентную связь или бивалентную, насыщенную или не насыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или три метиленовые единицы в составе L, могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(=S)-, -C(=NR)-, -N=N- или -C(=N2)-;

Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное или частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1-4 группы Re; и

каждый Re независимо выбран из -Q-Z, оксогруппы, NO2, галогена, CN, подходящей уходящей группы, или C1-6 алифатической группы, возможно содержащей в качестве заместителей оксогруппу, галоген, NOz или CN, где:

Q представляет собой ковалентную связь, или бивалентную насыщенную или ненасыщенную, прямую или разветвленную, С1-6 углеводородную цепь, причем одна или две метиленовые единицы в составе Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO- или -SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и

Z представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00153]. В некоторых вариантах реализации, группы R1, R1', R2, R3, R4, Rx, и Ry формул II-а и II-b соответствуют определенному выше для формулы I и описанию классов и подклассов, приведенному в тексте настоящей заявки.

[00154] В некоторых вариантах реализации, группы R1 и R1' формул II-а и II-b совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо. В других вариантах реализации, R1 и R1' совместно образуют возможно содержащее заместители, циклопропильное кольцо.

[00155] В некоторых вариантах реализации, группа R2 формулы II-b представляет собой -N(R)2, или, возможно содержащую заместители группу, выбранную из циклоалкила С3-7 или 6-10-членного арила. В некоторых вариантах реализации, R2 представляет собой -N(R)2 или, возможно содержащую заместители группу, выбранную из циклоалкила С3-5 или 6-8-членного арила. В некоторых вариантах реализации, R2 является -N(R)2, и R2 является метилом. Существуют варианты реализации, согласно которым R2 является циклопропилом. В других вариантах реализации, R представляет собой фенил.

[00156] В некоторых вариантах реализации, группы Rx формул II-а и II-b представляют собой -T-Rz, где Т представляет собой ковалентную связь, или бивалентную С1-6 углеводородную цепь, где одна или две метиленовые единицы Т могут быть независимо замещены на -O-, и Rz представляет собой, возможно содержащую заместители группу, выбранную из следующих примеров: 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Т представляет собой -СН2-, и Rz является фенилом. В других вариантах реализации, Т представляет собой ковалентную связь, и Rz представляет собой

В некоторых вариантах реализации, Т представляет собой ковалентную связь или -O-. Существуют варианты реализации, согласно которым Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

Согласно некоторым вариантам реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

[00157] В некоторых вариантах реализации, группа R4 формул II-а и II-b представляет собой -NHC(O)OR6, где R6 является, возможно содержащей заместители группой, выбранной из C1-6 алифатических групп. В некоторых вариантах реализации, R6 представляет собой циклопентил. В других вариантах реализации, R6 представляет собой w-бутил.

[00158] Согласно некоторым вариантам реализации, R4 представляет собой -NHC(O)R5, где R5 независимо представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из C1-6 алифатических групп. В некоторых вариантах реализации, R5 представляет собой -N(R)2, и каждый R независимо представляет собой водород или возможно содержащую заместители группу, выбранную из C1-6 алифатических групп. В некоторых вариантах реализации, R5 представляет собой -N(R)2, каждый R независимо представляет собой водород или m-бутил.

[00159] Согласно некоторым вариантам реализации настоящего изобретения предложено соединение формулы III-a или III-b

или фармацевтически приемлемая соль указанного соединения, где:

R1 и R1' независимо представляют собой водород или, возможно содержащую заместители C1-6 алифатическую группу, или R1 и R1' совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо;

R2 представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из следующих: С3-7 циклоалкил, связанная мостиком бициклическая группа, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород, или возможно содержащую заместители C1-6 алифатическую группу, или два Ry совместно с атомом азота, к которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу;

Rx представляет собой -T-Rz, где

Т является ковалентной связью или бивалентной C1-6 углеводородной цепью, где одна или две метиленовые единицы в составе Т могут быть независимо замещены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -ОС(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или -SO2N(R)-; и

Rz представляет собой водород или, возможно содержащую заместители группу, выбранную из следующих: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или циклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, или боковую цепь природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы; и

[00160] R6 представляет собой возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00161] Согласно некоторым вариантам реализации, настоящее изобретение предлагает соединение формулы III-а или III-b, или фармацевтически приемлемую соль указанного соединения, где каждый из R1, R1', R2, R3, R4, и Rx соответствует определенному выше, и где:

R3 представляет собой -L-Y, где

L представляет собой ковалентную связь или бивалентную насыщенную или не насыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или три метиленовые единицы в составе L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(=S)-, -C(=NR)-, -N-N- или -С(=N2)-;

Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2, или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, где указанное кольцо содержит в качестве заместителей 1-4 группы Re; и

каждый Re независимо выбран из -Q-Z, оксогруппы, NO2, галогена, CN, подходящей уходящей группы или C1-6 алифатической группы, возможно содержащей в качестве заместителей оксогруппу, галоген, NO2 или CN, где

Q представляет собой ковалентную связь или бивалентную насыщенную или не насыщенную, прямую или разветвленную C1-6 углеводородную цепь, причем одна или две метиленовые единицы в составе Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO-, or-SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и Z представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00162] В некоторых вариантах реализации, каждая из групп R1, R1', R2, R3, R4 и R, формул III-а и III-b соответствует определенному выше и описанию классов и подклассов, приведенному в тексте настоящей заявки.

[00163] В некоторых вариантах реализации, группа R2 формулы III-b представляет собой -N(R)2 или, возможно содержащую заместители группу, выбранную из С3-7 циклоалкила или 6-10-членного арила. В некоторых вариантах реализации, R2 представляет собой -N(R)2 или возможно содержащую заместители группу, выбранную из С3-5 циклоалкила или 6-8-членного арила. В некоторых вариантах реализации, R2 представляет собой -N(R)2, и R представляет собой метил. В некоторых вариантах реализации, R2 представляет собой циклопропилм.

[00164] В некоторых вариантах реализации группа Rx формул III-a и III-b представляет собой -T-Rz, Т представляет собой ковалентную связь или бивалентную C1-6 углеводородную цепь, причем одна или две метиленовые единицы Т могут быть независимо замещены на -O-, и Rz представляет собой, возможно содержащую заместители группу, выбранную из следующих примеров: 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Т представляет собой -СН2 и Rz представляет собой фенил. В других вариантах реализации, Т является ковалентной связью, и Rz представляет собой

В некоторых вариантах реализации, Т является ковалентной связью или -O-.

Согласно некоторым вариантам реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, Rz представляет собой

В некоторых вариантах реализации, R7 представляет собой

[00165] В некоторых вариантах реализации, группа R4 формул III-a и III-b

представляет собой -NHC(O)OR6, где R6 представляет собой возможно содержащую заместители группу, выбранную из Ci-б алифатических групп. В некоторых вариантах реализации, R6 представляет собой циклопентил. В других вариантах реализации, R6 представляет собой т-бутил.

[00166] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы IV-a или IV-b

или фармацевтически приемлемая соль указанного соединения, где:

R1 и R1' совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо;

R2 представляет собой, возможно содержащую заместители группу, выбранную из следующих: С3-7 циклоалкил, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород, или, возможно содержащую заместители C1-6 алифатическую группу, или два Ry совместно с атомом азота, к которому они присоединены образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу;

Rx представляет собой -T-Rz, где:

Т является ковалентной связью или бивалентной C1-6 углеводородной цепью, где одна или две метиленовые единицы в составе Т могут быть независимо замещены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -ОС(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или -SO2NCR)-; и

Rz представляет собой водород или возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или циклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

Ry представляет собой водород, или Rx и Ry совместно образуют, возможно содержащий заместители, С3-7 карбоциклил;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, или боковую цепь природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R6 представляет собой возможно содержащую заместители группу, выбранную из следующих примеров: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00167] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы IV-a или IV-b или фармацевтически приемлемая соль указанного соединения, где каждый из R1, R1', R2, R3, R4, и Rx соответствует определенному выше, и где

L представляет собой ковалентную связь или бивалентную, насыщенную или не насыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или метиленовые единицы в составе L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(=S)-, -C(=NR)-, -N=N- или -C(=N2)-;

Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN или 3-10-членное моноциклическое или бициклическое, насыщенное или частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1-4 группы Re; и

каждый R6 независимо выбран из -Q-Z, оксогруппы, NO2, галогена, CN, подходящей уходящей группы или C1-6 алифатической группы, возможно содержащей в качестве заместителей оксогруппу, галоген, NO2 или CN, где

Q представляет собой ковалентную связь, или бивалентную насыщенную или ненасыщенную, прямую или разветвленную, С1-6 углеводородную цепь, причем одна или две метиленовые единицы в составе Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO- или -SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и

Z представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00168] В некоторых вариантах реализации, каждая из групп R1, R1', R2, R3, R4, и Rx формулы IV соответствует описанному выше для формулы I и описанию классов и подклассов соединений, приведенному в тексте настоящей заявки.

[00169] В некоторых вариантах реализации, группы R1 и R1' формул IV-a и IV-b совместно образуют возможно содержащее заместители 3-7-членное карбоциклическое кольцо. В некоторых вариантах реализации, указанные соединения представляют собой соединения, соответствующие формулам IV-c и IV-d

или фармацевтически приемлемые соли указанных соединений, где каждый R2, R3, R4, Rx, Ry, и R° соответствует описанному выше для формул IV-a и IV-b, и описанию классов и подклассов, приведенному в тексте настоящей заявки.

[00170] В некоторых вариантах реализации, R° представляет собой возможно содержащую заместители группу, выбранную из C1-6 алифатических групп. В некоторых вариантах реализации, R° представляет собой этил. В других вариантах реализации, R° представляет собой винил.

[00171] Как в общих чертах определено в описании к формулам IV-a и IV-b, R4 представляет собой -NHC(O)OR6. В некоторых вариантах реализации, R6 представляет собой возможно содержащую заместители группу, выбранную из C1-6 алифатической группы или 6-10-членного арила. В других вариантах реализации, R6 представляет собой С1-4 алифатическую группу. В других вариантах реализации, R6 представляет собой т-бутил.

[00172] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формул V-a и V-b

или фармацевтически приемлемая соль указанного соединения, где:

R1 и R1' независимо представляют собой водород или возможно содержащую заместители C1-6 алифатическую группу, или R1 и R1' совместно образуют, возможно содержащее заместители 3-7-членное карбоциклическое кольцо;

R2 представляет собой -N(R)2;

каждый R независимо представляет собой водород, или, возможно содержащую заместители C1-6 алифатическую группу, или два R совместно с атомом азота, к которому они присоединены образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу;

Rx представляет собой -T-Rz, где

Т является ковалентной связью или бивалентной C1-6 углеводородной цепью, причем одна или две метиленовые единицы в составе Т, могут быть независимо замещены на -O-, -S-, -N(R)-, -С(O)-, -С(O)O-, -ОС(O)-, -N(R)C(O)-, -C(O)N(R)-, -S(O)-, -S(O)2-, -N(R)SO2- или -SO2N(R)-; и

Rz представляет собой водород или возможно содержащую заместители группу, выбранную из следующих: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный моноциклический или бициклический арил, 5-10-членный моноциклический или циклический гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, или боковую цепь природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, насыщенное или не насыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R6 представляет собой возможно содержащую заместители группу, выбранную из следующих: С1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00173] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединения формулы V-a или V-b, или фармацевтически приемлемая соль указанного соединения, где каждый из R1, R1', R2, R3, R4, и Rx соответствует определенному в тексте настоящей заявки:

R3 представляет собой -L-Y, где

L представляет собой ковалентную связь или бивалентную, насыщенную или не насыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или метиленовые единицы в составе L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(=S)-, -C(-NR)-, -N=N- ИЛИ -C(=N2)-;

Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2, или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное или частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1-4 группы Re; и

каждый Re независимо выбран из -Q-Z, оксогруппы, NO2, галоген, CN, подходящей уходящей группы, или C1-6 алифатической группы, возможно содержащей в качестве заместителей оксогруппу, галоген, NO2 или CN, где:

Q представляет собой ковалентную связь, или бивалентную несыщенную или ненасыщенную, прямую или разветвленную, углеводородную цепь C1-6, где одна или две метиленовые единицы в составе Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO-, or-SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и

Z представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00174] В некоторых вариантах реализации, группы R1, R1', R2, R3, R4, и Rx формул V-a и V-b соответствуют описанному выше, а также описанию классов и подклассов соединений, приведенному в тексте настоящей заявки.

[00175] В некоторых вариантах реализации, группы R1 и R1' формулы V совместно образуют возможно содержащее заместители, 3-7-членное карбоциклическое кольцо. В некоторых вариантах реализации, такие соединения соответствуют формулам V-c и V-d

или предложены фармацевтически приемлемые соли таких соединений, где R2, R3, R4, R°, и Rx определены в описании к формулам V-a и V-b и соответствуют описаниям классов и подклассов, приведенному в тексте настоящей заявки.

[00176] В некоторых вариантах реализации, R° представляет собой, возможно содержащую заместители группу, выбранную из C1-6 алифатических групп. В других вариантах реализации, R° представляет собой винил.

[00177] Как в общих чертах определено в настоящем описании, в отношении формул V-a и V-b, R4 представляет собой -NHC(O)OR6. В некоторых вариантах реализации, R6 представляет собой возможно содержащую заместители группу, выбранную из С1-6 алифатических групп. В некоторых вариантах реализации, R6 представляет собой циклопентил.

[00178] Как в общих чертах определено в настоящем описании в отношении формул V-a и V-b, R2 представляет собой -N(R)2, каждый R независимо представляет собой водород, или, возможно содержащую заместители C1-6 алифатическую группу, или два R совместно с атомом азота, к которому они присоединены образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, R представляет собой, возможно содержащую заместители, C2-4 алифатическую группу. В некоторых вариантах реализации, R представляет собой метил.

[00179] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы VI-a или VI-b

или фармацевтически приемлемая соль указанного соединения, где:

R1 и R1' совместно образуют, возможно содержащее заместители, 3-7-членное карбоциклическое кольцо;

R2 представляет собой -N(R)2 или, возможно содержащую заместители группу, выбранную из, следующих: С3-7 циклоалкил, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород, или, возможно содержащую заместители, алифатическую группу C1-6, или два R совместно с атомом азота, которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу;

Rx и Ry совместно образуют возможно содержащее заместители, С3-7 карбоциклическое кольцо;

R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, или боковую цепь природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R5 представляет собой -N(R)2.

[00180] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы VI-a или VI-b, или фармацевтически приемлемая соль указанного соединения, где каждый R2, R3, R4, Rx, и Ry соответствует определенному выше, и где:

R3 представляет собой -L-Y, где:

L представляет собой ковалентную связь или бивалентную, насыщенную или не насыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или метиленовые единицы в составе L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-; -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(=S)-, -C(=NR)-, -N-N- ИЛИ -C(=N2)-;

Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2, или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное или частично ненасыщенное, или арильное кольцо, оодержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1 -4 группы Re; и

каждый R° независимо выбран из -Q-Z, оксогруппы, NO2, галогена, CN, подходящей уходящей группы, или C1-6 алифатической группы, возможно содержащей в качестве заместителей оксогруппу, галоген, NO2 или CN, где:

Q представляет собой ковалентную связь, или бивалентную насыщенную или не насыщенную, прямую или разветвленную, С1-6 углеводородную цепь, причем одна или две метиленовые единицы в составе Q могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO-, or-SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и

Z представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00181] В некоторых вариантах реализации, группы R1, R1', R2, R3, R4, Rx, и Ry формулы VI соответствуют описанию для формулы I а также описанию классов и подклассов, приведенному в настоящем описании.

[00182] Как определено в общем для соединений формул VI-a и VI-b, R4 представляет собой -NHC(O)R5, и R5 представляет собой -N(R)2, где каждый R представляет собой водород, возможно содержащую заместители, C1-6 алифатическую группу, или два R совместно с атомом азота, к которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

[00183] В некоторых вариантах реализации, каждый R независимо представляет собой водород или C1-6 алифатическую группу. В других вариантах реализации, каждый R независимо представляет собой водород или т-бутил.

[00184] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы VII-а или VII-b

или фармацевтически приемлемая соль указанного соединения, где

R1 и R1' независимо представляют собой водород или, возможно содержащую заместители, С1-6 алифатическую группу;

R2 представляет собой -N(R)2 или, возможно содержащую заместители группу, выбранную из следующих: С3-7 циклоалкил, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

каждый R независимо представляет собой водород, или, возможно содержащую заместители С1-6 алифатическую группу, или два R совместно с атомом азота, к которому они присоединены, образуют 4-7-членное гетероциклическое кольцо, содержащее 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R3 представляет собой головную группу;

Rx' и Rx связаны вместе с находящимися между ними атомами образуют, возможно содержащее заместители, спиро-соединенное 5-7-членное кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R4 представляет собой Н, ; боковую цепь природной или неприродной аминокислоты; или R4 и Rx совместно с находящимися между ними атомами образуют, возможно содержащее заместители, насыщенное или не насыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, которые независимо выбраны из азота, кислорода или серы;

R5 независимо представляет собой -N(R)2 или, возможно содержащую заместители группу, выбранную из следующих: C1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы; и

R7 представляет собой возможно содержащую заместители группу, выбранную из следующих: С1-6 алифатическая группа, связанный мостиком бицикл, 6-10-членный арил, 5-10-членный гетероарил, содержащий 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы.

[00185] Согласно некоторым вариантам реализации настоящего изобретения, предложено соединение формулы VII-а или VII-b или фармацевтически приемлемая соль указанного соединения, где каждый из R1, R1', R2, R3, R4, Rx, и Rx' соответствует определенному выше и где

R3 представляет -L-Y, где:

L представляет собой ковалентную связь или бивалентную, насыщенную или не насыщенную, прямую или разветвленную C1-8 углеводородную цепь, причем одна, две или три метиленовые единицы в составе L могут быть независимо замещены на циклопропилен, -NR-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2-, -SO2N(R)-, -O-, -C(O)-, -OC(O)-, -C(O)O-, -S-, -SO-, -SO2-, -C(-S)-, -C(-NR)-, -N=N- или -C(=N2)-;

Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN, или 3-10-членное моноциклическое или бициклическое, насыщенное или частично ненасыщенное, или арильное кольцо, содержащее 0-3 гетероатомов, которые независимо выбраны из азота, кислорода или серы, и где указанное кольцо содержит в качестве заместителей 1-4 группы Re; и

каждый Re независимо выбран из -Q-Z, оксогруппы, NO2, галогена, CN, подходящей уходящей группы или C1-6 алифатической группы, возможно содержащей в качестве заместителей оксогруппу, галоген, NO2 или CN, где

Q представляет собой ковалентную связь, или бивалентную насыщенную или не насыщенную, прямую или разветвленную, C1-6 углеводородную цепь, причем одна или две метиленовые единицы в составе Q, могут быть независимо замещены на -N(R)-, -S-, -O-, -С(O)-, -ОС(O)-, -С(O)O-, -SO-, or-SO2-, -N(R)C(O)-, -C(O)N(R)-, -N(R)SO2- или -SO2N(R)-; и

Z представляет собой водород или С1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN.

[00186] В некоторых вариантах реализации, группы R1, R1', R2, R3, Rx, и Rx' формул VII-a и VII-b соответствуют описанию для формулы I, а также описанию классов и подклассов, приведенному в тексте настоящей заявки.

[00187] В некоторых вариантах реализации, группа R5 соединений формул VII-a и VII-b представляет собой возможно содержащее заместители 5-10-членное карбоциклическое кольцо, содержащее 1-4 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, R5 представляет собой, возможно содержащее заместители 6-членное гетероарильное кольцо, содержащее 1-2 атомов азота. В некоторых вариантах реализации, R5 представляет собой пиперазинил.

[00188] В некоторых вариантах реализации, группа R7 соединений формул VII-a и VII-b представляет собой возможно содержащую заместители, C1-6 алифатическую группу. В некоторых вариантах реализации, R7 представляет собой разветвленную С 1-5 алкильную группу. В других вариантах реализации, R7 представляет собой циклопентил или циклогексил.

[00189] В некоторых вариантах реализации, группы Rx и Rx' формул VII-a и VII-b совместно образуют, возможно содержащее заместители, спиро-соединенное 5-7-членное кольцо, содержащее 0-2 гетероатомов, которые независимо выбраны из азота, кислорода или серы. В некоторых вариантах реализации, Rx и Rx' совместно образуют, возможно содержащее заместители, спиро-соединенное 5-6-членное кольцо, содержащее 1-2 гетероатомов, выбранных из -О- и -S-. В других вариантах реализации, Rx и Rx' совместно образуют

[00190] Согласно описанному в тексте настоящей заявки, в некоторых вариантах реализации, группа R4 в составе соединений формулы I представляет собой водород. Согласно некоторым вариантам реализации настоящего изобретения, предложены соединения формул VIII-a и VIII-b

Где каждая группа R1, R1', R2, R3, Rx и Rx' соответствует описанию для формулы I, a также описанию классов и подклассов, приведенному в тексте настоящей заявки.

[00191] Примеры соединений формулы I приведены в Таблице 3 ниже.

Таблица 3. Примеры Соединений формулы I

[00192] Согласно некоторым вариантам реализации настоящего изобретения, предложено любое из приведенных выше, в Таблице 3 соединений, или фармацевтически приемлемая соль указанного соединения.

[00193] Как было в общих чертах определено выше, R3 представляет собой головную группу. Вне привязок к какой-либо конкретной теории, считается, что указанные группы R3, т.е. головные группы, особенно подходят для ковалентного связывания ключевого остатка цистеина в области связывания протеазы ВГС. Обыкновенному специалисту в данной области известно, что протеаза ВГС и ее мутанты содержат в составе области связывания остаток цистеина. В некоторых вариантах реализации, соединения согласно настоящему изобретению содержат головную группу, благодаря свойствам которой указанные соединения могут вносить метку в остаток цистеина С159 протеазы ВГС. В некоторых вариантах реализации, соединения согласно настоящему изобретению содержат головную группу, благодаря свойствам которой указанные соединения остаток цистеина С16 протеазы ВГС.

[00194] Таким образом, в некоторых вариантах реализации, R характеризуется тем, что группа -L-Y способна ковалентно связываться с остатком цистеина, и, таким образом, необратимо ингибировать фермент. В некоторых вариантах реализации, остатком цистеина является Cys159 протеазы ВГС или ее мутанта, где нумерация остатков осуществляется согласно Uniprot (code Q91RS4).

[00195] Специалисту в данной области понятно, что для такого ковалентного связывания подходят различные головные группы, согласно определенному в настоящем описании. Такие группы R3 включают, но не ограничиваются описанными в тексте настоящей заявки и приведенными выше в Таблице 3. Указанный процесс осуществляли путем проведения масс-спектрометрических экспериментов согласно протоколу, подробно описанному ниже, в Примерах 24-27. Результаты указанного эксперимента приведены на Фигурах с 1 по 14, на которых показано, что соединения согласно изобретению ковалентно модифицируют Cys159 протеазы ВГС. Действительно, эти эксперименты показывают, что соединения согласно изобретению не осуществляют ковалентной модификации варианта ВГС C159S, и доказывают, таким образом, что ковалентной модификации подвергается именно остаток Cys159.

[00196] Согласно другому аспекту настоящего изобретения, предложен конъюгат, содержащий протеазу ВГС или ее мутант, ковалентно связанную с группой-ингибитором в области Cys159. В некоторых вариантах реализации, ингибитор ковалентно связывают при помощи линкерного участка.

[00197] Согласно некоторым вариантам реализации настоящего изобретения, предложен конъюгат состава Cys159-линкер-группа-ингибитор. Специалисту в данной области понятно, что "линкерная" группа (линкерный участок) соответствует головной группе -L-Y согласно описанному в настоящем тексте. Соответственно, в некоторых вариантах реализации, описание линкерного участка соответствует приведенному выше описанию для группы -L-Y. Тем не менее, понятно, что линкерный участок является бивалентным и, таким образом, соответствующая ему группа -L-Y также должна иметь валентность, равную двум, образовывающуюся в результате реакции головной группы с Cys16 протеазы ВГС или ее мутанта.

[00198] Термин "группа-ингибитор" относится к скелетной группе, связывающейся с активным центром протеазы ВГС. Такие скелетные группы хорошо известны в данной области и включают группы, описанные в патенте США №2006258868, патенте США №6642204, патенте США №7091184, патенте США №6642204, патенте США №7091184, патенте США №2006205638, патенте США №7189844, патенте США №2005267151, патенте США №7148347, WO 2007009227, патенте США №2007243166, патенте США №20070224167, патенте США №2006287248, патенте США №2006046956, патенте США №7253160, WO 2006122188, патенте США №2005143316, патенте США №7135462, патенте США №7132504, патенте США №6878722, патенте США №7041698, патенте США №6869964, патенте США №6995174, патенте США №6872805, патенте США №2007099825, патенте США №6867185, патенте США №2007010455, патенте США №2006199773, патенте США №7208600, патенте США №7273885, патенте США №7273851, патенте США №2007072809, патенте США №2006122123 и патенте США №20050267018.

[00199] В некоторых вариантах реализации, группа-ингибитор представляет собой соединение формулы А

где каждая из групп R1, R1, R2, R4, Rx, Rx', R4, и Ry формулы А соответствует определенному выше для формулы I и описанию классов и подклассов, приведенному в настоящем тексте. Таким образом, согласно некоторым вариантам реализации настоящего изобретения предложен конъюгат формулы

Где каждая из групп R1, R1', R2, R4, Rw, Rx, Rx', R4 и Ry в составе конъюгата соответствует приведенному выше описанию для формулы I, а также описанию классов и подклассов, приведенному в тексте настоящей заявки.

[00200] В некоторых вариантах реализации, R3 характеризуется тем, что группа -L-Y способна ковалентно связываться с остатком цистеина, и, таким образом осуществлять необратимое ингибирование фермента. В некоторых вариантах реализации, остатком цистеина является Cys16 протеазы ВГС или ее мутанта, где нумерация остатков осуществляется согласно Uniprot (code Q91RS4).

[00201] Согласно другому аспекту настоящего изобретения, предложен конъюгат, содержащий протеазу ВГС, или ее мутант, ковалентно связанную с ингибитором в области Cys16. В некоторых вариантах реализации, ковалентое связывание ингибитора осуществляют при помощи линкерного участка.

[00202] Согласно некоторым вариантам реализации настоящего изобретения, предложен конъюгат формулы Cys16-линкер-ингибитор. Специалисту в данной области понятно, что "линкерный" участок соответствует головной группе -L-Y согласно описанному в настоящем тексте. Соответственно, в некоторых вариантах реализации, описание линкерного участка соответствует приведенному выше описанию для группы -L-Y. Тем не менее, понятно, что линкерный участок является бивалентным и, таким образом, соответствующая ему группа -L-Y также должна иметь валентность, равную двум, образовывающуюся в результате реакции головной группы с Cys16 протеазы ВГС или ее мутанта.

[00203] В некоторых вариантах реализации, ингибитор имеет структуру формулы А-1

Где каждая из групп R1, R1', R2, R4, Rx, Rx', R4 и Ry формулы А-1 соответствует описанию, приведенному выше для формулы I, а также описанию классов и подклассов, приведеному в тексте настоящей заявки. Таким образом, согласно некоторым вариантам реализации настоящего изобретения, предложен конъюгат формулы

где каждая из групп R1, R1', R2, R4, Rw, Rx, Rx', R4 и Ry в составе конъюгата соответствует описанию, приведенному выше для формулы I, а также описанию классов и подклассов, приведеному в текстсе настоящей заявки.

[00204] Специалисту в данной области будет понятно, что некоторые соединения согласно изобретению являются обратимыми ингибиторами. Согласно некоторым вариантам реализации, указанные соединения удобны для применения в качестве соединений сравнения. В некоторых вариантах реализации, указанные обратимые ингибиторы полезны в качестве ингибиторов протеазы ВГС или ее мутанта, и, таким образом, полезны при лечении одного или более заболеваний, описанных в настоящем тексте. В некоторых вариантах реализации, указанные соединения являются обратимыми аналогами необратимых ингибиторов согласно изобретению. Например, соединение IR-3 (выше) является сравнительным аналогом соединения I-3.

[00205]

Общие способы получения Соединений согласно настоящему изобретению

[00206] Согласно некоторым вариантам реализации, соединения согласно настоящему изобретению в общем случае получают в соответствии со Схемой 1, приведенной ниже:

[00207] Согласно одному аспекту настоящего изобретения, предложены способы получения соединений формулы I в соответствии с этапами, указанными выше на Схеме 1, для которых определена и описана каждая переменная, и каждый PG является подходящей защитной группой. На этапе S-1, N-защищенное (например, Вос (трет-бутоксикарбонил)) производное пролина формулы А конденсируют с альфа-аминоэфиром формулы В в условиях сопряжения пептидов с получением дипептида формулы С. Подходящие условия сопряжения пептидов хорошо известны в данной области и включают условия, подробно описанные в РСТ № WO 2002094822 (US 6825347), содержимое которой полностью включено в настоящее описание посредством ссылки. За исключением случаев, оговоренных особо, в тексте настоящей заявки указанные условия будут считаться подходящими условиями сопряжения пептидов.

[00208] На этапе S-2, сложноэфирную группу подвергают гидролизу при помощи подходящего основания и затем нейтрализуют с получением дипептида формулы D. Подходящие основания включают, но не ограничиваются щелочными металлами, гидроксидами щелочноземельных металлов и их сочетаниями. В некоторых вариантах реализации, основанием является гидроксид лития.

[00209] На этапе S-3, осуществляют сопряжение дипептида формулы D с сульфонамидом формулы Е в подходящих условиях сопряжения пептидов с получением ацилсульфонамида формулы F.

[00210] На этапе S-4, посредством отщепления защитной группы (например, удаления Вос) от дипептида формулы F, получают амин формулы G. В некоторых вариантах реализации, отщепления группы Вос достигают путем взаимодействия соединения формулы F с неорганической или органической кислотой в галогенированном углеводородном растворителе. В некоторых вариантах реализации, в качестве кислоты применяют трифторуксусную кислоту, а растворителем является дихлорметан.

[00211] На этапе S-5, осуществляют сопряжение амина формулы G с карбоновой кислотой формулы Н в подходящих условиях сопряжения пептидов с получением промежуточного соединения формулы I-0.

[00212] Промежуточное соединение формулы I-0 превращают в соединения формулы I в ходе этапов, описанных в настоящем тексте в качестве примеров.

[00213], Как определено в общих чертах выше, группа PG формул А, С, D, и F является подходящей защитной аминогруппой. Подходящие защитные аминогруппы хорошо известны в данной области и включают группы, подробно описанные в Protecting Groups in Organic Synthesis, Т.W.Greene and P.G.M.Wuts, 3rd edition, John Wiley & Sons, 1999, описание которой полностью включено в настоящую заявку посредством ссылки. Защищенные амины хорошо известны в данной области и включают группы, подробно описанные в Greene (1999). Далее, подходящие монозащищенные амины включают, но не ограничиваются аралкиламинами, карбаматами, аллиламинами, амидами и им подобными. Примеры подходящих моно-защищенных аминогрупп включают следующие: т-бутилоксикарбониламино-(NHBOC), этилоксикарбониламино-, метилоксикарбониламино-, трихлорэтилоксикарбоксиламино-, аллилоксикарбониламино-(-NHAlloc), бензилоксикарбониламино- (-NHCBZ), аллиламино-, бензиламино- (-NHBn), фторэнилметилкарбонил-(-NHFmoc), формамидо-, ацетамидо-, хлорацетамидо, дихлорацетамидо-, трихлорацетамидо-, фенилацетамидо-, трифторацетамидо-, бензамидо-, т-бутилдифенилсилил и им подобные. Подходящие дизащищенные амины включают амины, содержащие два заместителя, независимо выбранные из заместителей, описанных выше для монозащищенных аминов, и, далее, включают циклические имиды, такие как фталимид, малеинимид, сукцинимид и им подобные.

[00214] Согласно другим вариантам реализации, соединения согласно настоящему изобретению получают в соответствии со Схемой 2, приведенной ниже.

[00215] Согласно одному аспекту настоящего изобретения, предложены способы получения соединений формулы I в соответствии с этапами, описанными выше на Схеме 1. На этапе S-6, производят удаление группы Вос из состава дипептида формулы С в условиях кислотного катализа с получением дипептидного эфира формулы J.

[00216] На этапе S-7, дипептидный эфир формулы J конденсируют с функционализированной аминокислотой формулы Н с применением подходящих условий сопряжения пептидов с получение трипептида формулы К, который далее преобразуют (конвертируют) в трипептидный эфир формулы L в ходе этапов, описанных в примерах в тексте настоящей заявки.

[00217] На этапе S-8, сложноэфирную группу в составе соединения формулы L подвергают гидролизу с подходящим основанием и затем нейтрализуют с получением трипептида формулы М. Подходящие основания включают, но не ограничиваются щелочными металлами, гидроксидами щелочноземельных металлов и их сочетаниями. В некоторых вариантах реализации, основанием является гидроксид лития.

[00218] На этапе S-9, трипептид формулы М конденсируют с сульфонамидом формулы Е с применением подходящих условий сопряжения пептидов с получением соединений формулы I.

[00219] Группа PG на формулах С, Н, и К представляет собой подходящую аминозащитную группу согласно описанному выше.

4. Применение, лекарственные формы и способы введения соединений согласно настоящему изобретению

Фармацевтически приемлемые композиции

[00220] Согласно еще одному варианту реализации изобретения, предложена композиция, содержащая соединение согласно изобретению или фармацевтически приемлемое производное указанного соединения, и фармацевтически приемлемый носитель, адъювант или растворитель. Количественное содержание указанного соединения в композициях согласно настоящему изобретению соответствует значительному ингибированию протеазы ВГС или ее мутанта в биологическом образце или в организме пациента. В некоторых вариантах реализации, количественное содержание указанного соединения в композициях согласно настоящему изобретению соответствует значительному ингибированию протеазы ВГС или ее мутанта в биологическом образце или в организме пациента. Согласно некоторым вариантам реализации настоящего изобретения, указанную композицию оформляют в лекарственную форму, предназначенную для введения пациенту, нуждающемуся в такой композиции. В некоторых вариантах реализации, композицию согласно настоящему изобретению оформляют в лекарственную форму, предназначенную для орального введения пациенту.

[00221] Термин "пациент", используемый в настоящем описании, относится к животному, предпочтительно - к млекопитающему, наиболее предпочтительно - к человеку.

[00222] Термин "фармацевтически приемлемый носитель, адъювант или растворитель" относится к не токсичному носителю, адъюванту или растворителю, не нарушающему фармакологическую активность соединения, содержащегося в составе лекарственной формы вместе с ним. Фарацевтически приемлемые носители, адъюванты или растворители, пригодные для применения в композициях согласно настоящему изобретению, включают, но не ограничиваются следующими примерами: иониты, окись алюминия, стерат алюминия, лецитин, белки сыворотки крови, такие как альбумин сыворотки человека, буферные вещества, такие как фосфаты, глицин, сорбиновая кислота, сорбат калия, смеси неполных глицеридов насыщенных растительных жирных кислот, вода, соли электролитов, такие как протаминсульфат, натрия фосфат двузамещенный, дикалийфосфат, натрия хлорид, соли цинка, коллоидная окись кремния, магния трисиликат, поливинил пирролидон, соединения на основе целлюлозы, полиэтиленгликоль, натрий-карбоксиметилцеллюлоза, полиакрилаты, воски, полиэтилен-полиоксипропилен-блок-полимеры, полиэтиленгликоль и ланолин.

[00223] Термин "фармацевтически приемлемое производное" относится к любой не токсичной соли, сложному эфиру, соли сложного эфира или другому производному соединения согласно настоящему изобретению, в результате введения пациенту способному образовать, прямо или опосредованно, соединение согласно изобретению, или обладающий ингибиторной активностью метаболит указанного соединения, или его остаток.

[00224] Термин "обладающий ингибиторной активностью метаболит, или его остаток", используемый в настоящем описании, означает, что метаболит или остаток метаболита также является ингибитором протеазы ВГС или ее мутанта.

[00225] Введение композиций согласно настоящему изобретению можно осуществлять оральным, парентеральным путем, ингаляцией, местно, ректальным, назальным путем, буккально, вагинально или посредством имплантируемой емкости. Значение термина "парентерально", используемого в настоящем описании, включает методики внутривенных, подкожных, внутримышечных, внутрисуставных, интрасиновиальных, интрастенальных, интратекальных, внутрипеченочных, внутричерепных инъекций и инфузий, и инъекций или инфузий в области пораженных тканей. Предпочтительно, композиции согласно настоящему изобретению вводят оральным, внутрибрюшинным или внутривенным путем. Стерильные лекарственные формы композиций согласно настоящему изобретению могут находиться в виде водной или масляной суспензии. Указанные суспензии можно оформлять в лекарственные формы в соответствии с методиками, известными в данной области, включающими применение подходящих диспергирующих агентов или увлажняющих агентов и суспендирующих агентов. Стерильный препарат, предназначенный для инъекции, также может представлять собой стерильный раствор для введения или суспензию в не токсичном, приемлемом для парентерального введения разбавителе или растворителе, например в виде раствора 1,3-бутандиола. В качестве приемлемых носителей и растворителей, пригодных для применения, можно использовать воду, раствор Рингера и изотонический раствор хлорида натрия. Также в качестве растворителя или суспендирующей среды можно применять стерильные жирные масла.

[00226] В этих целях можно применять любое мягкое жирное масло, включая синтетические моно- или диглицериды. Жирные кислоты, такие как масляная кислота и ее глицеридные производные, полезны в изготовлении лекарственных форм, предназначенных для инъекций, также как природное оливковое или касторовое масло, особенно в полиоксиэтилированных формах. Такие масляные растворы или суспензии также могут содержать растворитель или диспергирующее соединение на основе длинноцепочечного спирта, такие как карбоксиметилцеллюлоза, или сходные диспергирующие агенты, обычно применяемые при изготовлении фармацевтически приемлемой лекарственной формы, включая эмульсии и суспензии. Также при изготовлении лекарственной формы можно применять другие обычно используемые поверхностно-активные вещества, такие как Tweens, Spans и другие эмульгирующие агенты или вещества, повышающие биодоступность, обычно применяемые в производстве фармацевтически приемлемых растворимых, жидких и других лекарственных форм.

[00227] Введение фармацевтически приемлемых композиций согласно настоящему изобретению можно осуществлять оральным путем в любой лекарственной форме, приемлемой для орального введения, включая, но не ограничиваясь капсулами, таблетками, водными суспензиями или растворами. При выборе таблеток для орального применения обычно используемые носители включают лактозу и кукурузный крахмал. Также обычно добавляют смазочные агенты, такие как стеарат магния. Полезные разбавители при оральном введении капсул включают лакозу и сухой кукурузный крахмал. В случае, когда для орального применения требуются водные суспензии, активное соединение соединяют с эмульгирующими и суспендирующими агентами. По желанию, также возможно добавление определенных подслащивающих, вкусовых или окрашивающих агентов.

[00228] Также, фармацевтический приемлемые композиции согласно настоящему изобретению можно применять в форме суппозиториев (медицинских свечей), предназначенных для ректального введения. Указанную лекарственную форму можно изготовить путем смешивания агента с подходящим не вызывающим раздражения наполнителем, находящемся в твердой форме при комнатной температуре, и в жидкой форме при ректальной температуре, и, таким образом, растворяющемся в прямой кишке с высвобождением препарата. Такие вещества включают какао масло, пчелиный воск и полиэтиленгликоли.

[00229] Фармацевтически приемлемые композиции согласно настоящему изобретению также можно вводить местно, особенно в случаях, когда объект лечения включает области или органы, являющиеся легкодоступными при местном применении, включая заболевания глаз, кожи или нижних отделов пищеварительного тракта. Для каждой из указанных областей или органов существуют легкие в изготовлении лекарственные формы, предназначенные для местного применения.

[00230] Местное введение в нижние отделы пищеварительного тракта можно осуществлять в форме ректальных суппозиториев (см. выше), или в подходящей лекарственной форме для введения при помощи клизмы. Также можно использовать трансдермальные пластыри местного применения.

[00231] В случае местного применения, фармацевтически приемлемые композиции согласно изобретению можно изготавливать в форме подходящих мазей, содержащих активное соединение, суспендированное или растворенное в одном или более носителей. Носители, применимые при местном введении соединений согласно настоящему изобретению, включают, но не ограничиваются следующими: минеральное масло, вазелиновое масло, белый (медицинский) вазелин, пропиленгликоль, полиоксиэтилен, полиоксипропилен, эмульгирующий воск и вода. Также, фармацевтически приемлемые композиции согласно изобретению можно изготавливать в форме подходящих лосьонов или кремов, содержащих активные соединения, суспендированные, или растворенные в одном или более носителей. Подходящие носители включают, но не ограничиваются следующими примерами: минеральное масло, сорбитан моностерат, полисорбат 60, цетиловые эфиры восков, цетеариловый спирт, 2-октилдодеканол, бензиловый спирт и вода.

[00232] Для офтальмологического применения, фармацевтически приемлемые композиции согласно изобретению можно изготавливать в форме тонкодисперсных суспензий в изотонических растворах, стерильных солевых растворах с отрегулированным показателем рН, или, предпочтительно, в изотонических растворах, стерильных солевых растворах с отрегулированным показателем рН, как с консервантом, например, с хлоридом бензалкония, так и без него. Также, фармацевтически приемлемые композиции согласно настоящему изобретению, предназначенные для офтальмологического применения, можно изготавливать в форме мазей, таких как вазелин.

[00233] Фармацевтически приемлемые композиции согласно настоящему изобретению также можно вводить в форме назального аэрозоля или ингаляции. Указанные композиции изготавливают в соответствии с методиками, хорошо известными в области лекарственных форм в фармацевтике, путем разведения в солевом растворе, с применением бензилового спирта или других подходящих консервантов, агентов, способствующих абсорбции, для повышения биодоступности, фторуглеродов, и/или других подходящих агентов, повышающих растворимость, и диспергирующих агентов.

[00234] В наиболее предпочтительном варианте реализации, фармацевтически приемлемые композиции согласно настоящему изобретению изготавливают в лекарственной форме, предназначенной для орального введения. Указанные лекарственные формы можно вводить как одновременно с приемом пищи, так и вне зависимости от этого. В некоторых вариантах реализации, фармацевтически приемлемые композиции согласно настоящему изобретению вводят не одновременно с приемом пищи. В других вариантах реализации, фармацевтически приемлемые композиции согласно настоящему изобретению вводят одновременно с приемом пищи.

[00235] Количество соединений согласно настоящему изобретению, которое можно соединять с веществами-носителями с получением композиции для одноразовой дозировки, варьируется в зависимости от пациента, подвергаемого лечению, определенного режима введения. Предпочтительно, композиции согласно настоящего изобретению следует изготавливать таким образом, чтобы пациент получал дозу ингибитора, равную 0.01-100 мг/кг массы тела.

[00236] Также следует понимать, что определенная дозировка и режим лечения для каждого конкретного пациента зависят от множества факторов, включая активность конкретного применяемого соединения, возраста пациента, массы тела, общего состояния здоровья, пола, диеты, которой придерживается пациент, времени введения, степени развития заболевания, подвергаемого лечению. Также количественное содержание соединения согласно настоящему изобретению в составе композиции будет варьировать для каждого конкретного соединения.

Способы Применения Соединений и Фармацевтически Приемлемых Композиций

[00237] Соединения и композиции, описанные в тексте настоящей заявки, обычно являются полезными в целях ингибирования активности протеазы ВГС и/или мутантной формы указанного фермента. Таким образом, соединения согласно настоящему изобретению являются полезными для лечения гепатитов, отличных от гепатитов А и В, включая гепатит С.

[00238] ВГС является крайне вариабельным вирусом, образующим полиморфные группы вариантов в организме хозяина. К настоящему времени идентифицировано шесть различных генотипов по всему миру (Simmonds et al., Hepatology, Vol.42, No.4, 2005). Впоследствии эти генотипы классифицировали на более близкородственные, генетически выраженные подтипы. Участки последовательности, используемые при сравнении, известные как консенсусные последовательности, приведены ниже, в Таблице 3а. Генотипы и подтипы ВГС имеют различное распространение в разных частях мира, и в некоторых областях преобладают определенные генотипы. Генотипы 1-3 широко распространены по всему миру. Подтип 1а преобладает в Северной и Южной Америке, Европе и Австралии. Подтип 1b распространен в Северной Америке и Европе, и также встречается в некоторых областях Азии. Генотип 2 представлен в наиболее развитых странах, но он менее распространен, чем генотип 1 (http://www.hcvadvocate.org/hepatitis/factsheets_pdf/genotype_FS.pdf). Другие генотипы преобладают в популяциях бывших жителей США, и поэтому представляют собой важные мишени.

[00239] Примечателен тот факт, что цистеин в 159 аминокислотном положении в генотипе 1b является консервативным для всех генотипов и подтипов NS3 ВГС, секвенированных к настоящему времени, хотя в других генотипах и подтипах в этом положении может находиться другая аминокислота. Направленное присоединение ингибиторов по этому остатку цистеина дает возможность для развития агентов, обладающих эффективностью в отношении множества генотипов ВГС.

[00240] Как описано в тексте настоящей заявки, согласно настоящему изобретению предложены необратимые ингибиторы протеазы одного или более генотипов ВГС и их вариантов. Указанные соединения, содержащие головную группу, обозначенную как R3, включают соединения формул I, I-a, I-b, I-c-1, I-c-2, I-c-3, I-c-4, I-c-5, I-c-6, I-d, I-е, I-f, I-g, I-h, II-a, II-b, III-a, III-b, IV-a, IV-b, IV-c, IV-d, V-a, V-b, V-c, V-d, VI-a, VI-b, VII-a, VII-b, VIII-a, и VIII-b, согласно описанному в настоящем тексте. В некоторых вариантах реализации, R3 отличается тем, что группа -L-Y способна ковалентно связываться с остатком цистеина, и, таким образом, необратимо ингибировать фермент. Вне привязок к какой-либо конкретной теории, считается, что указанные группы R3, т.е. головные группы, особенно подходят для ковалентного связывания с ключевым остатком цистеина в области связывания протеазы одного или более генотипов ВГС или его вариантов. В некоторых вариантах реализации, один или более генотипов, протеаза которых подвергается ингибированию при взаимодействии с соединениями согласно изобретению, включают 1a, 1b, 2а, и 3а. В некоторых вариантах реализации, один или более таких вариантов включают А156Т, A156S, D168V, D168A, и R155K.

[00241] Обычному специалисту в данной области будет понятно, что протеаза различных генотипов ВГС и его вариантов содержит один или более остатков цистеина рядом с областью связывания. Вне привязок к какой-либо конкретной теории, считается, что соседство головной группы с остатком цистеина согласно настоящему изобретению усиливает ковалентную модификацию указанного цистеина при помощи головной группы. В некоторых вариантах реализации, остатком цистеина согласно настоящему изобретению является Cys159 протеазы ВГС подтипа 1b, или его варианта, нумерация остатков в соответствии с Uniprot (code Q91RS4). Остатки цистеина протеазы других генотипов и подтипов ВГС, которые возможно подвергнуть ковалентной модификации при помощи необратимых ингибиторов согласно настоящему изобретению, включают остатки, приведенные ниже, в Таблице 3а, где выделенное жирным шрифтом и подчеркнутое "С" относится к остатку цистеина, являющемуся консервативным в положении, эквивалентном Cys159 протеазы ВГС подтипа 1b.

Таблица 3а.
генотип/подтип ВГС Участок Типичной Последовательностиа ID Пациента Номер Последовательности
GHAVGLFRAAVCTRGVAKAV _.H77.NC004102 SEQ ID NO:1
GHAVGIFRAAVCTRGVAKAV CH.BID-V271.EU482858 SEQ ID NO:2
GHAVGIFRAAVCTRGVAKAV DE.BID-V25.EU482831 SEQ ID NO:3
GHAVGLFRAAVCTRGVAKAV US.H77-H21.AF011753 SEQ ID NO:4
1b GHAVGIFRAAVCTRGVAKAV AU.HCV-A.AJ000009 SEQ ID NO:5
1b GHVVGIFRAAVCTRGVAKAV CH.BID-V272.EU482859 SEQ ID NO:6
1b GHAVGIFRAAVCTRGVAKAV JP.HCV-BK.M58335 SEQ ID NO:7
GHAVGIFRAAVCTRGVAKAV ID.HC-G9.D14853 SEQ ID NO:8
GHVAGIFRAAVCTRGVAKAV IN.AY051292.AY051292 SEQ ID NO:9
GHAVGIFRAAVCSRGVAKSI JP.AY746460.AY746460 SEQ ID NO:10
GHAVGIFRAAVCSRGVAKSI JP.JCH-6.AB047645 SEQ ID NO:11
генотип/подтип ВГС Участок Типичной Последовательностиа ID Пациента Номер Последовательности
GHAVGIFRAAVCSRGVAKSI _.G2AK1.AF169003 SEQ ID NO:12
2b GHAVGLFRAAVCARGVAKSI JP.HC-J8.D10988 SEQ ID NO:13
2b GHAVGLFRAAVCARGVAKSI JP.MD2b1-2.AY232731 SEQ ID NO:14
GHAVGIFRAAVCSRGVAKSI _.BEBE1.D50409 SEQ ID NO:15
2i AHAVGIFRAAVCSRGVAKSI VN.D54.DQ155561 SEQ ID NO:16
2k GHAVGIFRAAICTRGAAKSI MD.VAT96.AB031663 SEQ ID NO:17
GHVAGIFRAAVCTRGVAKAL CH.452.DQ437509 SEQ ID NO:18
GHVAGIFRAAVCTRGVAKAL DE.HCVCENS1.X76918 SEQ ID NO:19
GHVAGIFRAAVCTRGVAKAL ID.ps23.EU315121 SEQ ID NO:20
3b GHVMGIFIAVVCTRGVAKAL IN.RG416.DQ284965 SEQ ID NO:21
3b GHVVGIFRAAVCTRGVAKAL JP.HCV-Tr.D49374 SEQ ID NO:22
3k GHVAGIFRAAVCTRGVAKAL ID.JK049.D63821 SEQ ID NO:23
GHAAGIFRAAVCTRGVAKAV EG.Eg9.DQ988077 SEQ ID NO:24
GHAAGLFRAAVCTRGVAKAV _.01-09.DQ418782 SEQ ID NO:25
GHAAGLFRAAVCTRGVAKAV _.F753.DQ418787 SEQ ID NO:26
4d GHAAGIFRAAVCTRGVAKAV _.03-18.DQ418786 SEQ ID NO:27
4d GHAAGIFRAAVCTRGVAKTV _.24.DQ516083 SEQ ID NO:28
4f GHAVGIFRAAVCTRGVAKAV FR.IFBT84.EF589160 SEQ ID NO:29
4f GHAVGIFRAAVCTRGVAKAV FR.IFBT88.EF589161 SEQ ID NO:30
5a GHVVGVFRAAVCTRGVAKAL GB.EUH1480.Y13184 SEQ ID NO:31
5a GHVVGVFRAAVCTRGVAKAL ZA.SA13.AF064490 SEQ ID NO:32
6a GHVVGLFRAAVCTRGVAKSL HK.6a74.DQ480524 SEQ ID NO:33
6a GHVVGLFRAAVCTRGVAKSL HK.6a77.DQ480512 SEQ ID NO:34
6a GHVVGLFRAAVCTRGVAKSL HK.EUHK2.Y12083 SEQ ID NO:35
6b GHVVGLFRAAVCTRGVAKAL _.Th580.NC009827 SEQ ID NO:36
6c GHVVGLFRAAVCTRGVAKAL TH.Th846.EF424629 SEQ ID NO:37
6d DHVVGLFRAAVCTRGVAKAL VN.VN235.D84263 SEQ ID NO:38
6e GHVVGLFRAAVCTRGVAKAI CN.GX004.DQ314805 SEQ ID NO:39
6f GHAVGIFRAAVCTRGVAKAI TH.C-0044.DQ835760 SEQ ID NO:40
6f GHAVGIFRAAVCTRGVAKAI TH.C-0046.DQ835764 SEQ ID NO:41
генотип/подтип ВГС Участок Типичной Последовательности" ID Пациента Номер Последовательности
6g GHVVGLFRAAVCTRGVAKAL HK.HK6554.DQ314806 SEQ ID NO:42
6g GHVVGLFRAAVCTRGVAKAL ID.JK046.D63822 SEQ ID NO:43
6h GHVAGIFRAAVCTRGVAKSL VN.VN004.D84265 SEQ ID NO:44
6i GHVAGIFRAAVCTRGVAKSL TH.C-0159.DQ835762 SEQ ID NO:45
6j GHVAGIFRAAVCTRGVAKSL TH.C-0667.DQ835761 SEQ ID NO:46
6j GHVAGIFRAAVCTRGVAKSL TH.Th553.DQ835769 SEQ ID NO:47
6k GHVAGIFRAAVCTRGVAKSL CN.KM41.DQ278893 SEQ ID NO:48
6k GHVAGIFRAAVCTRGVAKSL CN.KM45.DQ278891 SEQ ID NO:49
6k GHVAGIFRAAVCTRGVAKSL VN.VN405.D84264 SEQ ID NO:50
6l GHVAGIFRAAVCTRGVAKSL US.537796.EF424628 SEQ ID NO:51
6m GHAVGVFRAAVCTRGVAKSL TH.C-0185.DQ835765 SEQ ID NO:52
6m GHAVGVFRAAVCTRGVAKSL TH.C-0208.DQ835763 SEQ ID NO:53
6n GHVVGIFRAAVCTRGVAKSL CN.KM42.DQ278894 SEQ ID NO:54
6n GHVVGIFRAAVCTRGVAKSL TH.D86/93.DQ835768 SEQ ID NO:55
60 GHAVGLFRAAVCTRGVAKAI CA.QC227.EF424627 SEQ ID NO:56
6p GHVVGLFRAAVCTRGVAKAI CA.QC216.EF424626 SEQ ID NO:57
6q GHAVGLFRAAVCTRGVAKAI CA.QC99.EF424625 SEQ ID NO:58
6t GHVVGLFRAAVCTRGVAKAI VN.TV241.EF632069 SEQ ID NO:59
6t GHVVGLFRAAVCTRGVAKAI VN.TV249.EF632070 SEQ ID NO:60
6t GHVVGLFRAAVCTRGVAKAI VN.VT21.EF632071 SEQ ID NO:61
7a SHCVGIFRAAVCTRGVAKAV CA.QC69.EF108306 SEQ ID NO:62
аОбыкновенному специалисту в данной области будет понятно, что любой вирус подвержен мутациям и склонен к полиморфизму, и любая из консенсусных последовательностей генотипов, описанных в настоящем тексте, являются типичными для каждого данного генотипа или подтипа. Указанные типичные консенсусные последовательности доступны на http://hcv.lanl.gov/content/sequence/NEWALIGN/align.html.

[00242] Устойчивость к лекарственным препаратам становится серьезной проблемой для направленной терапии. Например, сообщается о развитии устойчивости к ингибиторам протеазы ВГС, находящихся в стадии разработки. Указанные соединения включают BILN 2061 и VX-950, разработанные Boehringer Ingelheim and Vertex Pharmaceuticals, соответственно. Химическая структура BILN 2061 и VX-950 приведена ниже.

[00243] Известно, что недавняя статья, опубликованная Vertex Pharmaceuticals, озаглавленная "In Vitro Resistance Studies of Hepatitis С Virus Serine Protease," обращается непосредственно к проблеме устойчивости мутантов, наблюдаемой у VX-950 и BILN 2061. См. Lin et al., The Journal of Biological Chemistry, Vol.279, No.17, Issue of April 23, pp.17508-17514, 2004. В указанной статье приведено заключение о том, что "будующая терапия, направленная на лечение гепатита С, включающая применение низкомолекулярных ингибиторов ферментов ВГС, может потребовать сочетания нескольких лекарственных препаратов, как в случае со способами лечения ВГС, применяемыми в настоящее время." См. страницу 17513, последний параграф.

[00244] Устойчивость к специфическим противовирусным препаратам является основным фактором, ограничивающим эффективность многих способов терапии, направленной против ретровирусов или РНК-содержащих вирусов. Способствующая ошибкам природа таких вирусов допускает возникновение мутаций, повышающих устойчивость к препаратам, доступным в настоящее время, и препаратам, проходящим клинические испытания. Проблема возникновения устойчивости является основным препятствием, которое встречают при разработке новых ВГС-специфичных ингибиторов, предназначенных для лечения пациентов с ВГС.

[00245] В ходе недавнего in vitro исследования устойчивости с использованием двух ингибиторов протеазы ВГС NS3-4A, VX-950 и BILN 2061, было обнаружено, что мутации, отобранные при действии как первого, так и второго ингибитора, вели к значительному снижению чувствительности к самому ингибитору. Тем не менее, первичные устойчивые мутанты к BILN 2061 обладали полной чувствительностью к VX-950, и вирусы, несущие главную мутацию устойчивости к VX-950, оставались чувствительны к BILN 2061 (Lin et al., Jour. Biol. Chem. 279 (17): 17508-14, 2004).

[00246] К нашему удивлению, было обнаружено, что соединения согласно настоящему изобретению ингибируют протеазу, по меньшей мере, пяти мутантов ВГС, включая А156Т, A156S, D168V и D168A и R155K. Этот факт контрастирует со свойствами других ингибиторов протеазы ВГС (например, VX-950 и BILN 2061), каждый из которых ингибирует протеазу только двух мутантов. Фактически, ни один из лекарственных препаратов, описанных на известном уровне техники, не показал эффективного ингибирования протеазы всех известных мутантов ВГС. Примером могут служить данные для BILN 2061 и VX-950, приведенные ниже, в Таблицах 4а и 4b, опубликованные Lin et al., а также в другой литературе по ВГС, и данные для соединения 1-3, полученные в соответствии со способами, описанными ниже, в Примерах. Вне привязок к какой-либо конкретной теории, считается, что соединения согласно настоящему изобретению могут служить эффективными ингибиторами протеазы ВГС устойчивых к лекарственным препаратам форм. В то время, как Таблица 4b демонстрирует активность соединения 1-3, направленную против трех референтных вариантов ВГС (AL56T, A156S, D168V, и D168A), следующие примеры описывают другие соединения согласно изобретению, обладающие активностью против указанных вариантов, а также против пятого варианта ВГС (R155K).

Таблица 4а.
Сравнительные Значения Ki (нМ)a
BILN 2061 VX-950
WT 19 100
А156Т >1200 9900
A156S 112 2900
D168V >1200 43
D168A >1200 150
аДанные для дикого типа были получены в ходе клеточных анализов, а данные для мутантов были получены при помощи биохимических методов анализа. См. Lin et al. и протоколы, приведенные в настоящем описании.
Таблица 4b.
Сравнительные Значения Ki (нМ)a
N 2061 VX-950 Соединение 1-3
WT 4 402 20
A156T - - 18
A156S 7 4650 1
D168V 5090 163 77
D168A 1860 193 45
аДанные для дикого типа были получены в ходе проведения клеточных анализов, а данные для мутантов были получены при помощи биохимических методов анализа. См. Lin et al. и протоколы, приведенные в настоящем описании.

[00247] Вне привязки к какой-либо конкретной теории, считают, что соединение формулы I является более эффективным для ингибирования нротеазы ВГС или мутантной формы указанного фермента, по сравнению с соответствующим соединением формулы I, в составе которого группа R3 формулы I не является головной группой, а представляет собой, например, неразветвленный алкил (например, алкил, не содержащий заместителей), разветвленный алкил, циклоалкил или алкенил. Например, соединение формулы I может являться более эффективным для ингибирования протеазы ВГС или ее мутанта, в сравнении с соответствующим соединением формулы I, в составе которого группа R3 формулы I не является головной группой, а представляет собой метил, этил, пропил, бутил (например, т-бутил), неразветвленный или разветвленный алкенил, не содержащий заместителей (например, C1-8 алкенил), циклогексил или циклопентил.

[00248] Соединение формулы I, как было описано выше, может обладать большей активностью, исходя из значений IC50, направленной против протеазы ВГС или мутантной формы указанного фермента, например A156T, A156S, D168V, D168A, или других мутантов, таких как описанные в тексте настоящей заявки, чем соответствующее соединение формулы I, в составе которого группа R3 формулы I не является головной группой, а представляет собой метил, этил, пропил, бутил (например, t-бутил), неразветвленный или разветвленный алкенил, не содержащий заместителей (например, C1-8 алкенил), циклогексил или циклопентил. Такую сравнительную активность соединения формулы I относительно соответствующего соединения формулы I, в составе которого группа R3 формулы I не является головной группой, можно определить при помощи стандартных зависимых от времени методов анализа, например, описанных ниже, в Примерах. В некоторых вариантах реализации, соединение формулы I является значительно более активным, чем соответствующее соединение формулы I, в составе которого группа R3 формулы I не является головной группой, а представляет собой метил, этил, пропил, бутил (например, т-бутил), неразветвленный или разветвленный алкенил, не содержащий заместителей (например, C1-8 алкенил), циклогексил или циклопентил. В некоторых вариантах реализации, соединение формулы I является значительно более активным, где активность соединения измеряют через приблизительно 1 минуту, приблизительно 2 минуты, приблизительно 5 минут, приблизительно 10 минут, приблизительно 20 минут, приблизительно 30 минут, приблизительно 1 час, приблизительно 2 часа, приблизительно 3 часа, приблизительно 4 часа, приблизительно 8 часов, приблизительно 12 часов, приблизительно 16 часов, приблизительно 24 часа или приблизительно 48 часов, относительно соответствующего соединения формулы I, в составе которого группа R3 формулы I не является головной группой, а представляет собой метил, этил, пропил, бутил (например, т-бутил), неразветвленный или разветвленный алкенил, не содержащий заместителей (например, алкенил C1-8), циклогексил, или циклопентил. В некоторых вариантах реализации, соединение формулы I может обладать активностью в приблизительно 1.5 раза, приблизительно 2 раза, приблизительно 5 раз, приблизительно 10 раз, приблизительно 20 раз, приблизительно 25 раз, приблизительно 50 раз, приблизительно 100 раз или даже приблизительно в 1000 раз большей, чем соответствующее соединение формулы I, в составе которого группа R3 формулы I не является головной группой, а представляет собой метил, этил, пропил, бутил (например, т-бутил), неразветвленный или разветвленный алкенил, не содержащий заместителей (например, алкенил C1-8), циклогексил или циклопентил.

[00249] Термин "клиническая устойчивость к лекарственным препаратам", используемый в настоящем описании, относится к потере мишенью лекарственного препарата чувствительности к лечению указанным препаратом вследствие мутации мишени препарата.

[00250] Термин "устойчивость", используемый в настоящем описании, относится к изменениям в последовательности нуклеиновой кислоты дикого типа, кодирующей белок-мишень, и/или в белковой последовательности мишени, когда указанные изменения снижают или сводят к нулю ингибиторную активность в отношении белка-мишени.

[00251] Примеры протеаз, подвергаемых ингибированию соединениями и композициями согласно изобретению, и для ингибирования активности которых полезны способы, описанные в тексте настоящей заявки, включают NS3, NS3-4A или их мутантные формы.

[00252] Активность соединения, применяемого согласно настоящему изобретению в качестве ингибитора протеаз NS3, NS3'4A или их мутантных форм, можно исследовать in vitro, in vivo или при помощи линии клеток. Способы анализа in vitro включают анализы, в ходе которых определяют ингибирование активности сериновой протеазы, и/или последующие функциональные последствия, или активность АТФазы активированных NS3, NS3·4A или их мутантных форм. Другие способы анализа in vitro включают-измерение способности ингибитора связываться с NS3 или NS3·4A. Связывание ингибитора можно измерять при помощи внесения радиоактивной метки в состав ингибитора перед связыванием, выделения комплекса ингибитор/NS3 или ингибитор/NS3·4A и определения количества связей, содержащих радиоактивную метку. Также, связывание ингибитора можно определить при помощи конкурентного анализа, в ходе которого новые ингибиторы инкубируют с NS3 или NS3·4A, связанными с известными лигандами с радиоактивной меткой. Подробное описание условий для исследования соединения, применяемого, согласно настоящему изобретению, в качестве ингибитора NS3 или NS3·4A или их мутантных форм, приведено ниже, в Примерах.

[00253] Сериновые протеазы составляют большое семейство протеолитических ферментов, расщепляющих пептидные связи в составе белков. Семейство сериновых протеаз включает пищеварительные ферменты химотрипсин, трипсин и эластазу и протеазы, играющие роль в свертывании крови. Сериновые протеазы обладают свойством "каталитической триады", включающей серин, аспарагиновую кислоту и гистидин, которые совместным действием активируют серин с образованием ковалентной связи с субстратом фермента, проводя, таким образом, гидролиз пептидной связи. В дополнение к указанному выше, сериновые протеазы принимают участие во многих функциях, включая иммунитет и воспалительные процессы.

[00254] Термины "лечение", "подвергать лечению" и "лечить", используемые в настоящем описании, относятся к обращению вспять течения болезни, облегчению симптомов, отсрочиванию приступов, или препятствованию развитию болезни или нарушения, или одного или более симптомов, согласно описанному в тексте настоящей заявки. В некоторых вариантах реализации, лечение можно назначить после развития одного или более симптомов. В других вариантах реализации, лечение можно назначить в отсутствие симптомов. Например, реципиенту можно назначить лечение до появления симптомов (например, в свете истории болезни и/или в свете генетических или других предрасполагающих факторов). Также лечение можно продолжать после устранения симптомов, например, в целях предотвращения или отсрочки рецидива.

[00255] Соединения и композиции, в соответствии со способами согласно настоящему изобретению, можно вводить в любой дозировке и с применением любого режима введения, являющимися эффективными для лечения или ослабления тяжести рака, аутоиммунного заболевания, нейродегенеративного или нейрологического заболевания, шизофрении, заболеваний костей, печени или заболевания сердца. Точные дозировки, требуемые для лечения конкретного пациента, будут варьироваться в зависимости от биологического вида, возраста, и общего состояния здоровья пациента, тяжести инфекции, конкретного соединения, режима его введения и других факторов. Соединения согласно настоящему изобретению, предпочтительно, изготавливают в стандартной лекарственной форме, характеризующейся легкостью при введении и универсальностью дозировки. Выражение "стандартная лекарственная дозировка", используемое в настоящем описании, относится к отдельной, в физическом плане, единице соединения, соответствующей курсу лечения пациента. Тем не менее, следует понимать, что общий дневной объем вводимых соединений и композиций согласно настоящему изобретению должен определяться в ходе посещения терапевта, в рамках здравого смысла, с медицинской точки зрения. Специфичный для каждого конкретного пациента или организма уровень дозировки зависит от множества факторов, включая заболевание, подвергаемое лечению и его степень тяжести; активность конкретного применяемого соединения; возраст, массу тела, общее состояние здоровья, пол и диету, которой придерживается пациент; время введения, режим введения, степень выведения конкретного применяемого соединения; длительность лечения; лекарственные препараты, применяемые в сочетании с соединением, или употребление которых совпадает с конкретным применяемым соединением, и другие факторы, хорошо известные в медицинских областях. Термин "пациент", используемый в настоящем описании, относится к животному, предпочтительно, млекопитающему, и наиболее предпочтительно - к человеку.

[00256] Введение фармацевтически приемлемых композиций согласно настоящему изобретению можно осуществлять в организм человека и других животных оральным, ректальным, парентеральным, интрацистернальным, внутривагинальным, внутрибрюшинным путем, местно (например, в форме порошков, мазей или капель), буккально, например в форме орального или назального спрея, и другими путями, в зависимости от тяжести инфекции, подвергаемой лечению. В некоторых вариантах реализации, соединения согласно настоящему изобретению можно вводить оральным или парентеральным путем в дозах, составляющих приблизительно от 0.01 мг/кг до приблизительно 50 мг/кг и, предпочтительно, от приблизительно 1 мг/кг до приблизительно 25 мг/кг массы тела пациента в день, один или более раза в день, в целях достижения желаемого терапевтического эффекта.

[00257] В некоторых вариантах реализации, композицию согласно настоящему изобретению вводят пациенту, нуждающемуся в ней, один раз в день ежедневно. Вне привязок к какой-либо конкретной теории, считается, что увеличенная продолжительность действия необратимого ингибитора протеазы ВГС NS3 является особым преимуществом при ежедневном введении пациенту, нуждающемуся в нем, по одному разу в день, ежедневно, для лечения заболевания, ассоциированного с протеазой ВГС. В некоторых вариантах реализации, композицию согласно настоящему изобретению вводят пациенту, нуждающемуся в ней, по меньшей мере, один раз в день, ежедневно. В других вариантах реализации, композицию согласно настоящему изобретению вводят пациенту, нуждающемуся в ней, два, три, или черыре раза в день, ежедневно.

[00258] Соединения формулы I, например, обычно обеспечивают увеличенную продолжительность действия при введении пациенту, в сравнении с соответствующим соединением формулы I, в составе которого вместо головной группы содержится такая группа, как неразветвленный алкил (например, не содержащий заместителей алкил), разветвленный алкил, циклоалкил или алкенил. Например, соединение формулы I может обеспечить увеличенную продолжительность действия при введении пациенту, в сравнении с соответствующим соединением формулы I, в составе которого группа R формулы I вместо головной группы представляет собой такую группу, как метил, этил, пропил, бутил (например, т-бутил), не содержащий заместителей неразветвленный или разветвленный алкенил (например, C1-8 алкенил), циклогексил или циклопентил.

[00259] Жидкие лекарственные формы, предназначенные для орального введения, включают, но не ограничиваются фармацевтически приемлемыми эмульсиями, микроэмульсиями, растворами, суспензиями, сиропами и эликсирами. В дополнение к действующим веществам, жидкие лекарственные формы могут содержать инертные разбавители, обычно используемые в данной области, такие как, например, вода или другие растворители, солюбилизирующие агенты и эмульсификаторы, такие как этиловый спирт, изопропиловый спирт, этиловый эфир угольной кислоты, этил ацетат, бензиловый спирт, бензил бензоат, пропиленгликоль, 1,3-бутиленгликоль, диметилформамид, масла (в частности, хлопковое, арахисовое, кукурузное, масло проростков пшеницы, оливковое, касторовое и кунжутное масла), глицерол, тетрафторфурфуриловый спирт, полиэтиленгликоли и сложные эфиры сорбитана и жирных кислот и их смеси. Помимо инертных разбавителей, композиции, предназначенные для орального введения, также могут содержать адъюванты, такие как увлажняющие агенты, эмульгирующие и суспендирующие агенты, подслащивающие, вкусовые и ароматические агенты.

[00260] Лекарственные формы, предназначенные для введения путем инъекции, например стерильные суспензии на водной или масляной основе, предназначенные для инъекций, можно изготавливать согласно способам, известным в данной области, при применении соответствующих диспергирующих или увлажняющих или суспендирующих агентов. Стерильная лекарственная форма, предназначенная для инъекции, также может представлять собой раствор для инъекции, суспензию или эмульсию в не токсичном парентерально приемлемом разбавителе или растворителе, например раствор в 1,3-бутандиоле. Среди приемлемых носителей и растворителей можно перечислить следующие примеры: вода, раствор Рингера, U.S.P. и изотонический раствор натрия хлорида. Также в качестве растворителя или суспендирующей среды успешно применяют жирные масла. Для этой цели можно применять любое жирное масло мягкой консистенции, включая синтетические моно- или диглицериды. Также, при изготовлении лекарственных форм, предназначенных для инъекции, применяют жирные кислоты, такие как масляная кислота.

[00261] Стерилизацию лекарственных форм, предназначенных для инъекций, можно проводить, например, при помощи фильтрации через задерживающий бактерии фильтр, или путем заключения стерилизующих агентов в форму стерильных твердых композиций, которые возможно растворить или диспергировать перед применением в стерильной воде или в других стерильных средах, приемлемых для инъекций.

[0001] В целях продления действия соединения согласно настоящему изобретению, часто желаемым является замедление всасывания соединения при введении подкожной или внутримышечной инъекции. Этого можно достичь путем применения жидкой суспензии, соединения в кристаллической или аморфной форме, обладающей низкой растворимостью в воде. Далее, степень всасывания соединения зависит от скорости растворения соединения, которая, в свою очередь, может находиться в зависимости от размера кристаллов и их формы. Также, как вариант, замедленного всасывания соединения, вводимого парентеральным путем, можно достичь путем растворения или суспендирования соединения в масляном носителе. Лекарственные формы соединений с замедленным высвобождением, предназначенные для инъекции, получают путем изготовления микроинкапсулированных форм соединения в биодеградируемых полимерах, таких как полилактид-полигликолид. В зависимости от соотношения соединения и полимера и природы конкретного применяемого полимера можно контролировать уровень высвобождения соединения. Примеры других биодеградируемых полимеров включают поли-ортоэфиры и поли-ангидриды. Лекарственные формы соединений с замедленным высвобождением, предназначенные для инъекции, также изготавливают путем помещения действующего соединения в липосомы или микроэмульсии, совместимые с тканями тела.

[00262] Композиции, предназначенные для ректального или вагинального введения, предпочтительно представляют собой суппозитории, которые можно изготавливать путем смешивания соединений согласно настоящему изобретению с подходящими не вызывающими раздражения наполнителями или носителями, такими как какао масло, полиэтиленгликоль или воск для суппозиториев, находящимися в твердом состоянии при комнатной температуре и переходящими в жидкое состояние при температуре тела и, таким образом, растворяющимися в прямой кишке или вагинальном пространстве с высвобождением действующего соединения.

[00263] Твердые лекарственные формы, предназначенные для орального введения, включают капсулы, таблетки, пилюли, порошки и гранулы. В составе указанных твердых лекарственных форм действующее соединение смешивают, по меньшей мере, с одним инертным, фармацевтически приемлемым наполнителем или носителем, таким как цитрат натрия или дикальций фосфат, и/или а) с наполнителями, такими как крахмал, лактоза, сахароза, маннитол, и кремниевая кислота, b) со связующими веществами, такими как, например, карбоксиметилцеллюлоза, альгинаты, желатин, поливинилпирролидинон, сахароза и камедь, с) с гигроскопическими веществами, такими как глицерол, d) с дизинтегрирующими агентами, такими как агар-агар, карбонат кальция, картофельный или крахмал из кассавы, альгиновая кислота, отдельные силикаты и карбонат натрия, е) с агентами, замедляющими растворение, такими как парафин, f) с ускорителями всасывания, например, с четвертичными аммонийными соединениями, g) с увлажняющими агентами, такими как, например, цетиловый спирт и глицеролмоностеарат, h) с абсорбентами, например, с каолином и бентонитовой глиной, и i) с лубрикантами, такими как тальк, стеарат кальция, стеарат магния, твердые полиэтиленгликоли, лаурилсульфат натрия, и смесями указанных соединений. В случае капсул, таблеток и пилюль лекарственная форма также может содержать буферные вещества.

[00264] Подобные твердые композиции также можно применять в качестве наполнения в мягких и твердых желатиновых капсулах, с использованием таких наполнителей, как лактоза или молочный сахар, или высокомолекулярные гликоли и подобные им соединения. Твердые лекарственные формы, такие как таблетки, драже, капсулы, пилюли и гранулы, возможно изготавливать с покрытиями и оболочками, такими как энтеросолюбильные покрытия и другие покрытия, хорошо известные в области фармацевтической продукции. Возможно, они могут включать контрастные вещества, и их можно изготавливать таким образом, чтобы действующее соединение (соединения) высвобождались исключительно, или предпочтительно, в определенной части пищеварительного тракта, возможно, с замедленным характером высвобождения. Примеры композиций согласно настоящему изобретению, подходящих для применения, включают полимерные соединения и воски. Подобные композиции в твердой форме также возможно применять в качестве фильтров в мягких и твердых желатиновых капсулах, с использованием таких наполнителей, как лактоза или молочный сахар, или высокомолекулярных гликолей и подобных им соединений.

[00265] Действующие соединения также могут находиться в микроинкапсулированной форме, с одним или более наполнителем, согласно описанному выше. Твердые лекарственные формы, такие как таблетки, драже, капсулы, пилюли и гранулы, возможно изготавливать с покрытиями и оболочками, такими как энтеросолюбильные покрытия, покрытия с контролируемым высвобождением и другими покрытиями, хорошо известными в области фармацевтических препаратов. В указанных твердых лекарственных формах действующее соединение можно смешивать, по меньшей мере, с одним инертным растворителем, таким как сахароза, лактоза или крахмал. Указанные лекарственные формы также могут содержать, в соответствии с обычной практикой, другие дополнительные агенты, помимо инертных растворителей, например лубриканты и другие вспомогательные агенты, применяемые при изготовлении таблеток, например стеарат магния и микрокристаллическая целлюлоза. В случае капсул, таблеток и пилюль, лекарственные формы могут также содержать буферные вещества. Возможно, они могут включать контрастные вещества, и их можно изготавливать таким образом, чтобы действующее соединение (соединения) высвобождались исключительно, или предпочтительно, в определенной части пищеварительного тракта, возможно, с замедленным характером высвобождения. Примеры композиций согласно настоящему изобретению, подходящих для применения, включают полимерные соединения и воски.

[00266] Лекарственные формы соединений согласно настоящему изобретению, предназначенные для местного или чрескожного введения, включают мази, пасты, крема, лосьоны, гели, присыпки, растворы, спреи, ингаляторы или пластыри. Действующее соединение смешивают с фармацевтически приемлемым носителем и любыми консервантами или буферами, если это требуется. Лекарственные формы для офтальмологического применения, ушные капли и глазные капли также входят в объем настоящего изобретения. Также, согласно настоящему изобретению, предложено применение чрескожных пластырей, имеющих дополнительное преимущество, состоящее в контролируемом высвобождении соединения в организме. Указанные лекарственные формы можно изготавливать путем растворения или диспергирования соединения в подходящей среде. Также для повышения поступления соединения через кожу можно применять усилители абсорбции. Ее уровень можно контролировать как путем использования мембраны, предназначенной для этой цели, так и путем диспергирования соединения в полимерном матриксе или геле.

[00267] Согласно одному варианту реализации, настоящее изобретение относится к способу ингибирования сериновой протеазы в биологическом образце, включающему этап приведения в контакт биологического образца и соединения согласно настоящему изобретению или композиции, содержащей указанное соединение.

[00268] Согласно другому варианту реализации, настоящее изобретение относится к способу ингибирования активности протеазы ВГС или мутантной формы указанного фермента в биологическом образце, включающему этап приведения в контакт указанного биологического образца и соединения согласно настоящему изобретению или композиции, содержащей указанное соединение. В отдельных вариантах реализации, настоящее изобретение относится к способу необратимого ингибирования активности протеазы ВГС или мутантной формы указанного фермента, в биологическом образце, включающему этап приведения в контакт указанного биологического образца и соединения согласно настоящему изобретению или композиции, содержащей указанное соединение.

[00269] Значение термина "биологический образец", используемого в настоящем описании, включает, без ограничений, культуры клеток или их экстракты; материал биопсии, полученный от млекопитающих, или его экстракты; а также образцы крови, слюны, мочи, кала, спермы, слезной жидкости или других жидкостей организма или их экстракты.

[00270] Ингибирование активности протеазы ВГС или мутантной формы указанного фермента в биологическом образце является полезным для многих целей, известных специалистам в данной области. Примеры указанных целей включают, но не ограничиваются переливанием крови, трансплантацией органов, хранением биологических образцов и биологическими анализами.

[00271] В другом варианте реализации настоящее изобретение относится к способу ингибирования активности протеазы ВГС или мутантной формы указанного фермента в организме пациента, включающему этап введения указанному пациенту соединения согласно настоящему изобретению или композиции, содержащей указанное соединение.

[00272] Согласно другому варианту реализации, настоящее изобретение относится к способу ингибирования активности протеазы ВГС или мутантной формы указанного фермента в организме пациента, включающему этап введения указанному пациенту соединения согласно настоящему изобретению или композиции, содержащей указанное соединение. Согласно отдельным вариантам реализации, настоящее изобретение относится к способу необратимого ингибирования активности протеазы ВГС или мутантной формы указанного фермента в организме пациента, включающему этап введения указанному пациенту соединения согласно настоящему изобретению или композиции, содержащей указанное соединение. Согласно другим вариантам реализации настоящего изобретения, предложен способ лечения заболевания, опосредованного протеазой ВГС или мутантной формы указанного фермента, у пациента, нуждающегося в таком лечении, включающий этап введения указанному пациенту соединения согласно настоящему изобретению или фармацевтически эффективной композиции, содержащей указанное соединение. Указанные заболевания подробно описаны в тексте настоящей заявки.

[00273] В зависимости от конкретного состояния или заболевания, которое подвергают лечению, в сочетании с соединениями или композициями согласно настоящему изобретению можно вводить дополнительные терапевтические агенты, обычно используемые для лечения указанного состояния. В настоящем описании дополнительные терапевтические агенты, обычно используемые для лечения определенного заболевания или состояния, определены как "подходящие для лечения заболевания или состояния агенты".

[00274] В отдельных вариантах реализации, соединение или композицию согласно изобретению вводят в сочетании с другим ингибитором протеазы ВГС или ее варианта. В некоторых вариантах реализации, соединение или композицию согласно изобретению вводят в сочетании с другим противовирусным агентом. Указанные противовирусные агенты включают, но не ограничиваются следующими примерами: иммуномодулирующие агенты, такие как α-, β- и γ-интерфероны, пэгилированные производные интерферона-α и тимозин; другие противовирусные агенты, такие как рибавирин, амантадин и телбивудин; другие ингибиторы протеаз гепатита С (ингибиторы NS2-NS3 и ингибиторы NS3-NS4A, например BILN 2061 и VX-950); ингибиторы других мишеней в течение жизненного цикла ВГС, включая ингибиторы геликазы и полимеразы; ингибиторы внутренней посадки рибосом; ингибиторы вирусной активности широкого спектра, такими как ингибиторы IMPDH (например, микофеноловая кислота и ее производные); или комбинации любых из перечисленных агентов.

[00275] В отдельных вариантах реализации, можно осуществлять введение комбинации 2 или более противовирусных агентов. В отдельных вариантах реализации можно осуществлять введение комбинации 3 или более противовирусных агентов. В некоторых вариантах реализации, противовирусные агенты выбраны из рибавирина и интерферона. В других вариантах реализации, противовирусным агентом является α-интерферон.

[00276] Другие примеры агентов, являющихся ингибиторами согласно настоящему изобретению, которые можно использовать в комбинациях, согласно описанному, включают, без ограничения: терапевтические агенты, применяемые при лечении болезни Альцгеймера, такие как Aricept® и Excelon®; терапевтические агенты, применяемые при лечении ВИЧ, такие как ритонавир; терапевтические агенты, применяемые при лечении болезни Паркинсона, такие как L-DOPA/карбидопа, энтакапон, ропинрол, прамипексол, бромокриптин, перголид, тригексифенидил и амантадин; терапевтические агенты, применяемые при лечение множественного склероза (МС), такие как бета-интерферон (например, Avonex® и Rebif®), Copaxone® и митоксантон; терапевтические агенты, применяемые при лечении астмы, такие как альбутерол и Singulair®; агенты, применяемые при лечении шизофрении, такие как зипрекса, риспердал, сероквель и галоперидол; противовоспалительные агенты, такие как кортикостероиды, блокаторы ФНО (TNF), IL-1 RA, азатиоприн, циклофосфамид и сульфасалазин; иммуномодуляторные и иммуносупрессорные агенты, такие как циклоспорин, такролимус, рапамицин, микофенолат мофетил, интерфероны, кортикостероиды, циклофофамид, азатиоприн и сульфозалин; нейротрофные факторы, такие как ингибиторы ацетилхолинэстеразы, ингибиторы МАО, интерфероны, противосудорожные препараты, блокаторы ионных каналов, рилузол и агенты, применяемые для лечения болезни Паркинсона; агенты, применяемые для лечения кардиоваскулярных заболеваний, такие как бета-блокаторы, ингибиторы ЭКН (АСЕ), диуретики, нитраты, блокаторы кальциевых каналов и статины; агенты, применяемые для лечения заболеваний печени, такие как кортикостероиды, холестирамин, интерфероны и противовирусные агенты; агенты, применяемые для лечения заболеваний крови, такие как кортикостероиды, агенты, применяемые для лечения лейкемии, и факторы роста; агенты, которые продлевают или улучшают фармакокинетику, такие как ингибиторы цитохрома Р450 (например, ингибиторы метабоолического расщепления) и ингибиторы CYP3A4 (например, кетокеназол и ритонавир), и агенты, применяемые для лечения заболеваний, вызывающих иммунодефицит, такие как гамма-глобин.

[00277] В отдельных вариантах реализации, соединения или композиции согласно настоящему изобретению вводят в сочетании с моноклональным антителом или терапевтическим средством, включающим миРНК.

[00278] Указанные дополнительные агенты можно вводить отдельно от композиции, содержащей соединение согласно настоящему изобретению, как часть составного режима дозировки. Также, в качестве альтернативного варианта, указанные агенты можно сделать составной частью единой лекарственной формы, в виде смеси с соединением согласно настоящему изобретению в одной композиции. При осуществлении введения в виде части составного режима дозировки, два действующих соединения можно применять одновременно, последовательно, или с перерывом, равным, обычно, пять часов, между приемами соединений.

[00279] Термин "комбинация" "в комбинации", и подобные термины, используемые в настоящем описании, относятся к одновременному или последовательному введению терапевтических агентов согласно настоящему изобретению. Например, соединение согласно настоящему изобретению можно вводить одновременно с другим терапевтическим агентом или последовательно, в отдельных стандартных лекарственных формах, или в единой стандартной лекарственной форме. Соответственно, согласно настоящему изобретению предложена единая стандартная лекарственная форма, содержащая соединение формулы I, дополнительный терапевтический агент и фармацевтически приемлемый носитель, адъювант или переносчик.

[00280] Количество обоих соединений, соединения согласно изобретению и дополнительного терапевтического агента (в композициях, содержащих дополнителььный терапевтический агент согласно описанному выше), которое возможно соединить с материалами-носителями с получением единой лекарственной формы, будет варьироваться в зависимости от определенного режима введения. Предпочтительно, композиции согласно изобретению следует изготавливать в дозировке, составляющей 0.01 - 100 мг/кг массы тела/день соединения согласно настоящему изобретению.

[00281] В композициях, содержащих дополнительный терапевтический агент, указанный дополнительный терапевтический агент и соединения согласно настоящему изобретению могут действовать совместно. Таким образом, количественное содержание дополнительного терапевтического агента в указанных композициях будет меньше, чем требуется при монотерапии с применением только одного терапевтического агента. В составе указанных композиций можно вводить дозировку дополнительного терапевтического агента, находящуюся в промежутке 0.01-100 мг/кг массы тела/день.

[00282] Количество дополнительного терапевтического агента в составе композиций согласно настоящему изобретению будет большим, чем количество, вводимое обычно в составе композиции, содержащей указанный терапевтический агент в качестве единственного действующего соединения. Предпочтительно, количественное содержание дополнительного терапевтического агента в композициях, описанных в тексте настоящей заявки, будет варьироваться от приблизительно 50% до 100% от количества, содержащегося обычно в композиции, содержащей указанный терапевтический агент в качестве единственного действующего соединения.

ПРИМЕРЫ

[00283] Согласно описанному в приведенных ниже Примерах, в отдельных иллюстративных вариантах реализации, соединения согласно настоящему изобретению получают в соответствии со следующими общими способами. Следует понимать, что, хотя общий способ описывает получение отдельных соединений согласно настоящему изобретению, приведенные ниже общие способы, а также другие способы, известные специалистам в данной области, можно применять с получением всех соединений и подклассов и видов каждого из этих соединений, согласно описанному в тексте настоящей заявки.

[00284] Нумерация соединений, использованная ниже в Примерах, соответствует нумерации соединений, использованной выше, в Таблице 3.

Общий Способ А Получения Соединений, где R3 содержит вторичную амидную группу

[00285] Как изображено выше, на Схеме 3, Вос-производное пролина N конденсировали с производным альфа-аминокислоты О с применением подходящих условий сопряжения пептидов, с получением сложного эфира дипептида Р. При помощи гидролиза сложного эфира Р с водным раствором гидроксида лития, вслед за которым проводили ацилирование, получали кислоту Q. Путем конденсирования Q с сульфонамидом R получали ацилсульфонамид S. В результате кислотно-катализируемого отщепления Вос от S получали промежуточное соединение Т. Путем конденсирования Т с Boc/Fmoc-защищенной аминокислотой U с применением подходящих условий сопряжения пептидов получали промежуточное соединение V. Путем селективного удаления защитной группы Fmoc из состава V с применением пиперидина получали W, который подвергали ацилированию посредством хлорангидрида с получением соединений I-3, I-4, I-7, I-8, и I-11 (и других соединений, приведенных в качестве дополнительных Примеров в настоящем описании). Несмотря на то, что этот способ в общих чертах описывает синтез конкретных соединений, специалисту в данной области будет понятно, что этот способ можно применять для синтеза других соединений формулы I.

Общий Способ В Получения Соединений, где R3 содержит третичную амидную группу

[00286] Как описано выше, на Схеме 4, промежуточное соединение Т, полученное согласно общему способу А, конденсировали с N-Boc-O-TBS-гомосерином Х при применении подходящих условий сопряжения пептидов, с получением трипептида Y. Путем катализируемого фторидом десилилирования Y получали спирт Z, который окисляли реагентом Десс-Мартина (Dess-Martin periodinane) с образованием альдегида АА, посредством восстановительного аминирования АА с применением триацетоксиборгидрида и метиламина получали метиламин ВВ. Посредством ацилирования ВВ получали соединения I-9 и I-12 (и другие соединения, приведенные в настоящем описании в качестве дополнительных примеров). Несмотря на то, что указанный способ в общих чертах описывает синтез конкретных соединений, специалисту в данной области будет понятно, что указанный способ можно применять для синтеза других соединений формулы I.

Общий Способ С Получения Соединений, где R3 содержит в своем составе эпоксид

[00287] Как изображено выше, на 5, альдегид, являющийся промежуточным соединением АА согласно общему способу В, приводили во взаимодействие с диметилсудьфоксометилидом с образованием эпоксида I-6. Несмотря на то, что указанный способ в общих чертах описывает синтез определенных соединений, специалисту в данной области будет понятно, что указанный способ можно применять для синтеза других соединений формулы I.

Общий Способ D Получения Соединений, где R3 содержит в своем составе 2-энамид

[00288] Как изображено выше, на Схеме 6, группу Вос в составе промежуточного соединения Р согласно общему способу А удаляли при помощи соляной кислоты с получением амина СС. Промежуточное соединение СС конденсировали с N-Вос-3-(Fmoc)амино-L-аланином при применении подходящих условий сопряжения пептидов с образованием трипептидного промежуточного продукта DD. Путем селективного удаления защитной группы Fmoc из состава DD с применением пиперидина получали амин ЕЕ. Посредством ацилирования ЕЕ при помощи хлорангидрида получали амид FF-1 или FF-2. После проведения гидролиза FF-1 или FF-2 при применении гидроксида лития и последующего ацилирования получали кислоту GG-1 или GG-2. В результате сопряжения кислоты GG-1 или GG-2 с применением бензолсульфонамида в подходящих условиях сопряжения пептидов получали I-2 и I-5. Несмотря на то, что указанный способ в общих чертах описывает синтез определенных соединений, специалисту в данной области будет понятно, что указанный способ можно применять для синтеза других соединений формулы I. Следует понимать, что этапы ацилирования и сопряжения с применением сульфонамида можно поменять местами, и, таким образом, осуществить присоединение группы R3 после присоединения группы R2.

[00289] Хотя отдельные защитные группы, например, Boc и TBS, приведены выше, на Схемах, специалисту в данной области будет понятно, что для получения соединений соглсно настоящему изобретению возможно применение других амино- и гидроксильных защитных групп. Соответственно, настоящим изобретением предусматривается применение множества гидроксильных защитных групп. Указанные защитные группы хорошо известны в данной области и включают группы, подробно описанные в Protecting Groups in Organic Synthesis, Т.W.Greene and P.G.M.Wuts, 3rd edition, John Wiley & Sons, 1999, описание которой включено в настоящий документ посредством ссылки.

Пример 1

[00290] N-[(1,1-диметилэтокси)карбонил]-3-[(2-пропеноил)амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-3): Указанное в заголовке соединение получали в соответствии с этапами и промежуточными соединениями, описанными ниже.

Промежуточное соединение 1

[00291] Этил-1-[[[(2S,4R)-1-[(1,1-диметилэтокси)карбонил]-4-[(7-метокси-2-фенил-4-квинолинил)окси]-2-пирролидинил]карбонил]амино]-2-этенил-(1R,2S)-циклопропанкарбоксилат: К раствору этилового эфира (1R,2S)-1-амино-2-винилциклопропана карбоновой кислоты толуолсульфоновой кислоты (2.29 г, 7.0 мМоль) и N-Boc (2S,4R)-(2-фенил-7-метоксиквинолин-4-оксо)пролина (3.4 г, 7.3 мМоль) в 100 мл DCM добавляли HATU (3.44 г, 9.05 мМоль) и затем DIEA (3.81 мл, 21.9 мМоль) при перемешивании. Смесь подвергали перемешиванию при r.t. (комнатной температуре) в течение двух часов. После полного израсходования исходных веществ реакционную смесь дважды отмывали солевым раствором и высушивали над MgSO4. После удаления растворителя проводили хроматографию неочищенного продукта с силикагелем (гексан:EtOAc=2:1). Получали 3.45 г соединения, указанного в заголовке: Rf 0.3 (EtOAc:гексан=2:1); MS m/z: 602.36 (M+H+).

Промежуточное соединение 2

[00292] 1-[[[(2S,4R)-1-[(1,1-диметилэтокси)карбонил]-4-[(7-метокси-2-фенил-4-квинолинил)окси]-2-пирролидинил]карбонил]амино]-2-этенил-(1R,2S)-циклопропанкарбоксильная кислота: К раствору продукта Промежуточного соединения 1 (1.70 г, 2.83 мМоль) в 140 мл THF/EbO/MeOH (9:5:1.5) добавляли лития гидроксид моногидрат (0.95 г, 22.6 мМоль). После перемешивания при r.t. в течение 24 часов реакционную смесь нейтрализовали 1.0 N HCl. Органические растворители выпаривали под вакуумом, а оставшуюся водную фазу подвергали ацилированию при рН~3 при помощи 1.0 N HCl и экстрагировали с применением EtOAc. Органический слой отмывали солевым раствором и высушивали над безводным сульфатом магния. В результате, после удаления растворителя, получали 1.6 г.указанного соединения: Rf 0.2 (EtOAc:МеОН=10:1); MS m/z: 574.36 (M+H+).

Промежуточное соединение 3

[00293] N-(1,1-диметилэтокси)карбонил)-(4К)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 2 (1.24 г, 2.16 мМоль) в 20 мл DMF добавляли HATU (0.98 г, 2.58 мМоль) и DIEA (1.43 мл, 8.24 мМоль), смесь перемешивали в течение часа, после чего добавляли раствор бензолсульфонамида (1.30 г, 8.24 мМоль), DMAP (1.0 г, 8.24 мМоль) и DBU (1.29 г, 8.4 мМоль) в 15 мл DMF. Перемешивание осуществляли в течение еще четырех часов. Реакционную смесь разводили в EtOAc и отмывали водным раствором NaOAc буфера (рН~5, 2×10 мл), раствором NaHCO3 и солевым раствором. После высушивания над MgSO4 и удаления растворителя очищенный продукт осаждали путем добавления одной части DCM. Фильтрат концентрировали, и остаток подвергали хроматографической очистке в силикагеле с применением гексана/EtOAc (1:1-1:2). Общее количество полученного указанного соединения составляло 0.76 г: Rf 0.3 (EtOAc:гексан=3:1), MS m/z: 713.45 (М+H+), 735.36 (M+Na+).

Промежуточное соединение 4

[00294] (4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 3 в 30 мл DCM добавляли капельным методом 15 мл TFA. Смесь перемешивали при r.t. в течение двух часов. После удаления растворителей добавляли 20 мл DCM, после чего производили выпаривание досуха. Этап добавления DCM с последующим выпариванием повторяли четыре раза. Далее, добавляли толуол (20 мл) и удаляли его путем выпаривания досуха. В результате двукратного повторения цикла получали осадок, затвердевавший в 0.9 г белого порошка в форме ТФА соли соединения, указанного в заголовке. Небольшой образец ТФА соли нейтрализовали при помощи NaHCO3 c получением соединения, указанного в заголовке: Rf 0.4 (DCM:MeOH=10:1); MS m/z: 613.65 (M+H+).

Промежуточное соединение 5

[00295] N-[(1,1-диметилэтокси)карбонил]-3-[[(9Н-фтор-9-илметокси)карбонил]амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 4 (0.15 г, 0.178 мМоль) и N-Вос-3-(Fmoc)амино-L-аланина (0.107 г, 0.25 мМоль) в 3.0 мл DMF добавляли HATU (85.1 мг, 0.224 мМоль) и NMM (90.5 мг, 0.895 мМоль) при r.t. при перемешивании. Анализ TLC показал, что реакция сопряжения завершилась по прохождении часа. Затем в смесь добавляли 20 мл EtOAc и отмывали смесь буфером (рН~4, AcONa/AcOH), NaHCO3 и солевым раствором, после чего высушивали ее над MgSО4. После удаления растворителя проводили хроматографию неочищенного масла с силикагелем (элюэнты: EtOAc/гексан). Общее количество полученного соединения, указанного в заголовке, составляло 0.12 г: Rf 0.4 (EtOAc:гексан=1:1); MS m/z: 1021.56 (M+H+).

Промежуточное соединение 6

[00296] N-[(1,1-диметиленокси)карбонил]-3-амино-L-аланил-(4К)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: Раствор 110 мг продукта Промежуточного соединения 5 (0.108 мМоль) в 1 мл DMF с 12% пиперидином подвергали перемешиванию в течение 1.5 часов при r.t, после чего выпаривали досуха под вакуумом. Осадок обрабатывали смесью гексан/эфир (4:1) с получением 70 мг обозначенного соединения: Rf 0.25 (EtOAc:МеОН=10:1); MS m/z: 798.9 (M+H+).

Соединение (I-3)

[00297] N-[(1,1-диметилэтокси)карбонил]-3-[(2-пропеноил)амино]-L-аланил-(4К)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: Акрилоил хлорид (11 мкл, 0.132 мМоль) добавляли капельным методом при 0°С к перемешиваемому раствору 69 мг продукта Промежуточного соединения 6 в 3 мл DCM, содержащего 3 экв. триэтиламина. Реакционную смесь подвергали перемешиванию при r.t. в течении 1.5 часов, после чего разбавляли 10 мл DCM. Итоговый раствор дважды отмывали солевым раствором и высушивали над сульфатом магния. После удаления растворителя получали неочищенный продукт, который подвергали хроматографической очистке с силикагелем, после проведения выделения при помощи гексан/ЕЮАс (1:3~1:5) и затем с DCM-метанолом (50:1~25:1)). В результате получали 36 мг указанного в заголовке соединения: Rf 0.25 (DCM:MeOH=25:1); MS m/z: 892.55 (M+H+).

[00298] Аналогичным путем при использовании продукта Промежуточного соединения 6 получали следующие соединения.

[00299] На основе 2-хлорсульфенилбензоил хлорида получали N-[(1,1-диметилэтокси)карбонил]-3-(бензоизотиазолин-3-один-2-ил)-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-10): Rf 0.3 (EtOAc:гексан=5:1); MS m/z: 933.55 (M+H+), 955.55 (M+Na+).

[00300] На основе 1-цианоциклопропилкарбонил хлорида получали N-[(1,1-диметилэтокси)карбонил]-3-[(1-циано-циклопропилкарбоксил)амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-11): 0.15 (EtOAc:гексан=5:1); MS m/z: 892.55 (M+H+).

[00301] На основе пропионил хлорида получали N-[(1,1-диметилэтокси)карбонил]-3-[(пропионил)амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (IR-3): Rf 0.35 (ErOAc:гексан=5:1); MS m/z: 855.45 (M+H+), 877.36 (M+Na+).

[00302] На основе хлорацетил хлорида получали N-[(1,1-диметилэтокси)карбонил]-3-[(хлорацетил)амино]-L-аланил-(4R)-4- [(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-7): Rf 0.3 (EtOAc:гексан=3:1); MS m/z: 875.45 (M+H+).

[00303] На основе R-хлорпропионил хлорида получали N-[(1,1-диметилэтокси)карбонил]-3-[R-(хлорпропионил)амино]-L-аланил-(4R)-4- [(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-13): Rf 0.5 (EtOAc/гексан - 2/1), M/Z 889.55 (M+H+).

[00304] На основе (S)-2-хлорпропаноил хлорида получали трет-бутил (S)-3-((S)-2-хлорпропанамидо)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат(1-21): M/Z 889.45 (M+H+).

[00305] На основе (R)-2-бромпропаноил хлорида получали трет-бутил (S)-3-(2-бромпропанамидо)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-22): M/Z 934.70 (M+H+).

[00306] На основе 2-хлор-2-фенилацетил хлорида получали трет-бутил (S)-3-(2-хлор-2-фенилацетамидо)-l-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат(1-23): M/Z 952.3 (M+H+).

[00307] трет-бутил-(8)-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-35) получали путем следования способу, описанному в Примере 1, за исключением замены бензилсульфонамида на циклопропилсульфонамид на этапе образования Промежуточного соединения 3. M/Z 817.30 (M+H+).

[00308] (1R,2S)-1-((2S,4R)-1-((S)-3-акриламидо-2-(трет-бутоксикарбониламино)пропаноил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамидо)-2-винилциклопропанкарбоксильную кислоту (I-41) получали путем следования способу, описанному в Примере 1, при использовании сложного эфира вместо сульфонамида, и последующим проведением гидролиза при помощи LiOH сложного эфира до карбоновой кислоты на последнем этапе. M/Z 714.30 (M+H+).

[00309] т-бутил-(S)-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(4-этинилфенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-61) получали путем следования способу, описанному в Примере 1, при использовании 4-этинилбензолсульфонамида в процессе синтеза Промежуточного соединения 3: Rf 0.58 (EtOAc/ МеОН 10:1); MS m/z: 877.3 (M+H+).

Пример 2

[00310] (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-(хлорацетил)амино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсуотфонил)-(1R,2S)-циклопропанкарбоксамид (I-4): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями согласно описанному ниже.

Промежуточное соединение 7

[00311] (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-[[(9Н-флуорен-9-илметокси)карбонил]амино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 4 (0.15 г, 0.178 мМоль) и (2S)-2-Вос-амино]-4-Fmoc-аминобутановой кислоты (0.107 г, 0.25 мМоль) в 3.0 мл DMF добавляли HATU (85.1 мг, 0.224 мМоль) и NMM (90.5 мг, 0.895 мМоль) при r.t. при перемешивании. Через час анализ TLC показал завершение реакции. К смеси добавляли 20 мл EtOAc и производили отмывку буфером (рН~4, AcONa/AcOH), раствором NaHCO3 и солевым раствором, после чего высушивали ее над MgSО4. После удаления растворителя неочищенный продукт подвергали хроматографической очистке с силикагелем (элюэнт:EtOAc/гексан) с образованием 0.12 г соединения, указанного в заголовке: Rf 0.35 (EtOAc:гексан=2:1); MS m/z: 1035.45 (М+Н+).

Промежуточное соединение 8

[00312] (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-аминобутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: Раствор 110 мг продукта Промежуточного соединения 7 растворяли в растворе 1 мл DMF и 12% пиперидином. Производили перемешивание в течение 1.5 часов при r.t. и последующее выпаривание досуха под высоким вакуумом. Осадок растирали в порошок и приводили во взаимодействие с гексан/эфир (4:1) с образованием 70 мг соединения, указанного в заголовке: Rf 0.55 (DCM/MeOH=25:1); MS m/z: 813.66 (M+H+).

Соединение (I-4)

[00313] (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-(хлорацетил)амино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 8 (60 мг, 0.074 мМоль) в 3 мл метилен хлорида в присутствии триэтиламина (70 мкл, 0.5 мМоль) при 0°С добавляли капельным методом хлорацетил хлорид (15 мкл, 0.18 мМоль, 3.0 экв.) при перемешивании. Перемешивание реакционной смеси производили при r.t. в течение 1.5 часов. Реакционную смесь разводили 10 мл ДХМ, дважды отмывали солевым раствором, и высушивали над сульфатом магния. После удаления растворителя получали неочищенный продукт, который подвергали хроматографической очистке с силикагелем (элюэнты: гексан/ЕtOАс (1:3-1:5) и ДХМ/МеОН (50:1-25:1)). В результате получали 27 мг соединения, указанного в заголовке: Rf 0.45 (ДХМ/МеОН=50:1), MS m/z: 889.55 (M+H+).

[00314] Путем конденсирования указанным способом продукта Промежуточного соединения 8 с акрилоил хлоридом получали (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-(2-пропеноил)амино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-8): Rf 0.65 (EtOAc:MeOH-=10:1); MS m/z: 867.55 (M+H), 889.45 (М+Na+).

[00315] На основе rac-2-хлорпропионил хлорида получали (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-(R,S-хлорпропионил)амино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1- амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-1): Rf 0.6 (EtOAc/MeOH=10/1), M/Z 903.64 (M+H+); 925.55 (M+Na+).

[00316] На основе 2-бромпропаноил хлорида получали 1-20: M/Z 949.36 (M+H+).

Пример 3

(2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-(2-пропеноил)метиламино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-12): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями, согласно описанному ниже.

Промежуточное соединение 9

[00317] N-[(1,1-диметилэтокси)карбонил]-O-[(1,1-диметилэтил)диметилсилил]-L-гомосеринил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 4 (0.20 г, 0.326 мМоль), и N-[(1,1-диметилэтокси)карбонил]-O-[(1,1-диметилэтил)диметилсилил]-L-гомосерина (0.152 г, 0.457 мМоль) в 10 мл ДМФ добавляли HATU (0.155 г, 0.408 мМоль) а затем NMM (0.175 мл, 1.63 мМоль) капельным методом при перемешивании. Перемешивание смеси производили при комнатной температуре в течение 1 часа. После чего реакционную смесь нейтрализовали насыщенным NaHCO3 и экстрагировали при помощи EtOAc. Органическую фазу трижды отмывали солевым раствором, и высушивали над сульфатом магния, фильтровали и выпаривали с образованием осадка, который очищали методом флэш-хроматографии (ЕtOАс/гексан=1:2) с получением 0.21 г соединения, указанного в заголовке: Rf 0.30 (EtOAc/гексан=1:1); MS m/z: 928.64 (M+H+), 950.55 (M+Na+).

Промежуточное соединение 10

[00318] N-[(1,1-диметилэтокси)карбонил]-L-гомосеринил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: Раствор продукта Промежуточного соединения 9 (189 мг, 0.2 мМоль) в TBAF (0.4 мл 1.0 М раствора TBAF в THF) и 4 мл THF подвергали перемешиванию при комнатной температуре в течение 3 часов. Реакционный раствор выпаривали под вакуумом для удаления THF. Осадок растворяли в EtOAc. Полученный раствор отмывали при помощи воды и солевого раствора, высушивали над безводным сульфатом магния, отфильтровывали и выпаривали с образованием осадка, который подвергали хроматографической очистке при помощи метода флэш-хроматографии (EtOAc/гексан=5:1) с получением 150 мг соединения, указанного в заголовке: Rf 0.30 (EtOAc/гексан=5:1); MS m/z: 814.36 (M+H+), 836.27 (М+Na+).

Промежуточное соединение 11

[00319] (2S)-N-[(1,1-диметилэтокси)карбонил]-4-оксобутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору продукта Промежуточного соединения 10 (100 мг, 0.123 мМоль) в 8 мл DCM добавляли реактив Десс-Мартина (62.8 мг, 0.148 мМоль) на ледяной бане. Смесь подвергали перемешиванию при 0°С в течение 1 часа, а затем - при комнатной температуре в течение 30 минут. На реакционную смесь воздействовали диэтиловым эфиром и подвергали ее выпариванию. Осадок немедленно вносили для очистки в хроматографическую колонку с EtOAc/гексан=2:1 с получением 66.7 мг соединения, указанного в заголовке: Rf 0.30 (EtOAc/гексан=2:1); MS m/z: 812.45 (M+H+).

Промежуточное соединение 12

[00320] (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-метиаминобутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид: К раствору метиламина (87.6 мл, 1.01 мМоль) в смеси растворителей (6 мл МеОН/3 мл CHCl3) добавляли продукт Промежуточного соединения 11 (82.3 мг, 0.101 мМоль), а затем - триацетоксиборгидрид тетраметил аммония (66.4 мг, 0.253 мМоль) при перемешивании. Смесь подвергали перемешиванию при комнатной температуре в течение 1 часа. Полученный раствор выпаривали для удаления растворителей и экстрагировали при помощи EtOAc (3×20 мл). Экстракты соединяли, дважды отмывали солевым раствором, высушивали над безводным сульфатом магния. После удаления растворителя осадок подвергали очистке при помощи флэш-хроматографии с EtOAc/гексан=5:1 с получением 59 мг соединения, указанного в заголовке: Rf 0.20 (EtOAc/гексан=5:1); MS m/z: 827.55 (M+H+), 849.45 (М+Na+).

Соединение I-12

[00321] (2S)-2- [[(1,1-диметилэтокси)карбонил]амино]-4-(2-пропеноил)метиламино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-12): К раствору продукта Промежуточного соединения 12 (67.8 мг, 0.082 мМоль) и триэтиламина (46 мл, 0.328 мМоль) в 4 мл дихлорметана добавляли акрилоил хлорид (7.4 мл, 0.090 мМоль) при 0°С. Смесь подвергали перемешиванию при комнатной температуре в течение ночи. Раствор дважды отмывали водой, после чего высушивали над сульфатом магния и выпаривали. Осадок подвергали очистке при помощи флэш-хроматографии с EtOAc/гексан=5:1 с получением 15 мг соединения, указанного в заголовке: Rf 0.65 (EtOAc/MeOH=10:1); MS m/z: 881.55 (M+Н+), 903.55 (М+Na+).

[00322] Путем конденсирования продукта Промежуточного соединения 12 с хлорацетил хлоридом способом, аналогичным указанному выше, получали: (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-4-(хлорацетил)метиламино-бутаноил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-9): Rf 0.35 (EtOAc/гексан=5:1); MS m/z: 903.55 (M+H+).

Пример 4

[00323] (2S)-2-[[(1,1-диметилэтокси)карбонил]амино]-3-оксиранпропанол-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-6): Раствор продукта Промежуточного соединения 11 (26.8 мг, 0.033 мМоль) в DMSO добавляли одномоментно к сухой смеси триметилсульфоксоний иодида (Me3SOI, 21.8 мг, 0.099 мМоль) и KOt-Bu (11.1 мг, 0.099 мМоль) при комнатной температуре при воздействии азота. Полученный чистый раствор подвергали перемешиванию при комнатной температуре в течение ночи. Реакционную смесь приводили во взаимодействие с водой и экстрагировали при помощи EtOAc. Органические экстракты отмывали солевым раствором, высушивали над безводным сульфатом магния, подвергали фильтрации и выпариванию. Неочищенный продукт подвергали очистке на планшетах TLC с EtOAc/гексан=2:1, с получением 4.5 мг соединения, указанного в заголовке: Rf 0.36 (EtOAc/гексан=2:1); MS m/z: 808.45 (M+H+2О).

Пример 5

[00324] N-[(1,1-диметилэтокси)карбонил]-3-[(4-диметиламино-2-бутеноил)амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид(I-5): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями согласно описанному ниже.

Промежуточное соединение 13

[00325] Этил-1-[[[(2S,4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-2-пирролидинил]карбонил]амино]-2-этенил-(1R,2S)-циклопропанкарбоксилатдигидрохлорид: 5.22 г продукта Промежуточного соединения 1 (8.68 мМоль) растворяли в 190 мл 4N HCl в диоксане. Смесь подвергали перемешиванию при комнатной температуре в течение 2.0 часов. Реакционную смесь концентрировали с образованием полутвердого продукта (5.0 г), который растворяли путем добавления гексана с получением 4.3 г соединения, указанного в заголовке.

Промежуточное соединение 14

[00326] этил-N-(1,1-диметилэтокси)карбонил]-3-[[(9Н-флуорен-9-илметокси)карбонил]амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинодинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксилат: К раствору продукта Промежуточного соединения 13 (0.1145 г, 0.2 мМоль) и (2S)-2-Boc-амино]-4-Fmoc-аминобутановой кислоты (0.119 г, 0.28 мМоль) в 1.47 мл DMF добавляли HATU (0.095 г, 0.25 мМоль). После чего капельным методом добавляли NMM (0.1086 мл, 0.68 мМоль) и смесь подвергали перемешиванию при комнатной температуре в течение 1 часа. Реакционную смесь разводили 30 мл EtOAc и отмывали 5% NaHCO3 и солевым раствором, после чего высушивали над MgSO4. После удаления растворителя неочищенный продукт подвергали очистке при помощи флэш-хроматографии (гексан:EtOAc=2:1) с образованием 0.143 г соединения, указанного в заголовке: Rf 0.30 (EtOAc:гексан=1:1). MS m/z: 910.55 (M+H+).

Промежуточное соединение 15

[00327] Этил N-[(1,1-Диметилэтокси)карбонил]-3-амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксилат: К раствору продукта Промежуточного соединения 14 (0.429 г, 0.47 мМоль) в 4.5 мл DMF добавляли 0.5 пиперидина при перемешивании. Перемешивание продолжали в течение 30 минут. Реакционную смесь вливали в 30 воды и экстрагировали при помощи EtOAc (3×30 мл), после чего высушивали над MgSO4. После выпаривания растворителя осадок подвергали очистке при помощи флэш-хроматографии (EtOAc:MeOH=10:1) с получением 0.15 г соединения, указанного в заголовке: Rf 0.20 (EtOAc:MeOH=10:1); MS m/z: 688.45 (M+H+), 710.45 (M+Na+).

Промежуточное соединение 16

[00328] Этил N-[(1,1-диметилэтокси)карбонил]-3-(4-диметиламино-2-бутеноил)амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксилат: К раствору продукта Промежуточного соединения 15 (100 мг, 0.145 мМоль) и 4-диметиламино-2-бутеновой кислоты (24.1 мг, 6.145 мМоль) в 5 мл DCM добавляли HATU (68.6 мг, 0.18 мМоль), а затем - DIEA (75.8 мкл, 0.436 мМоль). Смесь подвергали перемешиванию при комнатной температуре в течение ночи. После чего производили двукратную отмывку реакционной смеси водой и высушивание ее над MgSО4, фильтрацию и выпаривание. Смесь очищали при помощи при помощи флэш-хроматографии с EtOAc:MeOH=1:1 с образованием 0.10 г соединения, указанного в заголовке: Rf 0.25 (EtOAc:MeOH=10:1) MS m/z: 799.45 (M+H+).

[00329] Аналогичным способом, при использовании кротонил хлорида, получали этил N-[(1,1-диметилэтокси)карбонил]-3-(2-бутеноил)амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксилат: Rf 0.30 (EtOAc:гексан=3:1). MS m/z: 756.45 (M+H+).

Промежуточное соединение 17

[00330] N-[(1,1-диметилэтокси)карбонил]-3-(4-диметиламино-2-бутеноил)амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксильная кислота: К раствору продукта Промежуточного соединения 16 (100 мг, 0.125 мМоль) в 10 мл THF/H2O/MeOH (9:5:1.5) добавляли LiOH·H2O (42 мг, 1.0 мМоль). Реакционную смесь подвергали перемешиванию при комнатной температуре в течение 24 часов и нейтрализовали при помощи уксусной кислоты. Органические растворители выпаривали под вакуумом и оставшуюся водную фазу экстрагировали при помощи EtOAc. Органический слой отмывали солевым раствором, после чего высушивали над MgSO4. После удаления растворителя получили 77.1 мг соединения, указанного в заголовке: MS m/z: 771.45 (М+Н+), 793.45 (M+Na+).

[00331] Способом, аналогичным описанному выше, получали, при использовании в качестве исходного соединения этил N-[(1,1-диметилэтокси)карбонил]-3-(2-бутеноил)амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксилата, N-[(1,1-диметилэтокси)карбонил]-3-(2-бутеноил)амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксильную кислоту: m/z: 728.2 (М+Н+), 750.2 (M+Na+).

Соединение I-5

[00332] N-[(1,1-диметилэтокси)карбонил]-3-[(4-диметиламино-2-бутеноил)амино]-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-5): Раствор продукта Промежуточного соединения 17 (77.1 мг, 0.10 мМоль), HATU (47.5 мг, 0.125 мМоль), DIPEA (69.5 мкл, 0.4 мМоль) в 2 мл сухого DMF перемешивали в течение 1 часа 15 минут. После чего к реакционному раствору добавляли раствор бензолсульфонамида (62.9 мг, 0.4 мМоль), DMAP (56.2 мг, 0.413 мМоль) и DBU (61.6 мкл, 0.413 мМоль) в 2 мл сухого DMF. Реакционную смесь подвергали перемешиванию при комнатной температуре в течение ночи. Образовавшуюся реакционную смесь разбавляли EtOAc (45 мл) и последовательно отмывали при помощи натрий-ацетатного буфера на водной основе (рН~4, 2×15 мл), 5% водного раствора бикарбоната натрия (15 мл) и солевого раствора (20 мл). Органический слой высушивали над MgSO4, фильтровали, после чего выпаривали. Неочищенный осадок подвергали очистке при помощи препаративных пластин для ТСХ (EtOAc:МеОН=1:1) с получением 15 мг соединения, указанного в заголовке: Rf 0.40 (EtOAc:МеОН=1:1); MS m/z: 910.55 (M+H+).

[00333] Способом, аналогичным описанному выше, получали, используя в качестве исходного соединения, N-[(1,1-диметилэтокси)карбонил]-3-(2-бутеноил)амино-L-аланил-(4R)-4-[(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-(1R,2S)-циклопропанкарбоксильную кислоту, N-[(1,1-диметилэтокси)карбонил]-3-[(2-бутеноил)амино]-L-аланил-(4R)-4- [(7-метокси-2-фенил-4-квинолинил)окси]-L-пролил-1-амино-2-этенил-N-(фенилсульфонил)-(1R,2S)-циклопропанкарбоксамид (I-2): Rf 0.35 (EtOAc:гексан=5:1); MS m/z: 867.55 (M+H+).

Пример 6

[00334] Метиловый эфир Boc-пролина конденсируют с карбонилдиимидазолом (CDI) с образованием промежуточного соединения имидазол карбамата, на которое затем воздействовали 4-фторизоиндолином. Метиловый эфир гидролизуют при помощи гидроксида лития и образовавшийся свободный карбоксилат сопрягают с этиловым эфиром 2-винил-1-аминоциклопропанкарбоновой кислоты при помощи HATU. Защитную группу Вос удаляют из состава образованного дипептида при помощи трифторуксусной кислоты (TFA) и образованный амин ацилируют при помощи защищенного аллил-орнитина. Посредством катализируемой рутением реакции обмена с замыканием кольца (RCM) формируют макроцикл и сложный эфир на С-конце гидролизуют при помощи гидроксида лития (LiOH). Образованную свободную кислоту сопрягают с циклопропансульфонамидом при помощи HATU, защитную группу Fmoc в составе боковой цепи орнитина удаляют путем воздействия N-метилморфолина и указанный свободный амин ацилируют при помощи акрилоил хлорида с получением в качестве конечного продукта соединения I-18. Упомянутый выше защищенный аллил-орнитин возможно получить посредством селективного востановления защищенной подходящим образом глутаминой кислоты при помощи катехол-борана, окисления образованного спирта до альдегида, введения аллиламина посредством восстановительного аминирования, введения Fmoc-хлорида для защиты боковых цепей и гидролиза сложного эфира при помощи гидроксида лития с получением требуемого промежуточного соединения.

[00335] Путем следования способам, описанным на приведенной выше схеме, можно получать следующие соединения:

Соединение I-19

[00336] (1aR,3aS,5R,9S,16aS,Z)-11-акрилоил-9-(трет-бутоксикарбониламино)-1а-(циклопропилсульфонилкарбамоил)-3,8-диоксо-1,1а,2,3,3а,4,5,6,8,9,10,11,12,13,14,16а-гексадекагидроциклопропа[н]пирроло[2,1-c][1,4,8]триазациклопентадецин-5-ил-4-фторизоиндолин-2-карбоксилат

Соединение I-16

[00337] (1aR,3aS,5R,9S,16aS,Z)-9-(трет-бутоксикарбониламино)-1а-(циклопропилсульфонилкарбамоил)-11-(N-метилакриламидо)-3,8-диоксо-1,1а,2,3,3а,4,5,6,8,9,10,11,12,13,14,16а-гексадекагидроциклопропа[н]пирроло[1,2-а] [1,4]диазациклопентадецин -5-ил 4-фторизоиндолин-2-карбоксилат

Пример 7

[00338] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-3-(N-метилакриламидо)-1-оксопропан-2-илкарбамат (I-52): Указанное соединение получали согласно этапам и Промежуточным соединениям в соответствии с описанным ниже.

Промежуточное соединение 7-1

[00339] (2S,4R)-трет-бутил-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-карбоксилат: Промежуточное соединение 7-1 получали из Промежуточного соединения 2 (Пример 1) путем следования способам, описанным для Промежуточного соединения 3 с применением циклопропилсульфонамида вместо бензолсульфонамида. Rf 0.3 (EtOAc:гексан=3:1), MS m/z: 677.2 (M+H+).

Промежуточное соединение 7-2

[00340] (2S,4R)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид: Продукт Промежуточного соединения 7-1 (0.8 г, 1.18 мМоль) растворяли в 5 мл 4N HCl в диоксане и производили перемешивание реакционной смеси в течение 1 часа при комнатной температуре. После удаления растворителей вливали 20 мл DCM, после чего выпаривали смесь досуха. Процедуру добавления DCM с последующим выпариванием повторяли трижды, с образованием соединения 6 в форме его HCl соли. MS m/z: 577.2 (М+Н+).

Промежуточное соединение 7-3

[00341] (S)-2-(трет-бутоксикарбониламино)-3-(2-нитрофенилсульфонамидо)пропановая кислота: К раствору (S)-3-амино-2-(трет-бутоксикарбониламино)пропановой кислоты (2.04 г, 10 мМоль), TEA (4.5 мл, 30 мМоль) в 50 мл CH2Cl2 добавляли нитробензолсульфонил хлорид (2.9 г, 13.0 мМоль) при комнатной температуре. Смесь подвергали перемешиванию в течение 10 часов при RT. Растворитель удаляли под вакуумом, после чего добавляли 100 мл EtOAc. Органический слой отмывали при помощи 1N HCl (до рН 3), воды и солевого раствора. Органический слой высушивали над Na2SO4, фильтровали и удаляли растворитель с получением неочищенного Промежуточного соединения 7-3 (4.0 г).

Промежуточное соединение 7-4

[00342] (S)-метил-2-(трет-бутоксикарбониламино)-3-(N-метил-2-нитрофенилсульфонамидо)пропаноат: Неочищенноное Промежуточное соединение 7-3 (2.0 г), K2CO3 (1.5 г, 4 экв.) растворяли в 10 мл DMF. Затем к реакционной смеси при комнатной температуре добавляли MeI (0.8 мл, 4 экв.). Образованную смесь подвергали перемешиванию в течение 20 часов. Основную часть DMF удаляли под вакуумом, и добавляли к смеси 100 мл EtOAc, после чего производили отмывку смеси водой и солевым раствором. Органический слой высушивали над Na2SO4. После удаления растворителя неочищенный продукт пропускали через короткую колонку с силикагелем (элюенты: EtOAc/гексан) с получением 1.62 г Промежуточного соединения 7-4. MS m/z: 439.9 (M+Na+).

Промежуточное соединение 7-5

[00343] (S)-2-(трет-бутоксикарбониламино)-3-(N-метил-2-нитрофенилсульфонамидо)пропановая кислота: К раствору Промежуточного соединения 7-4 (1.6 г, 3.8 мМоль) в 10 мл THF/MeOH (1:1) добавляли водный раствор 1N LiOH (5.8 мл, 5.8 мМоль). После перемешивания при RT в течение 10 часов реакционную смесь нейтрализовывали при помощи 1.0N HCl. Органический растворитель выпаривали под вакуумом и оставшуюся водную фазу ацилировали до значений рН~3 при помощи 1.0N HCl, после чего проводили экстракцию при помощи EtOAc. Производили отмывку органического слоя солевым раствором и высушивание над безводным сульфатом натрия. После удаления растворителя получали 1.5 г Промежуточного соединения 7-5. MS m/z: 402.0 (М-1, негативный режим).

Промежуточное соединение 7-6

[00344] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-3-(N-метил-2-нитрофенилсульфонамидо)-1-оксопропан-2-ил-карбамат: К раствору Промежуточного соединения 7-2 (0.27 г, 0.44 мМоль) и Промежуточного соединения 7-5 (0.24 г, 0.58 мМоль) в 5.0 мл безводного ацетонитрила добавляли HATU (0.22 г, 0.58 моль) и DIEA (0.23 мл, 1.3 мМоль) при RT при перемешивании. При помощи анализа методом ТСХ и методом LC-MS (жидкостной хроматографии/масс-спектрометрии) было отмечено окончание реакции сопряжения по прошествии одного часа. После чего производили вливание 20 мл EtOAc и отмывку смеси при помощи буфера (рН~4, AcONa/AcOH), NaHCO3 и солевого раствора. Органический слой высушивали над Na2SO4. После удаления растворителя неочищенный продукт пропускали через хроматографическую колонку с силикагелем (элюенты: EtOAc/гексан). Общее количество образованного Промежуточного соединения 7-6 составляло 0,35 г: Rf 0.4 (EtOAc:гексан=1:1); MS m/z: 962.2 (М+Н+).

Промежуточное соединение 7-7

[00345] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-3-(метиламино)-1-оксопропан-2-ил-карбамат: К раствору Промежуточного соединения 7-6 (0.35 г, 0.36 мМоль) в 5 мл DMF добавляли фенилтиол (80 мг, 0.72 мМоль) и K2CO3 (0.20 г, 1.0 мМоль). Образованную смесь подвергали перемешиванию в течение 10 часов при RT. Затем добавляли 30 мл EtOAc и отмывали реакционную смесь водой, солевым раствором и водой. Органический слой высушивали над Na2SO4. После удаления растворителя неочищенный продукт пропускали через хроматографическую колонку с силикагелем (элюенты: EtOAc/гексан) с получением 0.2 г Промежуточного соединения 7-7. MS m/z: 777.2 (M+H+).

Соединение (I-52)

[00346] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-3-(N-метилакриламидо)-1-оксопропан-2-ил-карбамат (I-52): К раствору 108 мг продукта Промежуточного соединения 7-7 при перемешивании добавляли капельным методом акрилоил хлорид (18 мкл, 0.207 мМоль) при 0°С в 3 мл DCM, содержащего 3 экв. триэтиламина. Реакционную смесь подвергали перемешиванию при RT в течение 1.5 часов и затем разбавляли 10 мл DCM. Образованный раствор дважды отмывали солевым раствором и высушивали над сульфатом магния. После удаления раствора получали неочищенный продукт, который подвергали очистке на хроматографической колонке с силикагелем сначала с использованием в качестве элюентов гексан/EtOAc (1:3 ~ 1:5) а затем - DCM-метанол (50:1 ~ 25:1). Общее количество полученного соединения, указанного в заголовке, составляло 100 мг: Rf 0.25 (DCM:MeOH=25:1); MS m/z: 831.3 (M+H+).

[00347] т-бутил-(S)-N-этил-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-78): Аналогичным образом получали соединение I-78, при использовании этил иодида на этапе Промежуточного соединения 7-4. MS m/z: 845.3 (M+H+).

[00348] т-бутил-(S)-N-2-пропенил-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-79): Соединение I-79 получали при использовании аллил бромида на этапе образования Промежуточного соединения 7-4. MS m/z: 857.3 (M+H+).

[00349] т-бутил-(S)-3-(2-оксопиррол-3-енил)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквииолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-80): Соединение I-80 получали при использовании в качестве исходного Соединение I-79 с применением катализируемой рутением реакции обмена с замыканием кольца. MS m/z: 829.3 (М+Н+).

[00350] т-бутил-(S)-N-метил-4-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксобутан-2-ил-карбамат (I-82): Соединение I-82 получали при использовании (2S)-2-boc-амино-4-аминобутановой кислоты на этапе образования Промежуточного соединения 7-3 вместо (S)-3-амино-2-boc-аминопропановой кислоты. Rf 0.35 (EtOAc/MeOH 10:1); MS m/z: 845.30 (M+H+).

Пример 8

[00351] трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(N-метилакриламидо)-1-оксопропан-2-ил-карбамат (I-28): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями, согласно описанному ниже.

Промежуточное соединение 8-1

[00352] трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фениквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(метиламино)-1-оксопропан-2-ил-карбамат: Промежуточное соединение 8-1 получали в соответствии со способом, описанным для Промежуточного соединения 7-7 в Примере 7 с применением Промежуточного соединения 4 из Примера 1 вместо Промежуточного соединения 7-2. MS m/z: 813.3 (M+H+).

Соединение I-28

[00353] трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(N-метилакриламидо)-1-оксопропан-2-ил-карбамат (I-28): К раствору 100 мг продукта Промежуточного соединения 8-1 при перемешивании добавляли капельным методом акрилоил хлорид (1.2 экв.) при 0°С в 3 мл DCM, содержащего 3 экв. триэтиламина. Реакционную смесь подвергали перемешиванию при RT в течение 1.5 часов, после чего разбавляли 10 мл DCM. Образованный раствор дважды отмывали солевым раствором и высушивали над сульфатом магния. После удаления растворителя получали неочищенный продукт, который подвергали очистке на хроматографической колонке, сначала при использовании в качестве элюентов гексан/EtOAc (1:3 ~ 1:5) а затем - DCM-метанол (50:1 ~ 25:1). Общее количество полученного соединения, указанного в заголовке, составляло 80 мг: Rf 0.25 (DCM:MeOH=25:1); MS m/z: 867.2 (M+H+).

[00354] При использовании аналогичным способом Промежуточного соединения 8-1 получали следующие соединения:

На основе хлорацетил хлорида получали трет-бутил-(S)-3-(2-хлор-N-метилацетамидо)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-ил-карбамат (I-29): MS m/z: 890.30 (М+Н+);

На основе (Е)-4-(диметиламино)бут-2-еноил хлорида получали трет-бутил-(S)-3-((Е)-4-(диметиламино)-N-метилбут-2-енамидо)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-30): M/Z 924.3 (М+Н+);

На основе метакрилоил хлорида получали трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(N-метилметакриламидо)-1-оксопропан-2-илкарбамат (I-32): MS m/z: 881.3 (М+Н+);

На основе 2-хлор-2-фенилацетилхлорида получали трет-бутил-(2S)-3-(2-хлор-N-метил-2-фенилацетамидо)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-33): MS m/z: 965.20 (М+Н+);

На основе бут-2-иноилхлорида получали трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(N-метилбут-2-инамидо)-1-оксопропан-2-илкарбамат (I-51): MS m/z: 879.30 (M+H+);

На основе 2-(трифторметил) акрилоил хлорида получали трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(N-метил-2-(трифторметил)акриламидо)-1-оксопропан-2-илкарбамат (I-53): MS m/z: 935.30 (M+H+).

Пример 9

[00355] (2S,4R)-1-(2-акриламидоацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-27): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями согласно описанному ниже.

Промежуточное соединение 9-1

[00356] (2S,4R)-1-(2-т-бутоксикарбониламиноацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид: К раствору продукта Промежуточного соединения 4 согласно Примеру 1 (0.10 г, 0.15 мМоль) и N-Boc-глицина (0.035 г, 0.20 мМоль) в 3.0 мл ацетонитрила добавляли HATU (85.1 мг, 0.22 мМоль) и DIEA (0.09 мл, 0.5 мМоль) при RT при перемешивании. Реакционную смесь подвергали перемешиванию при комнатной температуре в течение 2 часов. Путем проведения анализов методом LC-MS и ТСХ было отмечено окончание реакции сопряжения. В смесь вливали 20 мл EtOAc и производили отмывку при помощи буфера (рН~4, AcONa/AcOH), NaHCO3 и солевого раствора, после чего высушивали над Na2SO4. После удаления растворителя неочищенный продукт пропускали через хроматографическую колонку с силикагелем (элюенты: EtOAc/гексан). Общее количество образованного соединения, указанного в заголовке, составляло 0.11 г: Rf 0.2 (EtOAc:гексан=2:1); MS m/z: 770.3 (M+H+).

Промежуточное соединение 9-2

[00357] (2S,4R)-1-(2-аминоацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид: Продукт Промежуточного соединения 9-1 (0.11 г, 0.13 мМоль) растворяли в 2 мл 4N HCl в диоксане и реакционную смесь перемешивали в течение 1 часа при RT. После удаления растворителей вливали 3 мл DCM, после чего производили выпаривание досуха. Процедуру добавления DCM с последующим выпариванием повторяли три раза с получением указанного в заголовке Промежуточного соединения 9-2 в форме его HCl соли (0.10 г). MS m/z: 670.2 (M+H+)).

Соединение I-27

[00358] (2S,4R)-1-(2-акриламидоацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-27): Указанное соединение получали путем сопряжения Промежуточного соединения 9-2 и акриловой кислоты при использовании HATU в соответствии с реакциями сопряжения, описанными для Промежуточного соединения 9-1. Общее количество образованного соединения, указанного в заголовке, составляло 0.10 г, 87%: Rf 0.5 (5% МеОН в DCM); MS m/z: 724.3 (M+H+).

[00359] Аналогичным образом, путем следования способам, описанным в Примере 9, были получены следующие соединения:

Соединение I-34

[00360] (2S,4R)-1-((S)-2-акриламидопропаноил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-34): Rf 0.4 (5% МеОН в DCM); MS m/z: 738.20 (M+H+).

Соединение I-43

[00361] (2S,4R)-1-(2-бут-2-инамидоацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-43): Rf 0.4 (5% МеОН в DCM); MS m/z: 736.2 (M+H+).

Соединение I-44

[00362] (2S,4R)-1-(2-метакриламидоацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-44): Rf 0.45 (5% МеОН в DCM); MS m/z: 738.3 (M+H+).

Соединение I-45

[00363] (2S,4R)-1-(2-((S,R)-2-хлор-2-фенилацетамидо)ацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-45): Rf 0.55 (5% МеОН в DCM); MS m/z: 822.3 (M+H+).

Соединение I-46

[00364] (2S,4R)-1-((R)-2-акриламидопропаноил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-46): Rf 0.4 (5% МеОН в DCM); MS m/z: 738.2 (M+H+).

Соединение I-47

[00365] (2S,4R)-1-(2-(Е)-бут-2-енамидоацетил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-47): Rf 0.45 (5% МеОН в DCM); MS m/z: 738.3 (M+H+).

Соединение I-24

[00366] трет-бутил-4-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-карбонил)пиперидин-4-илкарбамат (I-24): Rf 0.20 (10% МеОН в DCM); MS m/z: 839.3 (M+H+).

Соединение I-25

[00367] трет-бутил-1-(2-хлорацетил)-4-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-карбонил)пиперидин-4-илкарбамат (I-25): Rf 0.50 (10% МеОН в EtOAc); MS m/z: 915.3 (M+H+).

Соединение I-26

[00368] трет-бутил-1-акрилоил-4-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пиррооилидин-1-карбонил)пиперидин-4-илкарбамат (I-26): Rf 0.40 (5% МеОН в DCM); MS m/z: 893.4 (M+H+).

Соединение I-59

[00369] трет-бутил-(S)-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(4-фтор-3-нитрофенил)-1-оксопропан-2-илкарбамат (I-59): Rf 0.40 (5% МеОН в DCM); MS m/z: 923.3 (М+Н+).

Соединение I-63

[00370] (2S,4R)-1-(2-фтор-4-нитробензамидоацетил)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-63): Rf 0.61 (EtOAc/MeOH 10:1); MS m/z: 837.3 (M+H+).

Соединение IR-27

[00371] Путем приведения во взаимодействие с винилсульфонилхлоридом можно получить следующую структуру: (2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопрорпил)-1-(2-пропионамидоацетил)пирролидин-2-карбоксамид (IR-27): MS m/z: 726.30 (M+H+).

Пример 10

Соединение I-39

[00372] (2S,4R)-1-(2-акриламидоацетил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-39): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями согласно описанному в Примере 9, при использовании Промежуточного соединения 7-2 вместо Промежуточного соединения 4 на первом этапе.

[00373] MS m/z: 687.8 (M+H+).

трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-3-метил-1-оксобутан-2-илкарбамат (I-R): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями согласно описанному в Примере 9, при использовании Промежуточного соединения 7-2 вместо Промежуточного соединения 4, и Boc-L-валина вместо Вос-глицина на первом этапе.

[00374] MS m/z: 776.3 (M+H+).

[00375] Аналогичным образом, путем следования способам, описанным в Примере 10, получали следующие соединения:

Соединение I-37

[00376] (2S,4R)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)-1-(2-(N-метилакриламидо)ацетил)пирролидин-2-карбоксамид (I-37): MS m/z: 702.0 (M+H+).

Соединение I-38

[00377] Трет-бутил-2-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-2-оксоэтилкарбамат (I-38): MS m/z: 733.9 (M+H+).

Соединение I-48

[00378] (2S,4R)-1-(2-бут-2-инамидоацетил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-48): Rf 0.4 (5% МеОН в DCM); MS m/z: 700.20 (M+H+).

Соединение I-49

[00379] (2S,4R)-1-акрилоил-N-((1R,2S)-1-(циклопрпилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-49): MS m/z: 631.0 (M+H+).

Соединение I-54

[00380] (2S,4R)-1-((R)-2-акриламидопропаноил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-54): Rf 0.66 (10% МеОН в DCM); MS m/z: 702.30 (M+H+).

Соединение I-56

[00381] (2S,4R)-1-((R)-2-акриламидо-3-метилбутаноил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-56): Rf 0.61 (10% МеОН в DCM); MS m/z: 730.30 (М+Н+).

Соединение I-57

[00382] (2S,4R)-1-(2-(Е)-бут-2-енамидоацетил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-57): Rf 0.6 (10% МеОН в DCM); MS m/z: 702.2 (M+H+).

Соединение I-60

[00383] (2S,4R)-1-((S)-2-акриламидо-3-метилбутаноил)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-60): Rf 0.45 (5% МеОН в DCM); MS m/z: 766.3 (M+H+).

Соединение I-65

[00384] (2S,4R)-1-((R)-2-акриламидо-3,3-диметилбутаноил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-65): MS m/z: 744.30 (M+H+).

Соединение I-66

[00385] (2S,4R)-1-((R)-2-акриламидо-фенилацетил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-2-карбоксамид (I-66): MS m/z: 764.30 (M+H+).

Соединение I-67

[00386] т-бутил-(2S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсльтфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-5-((2R,3S)-2-метил-4-оксооксетан-3-иламино)-1,5-диоксопентан-2-илкарбамат (I-67): MS m/z: 889.2 (M+H+).

Соединение I-69

[00387] т-бутил-(2S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопрпилкарбамоил)-4-(7-метокси-2-фенилквинолиин-4-илокси)пирролидин-1-ил)-5-((3S)-2-оксооксетан-3-иламино)-1,5-диоксопентан-2-илкарбамат (I-69): MS m/z: 875.3 (M+H+).

Соединение I-70

[00388] т-бутил-(2S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-5-(2-оксоазетидинил)-1,5-диоксопентан-2-илкарбамат (I-70): MS m/z: 859.2 (М+H+).

Пример 11

Соединение I-31

[00389] (2S,4R)-1-((S)-3-акриламидо-2-(6-(5-((3aS,4S,6aR)-2-оксогексагидро-1Н-тиено[3,4-d]имидазол-4-ил)пентанамидо)гексанамидо)пропаноил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенисульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-31) Указанное соединение получали в соответствии с этапами и Промежуточными соединениями согласно описанному ниже.

Промежуточное соединение 11-1

[00390] (2S,4R)-1-((S)-3-акриламидо-2-аминопропаноил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид: К раствору продукта из Примера 1 (I-3) (30 мг, 0.04 мМоль) в 3 мл DCM добавляли капельным методом 0.5 мл TFA. Смесь подвергали перемешиванию при КТ в течение двух часов. После удаления растворителей вливали 5 мл DCM, после чего выпаривали реакционную смесь досуха. Процедуру добавления DCM с последующим выпариванием повторяли четыре раза. Затем добавляли толуол (4 мл) и удаляли его выпариванием, с образованием соединения, указанного в заголовке: MS m/z: 753.2 (М+Н+).

Соединение I-31

[00391] (2S,4R)-1-((S)-3-акриламидо-2-(6-(5-((3aS,4S,6aR)-2-оксогексагидро-1Н-тиено[3,4-d]имидазол-4-yl)пентанамидо)гексанамидо)пропаноил)-4-(7-метокси-2-фенилквинолин-4-илокси)-N-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид (I-31): Указанное соединение получали путем сопряжения Промежуточного соединения 11-1 с биотинилированной карбоновой кислотой () в соответствии с этапами, описанными для Промежуточного соединения 9-1 в Примере 9. MS m/z: 1092.4 (M+H+).

[00392] Аналогичным образом, при использовании продукта Промежуточного соединения 11-1, получали следующие соединения:

Соединение I-42

[00393] N1-((S)-3-акриламидо-1-((2S,4R)-4-(7-метокси-2-фенилквинолин-4-илокси)-2-((1R,2S)-1-(фенилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-ил)-N1,N5-диметил-N5-(проп-2-инил)глутарамид (I-42): Rf 0.45 (5% МеОН в DCM); MS m/z: 918.3 (M+H+).

[00394] Используя в качестве исходного соединение I-35 (Пример 1), путем последующего удаления TFA-boc способом, описанным выше, и с применением хлорциклопентил формата с образованием итогового амина, получали соединение I-55:

Соединение I-55

[00395] Циклопентил-(S)-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-55). Rf 0.59 (10% МеОН в EtOAc); MS m/z: 829.30 (M+H+).

[00396] Используя в качестве исходного соединение I-52 (Пример 7), путем последующего удаления TFA-boc способом, описанным выше, и с применением хлорциклопентил формата для ацилирования итогового амина, получали соединение I-72:

Соединение I-72

[00397] циклопентил-(S)-N-метил-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-72): Rf 0.40 (5% МеОН в DCM); MS m/z: 843.3 (M+H+).

[00398] Используя в качестве исходного соединение I-52 (Пример 7), путем последующего удаления TFA-boc способом, описанным выше, и с применением пиразин-2-кислоты и HATU для ацилирования итогового амина, получали соединение I-58:

Соединение I-58

[00399] (S)-N-3-(N-метил)акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксо-2-пропилпиразинкарбоксамид (I-58): Rf 0.35 (5% МеОН в DCM); MS m/z: 837.3 (M+H+).

[00400] Используя в качестве исходного соединение I-52 (Пример 7), путем последующего удаления TFA-boc способом, описанным выше, и с применением хлопропаргил формата для ацилирования образованного амина, получали соединение I-81:

Соединение I-81

[00401] Проп-2-инил-(S)-N-метил-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-81): MS m/z: 813.3 (M+H+).

[00402] Используя в качестве исходного соединение I-82 (Пример 7), путем последующего удаления TFA-boc способом, описанным выше, и с применением хлорциклопентил формата для ацилирования образованного амина, получали соединение I-85:

Соединение I-85

[00403] Циклопентил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-4-(N-метилакриламидо)-1-оксобутан-2-илкарбамат (I-85): MS m/z: 857.5 (M+1).

Пример 12

Соединение I-50

[00404] (Е)-((2R,3S)-3-(трет-бутоксикарбониламино)-4-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-4-оксобутан-2-ил) бут-2-еноат (I-50): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями, описанными ниже.

Промежуточное соединение 12-1

[00405] (2S,3R)-3-((Е)-бут-2-еноилокси)-2-(трет-бутоксикарбониламино)бутановая кислота:

К раствору Boc-L-треонина (0.44 г, 2.0 мМоль) в 10.0 мл DCM добавляли кротил хлорид (0.32 г, 3.0 мМоль) при RT, а затем - каталитически эффективное количество DMAP и TEA (1.0 мл, 6 мМоль). Реакционную смесь подвергали перемешиванию в течение 10 часов при RT. Для подавления реакции добавляли водный раствор NaHCO3 (10 мл). Через 2 часа производили медленное вливание 1N HCl до достижения значения РН ~3. После чего отбирали слой DCM, а водную фазу экстрагировали при помощи DCM (2Х 10 мл), органический слой высушивали над Na2SO4, фильтровали и удаляли растворитель с образованием неочищенного продукта.

Соединение I-50

[00406] (Е)-((2R,3S)-3-(трет-бутоксикарбониламино)-4-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-4-оксобутан-2-ил)бут-2-еноат (I-50): Указанное соединение получали путем сопряжения Промежуточного соединения 7-2 из Примера 7 и Промежуточного соединения 12-1 при помощи HATU, путем следования описанию реакций сопряжения для Промежуточного соединения 5 в Примере 1. Общее количество полученного соединения, указанного в заголовке, составляло 58 мг с ~40% выходом. Rf 0.5 (EtOAc); MS m/z: 846.0 (M+H+).

[00407] Аналогичным способом получали Соединение I-64, путем использования в качестве исходного Промежуточное соединение 7-2 (Пример 7):

Соединение I-64

[00408] т-бутил-(2S,3R)-3-акрилокси-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-1-оксобутан-2-илкарбамат (I-64): MS m/z: 832.2 (M+H+).

Пример 13

Соединение I-68

[00409] трет-бутан-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-илкарбамат: (I-68): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями описанным ниже способом:

Промежуточное соединение 13-1

[00410] (S)-2-(трет-бутоксикарбониламино)-7-метил-5-оксоокт-6-еновая кислота: К раствору N-Boc-пироглутаминовой кислоты (0.23 г, 1.0 мМоль) в 10.0 мл безводного THF медленно добавляли 2-метилпроп-1-енил-бромид магния (0.5 М в THF, 5 мл, 2.5 мМоль) при -78°С. Реакционную смесь подвергали перемешиванию в течение 1 часа при -78°С. Затем добавляли водный раствор 1N HCl (2.5 мл) и смесь медленно прогревали до RT: РН доводили ~3 при помощи 1N HCl. После чего производили удаление THF под вакуумом и оставшуюся водную фазу экстрагировали при помощи DCM (3Х 20 мл), органический слой высушивали над Na2SO4, фильтровали и удаляли растворитель с получением неочищенного продукта.

Соединение I-68

[00411] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-метокси-2-фенилквинолин-4-илокси)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-илкарбамат (I-68): Указанное соединение получали путем сопряжения Промежуточного соединения 7-2 из Примера 7 и Промежуточного соединения 13-1 при помощи HATU, путем следования описанию реакций для Промежуточного соединения 5 в Примере 1. Общее количество полученного соединения, указанного в заголовке, было равно 70 мг, 65%: Rf 0.5 (EtOAc); MS m/z: 844.2 (M+H+).

Пример 14

Соединение I-73

[00412] трет-бутил-(S)-3-акриламидо-1-((2S,4R)-4-(7-бромизоквинолин-1-илокси)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-73): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями описанным ниже способом.

Промежуточное соединение 14-1

[00413] (2S,4R)-4-(7-бромизоквинолин-1-илокси)-1-(3,3-диметилбутаноил)пирролидин-2-карбоксильная кислота: К раствору транс-4-гидрокси L-BOC-пролина (5 г, 21.6 мМоль) в DMSO (60 мл) при RT добавляли одну долю калия т-бутоксид (7.3 г, 65 мМоль). Смесь подвергали перемешиванию при RT в течение 30 минут, охлаждали на ледяной бане (~17°С) и добавляли 2 доли 7-бром-1-хлоризоквинолина (5.24 г, 21.6 моль). Реакционную смесь оставляли до достижения RT, перемешивали в течение 1 часа (окончание реакции отмечали при помощи метода LC-MS, более длительное время реакции может потребоваться при больших масштабах). Реакционную смесь вливали в 400 мл ледяной воды, содержащей 45 мМоль HCl. Проводили экстракцию реакционной смеси при помощи EtOAc, отмывку солевым раствором и высушивание над безводным Na2SO4. Далее, выпаривали растворитель с получением Промежуточного соединения 14-1 (~ 8 г). 1HNMR (DMSO-d6, 400 МГц) δ 8.32 (t, 1Н, J=0.8 Гц), 8.06 (d, 1H, J=5.2 Гц), 7.92 (dd, 2H, J=8.0, 1.6 Гц), 7.46 (d, 1H, J=6.0 Гц), 5.67 (br s, 1H), 4.40 (t, 1H, J=8.0 Гц), 3.77 (m, 1H), 3.65 (br d. 1H, J=12 Гц), 3.33 (s, 3H, OMe), 2.65 (m, 1H), 2.35 (m. 1H), 1.36 (s, 9H). LC/Ms: m/z 435 (M-1, ES-).

Промежуточное соединение 14-2

[00414] трет-бутил-(1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбонатамат: К раствору 500 мг (1R,28)-1-ВОС-амино-2-винилциклопропанкарбоновой кислоты (2.2 мМоль) в 4 мл DMA (М,Н-диметилацетамид) добавляли 370 мг карбонил диимидазола (CDI, 2.3 мМоль) при перемешивании. Реакционную смесь подвергали перемешиванию при RT в течение 1 часа, после чего добавляли к ней 280 мг циклопропилсульфонамида (2.3 мМоль), 1 мл диизопропилэтиламина и 350 мкл DBU. Образованную смесь подвергали перемешиванию при 60°С в течение ночи. Удаляли растворитель и, по отработанному способу, применяли 100 мл EtOAc, производили отмывку при помощи 10 мл 1.0N водного раствора HCl, высушивали над безводным Na2SO4. После концентрирования осадок подвергали очищению методом флэш-хроматографии, с получением 580 мг твердого соединения белого цвета. 1HNMR (CDCl3, 400 МГц) δ 9.7 (br s, 1H), 5.61 (m, 1H), 5.33 (br dd, 2H, J=9.6, 1.2 Гц), 5.18 (dd, J=9.6, 1.2 Гц), 2.92 (m, 1H) 2.14 (q, 1H, J=8.0 Гц). 1.91dd, 1H, J=8.4, 2.4 Гц), 1.55 (br s, 2H), 1.47 (s, 9H), 1.40 (m, 2H), 1.30 (m, 2H), 0.95-1.15 (m, 2H).

LC/MS: m/z 329.1, (M-1, ES-).

Промежуточное соединение 14-3

[00415] (1R,2S)-1-амино-N-(пиклопропилсульфонид)-2-винилциклопропанкарбоксамид:

К 580 мг Промежуточного соединения 14-2, полученного описанным выше способом, в 2 мл безводного дихлорметана добавляли 9 мл 4.0 М HCl в диоксане. Реакционную смесь подвергали перемешиванию при RT в течение 30 минут, затем концентрировали при пониженном давлении и высушивали под вакуумом с образованием, приблизительно, 532 мг соли Промежуточного соединения 14-3.

Промежуточное соединение 14-4

[00416] (2S,4R)-трет-бутил-4-(7-бромизоквинолин-1-илокси)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-карбоксилат:

Указанное соединение получали путем сопряжения Промежуточного соединения 14-1 и Промежуточного соединения 14-3 при помощи HATU, в соответствии с реакциями сопряжения, описанными для Промежуточного соединения 5 в Примере 1. Общее количество полученного Промежуточного соединения 14-4 составляло 435 мг (~67%). LC/MS: m/z 649.6 (ES+), m/z=647.6 (ES-).

Соединение I-73

[00417] трет-бутил-(S)-3-акриламидо-1-((2S,4R)-4-(7-бромизоквинолин-1-илокси)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-1-оксопропан-2-илкарбамат (I-73) получали из Промежуточного соединения 14-4 в соответствии со способами, описанными для синтеза Соединения 1-3 в Примере 1. Соединение очищали методом флэш-хроматографии с EtOAc в качестве элюента, с получением 93 мг соединения, указанного в заголовке. 1HNMR (CD3OD, 400 МГц) δ 8.30 (s, 1H), 8.01 (d, 1, J=5.6 Гц). 7.80 (dd, 1H, J=8.8, 2.0 Гц), 7.75 (d, 1H, J=8.8 Гц), 7.33 (d, 1H, J=5.6 Гц), 6.24 (br d, 2H, J=8.0 Гц), 5.92 (br s, 1H), 5.70-5.80 (m, 1H), 5.65 (dd, 1H, J=8.8, 3.2 Гц), 5.34 (d, 1H, J=18.4 Гц), 5.13 (d, 1H, J=12.0 Гц), 4.55-4.63 (m, 1H), 4.35 (m, 1H), 3.58 (dd, 1H, J=13.2, 5.2 Гц), 3.47 (m, 1H), 3.35 (m, 1H), 2.97 (m, 1H, 2.60 (dd, 1H, J=13.2, 6.8 Гц), 2.36 (m, 1H), 2.30 (q, 1H, J=8.4 Гц), 1.89 (dd, 1H, J=7.6, 5.2 Гц), 1.43 (dd, 1H, J=4.8, 8.4 Гц), 1.10-1.30 (m, 13H). LC/MS: m/z 787.2 (ES-).

[00418] При использовании аналогичным образом продукта Промежуточного соединения 14-4 получали соединение, структура которого приведена ниже, в соответствии со способами, описанными в Примере 9:

Соединение I-74

[00419] (2S,4R)-1-((R)-2-акриламидопропаноил)-4-(7-бромизоквинолин-1-илокси)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)пирролидин-2-карбоксамид: MS m/z: 674.0 (M+H+).

[00420] Следующее соединение получали при использовании продукта Промежуточного соединения 14-4 и Промежуточного соединения 13-1, в соответствии со способом, описанным в Примере 13:

Соединение I-75

[00421] трет-бутил-(S)-1-((2S,4R)-4-(7-бромизоквинолин-1-илокси)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-илкарбамат: 1HNMR (CD3OD, 400 МГц) δ 9.38 (s, 1H), 8.31 (d, 1H, J=0.8 Гц), 8.03 (d, 1, J=6.0 Гц), 7.80-7.75 (m, 2H), 7.33 (d, 1H, J=6.0 Гц), 6.20 (t, 1H, J=1.2 Гц), 5.92 (br s, 1H), 5.70-5.80 (m, 1H), 5.34 (dd, 1H, J=17.2, 1.6 Гц), 5.13 (d, 1H, J=11.6 Гц), 4.63 (m, 1H), 4.47 (d, 1H, J=11.6 Гц), 4.33 (t, 1H, J=6.8 Гц), 4.08-4.18 (m, 2H), 2.96 (m, 1H), 2.52-2.60 (m, 2H), 2.24-2.35 (m, 2H), 2.12 (s, 3H, Me), 2.00 (m, 1H), 1.90 (s+m, 4H, Ме+1Н), 1.80 (m, 1H), 1.40-1.43 (m, 1H), 1.25 (m, 1H), 1.17 (s, 9H), 1.05-1.15 (m, 2 H).

LC/MS: m/z 814.2 (ES-).

[00422] Следующее соединение получали при использовании продуктов Промежуточного соединения 14-4 и Промежуточного соединения 7-5, в соответствии со способом, описанным в Примере 7:

Соединение I-84

[00423] трет-бутил-(S)-1-((2S,4R)-4-(7-бромизоквинолин-1-илокси)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)пирролидин-1-ил)-3-(N-метилакриламидо)-1-оксопропан-2-илкарбамат (I-84): LC/MS: m/z: 801.1, 803.2 (ES-).

[00424] Путем использования в качестве исходного соединения 1-хлоризоквинолин вместо 7-бром-1-хлоризоквинолина в процессе синтеза Промежуточного соединения 14-1 и в соответствии с описанием этапа сопряжения из Примера 14 получали соединение I-97:

Соединение I-97

[00425] {1-(акрилоиламино-метил)-2-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(изоквинолин-1-илокси)-пирролидин-1-ил]-2-оксо-этил}-трет-бутиловый эфир карбаминовой кислоты (I-97) LC-MS: m/z=711.2 (ES+), 709.2 (ES-).

[00426] Путем использования в качестве исходного соединения 1-хлоризоквинолина вместо 7-бром-1-хлоризоквинолина в процессе синтеза Промежуточного соединения 14-1 и в соответствии с описанием этапа сопряжения из Примера 7 получали соединение I-98:

Соединение I-98

[00427] {1-[(акрилоил-метил-амино)-метил]-2-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(изоквинолин-1-илокси)-пирролидин-1-ил]-2-оксо-этил}-трет-бутиловый эфир карбаминовой кислоты (I-98) LC-MS: m/z=723.2 (ES-).

[00428] Путем использования в качестве исходного соединения 1-хлоризоквинолина вместо 7-бром-1-хлоризоквинолина в процессе синтеза Промежуточного соединения 14-1 и в соответствии с описанием этапа сопряжения из Примера 13 получали соединение I-86:

Соединение I-86

[00429] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(изоквинолин-1-илокси)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-илкарбамат (I-86): LC/MS: m/z: 736.3 (ES-).

[00430] Следующее соединение можно получить путем сопряжения Промежуточного соединения 14-4 и подходящей кислоты, полученной способом, аналогичным способу получения Промежуточного соединения 13-1, в соответствии со способом, описанным в Примере 13:

Соединение I-90

[00431] Следующее соединение можно получить путем сопряжения Промежуточного соединения 14-4 и подходящей кислоты, полученной способом, аналогичным способу получения Промежуточного соединения 13-1, в соответствии со способом, описанным в Примере 13:

Соединение I-91

[00432] {1-[4-(7-бром-изоквинолин-1-илокси)-2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-пирролидин-1-карбонил]-5-метил-4-оксо-гепт-5-енил}-трет-бутиловый эфир карбаминовой кислоты (I-91), LC-MS: m/z 838.0 (ES+, M+Na), 814.2 (ES-).

[00433] Путем использования в качестве исходного соединения 1-хлор-6-метоксиизоквинолина на этапе синтеза Промежуточного соединения 14-1, и в соответствии со способами, описанными выше, можно получать следующие соединения:

Соединение I-93

Соединение I-94

[00434] Путем использования в качестве исходного соединения 1-хлор-6-метоксиизоквинолина на этапе синтеза Промежуточного соединения 14-1, и в соответствии со способами, описанными выше, получали следующие соединения:

Соединение I-92

[00435] {1-(акриламино-метил)-2-[2-(1-циклопропансульфаниламинокарбонил-2-винил-циклопрпилкарбамоил)-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-1-ил]-2-оксо-этил}-трет-бутиловый эфир карбаминовой кислоты (I-92), LC-MS: m/z=741.2 (ES+).

Соединение I-95

[00436] {1-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-1-карбонил]-5-метил-4-оксо-гепт-5-енил}-трет-бутиловый эфир карбаминовой кислоты (I-95), LC-MS: m/z=768.2 (ES+)

Соединение I-96

[00437] {1-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-1-карбонил]-6-метил-4-оксо-гепт-5-енил}-трет-бутиловый эфир карбаминовой кислоты (I-96), LC-MS: m/z=768.2 (ES+).

Соединение I-99

[00438] {1-[(акрилоил-аллил-амино)-метил]-2-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-1-ил]-2-оксо-этил}-трет-бутиловый эфир карбаминовой кислоты (I-99), LC-MS: m/z=779.3 (ES-)

Соединение I-100

[00439] {2-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-1-ил]-1-метил-2-оксо-этил}-трет-бутиловый эфир карбаминовой кислоты (1-100), LC-MS: m/z=626.2 (ES+), 624.2 (ES-).

Соединение IR-100

[00440] (2S,4R)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(6-метоксиизоквинолин-1-илокси)-1-((R)-2-пропионамидопропаноил)пирролидин-2-карбоксамид (IR-100), LC-MS: m/z=628.2 (ES+), 626.2 (ES-).

Соединение I-101

[00441] {1-[2-(1-циклопропансульфониламинокарбонил-2-винил-циклопропилкарбамоил)-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-1-карбонил]-2-метил-пропил}-трет-бутиловый эфир карбаминовой кислоты (I-101), LC-MS: m/z=654.2 (ES+), 652.2 (ES-).

I-105

[00442] (2S,4R)-1-((R)-2-акриламидо-4-метилпентаноил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(6-метоксиизоквинолин-1-илокси)пирролидин-2-карбоксамид, MS m/z: 668.2 (M+H+).

I-106

[00443] (2S,4R)-1-((R)-2-акриламидо-3-фенилпропаноил)-N-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропил)-4-(6-метоксиизоквинолин-1-илокси)пирролидин-2-карбоксамид, MS m/z: 702.2 (М+Н+).

I-129

[00444] MS: m/e=754.2 (M+1)

[00445] Аналогичным способом, путем использования в качестве исходного соединение I-92, после чего проводили отщепление группы Вое, при осуществлении реакций сопряжения аналогично реакциям сопряжения для I-31, получали биотинилированные соединения.

I-103

[00446] 1-{3-акрилоиламино-2-[5-(2-оксо-гексагидро-тиено[3,4-d]имидазол-6-ил)-пентаноиламино]-пропионил}-4-(6-метокси-изоквинолин-1-илокси)-пирролидин-2-карбоксильная кислота (1-циклопропансульфониламинокарбонил-2-винил-циклопропил)-амид I-103, LC-MS: m/z=867.3 (ES+), 865.2 (ES-).

I-104

[00447] I-104, LC-MS: m/z=1183.4 (ES+), 1181.4 (ES-).

[00448] Путем использования в качестве исходного соединения (2S,4R)-1-(трет-бутоксикарбонил)-4-(5-(4-метоксифенил)-2Н-тетразол-2-ил)пирролидин-2-карбоновой кислоты, в соответствии со способами, описанными в Примере 14, получали следующее соединение:

I-108

[00449] трет-бутил-(S)-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(5-(4-метоксифенил)-2Н-тетразол-2-ил)пирролидин-1-ил)-1-оксопропан-2-илкарбамаг, MS m/z: 742.1 (M+H+).

[00450] Путем использования в качестве исходного соединения (2S,4R)-1-(трет-бутоксикарбонил)-4-(3-(тиофен-2-ил)квиноксалин-2-илокси)пирролидин-2-карбоновой кислоты, и в соответствии со способами, описанными в Примере 14, получали следующее соединение:

I-109

[00451] трет-бутил-(S)-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(3-(тиофен-2-ил)квиноксалин-2-илокси)пирролидин-1-ил)-1-оксопропан-2-илкарбамат, MS m/z: 794.2 (M+H+).

[00452] Путем использования в качестве исходного соединения (2S,4R)-1-(трет-бутоксикарбонил)-4-(5-(4-метоксифенил)-2Н-тетразол-2-ил)пирролидин-2-карбоновой кислоты, и в соответствии со способами, описанными в Примере 14 и Примере 13, получали следующее соединение:

I-107

[00453] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(5-(4-метоксифенил)-2Н-тетразол-2-ил)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-илкарбамат, MS m/z: 769.1 (М+Н+).

[00454] Путем использования в качестве исходного соединения (2S,4R)-1-(трет-бутоксикарбонил)-4-(3-(тиофен-2-ил)квиноксалин-2-илокси)пирролидин-2- карбоновой кислоты и в соответствии со способами, описанными в Примере 14 и Примере 13, получали следующее соединение:

I-110

[00455] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(3-(тиофен-2-ил)квиноксалин-2-илокси)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-ил карбамат, MS m/z: 821.2 (M+H+).

I-114

[00456] трет-бутил-(S)-1-((2S,4R)-2-((1R,2R)-1-(циклопропилсульфонилкарбамоил)-2-этилциклопропилкарбамоил)-4-(6-метоксиизоквинолин-1-илокси)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-ил карбамат. Аналогично, указанное соединение можно получить в соответствии со способами, применявшимися для соединения I-96 в Примере 14, при использовании в качестве исходного насыщенного Промежуточного соединения 14-2. Насыщенное Промежуточное соединение 14-2 можно получить путем применения катализируемой палладием реакции гидрогенизации Промежуточного соединения 14-2.

Пример 15

Соединение I-76

[00457] (S)-трет-бутил-3-(акриламидометил)-4-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-винилизоквинолин-1-илокси)пирролидин-1-ил)-4-оксобутаноат (I-76): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями, описанным ниже способом:

Промежуточное соединение 15-1

[00458] (2S,4R)-1-(трет-бутоксикарбонил)-4-(7-винилизоквинолин-1-илокси)пирролидин-2-карбоновая кислота: Промежуточное соединение 15-1 получали путем воздействия на Промежуточное соединение 14-1 винил-бороновой кислотой в условиях реакции Сузуки.

Соединение I-76

[00459] (S)-трет-бутид-3-(акриламидометил)-4-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-винилизоквинолин-1-илокси)пирролидин-1-ил)-4-оксобутаноат (I-76): Указанное соединение получали из Промежуточного соединения 15-1 в соответствии со способами, описанными в Примере 14. LC/MS: m/z 762.2 (M-1, ES-).

[00460] Приведенные ниже соединения также получали в соответствии с Примером 15, при использовании 2-тиофен-бороновой кислоты вместо винил-бороновой кислоты:

Соединение I-87

[00461] трет-бутил-(S)-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-(тиофен-2-ил)изоквинолин-1-илокси)пирролидин-1-ил)-7-метил-1,5-диоксоокт-6-ен-2-илкарбамат. LC/MS: m/z 818.2 (ES-).

Соединение I-88

[00462] циклопентил-(S)-3-акриламидо-1-((2S,4R)-2-((1R,2S)-1-(циклопропилсульфонилкарбамоил)-2-винилциклопропилкарбамоил)-4-(7-(тиофен-2-ил)изоквинолин-1-илокси)пирролидин-1-ил)-1-оксопропан-2-илкарбамат. LC/MS: m/z 805.2 (ES+).

Пример 16

Соединение I-77

[00463] (1R,2S)-N-1-циклопропилсульфонилкарбоксамидо-2-винилциклопропил-(2R,4S,7S,14Е)-7-акриламидометил-2Н-16,18-этено-2,5-метано-11Н-пиридо[2,3-k][1,10,3,6]диоксадиазациклононадецин-4-илкарбоксамид (I-77): Указанное соединение получали в соответствии с этапами и Промежуточными соединениями, описанными ниже:

Промежуточное соединение 16-1

[00464] метил (S)-2-амино-3-(2-нитрофенилсульфонамидо)пропаноатгидрохлорид: 1.2 г Промежуточного соединения 7-3 (Пример 7, 3.08 мМоль) в 30 мл МеОН при RT, барботировали в хлористоводородном газе до насыщения в МеОН. Образованную смесь подвергали перемешиванию в течение ночи, после чего концентрировали досуха при пониженном давлении с образованием Ме-сложноэфирной HCl соли Промежуточного соединения 16-1 с количественным выходом. 1HNMR (CD3OD, 400 МГц) δ 8.13 (m, 1H), 7.89 (m, 1H), 7.76 (m, 2H), 4.23 (t, 1H, J=4.4 Гц), 3.85 (s, 3Н, ОМе), 3.56 (t, 2H, J=5.6 Гц).

Промежуточное соединение 16-2

[00465] метил-(S)-2-(4-пентенилоксикарбониламино)-3-(2-нитрофенилсульфонамидо)пропаноат: К суспензии Промежуточного соединения 16-1 (полученного в соответствии с описанным выше) в 20 мл насыщенного водного раствора NaHCO3 и 20 мл THF, добавляли 6.4 мл 0.5 М раствора пент-4-енилкарбонохлоргидрат толуола. Образованную смесь подвергали перемешиванию при RT в течение 3 часов, затем ацилировали до значения рН ~ 3, экстрагировали при помощи EtOAc (40 мл х 2). Смешанный органический слой высушивали над безводным сульфатом натрия. Осадок, образованный после концентрирования, подвергали флэш-хроматорафии с силикагелем с образованием 890 мг желтоватого масла. 1HNMR (CDCl3, 400 МГц) δ 8.13 (m, 1H), 7.89 (m, 1H), 7.76 (m, 2H), 5.81 (m, 1H), 5.76 (t, 1H, J=6.4 Гц), 5.49 (br d, 1H), 5.05 (dq, 1H, J=2.0, 16.8 Гц), 5.00 (dq, 1H, J=1.5, 10.4 Гц), 4.43 (br q, 1H), 4.07 (t, 2H, J=7.2 Гц), 3.80 (s, 3Н), 3.55 (t, 2H, J=4.8 Гц), 2.13 (q, 2H, J=7.2 Гц), 1.72 (m, 2H).

Промежуточное соединение 16-3

[00466] (S)-2-(4-пентенилоксикарбониламино)-3-(2-нитрофенилсульфонамидо)пропановая кислота: К смеси 890 мг Промежуточного соединения 16-2 в вымешанном растворителе (THF/MeOH 10 мл/10 мл) добавляли 900 мг моногидрата гидроксида лития и 10 мл воды. Реакционную смесь подвергали перемешиванию при r.t. в течение 2 часов, затем закисляли до значения рН ~ 5. После чего реакционную смесь экстрагировали при помощи EtOAc (60 мл х 2) и высушивали над безводным сульфатом натрия. После концентрирования получали 860 мг бледно-желтого твердого соединения. 1HNMR (CDCl3, 400 МГц) δ 8.13 (m, 1H), 7.88 (m, 1H), 7.76 (m, 2H), 5.93 (br s, 1H), 5.81 (m, 1H), 5.67 (br d, 1H, J=6.0 Гц), 5.05 (dq, 1H, J=2.0, 18.4 Гц), 5.00 (dq, 1H, J=1.6, 10.0 Гц), 4.43 (br q, 1H), 4.11 (m, 2H), 3.58 (t, 2H, J=5.2 Гц), 2.11 (q, 2H, J=7.2 Гц), 1.75 (m, 2Н).

Промежуточное соединение 16-4

[00467] (2S,4R)-метил-4-(7-бромизоквинолин-1-илокси)пирролидин-2-карбоксилатгидрохлорид: Промежуточное соединение 15-1 из Примера 15 (~15 мМоль) растворяли в метаноле и 20 мл 4.0 M HCl в диоксане, перемешивание осуществляли в течение ночи (при помощи метода LC-MS было показано ~70% перехода (превращения)). После этого добавляли еще 20 мл 4.0 M HCl в диоксане, и реакцию продолжали в течение еще 18 часов. После чего реакционную смесь концентрировали; после фильтрации получали 4.0 г бледного белого твердого соединения (~70%). 1HNMR (CD3OD, 400 МГц) δ 8.51 (s, 1H), 8.03 (d, 1H, J=5.6 Гц), 7.86 (dd, 1H, J=8.0, 1.6 Гц), 7.80 (d, 1H, J=8.0 Гц), 7.41 (d, 1H, J=6.0 Гц), 5.96 (t, 1H, J=4.4 Гц), 4.86 (dd, 1H, J=8.4, 10.4 Гц), 3.88 (s, 3Н), 3.86 (dd, 1H, J=13.2, 4.8 Гц), 3.78 (d, 1H, J=13.2 Гц), 2.91 (qt, 1H, J=8.0, 1.2 Гц), 2.64 (dq, 1H, J=4.8, 14.8 Гц).

LC/MS: m/z 351.0, 353.0 (ES+)

Промежуточное соединение 16-5

[00468] (2S,4R)-метил-4-(7-бромизоквинолин-1-илокси)-1-((S)-3-(2-нитрофенилсульфонамидо)-2-((пент-4-енилокси)карбониламино)пропаноил)пирролидин-2-карбоксилат: К смеси, содержащей 812 мг Промежуточного соединения 16-4 (2.1 мМоль) и 860 мг Промежуточного соединения 16-3 (2.14 мМоль) в 30 мл ацетонитрила, добавляли 2 мл N,N-диизопропилэтил амина, а затем 1.0 г HATU (2.5 мМоль). Реакционную смесь подвергали перемешиванию при r.t. в течение 2 часов, затем подвергали отработанной процедуре и продукт очищали путем применения метода флэш-хроматографии с элюентом (гептан/EtOAc v/v 1:2), с образованием 1.18 г Промежуточного соединения 16-5 (77%). LC/MS: m/z 733.9, 735.0 (ES+); 732.0, 734.0 (ES-)

Промежуточное соединение 16-6

[00469] (2S,4R)-метил-1-((S)-3-(2-нитрофенилсульфонамидо)-2-((пент-4-енилокси)карбониламино)пропаноил)-4-(7-винилизоквинолин-1-илокси)пирролидин-2-карбоксилат: Раствор 1.10 г Промежуточного соединения 16-5 (1.5 мМоль) в толуоле продували потоком азота в течение 30 мин, после чего добавляли 660 мкл винил трибутилина (2.25 мМоль) и 200 мг тетракис(трифенилфосфорина) палладия. Образованную смесь нагревали при 100°С в течение 48 часов, затем охлаждали до комнатной температуры. Реакционную смесь фильтровали методом целитной хроматографии в короткой колонке и отмывали при помощи 50 мл EtOAc. Смешанный органический слой концентрировали и осадок подвергали флэш-хроматографии с силикагелем с элюентом (гептан/EtOAc v/v 1:2 to 1:3) с образованием приблизительно 520 мг указанного продукта. LC/MS: m/z 682.2 (ES+); 680.0 (ES-).

Промежуточное соединение 16-7

[00470] метил-(2R,4S,7S,14Е)-7-(2-нитробензолсульфонил)аминометил-2Н-16,18-этено-2,5-метан-11Н-пиридо[2,3-k][1,10,3,6]диоксадиазациклононадецин-4-илкарбоксилат: Раствор 350 мг Промежуточного соединения 16-6в 75 мл безводного дихлорэтана продували потоком азота в течение 30 мин, после чего добавляли 75 мг катализатора Граббса. Образованную смесь нагревали при 55°С в течение ночи и затем добавляли еще 50 мг реагента Граббса. Реакцию продолжали в течение еще 24 часов, по прошествии которых реакционную смесь охлаждали. Реакционную смесь концентрировали при пониженном давлении, и осадок подвергали флэш-хроматографии с силикагелем с элюентом (гептан/EtOAc v/v 1:1 to 1:3), с образованием 310 мг твердого соединения коричневого цвета.

Промежуточное соединение 16-8

[00471] (2R,4S,7S,14Е)-7-(2-нитробензолсульфонил)аминометил-2Н-16,18-этено-2,5-метано-11Н-пиридо[2,3-k][1,10,3,6]диоксадиазациклононадецин-4-илкарбоновая кислота: Промежуточное соединение 16-8 получали из Промежуточного соединения 16-7 в соответствии со способами, описанными для получения Промежуточного соединения 16-3. LC/MS: m/z 640.2 (ES+); 638.0 (ES-).

Промежуточное соединение 16-9

[00472] (1R,2S)-N-1-циклопропилсульфонилкарбоксамидо-2-винилциклопропил (2R,4S,7S,14Е)-7-(2-нитробензолсульфонил)аминомегил-2Н-16,18-этено-2,5-метано-11Н-пиридо[2,3-k][1,10,3,6]диоксадиазациклононадецин-4-илкарбоксамид: Промежуточное соединение 16-9 получали путем сопряжения Промежуточного соединения 16-8 и Промежуточного соединения 14-3 в соответствии со способами, описанными для получения Промежуточного соединения 16-5. (выход = 123 мг) LC/MS: m/z 852.1 (ES+); 850.2 (ES-).

Соединение I-77

[00473] (1R,2S)-N-1-циклопропилсульфонилкарбоксамидо-2-винилциклопропил (2R,4S,7S,14Е)-7-акриламидометил-2Н-16,18-этено-2,5-метано-11Н-пиридо[2,3-k][1,10,3,6]диоксадиазациклононадецин-4-илкарбоксамид (I-77): К раствору 12 мг Промежуточного соединения 16-9 в 1 мл DMF добавляли 40 мкл тиофенола и 50 мг карбоната калия. Смесь подвергали перемешиванию при RT в течение ночи, после чего разбавляли при помощи 10 мл EtOAc. Осадок подвергали фильтрации, фильтрат концентрировали и высушивали под вакуумом.

[00474] К осадку добавляли 3 мл ацетонитрила, 20 мг акриловой кислоты и 300 мкл N,N-диизопропилэтил амина, а затем - 100 мг HATU. Реакционную смесь подвергали перемешиванию при RT в течение 2 часов, после чего подвергали отработанной процедуре и осуществляли окончательную очистку смеси при помощи метода флэш-хроматографии с силикагелем (элюент - 5% метанол в EtOAc), с получением 9.5 мг соединения I-77. 1HNMR (CD3OD, 400 МГц) δ 9.14 (s, 1H), 8.44 (s, 1H), 7.87 (d, 2H, J=6.0 Гц), 7.72 (d, 1H, J=8.4 Гц), 7.55 (dd, 1H, J=8.8, 1.2 Гц), 7.27 (d, 1h, 6.0 Гц), 6.56 (d, 1H, J=15.6 Гц), 6.44 (m, 1H), 6.29 (d, 1H, J=10.8 Гц), 6.26 (d, 1H, J=4.4 Гц), 5.65-5.75 (m, 3Н), 5.28 (dd, 1H, J=1.2, 16.8 Гц), 5.09 (dd, 1H, J=2.0, 10.4 Гц), 4.80 (m, 1H), 4.40-4.48 (m, 2H), 4.00 (m, 2H) 3.50-3.70 (m, 2H), 2.95-3.01 (m, 1H), 2.19-2.35 (m, 4H), 1.80-1.90 (m, 2H), 1.20-1.50 (m, 5H), 1.10 (m, 2H). LC/MS: m/z 721.2 (ES+); 719.2 (ES-).

[00475] Аналогично, путем сочетания способов с описанным в Примере 7, получали следующее соединение:

(1R,2S)-N-1-циклопропилсульфонилкарбоксамидо-2-винилциклопропил (2R,4S,7S,14Е)-7-(N-метилакриламидометил-2Н-16,18-этено-2,5-метано-11Н-пиридо[2,3-k][1,10,3,6]диоксадиазациклононадецин-4-илкарбоксамид (I-83): LC/MS: m/z 735.2 (ES+).

[00476] Аналогичным способом получали следующие соединения:

Пример 17

[00477] (I-102), указанное соединение получали в соответствии с этапами и Промежуточными соединениями, описанными ниже:

Промежуточное соединение 17-1

[00478] 4-(7-винил-изоквинолин-1-илокси)-пирролидин-2-метилового эфира карбоновой кислоты гидрохлорид. Промежуточное соединение 17-1 получали путем перемешивания Промежуточного соединения 15-1 в насыщенном HCl метаноле в течение ночи. LC-MS: m/z=299.2 (ES+).

Промежуточное соединение 17-2

[00479] 2-бенизиловый эфир 1-пент-4-ениловый эфир 5-оксо-пирролидин-1,2-дикарбоновой кислоты (Промежуточное соединение 17-2). При 0°С к раствору 5.5 г бензилового эфира 5-оксо-пирролидин-2-карбоновой кислоты (25 мМоль), 4 мл триэтиламина, 3.3 г N,N-диметиламинопиридина (27 мМоль) в 40 мл дихлорметана добавляли 4.1 г 4-пентенил-1-илхлорформата (27.6 мМоль) при перемешивании. После этого реакционную смесь нагревали до комнатной температуры, и подвергали перемешиванию в течение выходных. После концентрирования образованную смесь растворяли в 120 мл этилового эфира, последовательно отмывали при помощи 30 мл 1.0N водного раствора HCl и солевого раствора, высушивали над безводным сульфатом натрия. Органический растворитель выпаривали при пониженном давлении и осадок подвергали очистке методом флэш-хроматографии с силикагелем с применением гептан/EtOAc (о/о 1/1), с образованием 7.3 г Промежуточного соединения 17-2 (88%) в виде неокрашенного масла. LC-MS: m/z=331.2 (ES+).

Промежуточное соединение 17-3

[00480] 1-пент-4-ениловый эфир 5-оксо-пирролидин-1,2-дикарбоновой кислоты (Промежуточное соединение 17-3).

К раствору 240 мг ацетата палладия (1.1 мМоль) под воздействием азота в 20 мл дегазированного дихлорметана добавляли 460 мкл триэтиламина (3.3 мМоль) и 5.33 мл триэтилсилана (33 мМоль) при перемешивании. После того, как перемешивание продолжали в течение 15 минут, добавляли 7.3 г Промежуточного соединения 17-2 в 25 мл дегазированного дихлорметана. Образованную смесь подвергали перемешиванию в течение ночи. Реакционную смесь пропускали через целитный слой, фильтрат концентрировали и подвергали очистке методом флэш-хроматографии с применением DCM/MeOH (v/v 9/1) в качестве элюента, с образованием 4.55 г неокрашенного масла (85%). LC-MS: m/z=240.1 (ES-).

Промежуточное соединение 17-4

[00481] 4-пент-4-ениловый эфир 2-(5-метил-3-оксо-гекс-4-енил)-янтарной кислоты (Промежуточное соединение 17-4). К раствору 1.0 г Промежуточного соединения 17-3 (4.0 мМоль) в 30 мл безводного THF под воздействием азота при -78°С добавляли 24 мл 0.5 М и смесь подвергали перемешиванию при -78°С в течение 1 часа, после чего добавляли 12 мл 1.0N безводной HCl. Затем производили нагревание до r.t. и экстракцию реакционной смеси при помощи 50 мл EtOAc, отмывку при помощи солевого раствора и высушивание над сульфатом натрия. Органический слой концентрировали с образованием 1.02 г Промежуточного соединения 17-4, которое возможно применять без дальнейшей очистки (86% выход). LC-MS: m/z=298.1 (ES+), 296.2 (ES-).

Промежуточное соединение 17-5

[00482] Метиловый эфир 1-(7-метил-5-оксо-2-пент-4-енилоксикарбониламино-окт-6-еноил)-4-(7-винил-изоквинолин-1-илокси)-пирролидин-2-карбоновой кислоты. Промежуточное соединение 17-5 получали при помощи реакции сопряжения Промежуточного соединения 17-1 и Промежуточного соединения 17-4 способом, аналогичным описанному в Примере 15. LC-MS: m/z=578.2 (ES+).

Промежуточное соединение 17-6

[00483] Промежуточное соединение 17-6 получали посредством олефиновой реакции обмена согласно описанному для Промежуточного соединения 16-7. LC-MS: 572.2 (М+Na+, ES+).

Промежуточное соединение 17-7

[00484] Промежуточное соединение 17-7. К смеси 420 мг Промежуточного соединения 17-6 (0.76 мМоль) в 6 мл т-BuOH и 3 мл THF добавляли 8 мл 1.0N раствора LiOH при перемешивании. После того, как перемешивание продолжали в течение 1 часа при комнатной температуре, раствор ацилировали до значения рН=5 при помощи 1.0N раствора HCl. Реакционную смесь экстрагировали при помощи 60 мл дихлорметана, отмывали солевым раствором и высушивали над безводным MgSO4. Смесь, образованную после фильтрации и концентрирования, можно напрямую применять на следующем этапе. (330 смолистого твердого соединения, 980%). LC-MS: m/z=534.2 (ES-).

I-102

[00485] (I-102). Указанное соединение получали путем сопряжения Промежуточного соединения 17-7 и Промежуточного соединения 14-3 в соответствии со способами, описанными для Промежуточного соединения 16-5, с образованием 223 мг розово-белого твердого соединения (53%). LC/MS: m/z 748.3 (ES+); 746.2 (ES-).

Пример 18

Экспрессия и очистка пептида одноцепочечной протеазы ВГС (wt)

[00486] Одноцепочечный протеолитический домен (NS4A21-32-GSGS-NS33-631) клонировали в клетки pET-14b (Novagen, Madison, WI) и трансформировали в клетки DH10B (Invitrogen). Образованную в результате плазмиду переносили в Escherichia coli BL21 (Novagen) для экспресии белка согласно описанному ранее (1, 2). Вкратце, культуры выращивали при 37°С в среде LB, содержащей 100 мкг/мл ампициллина до достижения величины оптической плотности при 600 им (OD600), равной 1.0, путем добавления изопропил-β-D-тиогалактопиранозида (IPTG) к 1 мМ. После дополнительного периода инкубации при 18°С в течение 20 часов собирали урожай клеток бактерий путем центрифугирования при 6,000×g в течение 10 минут и ресуспендирования в лизирующем буфере, содержащем 50 мМ Na3PO4, рН 8.0, 300 мМ NaCl, 5 мМ 2-меркаптоэтанола, 10% глицерола, 0.5% Igepal CA630 и смесь ингибиторов протеаз, содержащую 1 мМ фенилметилсульфонил фторида, 0.5 мкг/мл леупептина, перстатина А и 2 мМ бензамидина. Клетки лизировали методом замораживания-оттаивания с последующим разрушением ультразвуком. Клеточный детрит отделяли путем центрифугирования при 12,000×g в течение 30 минут. Супернатант подвергали дальнейшей очистке путем пропускания через 0.45-мкм фильтр (Coming) а затем - через HiTrap хелатирующую колонку, заряженную NiSO4 (Amersham Pharmacia Biotech). Связанный белок элюировали при помощи раствора имидазола в 100-до-500 мМ линейном градиенте. Отобранные фракции подвергали хроматографии в Ni2+колонке и анализировали в 10% натрий-додецил-сульфат (SDS)-полиакриламидном геле. Очищенный белок разделяли при помощи электрофореза в 12% SDS-PAGE (полиакриламидном) геле, после чего переносили на нитроцеллюлозную мембрану. После этого белок исследовали методом Вестерн-блоттинга с моноклональными антителами к NS3. Белки визуализировали при помощи набора для хемолюминесценции (Roche) с антителами козла к антителам мыши, конъюгированными с пероксидазой хрена (Pierce) в качестве вторичных антител. Отбирали аликвоты белка и хранили их при -80°С.

Пример 19

Клонирование и экспрессия устойчивых к лекарственным препаратам мутантов протеазы ВГС A156S, А156Т, D168A, D168V и варианта C159S

[00487] При помощи метода ПЦР получали фрагменты мутантной ДНК NS4A/NS3 и клонировали их в экспрессионный вектор рЕТ. После трансформации в компетентные клетки BL21 экспрессию индуцировали при помощи IPTG в течение 2 часов. Белки слияния, меченные гистидином, очищали методом аффинной хроматографии, а затем - методом эксклюзионной хроматографии.

Пример 20

[00488] Аналитический буфер: 2% CHAPS, 50 мМ Tris pH 7.5, 50% глицерол, 2 мкм М-2235 (Bachem) субстрата. К 50 мкл добавляли 49 мкл аналитического буфера, 1 мкл (1U) сериновой протеазы ВГС (Bioenza). Инкубировали в течение 20 минут при комнатной температуре. Регистрацию результатов на планшете производили как при 350/460 нм (возбуждение/эмиссия) на флуоресцентном аппарате для чтения микропланшетов, так и осуществляли считывание с 1-минутными интервалами с получением кинетической кривой.

[00489] Фермент переносил воздействие 1% ДМСО и 2% метанола. В других экспериментах по исследованию соединений согласно настоящему изобретению соединения разводили в 10 раз в чистом ДМСО с 20% метанолом (10% ДМСО и 20% метанол). Раствор этих соединений добавляли к реакционной смеси (не превышая 10% итогового объема реакции). Итоговая концентрация органических растворителей составляла: 1% ДМСО и 2% метанола.

Пример 21

Дополнительные протоколы исследований

Способ А:

[00490] Соединения исследовали с целью оценки противовирусной активности и цитотоксичности соединений in vitro с применением репликонов РНК ВГС. В исследовании использовали линию клеток ЕТ (luc-ubi-neo/ET), представляющими собой линию клеток гепатомы человека Huh7, содержащих репликон РНК ВГС со стабильным репортером люциферазы (Luc) и тремя клеточными адаптивными мутациями, несущими адаптивный характер для культуры. Уровни РНК ВГС напрямую измеряли путем применения вирус-специфической TaqMan RT-PCR:

Прямой праймер: ACGCAGAAAGCGTCTAGCCAT (SEQ ID NO:63)

Обратный праймер: TACTCACCGGTTCCGCAGA (SEQ ID NO:64)

Образец: [6-FAM]-CCTGGAGGCTGCACGACACTCAT-[TAMRA] (SEQ ID NO:65)

[00491] Линию клеток ЕТ выращивали в модифицированной питательной среде Дульбекко (DMEM), с 10% эмриональной бычьей сыворотки (FBS), 1% пенициллина-стрептомицина (pen-strep), 1% глутамина, 250 мкг/мл G418 в 5% инкубаторе с СО2 при 37°С. Все реагенты для культивирования получали в Mediatech (Manassas, VA). Клетки трипсинизировали (1% трипсин:ЭДТА) и наносили в количестве 5×103 клеток в лунке на 96-луночные аналитические планшеты (Costar) для измерений числа клеток (цитотоксичности) или противовирусной активности. Вносили препараты, в 3-кратных концентрациях в 6-лунок каждый, и проводили анализ в среде DMEM, 5% FBS (ФБР), 1% pen-strep, 1% глутамина. В качестве положительного контроля в каждом анализе применяли интерферон альфа-2b человека (PBL Biolabs, New Brunswick, NJ). По прошествии 72 часов после внесения препаратов клетки все еще были субконфлюентными. Противовирусную активность измеряли путем анализирования активности люциферазы, синтезированной с репликона при использовании Steady-Glo Luciferase Assay System (Promega, Madison, WI) в соответствии с инструкциями производителя. Число клеток в каждой лунке определяли путем применения реагента CytoTox-1 (Promega). Профиль соединения получали путем вычисления соответствующих значений ЕС50 (эффективная концентрация, при которой вирусная репликация ингибируется на приблизительно 50%), ЕС90 (эффективная концентрация, при которой вирусная репликация ингибируется на приблизительно 90%), IC50 (концентрация, при которой выживаемость клеток снижается до 50%) и SI50 (индекс селекции: ЕС50/IC50). Значения IC50 для некоторых соединений приведены ниже, в Таблице 5.

Способ В: исследование протеазы ВГС при помощи метода РПЭФ

[00492] Для определения ингибиторов протеазы ВГС NS3/4A применяли количественный метод на основе резонансного переноса энергии флуоресценции (РПЭФ). В анализе применяли синтетический пептид РПЭФ, полученный на основе сайта разрезания NS5A/5B ВГС, с протеазой ВГС для оценки активности соединений против протеазы, осуществлявшейся путем измерения расщепляющей активности комплекса. В синтетический пептид, содержащий участок соединения NS5A-5B (NH2-EDWCCSMSYK-COOH), вносили метку Dabcyl (диметиламинофенилазобензойной кислоты) и Edans по N- и С-концам, соответственно (Invitrogen, Carlsbad, CA). Измерения величины IC50 анализируемого соединения осуществляли измерения флуресценции. Два флуорофора образуют пару, гасящую флуоресценцию, и формируют РПЭФ внутри структуры интактного пептида. Флуоресценция восстанавливается после расщепления пептида, обнаруживающего РПЭФ, комплексом протеиназ ВГС NS3/4A (100 нг/мл), и возможно продолжительное измерение в спектре возбуждения/испускания = 340/490 нм.

Пример 22

Анализ Протеазы ВГС Методом РПЭФ, проводимый на Ферментах Дикого Типа и Мутанте NS3/4A 1b (IC50)

[00493] Протокол представляет собой модифицированный анализ на основе РПЭФ (v_02), взятый из In Vitro Resistance Studies of HCV Serine Protease Inhibitors, 2004, JBC, vol. 279, No. 17, pp 17508-17514. Специфическую эффективность соединений измеряли в отношении мутантов A156S, А156Т, D168A, и D168V протеолитического фермента ВГС NS3/4A 1b следующими способами.

[00494] 10Х раствора протеолитического фермента NS3/4A, Bioenza (Mountain View, СА) и 1.13Х 5-FAM/QXL™520 субстрата пептида РПЭФ Anaspec (San Jose, СА) помещали в 50 мМ HEPES, рН 7.8, с 100 мМ NaCl, 5 мМ DTT и 20% глицеролом. 5 мкл каждого фермента подвергали предварительной инкубации на 384-луночных, черных, необработанных микротитровальных планшетах Corning (#3573) (Coming, NY) в течение 30 минут при 25°C с 0.5 мкл 50% ДМСО и соединениями согласно настоящему изобретению, разведенными в параллелях в 50% ДМСО. Реакции протеаз начинали с добавления 45 мкл субстрата для РПЭФ и в течение 120 минут проводили измерения λех487/λem514 при помощи монохроматоров Quad4 в планшет-ридере Synergy4, BioTek (Winooski, VT). По результатам каждого анализа динамические кривые, полученные для каждой лунки, оценивали по линейным характеристикам реакции и статистическим значениям соответствия (R2, абсолютная сумма квадратов). Начальную скорость (от 0 минут до 30+ минут) для каждой реакции определяли по уклону графика зависимости относительных единиц флуоресценции от времени (в минутах), после чего строили график зависимости концентрации ингибитора для оценки величины IC50, на основе log[Ингибитор] vs Ответ, модель Вариабельного Уклона в GraphPad Prism, GraphPad Software (San Diego, СА).

[00495] В Таблице 5 показана активность некоторых соединений согласно настоящему изобретению в анализе методом РПЭФ. Номера соединений соответствуют номерам соединений в Таблице 3. Соединения, активность которых определена как "А", показывали IC50≤10 нМ; соединения, активность которых определена как "В", показывали IC50≥10 нМ и ≤100 нМ; соединения, активность которых определена как "С", показывали IC50>100 нМ и ≤1000 нМ; соединения, активность которых определена как "D", показывали IC50>1000 нМ и <10,000 нМ; и соединения, активность которых определена как "Е", показывали IC50≥10,000 нМ.

Таблица 5
Данные Ферментативной Активности Для Типичных Соединений
Анализируемое Соединение Фермент / Анализ Ингибирование
(I-1) Дикий Тип А
ВГС D168A D
(I-2) Биохимический С
Анализ Репликона1 С
Цитотоксичность Е
Дикий Тип А
ВГС A156S В
ВГС А156Т В
ВГС D168A D
ВГС D168V С
(I-3) Биохимический В
Анализ Репликона1 В
Цитотоксичность Е
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V В
(IR-3) Биохимический В
Анализ Репликона1 D
Цитотоксичность Е
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
(I-4) Анализ Репликона1 B
Цитотоксичность D
Дикий Тип А
Анализируемое Соединение Фермент / Анализ Ингибирование
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V В
(I-5) Анализ Репликона1 D
Цитотоксичность Е
Дикий Тип А
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
(I-6) Дикий Тип А
ВГС D168A С
(I-7) Биохимический В
Анализ Репликона1 В
Цитотоксичность Е
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V В
(I-8) Анализ Репликона1 С
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V В
(I-9) Анализ Репликона1 В
Цитотоксичность С
Дикий Тип А
Анализируемое Соединение Фермент / Анализ Ингибирование
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
(I-10) Анализ Репликона1 С
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V В
(I-11) Дикий Тип А
D168A С
(I-12) Анализ Репликона1 B
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V В
(I-13) Дикий Тип А
ВГС D168A С
(I-20) Анализ Репликона1 С
Цитотоксичность D
WT А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V С
(I-21) Дикий Тип А
ВГС D168A С
Анализируемое Соединение Фермент / Анализ Ингибирование
(I-22) Анализ Репликона1 С
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V С
(I-23) Анализ Репликона1 C
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т D
ВГС D168A С
ВГС D168V D
(I-24) Дикий Тип С
ВГС D168A D
(I-25) Анализ Репликона1 Е
Цитотоксичность С
Дикий Тип А
ВГС D168A В
(I-26) Анализ Репликона1 Е
Цитотоксичность Е
Дикий Тип А
ВГС D168A С
(I-27) Анализ Репликона1 В
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
Анализируемое Соединение Фермент / Анализ Ингибирование
ВГС D168V В
(IR-27) Дикий Тип С
ВГС D168A D
(I-28) Анализ Репликона1 А
Цитотоксичность D
Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
(I-29) Анализ Репликона1 В
Цитотоксичность С
Дикий Тип А
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
(I-30) Анализ Репликона1 В
Цитотоксичность Е
Дикий Тип А
ВГС D168A С
(I-31) Дикий Тип А
ВГС D168A В
(I-32) Анализ Репликона1 С
Цитотоксичность Е
Дикий Тип А
ВГС D168A D
(I-33) Анализ Репликона1 А
Цитотоксичность Е
Дикий Тип А
Анализируемое Соединение Фермент / Анализ Ингибирование
ВГС А156Т С
ВГС D168A С
ВГС D168V D
(I-34) Дикий Тип В
ВГС D168A D
(I-35) Анализ Репликона1 А
Цитотоксичность С
Дикий Тип А
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
(I-37) Дикий Тип В
ВГС D168A D
(I-38) Дикий Тип А
ВГС D168A С
(I-39) Анализ Репликона1 В
Цитотоксичность С
Дикий Тип А
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
(I-40) Дикий Тип В
ВГС D168A А
(I-41) Анализ Репликона1 Е
Цитотоксичность Е
Дикий Тип В
ВГС D168A D
(I-42) Анализ Репликона1 Е
Анализируемое Соединение Фермент / Анализ Ингибирование
Цитотоксичность Е
Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A В
ВГС D168V C
(I-43) Дикий Тип C
ВГС D168A D
(I-44) Дикий Тип В
ВГС D168A D
(I-45) Дикий Тип С
ВГС D168A D
(I-46) Анализ Репликона1 А
Цитотоксичность С
Дикий Тип А
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
(I-47) Анализ Репликона1 D
Цитотоксичность Е
Дикий Тип В
ВГС D168A D
(I-48) Анализ Репликона1 D
Цитотоксичность Е
Дикий Тип В
ВГС D168A D
(I-49) Дикий Тип В
ВГС D168A С
(I-73) ВГС R155K А
Анализируемое Соединение Фермент / Анализ Ингибирование
(I-74) ВГС R155K А
(I-75) ВГС R155K В
1 Данные получены в ходе анализа, описанного в Примере 21.

Пример 23

Анализ методом РПЭФ Протеазы ВГС Дикого Типа и Мутанта Фермента NS3/4A 1b (IC50_APP).

[00496] Приведенному ниже протоколу следовали для получения величин "кажущихся" IC50 (IC50_APP), приведенных ниже, в Таблице 6. Вне привязок к какой-либо конкретной теории, считают, что IC50_APP, по сравнению с величинами IC50, могут предоставить более применимые показатели ингибирования в зависимости от времени, и, следовательно, лучше описывают связывающую способность. Протокол представляет собой модифицированный анализ на основе РПЭФ (v_03), разработанный с целью оценки эффективности соединений, порядка и профилей устойчивости в отношении протеазы ВГС NS3/4A 1b дикого типа и мутантов C159S, A156S, А156Т, D168A, D168V, R155K следующим способом: 10Х раствора NS3/4A протеолитического фермента, Bioenza (Mountain View, СА) и 1.13Х 5-FAM/QXL™520 FRET субстрата пептида, Anaspec (San Jose, СА) помещали в 50 мМ Tris-HCl, pH 7.5, 5 мМ DTT, 2% CHAPS и 20% глицерол. 5 мкл каждого фермента вносили на 384-луночные, черные, микротитровальные планшеты Corning (#3575) (Corning, NY) после нанесения 0.5 мкл of 50% ДМСО и соединений, разведенных в параллелях, в 50% ДМСО. Реакции протеаз начинали непосредственно после добавления фермента, с добавлением 45 мкл субстрата РПЭФ, и измерения проводили в течение 60-90 минут при λех485/λem520 на планшет-ридере Synergy4, BioTek (Winooski, VT). По результатам каждого анализа динамические кривые, полученные для каждой лунки, оценивали по линейным характеристикам реакции и статистическим значениям соответствия (R2, 95% доверительные интервалы, абсолютная сумма квадратов). Начальную скорость (от 0 минут до 15 минут) для каждой реакции определяли по уклону графика зависимости относительных единиц флуоресценции от времени (в минутах), после чего строили график зависимости от концентрации в виде процентной доли от значения для контролей в отсутствие ингибитора и фермента для оценки кажущихся величин IC50 по log[Ингибитор] vs Ответ, Модель Вариабельного уклона в GraphPad Prism, GraphPad Software (San Diego, CA).

[00497] В таблице 6 показана активность некоторых соединений согласно настоящему изобретению в анализе методом РПЭФ. Номера соединений соответствуют номерам соединений в Таблице 3. Соединения, активность которых определена как "А", показали IC50≤10 нМ; соединения, активность которых определена как "В", показали IC50>10 нМ и ≤100 нМ; соединения, активность которых определена как "С", показали IC50>100 нМ и ≤1000 нМ; соединения, активность которых определена как "D", показали IC50>1000 нМ и <10,000 нМ; и соединения, активность которых определена как "Е", показали IC50≥10,000 нМ.

Таблица 6.
Данные по ферментативной активности примеров соединений согласно настоящему изобретению
Анализируемое соединение Фермент / Анализ
(I-3) Дикий Тип А
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 В
(I-4) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 C1
Анализируемое соединение Фермент / Анализ
(I-7) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 C1
(I-9) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
Анализ Репликона4 B
Анализ Репликона4 Е1
(I-12) Дикий Тип А
ВГС A156S А
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-22) Дикий Тип А
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 С
Анализ Репликона4 Е1
(I-27) Дикий Тип А
ВГС A156S А
Анализируемое соединение Фермент / Анализ
ВГС А156Т С
ВГС D168A С
ВГС D168V D
Анализ Репликона4 С
Анализ Репликона4 С1
(I-28) Дикий Тип А
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-30) Дикий Тип В
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-33) Дикий Тип А
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 А
Анализ Репликона4 B1
(I-35) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
Анализируемое соединение Фермент / Анализ
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-39) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
Анализ Репликона4 В
Анализ Репликона4 С1
(I-42) Дикий Тип B
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
Анализ Репликона4 Е
Анализ Репликона4 Е1
(I-46) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
Анализ Репликона4 А
Анализ Репликона4 А1
(I-50) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V D
Анализ Репликона4 А
Анализируемое соединение Фермент / Анализ
Анализ Репликона4 А1
(I-51) Дикий Тип В
ВГС D168A D
(I-52) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A D
ВГС D168V D
Анализ Репликона4 А
Анализ Репликона4 А1
(I-53) Дикий Тип А
ВГС A156S В
ВГС А156Т В
ВГС D168A С
ВГС D168V C
Анализ Репликона4 C
Анализ Репликона4 Е1
(I-54) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V С
Анализ Репликона4 А
Анализ Репликона4 А1
(I-55) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V С
Анализ Репликона4 А
Анализируемое соединение Фермент / Анализ
Анализ Репликона4 С1
(I-56) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
Анализ Репликона4 А
Анализ Репликона4 В1
(I-57) Дикий Тип С
ВГС D168A D
(I-58) Дикий Тип В
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 С
Анализ Репликона4 D1
(I-59) Дикий Тип А
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 С
Анализ Репликона4 D1
Анализируемое соединение Фермент / Анализ
(I-60) Дикий Тип В
ВГС A156S В
ВГС А156Т С
ВГС D168A D
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-61) Дикий Тип В
ВГС A156S В
ВГС А156Т D
ВГС D168A D
ВГС D168V D
Анализ Репликона4 С
Анализ Репликона4 D1
(I-62) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A D
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-63) Дикий Тип С
ВГС A156S С
ВГС А156Т D
ВГС D168A D
ВГС D168V D
(I-64) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
Анализируемое соединение Фермент / Анализ
ВГС D168V В
Анализ Репликона4 С
Анализ Репликона4 С1
(I-65) Дикий Тип с
ВГС A156S с
ВГС А156Т D
ВГС D168A D
ВГС D168V D
(I-66) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V С
Анализ Репликона4 B
Анализ Репликона4 C1
(I-67) Дикий Тип А
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
Анализ Репликона4 В
Анализ Репликона4 С1
(I-68) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V С
Анализ Репликона4 А
Анализ Репликона4 В1
(I-69) Дикий Тип А
Анализируемое соединение фермент / Анализ
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V С
(I-70) Дикий Тип А
ВГС A156S А
ВГС А156Т А
ВГС D168A А
ВГС D168V А
Анализ Репликона4 С
Анализ Репликона4 С1
(I-71) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V С
Анализ Репликона4 С
Анализ Репликона4 С1
(I-72) Дикий Тип А
ВГС A156S А
ВГС А156Т С
ВГС D168A С
ВГС D168V D
Анализ Репликона4 А
Анализ Репликона4 В1
(I-73) Дикий Тип А
ВГС A156S В
ВГС А156Т В
ВГС D168A С
ВГС D168V D
Анализируемое соединение Фермент / Анализ
ВГС R155K В
Анализ Репликона4 В
Анализ Репликона4 С1
(I-74) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V С
ВГС R155K B
Анализ Репликона4 B
Анализ Репликона4 B1
(I-75) Дикий Тип А
ВГС A156S В
ВГС А156Т С
ВГС D168A D
ВГС D168V С
ВГС R155K С
Анализ Репликона4 А
Анализ Репликона4 В1
(I-77) Дикий Тип А
ВГС A156S В
ВГС А156Т С
ВГС D168A С
ВГС D168V D
ВГС R155K В
Анализ Репликона4 А
Анализ Репликона4 В1
Анализируемое соединение Фермент / Анализ
(I-83) Дикий Тип В
ВГС D168A D
ВГС A156S D
ВГС R155K D
(I-84) Дикий Тип А
ВГС A156S С
ВГС А156Т С
ВГС D168A С
ВГС D168V D
Анализ Репликона4 В
Анализ Репликона4 С1
(I-85) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A В
ВГС D168V С
Анализ Репликона4 B
Анализ Репликона4 B1
(I-86) Дикий Тип А
ВГС A156S В
ВГС А156Т C
ВГС D168A C
ВГС D168V C
Анализ Репликона4 А
Анализ Репликона4 В1
(I-87) Дикий Тип А
ВГС A156S А
ВГС А156Т В
ВГС D168A С
ВГС D168V D
Анализируемое соединение Фермент / Анализ
Анализ Репликона4 А
Анализ Репликона4 В1
(I-88) Дикий Тип А
ВГС A156S В
ВГС R155K D
ВГС D168A С
ВГС R155K D
Анализ Репликона4 А
Анализ Репликона4 В1
(I-91) Дикий Тип А
ВГС A156S В
ВГС D168A D
ВГС R155K С
Анализ Репликона В2
Анализ Репликона С3
(I-92) Дикий Тип А
ВГС A156S А
ВГС В168А С
ВГС R155K В
Анализ Репликона В2
Анализ Репликона C3
(I-95) Дикий Тип А
ВГС A156S А
ВГС D168A С
ВГС R155K В
Анализ Репликона В2
Анализ Репликона C3
(I-96) Дикий Тип А
ВГС A156S А
ВГС D168A С
ВГС D168V С
Анализируемое соединение Фермент / Анализ
ВГС R155K В
ВГС С1598 А
ВГС А156Т В
Анализ Репликона А2
Анализ Репликона В3
(I-97) Дикий Тип А
ВГС A156S В
ВГС D168A С
ВГС R155K С
Анализ Репликона С2
Анализ Репликона C3
(I-98) Дикий Тип B
ВГС A156S B
ВГС D168A C
ВГС R155K C
Анализ Репликона B2
Анализ Репликона C3
(I-99) Дикий Тип А
ВГС A156S В
ВГС D168A D
ВГС R155K С
Анализ Репликона В2
(I-100) Дикий Тип А
ВГС A156S А
ВГС D168A В
ВГС R155K А
Анализ Репликона В2
(IR-100) Дикий Тип С
ВГС A156S С
ВГС D168A D
ВГС R155K D
Анализируемое соединение Фермент / Анализ
Анализ Репликона D2
(I-101) Дикий Тип А
ВГС A156S А
ВГС D168A С
ВГС R155K В
Анализ Репликона В2
(I-102) Дикий Тип А
ВГС A156S В
ВГС D168A D
ВГС R155K В
Анализ Репликона А2
Анализ Репликона В3
(I-103) Дикий Тип В
ВГС A156S B
ВГС D168A B
ВГС R155K C
Дикий Тип А
(I-104) ВГС A156S А
ВГС D168A В
ВГС R155K В
(I-105) Дикий Тип А
ВГС A156S А
ВГС D168A С
ВГС R155K В
ВГС C159S С
ВГС D168V C
ВГС А156Т А
(I-106) Дикий Тип А
ВГС A156S А
ВГС D168A С
ВГС R155K В
Анализируемое соединение Фермент / Анализ
ВГС C159S С
ВГС D168V С
ВГС А156Т А
(I-107) Дикий Тип А
ВГС A156S В
ВГС D168A D
ВГС R155K D
ВГС C159S В
Анализ Репликона С2
(I-108) Дикий Тип А
ВГС A156S В
ВГС D168A D
ВГС R155K D
ВГС C159S С
Анализ Репликона С2
(I-109) Дикий Тип А
ВГС A156S С
ВГС D168A D
ВГС R155K С
ВГС C159S С
Анализ Репликона С2
(I-110) Дикий Тип А
ВГС A156S С
ВГС D168A D
ВГС R155K С
ВГС C159S В
Анализ Репликона В2
(I-129) Дикий Тип А
ВГС A156S А
ВГС D168A С
ВГС R155K В
1 Обозначает величину IC90 (нМ).
2 Обозначает величину EC50 (нМ). Данные получены в ходе анализа, описанного в Примере 34.
3 Обозначает величину ЕС90 (нМ). Данные получены в ходе анализа, описанного в Примере 34.
4 Данные получены в ходе анализа, описанного в Примере 21.

Пример 24

[00498] Проводили масс-спектрометрический анализ ВГС дикого типа или варианта C159S в присутствии анализируемого соединения согласно настоящему изобретению. 100 пМоль ВГС дикого типа (Bioenza CA) инкубировали с анализируемым соединением в течение 1 часа и 3 часов при 10-кратном избытке (I-3) по отношению к белку. Отбирали аликвоты образца объемом 1 мкл (общий объем 4.24 мкл), разбавляли 10 мкл 0.1% ТФА, а затем при помощи наконечника пипетки ZipTip C4 наносили непосредственно на мишень MALDI с применением синапиновой кислоты в качестве матрицы для десорбции (10 мг/мл в 0.1% TFA:ацетонитрил 50:50). Анализы проводили на масс-спектрометре Shimadzu Biotech Axima TOF2 (Shimadzu Instruments) с время-пролетной лазерной ионизацией и десорбцией из матрицы (MALDI-TOF). При помощи способа, аналогичного описанному выше, анализировали 100 мМоль мутантной формы протеазы ВГС C159S, в течение 3 часов при 10-кратном избытке (I-3) по отношению к белку.

[00499] Интактный белок ВГС показал значение МН+ of 24465, соответствующие синапиновые (матричные) аддукты показали значения, приблизительно, на 200 Да выше. Произошло стехиометрическое включение соединения (I-3) (MW 852 Да), с образованием нового пика массы, выше на приблизительно 850-860 Да (МН+ 25320-25329). (Фигура 1), что соответствует включению одной молекулы (I-3). Как показано на Фигуре 1, значительную реакцию наблюдали даже по прошествии 1 часа при 10-кратной концентрации соединения, практически полное превращение происходило через 3 часа при 10-кратной концентрации. Вариант фермента C159S не показал признаков модификации, что подтверждает факт модификации Cys159 указанным соединением.

[00500] На Фигуре 11, 11А и 11В приведены данные по сравнению соединения 1-3 с его обратимым аналогом, соединением IR-3 и в сравнении с результатами в отсутствие соединения согласно настоящему изобретению с диким типом ВГС.

Пример 25

[00501] Как показано на Фигурах 2, 3, 4, и 5, проводили масс-спектрометрический анализ ВГС дикого типа или мутантов ВГС в присутствии анализируемых соединений согласно настоящему изобретению (I-3). Мутанты ВГС (A156S), (А156Т), (D168A), и (D168V) инкубировали в течение 1 часа и 3 часов в 10-кратном избытке (I-3) по отношению к белку. Аликвоты образца объемом 1 мкл разводили в 10 мкл 0.1% ТФА, а затем при помощи наконечника пиптетки ZipTip C4 наносили непосредственно на мишень MALDI с применением синапиновой кислоты в качестве матрицы для десорбции (10 мг/мл в 0.1% ТФА:ацетонитрил 50:50).

[00502] ВГС (A156S): как можно видеть на Фигуре 2, в сравнении с белком в отсутствие соединения согласно настоящему изобретению, белок, который инкубировали с (I-3), реагировал в значительной степени с образованием новых частиц при 25,340 МВт, что, приблизительно, на 855 Да тяжелее при согласовании с массой соединения (I-3) при 853 Да. Наблюдалось очень незначительное изменение в превращении между периодами протекания реакции длительностью в 1 час и 3 часа.

[00503] ВГС (А156Т): Как изображено на Фигуре 3, в случае мутанта ВГС (А156Т) практически полную реакционную способность наблюдали уже по прошествии 1 часа протекания реакции. В указанном случае также хорошо согласуется различие по массе новых частиц, - приблизительно 25,350, и не вступившего в реакцию мутанта - 24,498, равное 852 Да.

[00504] ВГС (D168A): Как изображено на Фигуре 4, для мутанта ВГС (D168A) практически полную реакционную способность наблюдали уже по прошествии 1 часа протекания реакции. В этом случае различие по массе между новыми частицами - 25,278 и не вступавшими в реакцию - 24,430 равно 848, также хорошо согласуется с массой I-3.

[00505] ВГС (D168V): Как изображено на Фигуре 5, для мутанта ВГС (D168V) полную реакционную способность наблюдали по прошествии 3 часов протекания реакции. В данном случае различия по массе между новыми частицами (25,305) и не вступавшим в реакцию мутантом (24,450) хорошо согласуется с массой I-3.

[00506] Как показано на Фигурах 6, 7, 8, 9, и 10, проводили масс-спектрометрический анализ ВГС дикого типа в присутствии анализируемых соединений I-7, I-8, I-4, I-9, и I-12, в ходе которого наблюдали характерные масс-спектрометрические сдвиги, ожидаемые при ковалентной модификации ВГС при помощи любого из подходящих соединений

Пример 26

[00507] Масс-спетрометрический анализ ВГС дикого типа (генотип 1b) в присутствии анализируемых соединений I-73 и I-75 согласно настоящему изобретению проводили в соответствии со следующим протоколом: ВГС NS3/4A дикого типа (wt) инкубировали в течение 1 часа при 10-кратном избытке анализируемого соединения по отношению к белку. Аликвоты образцов объемом 2 мкл разводили в 10 мкл 0.1% ТФА, а затем при помощи наконечника пипетки ZipTip C4 наносили непосредственно на мишень MALDI с применением синапиновой кислоты в качестве матрицы десорбции (10 ммл в 0.1% ТФА:ацетонитрил 50:50). Для измерения массы интактного белка прибор устанавливали в линейный режим с применением установок быстрого вывода 24,500, и стандартом для калибрации прибора служил апомиоглобин.

[00508] Как показано на Фигуре 13, через 1 час протекания реакции наблюдали практически полное преобразование в полипептид с другой массой. Первый пик массы на 25256 Да продемонстрировал увеличение массы, равное 789 Да, что находится в соответствии с массой I-73 (790 Да). Аналогично, для соединения I-73 ковалентную модификацию наблюдали при взаимодействии с мутантом D168A.

[00509] Как показано на Фигуре 14, через 1 час протекания реакции наблюдали переход на новый пик при МН+, равном 25282, что является на 815 Да тяжелее, и согласуется с массой I-75 (817 Да). Существенный переход также наблюдали для соединения I-75 в отношении мутанта D168A при протекании реакции в течение часа и дольше.

[00510] Соединение I-50 анализировали аналогичным способом и через час протекания реакции наблюдали значительную ковалентную модификацию ВГС NS3/4A wt.

Пример 27

[00511] Масс-спектрометрический анализ NS3/4A генотипов 1а, 1b, 2а, и 3а ВГС в присутствии анализируемого соединения I-96 согласно настоящему изобретению проводили в соответствии со следующим протоколом: NS3/4A ВГС инкубировали в течение 3 часов с 10-кратным избытком анализируемого соединения по отношению к белку. Аликвоты образцов объемом 2 мкл разводили в 10 мкл 0.1% ТФА, а затем при помощи наконечника пипетки ZipTip C4 наносили непосредственно на мишень MALDI с применением синапиновой кислоты в качестве матрицы для десорбции (10 мг/мл в 0.1% ТФА:ацетонитрил 50:50). Для измерения массы интактного белка прибор устанавливали в линейный режим с применением установок быстрого вывода 24,500, и стандартом для калибровки прибора служил апомиоглобин. Через три часа протекания реакции наблюдали значительную ковалентную модификацию NS3/4A каждого генотипа ВГС.

[00512] Анализ соединения I-27 осуществляли способом, аналогичным способу анализа NS3/4A ВГС wt (генотип 1b), и через три часа протекания реакции наблюдали практически полную ковалентную модификацию NS3/4A ВГС wt.

Пример 28

Модификация Cys159 протеазы ВГС дикого типа с применением метода триптического гидролиза

[00513] ВГС инкубировали с анализируемым соединением I-3 согласно настоящему изобретению в течение 3 часов, перед проведением триптического расщепления. В качестве алкилирующего агента после завершения инкубации соединения применяли иодоацетамид. Для триптических гидролизатов разводили аликвоты образцов объемом 2 мкл (0.06 мкг/мкл) в 10 мкл 0.1% ТФА, а затем при помощи наконечника пиптетки ZipTip C4 наносили непосредственно на мишень MALDI с применением альфа-циано-4-гидрокси-фенилакриловой кислоты в качестве матрицы (5 мг/мл в 0.1% ТФА:ацетонитрил 50:50).

[00514] Для анализа триптических гидролизатов прибор устанавливали в режим работы на отражение с применением установок быстрого вывода 1800. Калибрацию проводили при помощи стандарта Laser Biolabs Pep Mix (1046.54, 1296.69, 1672.92, 2093.09, 2465.20). Для анализа методом CID/PSD выбирали пептид с применением курсоров для установки временной регулировки ионных затворов, и фрагментацию наблюдали при силе излучения лазера, выше приблизительно на 20%, в качестве газа, применяемого для столкновения в CID, использовали Не. Калибровку для фрагментов проводили при помощи калибровки фрагментации P14R для Рефлектрона с искривленным полем.

[00515] Модификация появилась в составе триптического пептида AAVCTR. Масса модифицированного пептида находится в соответствии с массой пептида (MH+ 620.32) + I-3 (852.31)=1472.63. Больше ни одного модифицированного пептида не обнаружили ни в одном из различных гидролизатов. Анализ соединения методом CID при 853.20 показал фрагмент подписи на 252. См. Фигуру 12А.

Пример 29

Культура клеток

[00516] Huh-luc/neo-ET, Huh7-Lunet получали в ReBLikon Gmbh (Heidelberg, Germany). Клетки выращивали в модифицированной по методу Дульбекко среде Игла (DMEM; Invitrogen), с добавлением 2 мМ L-глутамина, заменимых аминокислот, 100 мкл пенициллина/мл, 100 мкг стрептомицина/мл и 10% эмбриональной бычьей сыворотки. G418 (Geneticin; Invitrogen) добавляли в итоговой концентрации 400 мкг/мл. Huh7-Lunet выращивали в отсутствии G418.

Пример 30

Мутантные конструкции

[00517] Конструкции, несущие клинически значимые мутации, создавали путем сайт-направленного мутагенеза в плазмиде pFK-I389-luc-ubi-neo-NS3-3'ET (ReBLikon Gmbh (Heidelberg, Germany)), при помощи Набора для Сайт-Направленного Мутагенеза QuickChange II (Stratagene, La Jolla, CA) в соответствии с инструкциями производителя, и с применением праймеров, описанных ниже в Таблице 7.

Таблица 7
Последовательности праймеров, которые применяли для создания линий клеток, несущих репликон.
NS3-A156S-F GCTGTGGGCATCTTTCGGTCTGCCGTGTGCACCCGAGGG SEQ ID NO:66
NS3-A156S-R CCCTCGGGTGCACACGGCAGACCGAAAGATGCCCACAGC SEQ ID NO:67
NS3-A156T-F GCTGTGGGCATCTTTCGGACTGCCGTGTGCACCCGAGGG SEQ ID NO:68
NS3-A156T-R CCCTCGGGTGCACACGGCAGTCCGAAAGATGCCCACAGC SEQ ID NO:69
NS3-D168A-F GGGGTTGCGAAGGCGGTGGCCTTTGTACCCGTCGAGTCT SEQ ID NO:70
NS3-D168A-R AGACTCGACGGGTACAAAGGCCACCGCCTTCGCA SEQ ID NO:71
АСССС
NS3-D168V-F GGGGTTGCGAAGGCGGTGGTCTTTGTACCCGTCGAGTCT SEQ ID NO:72
NS3-D168V-R AGACTCGACGGGTACAAAGACCACCGCCTTCGCAACCCC SEQ ID NO:73
NS3-C159S-F ATCTTTCGGGCTGCCGTGAGCACCCGAGGGGTTGCGAAG SEQ ID NO:74
NS3-C159S-R CTTCGCAACCCCTCGGGTGCTCACGGCAGCCCGAAAGAT SEQ ID NO:75
NS3-R155K-F CACGCTGTGGGCATCTTTAAGGCTGCCGTGTGCACCCGA SEQ ID NO:76
NS3-R155K-R TCGGGTGCACACGGCAGCCTTAAAGATGCCCACAGCGTG SEQ ID NO:77

Пример 31

Транскрипция in vitro

[00518] In vitro транскрипты +-цепей ВГС создавали в соответствии с протоколом, описанным у Lohmann V et al., J. Virol., 77:3007-3019, 2003. Для транскрипции плюс-цепей РНК ВГС плазмидную ДНК (pFK I341 PI-Luc/NS3-3'/ET, полученную в ReBLikon Gmbh (Heidelberg, Germany)), последовательно подвергали воздействию Asel и Seal. После рестрикционного расщепления экстрагировали ДНК при помощи фенола и хлороформа, осаждали при помощи этанола и растворяли в воде с отсутствием рибонуклеаз. Реакционная смесь для транскрипции in vitro состояла из 80 мМ HEPES (рН 7.5), 12 мМ MgCl2, 2 мМ спермидина, 40 мМ дитиотреитола, 3.125 мМ концентраций каждого нуклеозид трифосфата, 1 мкл РНКазина. Для реакции брали 5 мкг рестрицированной плазмидной ДНК и 80 мкл РНК-полимеразы Т7 (Promega). Через 2 часа инкубации полимеразы при 37°С вносили дополнительные 40 мкл Т7 и реакционную смесь инкубировали в течение еще 2 часов. Терминацию транскрипции осуществляли путем внесения 1 мкл ДНказы с отсутствием рибонуклеаз (Promega) на мкг плазмидной ДНК, после которого инкубировали смесь в течение 30 минут при 37°С. После экстракции при помощи кислого фенола и хлороформа РНК осаждали при помощи изопропанола и растворяли в воде в отсутствие РНКаз. Концентрацию определяли путем измерения оптической плотности при 260 нМ (OD260) и целостность РНК проверяли при помощи денатурирующего электрофореза в агарозном геле.

Пример 32

Трансфекция полноразмерного генома ВГС и селекция стабильных линий клеток

[00519] 7×104 Huh7-Lunet клеток культивировали в течение ночи на 12-луночном планшете, на следующий день трансфицировали 1 мкг РНК на лунку с применением набора Minis Tx (Madison, WI). Трансфекцию осуществляли в соответствии с инструкциями производителя и через 24 часа после трансфекции клетки подвергали Анализу Люциферазы или селекции при помощи G418 (400 мкг\мл) с получением стабильных линий клеток.

Пример 33

Ингибирование автопртеолиза протеазы

[00520] Клетки Huh-7-Luc-Neo-ET помещали в Среду для Анализа Структуры Репликона (RPMI с добавлением 5% ФБР, IX заменимых аминокислот и пенициллина/стрептомицина) с плотностью клеток, составляющей 1×105 клеток в лунке, на 12-луночные планшеты. Через восемь часов среду удаляли и замещали на 1 мл среды, содержащей анализируемое соединение согласно настоящему изобретению (5 лунок на соединение) и 0.02% ДМСО, поле чего клетки возвращали в инкубатор на ночь. По прошествии шестнадцати часов 1 лунку для каждого соединения и 1 необработанную лунку промывали ФБР, затем клетки лизировали и выскабливали в 30 мкл Буфера для Клеточной Экстракции (Biosource, Camarillo, CA) с добавлением Полного Ингибитора Протеаз (Roche, Indianapolis, IN). Остальные лунки дважды промывали ФБР и затем заполняли Средой для Анализа Структуры Репликона и помещали обратно в инкубатор. Клетки промывали один раз каждый час путем удаления старой среды и замещения ее на свежую среду и лизировали и собирали через 4, 12, 24, и 48 часа после первого сбора клеток.

[00521] Лизаты клеток разделяли при помощи SDS-Page (4-20%) и переносили на мембрану Immobilon-P PVDF (Millipore Corporation, MA) и проводили блоттинг при помощи моноклональных антител к NS3 (Bioenza, CA). Блоты сканировали при помощи инфракрасного сканера Odyssey, Licor, и бэнд FL и продукты расщепления подсчитывали отдельно при помощи Licor software, снабженного сканером. Продукт расщепления высчитывали как процент от общего содержания NS3 в каждом образце по отношению к контролю ДМСО при условии, что контроль ДМСО отражает 100% активность.

Результаты и Обсуждения

[00522] В результате ингибирования активности протеазы автопротеолиза не происходит, и единственными обнаруживаемыми белковыми частицами являются холоферменты. Через 16 часов непрерывного воздействия на клетки, несущие репликон, соединения-ингибитора NS3, продукты автопротеолиза не обнаруживались в подвергнутых обработке образцах, но с легкостью обнаруживались в не подвергнутых обработке клетках, несущих репликон, применявшихся в качестве контроля. Продленный срок действия демонстрировали путем подвергания клеток, несущих репликон, воздействию ингибитора протеазы в течение 16 часов, после чего соединение согласно настоящему изобретению удаляли, и клетки, несущие репликон, подвергали повторным отмывкам в течение еще нескольких часов. Ковалентные необратимые ингибиторы NS3 показали устойчивое ингибирование внутренней автопротеолтической активности NS3 в течение срока до 48 часов, в то время как при применении обратимых соединений автопротеолитическая активность протеазы быстро возвращалась (Фигура 17 и Фигура 18).

[00523] В частности, Фигуры 15 и 16 отражают активность люциферазы, в ходе анализа структуры репликона, в присутствии различных концентраций двух ингибиторов протеазы ВГС, Соединения I-R и Соединения I-50, в периоды, составляющие 24 часа, 48 часов и 96 часов. Соединение I-R представляет собой нековалентный ингибитор, а Соединение I-50 является необратимым ковалентным ингибитором. Несмотря на различия в механизме действия на протеазу двух указанных соединений, в ходе анализа структуры репликона получали сходные результаты по причине непрямого характера считывания данных.

[00524] На Фигуре 17 изображены два необратимых ковалентных ингибитора (соединение I-96 и соединение I-102) протеазы NS3, показавших продленный срок ингибирования активности протеазы NS3 в клетках дикого типа, несущих репликон, который измеряли по величине автопротеолиза, после удаления указанных соединений. Соединения инкубировали с клетками, несущими репликон, в течение 16 часов, после чего соединения удаляли (временная точка 0). Даже в течение срока до 48 часов после удаления необратимых ковалентных ингибиторов NS3, степень ингибирования автопротеолитической активности NS3 достигала по меньшей мере 50%, в то время как при применении препарата с обратимым действием, VX-950, практически полное возвращение активности наблюдали уже через 4 часа после удаления препарата.

[00525] На Фигуре 18 приведен другой ковалентный ингибитор протеазы NS3, соединение I-54, показавший продленный срок ингибирования активности протеазы NS3 в клетках дикого типа, несущих репликон, который измеряли через длительность автопротеолиза, достигавшую срока 24 часа после удаления соединения. Соединение I-54, представляющее собой необратимый ковалентный ингибитор, показывает практически полное ингибирование на срок до 24 часов после удаления соединения, в то время как обратимый препарат, VX-950, показывает полное возвращение активности уже через 4 часа после удаления препарата.

[00526] На Фигуре 19 приведен ковалентный ингибитор протеазы, соединение I-54, показавший продленный срок ингибирования активности протеазы NS3 в модифицированной системе репликона, где протеаза NS3 несет наблюдаемую в клинике мутацию замены аминокислоты аргинина на лизин в 155 положении (R155K). Указанная мутация ведет к появлению устойчивости к препаратам ингибиторов протеаз. На Фигуре 19 показано, что, несмотря на наличие такой мутации, препараты необратимых ковалентных ингибиторов могут ингибировать активность мутантной протеазы по меньшей мере в течение 24 часов после удаления соединения.

Пример 34

Анализ Люциферазы

[00527] Соединения согласно настоящему изобретению исследовали с целью оценки противовирусной активности и цитотоксичности соединений в ходе анализа активности люциферазы, синтезированной с репликона. В анализе применяли линию клеток ЕТ (luc-ubi-neo/ET), представляющими собой линию клеток Huh7 гепатомы человека, содержащую РНК репликон ВГС с устойчивым репортером люциферазы (Luc) и мутациями, несущими адаптивный характер для клеток. Линию клеток ЕТ культивировали в инкубаторе с 5% CO2 при 37°С в модифицированной питательной среде Дульбекко (DMEM) с добавлением 2 мМ L-глутамина, заменимых аминокислот, 100 мкл пенициллина/мл, 100 мкг стрептомицина/мл, и 10% эмбриональной бычьей сыворотки. G418 (Geneticin; Invitrogen) добавляли в итоговой концентрации 400 мкг/мл.

[00528] Все реагенты для культур клеток получали в Invitrogen (Carlsbad). Клетки трипсинизировали (1% трипсин: ЭДТА) и помещали в концентрации, составляющей 5×103 клеток в лунке, на 96-луночные аналитические планшеты (Costar) с целью измерения числа клеток (цитотоксичность) или исследования противовирусной активности. Анализируемые соединения добавляли в 3-кратной концентрации в 6 лунок каждое, и анализ проводили в среде DMEM, 5% ФБР, 1% пен-стреп, 1% глутамин, 1% заменимые аминокислоты. В качестве положительного контроля в каждой постановке применяли интерферон альфа-2b человека (PBL Biolabs, New Brunswick, NJ). По прохождении 72 часов обработки клеток, после внесения анализируемого соединения, все клетки были субконфлюэнтными. Антивирусную активность измеряли путем анализа активности люциферазы, синтезированной с репликона, при применении Системы Анализа Люциферазы Steady-Glo (Promega, Madison, WI) в соответствии с инструкциями производителя. Число клеток в каждой лунке определяли при помощи АнализаТитра Клеток Blue (Promega). Профиль соединения получали путем вычисления соответствующих величин EC50 (эффективная концентрация, при которой степень ингибирования репликации вируса достигает, приблизительно, 50%), ЕС90 (эффективная концентрация, при которой степень ингибирования репликации вируса достигает, приблизительно, 90%), IC50 (концентрация, снижающая жизнеспособность клеток, приблизительно до) и SI50 (селективный индекс: ЕС50/IC50).

[00529] Хотя мы описали несколько вариантов реализации настоящего изобретения, очевидно, что основные примеры, приведенные нами, можно видоизменить с созданием других вариантов реализации, предусматривающих применение соединений и способов согласно настоящему изобретению. Таким образом, следует понимать, что объем настоящего изобретения определяется скорее прилагаемой формулой, чем отдельными вариантами реализации, представленными в примерах.

1. Соединение формулы I

или фармацевтически приемлемая соль указанного соединения, где
R1 и R1' вместе образуют 3-7-членное карбоциклическое кольцо, возможно замещенное C1-6алкилом или С2-6алкенилом;
R2a представляет собой -OH или -NHSO2R2;
R2 представляет собой С3-7циклоалкил, 6-10-членный арил, возможно замещенный С2-6алкинилом;
каждый R независимо представляет собой водород или C1-6алифатическую группу;
R3 представляет собой головную группу -L-Y, причем головная группа -L-Y выбрана из (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) и (k):
(a) L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и одно или два дополнительных метиленовых звена в составе L независимо замещены функциональной группой, выбранной из -NRC(O)-, -OC(O)- или -C(O)-, при этом по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы; и Y представляет собой водород или C1-6 алифатическую группу, возможно замещенную галогеном или CN; или
(b) L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено функциональной группой, выбранной из -C(O)-, -NRC(O)- или -OC(O)-, при этом по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы, и одно или два дополнительных метиленовых звена в составе L возможно и независимо замещены -N(R)-; и Y представляет собой водород или C1-6 алифатическую группу, возможно замещенную галогеном или CN; или
(c) L представляет собой бивалентную С2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено функциональной группой -C(O)-, при этом по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы, и одно или два дополнительных метиленовых звена в составе L возможно и независимо замещены -N(R)-; и Y представляет собой водород или C1-6 алифатическую группу, возможно замещенную галогеном или CN; или
(d) L представляет собой бивалентную С2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну алкилидениловую двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено функциональной группой -C(O)-, при этом по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы; и Y представляет собой водород или C1-6 алифатическую группу, возможно замещенную галогеном или CN; или
(e) L представляет собой бивалентную С2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну тройную связь, и одно или два дополнительных метиленовых звена в составе L возможно и независимо замещены на -NRC(O)-; и Y представляет собой водород или C1-6 алифатическую группу, возможно замещенную галогеном или CN; или
(f) L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем одно метиленовое звено в составе L замещено циклопропиленом, и одно или два дополнительных метиленовых звена в составе L независимо замещены -NRC(O)-; и Y представляет собой C1-6 алифатическую группу, возможно замещенную галогеном или CN; или
(g) L представляет собой ковалентную связь, и Y представляет собой С2-6алкенил, замещенный оксо; или
(h) L представляет собой -C(O)-, и Y представляет собой C2-6алкенил; или
(i) L представляет собой -N(R)C(O)-, и Y выбран из:
(i) С2-6алкенила; или
(ii) C2-6алкинила; или
(iii) 6-членного ароматического кольца, при этом указанное кольцо замещено 1-4 группами Re; или
(j) L представляет собой бивалентную C1-8 насыщенную или ненасыщенную углеводородную цепь, которая может быть линейной или разветвленной, и Y выбран из:
(i) C2-6алкенила, замещенного оксогруппой; или
(ii) насыщенного 3-4-членного гетероциклического кольца, содержащего один гетероатом, представляющий собой кислород; или
(iii) частично ненасыщенного 4-6-членного гетероциклического кольца, имеющего 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, при этом указанное кольцо замещено 1-4 группами Re; или
(iv) 6-членного ароматического кольца, замещенного 1-4 группами Re; или
(v) 8-10-членного бициклического насыщенного, частично ненасыщенного или арильного кольца, содержащего 0-3 гетероатома, независимо выбранных из азота, кислорода или серы, при этом указанное кольцо замещено 1-4 группами Re; или
(k) L представляет -CH2-, -NH-, -CH2NH- или -CH2NHC(O)-, и Y выбран из:
(i) -CH2Cl; или
(ii) C2-6алкенила, возможно замещенного оксогруппой; или
(iii) C2-6алкинила, возможно замещенного оксогруппой; или
(iv) насыщенного 3-4-членного гетероциклического кольца, содержащего один гетероатом, представляющий собой кислород, при этом указанное кольцо замещено 1-2 группами Re; или
(v) насыщенного 3-6-членного карбоциклического кольца, при этом указанное кольцо замещено 1-4 группами Re; или
(vi) частично ненасыщенного 4-6-членного гетероциклического кольца, содержащего 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, при этом указанное кольцо замещено 1-4 группами Re; или
(vii) 8-10-членного бициклического насыщенного, частично ненасыщенного или арильного кольца, содержащего 0-3 гетероатома, независимо выбранных из азота, кислорода или серы, при этом указанное кольцо замещено 1-4 группами Re; каждая группа Re независимо выбрана из оксогруппы, NO2, галогена или CN;
или
R3 и кольцо, образованное R1 и R1', совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы, причем образованное таким образом кольцо содержит головную группу -L-Y;
Rw представляет собой водород;
Rx представляет собой -T-Rz где:
Т представляет собой ковалентную связь или бивалентную C1-6 углеводородную цепь, причем одно или два метиленовых звена в составе Т возможно и независимо замещены на -O-, -C(O)-, -C(O)O-; и
Rz представляет собой 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, при этом Rz возможно замещен галогеном, C2-6алкенилом, C1-6алкокси, 5-6-членным гетероарилом, содержащим 1-2 гетероатома, выбранных из азота, кислорода или серы, конденсированным 6-10-членным арилом, который возможно замещен фтором, или 6-10-членным арилом, возможно замещенным C1-6алкокси;
Rx' представляет собой водород;
Ry представляет собой водород;
R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, боковую группу природной или неприродной аминокислоты, причем боковая группа представляет собой боковую группу аланина, валина или фенилаланина; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы;
или
Т представляет собой -OC(O)-,
Rz представляет собой 8-10-членное бициклическое кольцо, содержащее по меньшей мере один атом азота,
R4 представляет собой -NHC(O)OR6,
R6 представляет собой возможно содержащую заместители C1-6 алифатическую группу, и
R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы;
каждый R5 представляет собой 5-10-членный гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или C1-6 алифатическую группу, замещенную (i) - (CH2)0-4N(Ro)C(O)Ro или (ii) - (CH2)0-4Ro и -(CH2)0-4S(Ro), при этом два Ro совместно образуют 3-12-членное насыщенное бициклическое кольцо, содержащее 0-4 гетероатома, выбранных из азота, кислорода или серы, и при этом R° представляет собой C1-6 алифатическую группу; и
R6 представляет собой C1-6 алифатическую группу.

2. Соединение по п.1, отличающееся тем, что указанное соединение соответствует формуле II-a или II-b

или фармацевтически приемлемая соль указанного соединения.

3. Соединение по п.1, отличающееся тем, что указанное соединение соответствует формуле III-a или III-b

или фармацевтически приемлемая соль указанного соединения, где
R4 представляет собой Н, -NHC(O)OR6, боковую цепь природной или неприродной аминокислоты, причем боковая цепь представляет собой боковую цепь аланина, валина или фенилаланина; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы.

4. Соединение по п.1, отличающееся тем, что указанное соединение соответствует формуле IV-a или IV-b

или фармацевтически приемлемая соль указанного соединения, где
R4 представляет собой Н, -NHC(O)OR6 или боковую цепь природной или неприродной аминокислоты, причем боковая цепь представляет собой боковую цепь аланина, валина или фенилаланина; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы.

5. Соединение по п.1, отличающееся тем, что указанное соединение соответствует формуле VIII-a или VIII-b

или фармацевтически приемлемая соль указанного соединения.

6. Соединение по п.1, отличающееся тем, что
L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну тройную связь, и одно или два дополнительных метиленовых звена в составе L возможно и независимо замещены на -NRC(O)-, и
Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей галоген или CN.

7. Соединение по п.6, отличающееся тем, что L представляет собой -NHC(O)C≡CCH2CH2-.

8. Соединение по п.1, отличающееся тем, что
L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем одно метиленовое звено в составе L замещено на циклопропилен, и одно или два дополнительных метиленовых звена в составе L независимо замещены на -NRC(O)-; и
Y представляет собой C1-6 алифатическую группу, возможно содержащую в качестве заместителей галоген или CN.

9. Соединение по п.1, отличающееся тем, что Y выбран из:

10. Соединение по п.1, отличающееся тем, что R3 выбран из





11. Соединение формулы I

или фармацевтически приемлемая соль указанного соединения, где:
R1 и R1' совместно образуют 3-7-членное карбоциклическое кольцо, возможно замещенное C1-6алкилом или C2-6алкенилом;
R2a представляет собой -OH или -NHSO2R2;
R2 представляет собой C3-7циклоалкил, 6-10-членный арил, возможно замещенный C2-6алкинилом;
каждый R независимо представляет собой водород или C1-6 алифатическую группу;
R3 представляет собой -L-Y, где
L представляет собой бивалентную насыщенную или ненасыщенную линейную или разветвленную C1-8 углеводородную цепь, причем одно, два или три метиленовых звена в составе L возможно и независимо замещены на -N(R)C(O)- или -C(O)N(R)-;
Y представляет собой 3-10-членное моноциклическое или бициклическое насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатома, независимо выбранных из азота, кислорода или серы, и причем указанное кольцо содержит в качестве заместителей 1-4 группы Re; и
каждый Re независимо выбран из -Q-Z, оксогруппы, NO2, галогена или CN,
где
Q представляет собой ковалентную связь; и
Z представляет собой водород или C1-6 алифатическую группу;
или
R3 и кольцо, образованное R1 и R1', совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы, причем образованное таким образом кольцо содержит головную группу -L-Y;
Rw представляет собой водород;
Rx представляет собой -T-Rz, где
Т представляет собой бивалентную C1-6 углеводородную цепь, причем одно или два метиленовых звена в составе Т возможно и независимо замещены на -O-, -C(O)-, -C(O)O-; и
Rz представляет собой 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, при этом Rz возможно замещен галогеном, C1-6алкенилом, C1-6алкокси, 5-6-членным гетероарилом, содержащим 1-2 гетероатома, выбранных из азота, кислорода или серы, конденсированным 6-10-членным арилом, который возможно замещен фтором, или 6-10-членным арилом, возможно замещенным C1-6алкокси;
Rx' представляет собой водород;
Ry представляет собой водород;
R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, боковую группу природной или неприродной аминокислоты, причем боковая группа представляет собой боковую группу аланина, валина или фенилаланина; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатома, независимо выбранных из азота, кислорода или серы;
или
Т представляет собой -OC(O)-,
Rz представляет собой 8-10-членное бициклическое кольцо, содержащее по меньшей мере один атом азота,
R4 представляет собой -NHC(O)OR6,
R6 представляет собой возможно содержащую заместители C1-6 алифатическую группу,
R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы;
каждый R5 представляет собой 5-10-членный гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или C1-6 алифатическую группу, замещенную (i) - (CH2)0-4N(Ro)C(O)Ro или (ii) - (CH2)0-4Ro и -(CH2)0-4S(Ro), при этом два Ro совместно образуют 3-12-членное насыщенное бициклическое кольцо, содержащее 0-4 гетероатома, выбранных из азота, кислорода или серы, и при этом Ro представляет собой C1-6 алифатическую группу; и
R6 представляет собой C1-6 алифатическую группу.

12. Соединение по п.11, отличающееся тем, что Y выбран из

13. Соединение формулы I

или фармацевтически приемлемая соль указанного соединения, где
R1 и R1' совместно образуют 3-7-членное карбоциклическое кольцо, возможно замещенное C1-6алкилом или C2-6алкенилом;
R2a представляет собой -ОН или -NHSO2R2;
R2 представляет собой C3-7циклоалкил, 6-10-членный арил, возможно замещенный C2-6алкинилом;
каждый R независимо представляет собой водород или C1-6алифатическую группу;
R3 представляет собой -L-Y, где
L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и одно или два дополнительных метиленовых звена в составе L независимо замещены функциональной группой, выбранной из -N(R)-, -NRC(O)-, -OC(O)- или -C(O)-, причем по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы;
Y представляет собой водород, C1-6 алифатическую группу, возможно содержащую в качестве заместителей оксогруппу, галоген, NO2 или CN, или 3-10-членное моноциклическое или бициклическое насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатома, независимо выбранных из азота, кислорода или серы, и при этом указанное кольцо содержит в качестве заместителей 1-4 группы Re; и
каждый Re независимо выбран из оксогруппы, NO2, галогена или CN;
или
R3 и кольцо, образованное R1 и R1', совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы, причем образованное таким образом кольцо содержит головную группу -L-Y;
Rw представляет собой водород;
Rx представляет собой -T-Rz, где
Т представляет собой бивалентную C1-6 углеводородную цепь, причем одно или два метиленовых звена в составе Т возможно и независимо замещены на -O-, -C(O)-, -C(O)O-; и
Rz представляет собой 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, при этом Rz возможно замещен галогеном, C2-6алкенилом, C1-6алкокси, 5-6-членным гетероарилом, содержащим 1-2 гетероатома, выбранных из азота, кислорода или серы, конденсированным 6-10-членным арилом, который возможно замещен фтором, или 6-10-членным арилом, возможно замещенным C1-6алкокси;
Rx' представляет собой водород;
Ry представляет собой водород;
R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, боковую группу природной или неприродной аминокислоты, причем боковая группа представляет собой боковую группу аланина, валина или фенилаланина; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы;
или
Т представляет собой -OC(O)-,
Rz представляет собой 8-10-членное бициклическое кольцо, содержащее по меньшей мере один атом азота,
R4 представляет собой -NHC(O)OR6,
R6 представляет собой возможно содержащую заместители C1-6 алифатическую группу,
R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы;
каждый R5 представляет собой 5-10-членный гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или C1-6 алифатическую группу, замещенную (i) - (CH2)0-4N(Ro)C(O)Ro или (ii) - (CH2)0-4Ro и -(CH2)0-4S(Ro), при этом два Ro совместно образуют 3-12-членное насыщенное бициклическое кольцо, содержащее 0-4 гетероатома, выбранных из азота, кислорода или серы, и при этом Ro представляет собой C1-6 алифатическую группу;
R6 представляет собой C1-6 алифатическую группу.

14. Соединение по п.13, отличающееся тем, что
L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено на функциональную группу, выбранную из -C(O)-, -NRC(O)- или -OC(O)-, причем по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы, и одно или два дополнительных метиленовых звена в составе L возможно и независимо замещены на -N(R)-;
и
Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей галоген или CN.

15. Соединение по п.14, отличающееся тем, что L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено на -C(O)-, и одно или два дополнительных метиленовых звена в составе L возможно и независимо замещены на -N(R)-.

16. Соединение по п.14, отличающееся тем, что L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено на -OC(O)-.

17. Соединение по п.13, отличающееся тем, что L представляет собой -NRC(O)CH=CH-, -NRC(O)CH=CHCH2N(CH3)-, -NRC(O)C(=CH2)CH2- или -CH2NRC(O)CH=CH-, где R представляет собой H или возможно замещенную C1-6 алифатическую группу; и Y представляет собой водород или C1-6 алифатическую группу, возможно содержащую в качестве заместителей галоген или CN.

18. Соединение по п.17, отличающееся тем, что L представляет собой -NHC(O)CH=CH-, -NHC(O)CH=CHCH2N(CH3)-, -NHC(O)C(=CH2)CH2- или -CH2NHC(O)CH=CH-.

19. Соединение по п.13, отличающееся тем, что L представляет собой бивалентную C2-8 углеводородную цепь, которая может быть линейной или разветвленной, причем L содержит по меньшей мере одну алкилидениловую двойную связь, и по меньшей мере одно метиленовое звено в составе L замещено на -C(O)-, причем по меньшей мере одна двойная связь расположена в альфа-бета положении относительно карбонильной функциональной группы.

20. Соединение формулы I

или фармацевтически приемлемая соль указанного соединения, где
R1 и R1' совместно образуют 3-7-членное карбоциклическое кольцо, возможно замещенное C1-6алкилом или C2-6алкенилом;
R2a представляет собой -OH или -NHSO2R2;
R2 представляет собой C3-7 циклоалкил, 6-10-членный арил, возможно замещенный C2-6алкинилом;
каждый R независимо представляет собой водород или C1-6 алифатическую группу;
R3 представляет собой -L-Y, причем L представляет собой ковалентную связь, -C(O)-, -N(R)C(O)-, -CH2-, -CH2NH-, -NH-, -CH2NHC(O)- или бивалентную насыщенную или ненасыщенную линейную или разветвленную C1-8 углеводородную цепь; и
Y выбран из следующих групп (i)-(x):
(i) -CH2Cl; или
(ii) C2-6алкенил, возможно содержащий в качестве заместителей оксогруппу; или
(iii) C2-6алкинил, возможно содержащий в качестве заместителей оксогруппу; или
(iv) насыщенное 3-4-членное гетероциклическое кольцо, содержащее 1 гетероатом, представляющий собой кислород, причем указанное кольцо содержит в качестве заместителей 1-2 группы Re; или
(v) насыщенное 3-6-членное карбоциклическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re; или
(vi) частично ненасыщенное 4-6-членное гетероциклическое кольцо, содержащее 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re или
(vii)
или
(viii) 6-членное ароматическое кольцо, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re; или
(ix)
или
(x) 8-10-членное бициклическое насыщенное, частично ненасыщенное или арильное кольцо, содержащее 0-3 гетероатома, независимо выбранных из азота, кислорода или серы, причем указанное кольцо содержит в качестве заместителей 1-4 группы Re;
каждая группа Re независимо выбрана из оксогруппы, NO2, галогена или CN;
или
R3 и кольцо, образованное R1 и R1', совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 12-18-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы, причем образованное таким образом кольцо содержит головную группу -L-Y;
Rw представляет собой водород;
Rx представляет собой -T-Rz, где
Т представляет собой бивалентную C1-6 углеводородную цепь, причем одно или два метиленовых звена в составе Т возможно и независимо замещены на -O-, -C(O)-, -C(O)O-; и
Rz представляет собой 5-10-членный моноциклический или бициклический гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода, или серы, или 4-7-членный гетероциклил, содержащий 1-2 гетероатома, независимо выбранных из азота, кислорода или серы, при этом Rz возможно замещен галогеном, C2-6алкенилом, C1-6алкокси, 5-6-членным гетероарилом, содержащим 1-2 гетероатома, выбранных из азота, кислорода или серы, конденсированным 6-10-членным арилом, который возможно замещен фтором, или 6-10-членным арилом, возможно замещенным C1-6алкокси;
Rx' представляет собой водород;
Ry представляет собой водород;
R4 представляет собой Н, -NHC(O)R5, -NHC(O)OR6, боковую группу природной или неприродной аминокислоты, причем боковая группа представляет собой боковую группу аланина, валина или фенилаланина; или R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы; или
Т представляет собой -OC(O)-,
Rz представляет собой 8-10-членное бициклическое кольцо, содержащее по меньшей мере один атом азота,
R4 представляет собой -NHC(O)OR6,
R6 представляет собой возможно содержащую заместители C1-6 алифатическую группу,
R4 и Rx совместно с находящимися между ними атомами образуют возможно содержащее заместители насыщенное или ненасыщенное 16-22-членное кольцо, содержащее 2-6 гетероатомов, независимо выбранных из азота, кислорода или серы;
каждый R5 представляет собой 5-10-членный гетероарил, содержащий 1-4 гетероатома, независимо выбранных из азота, кислорода или серы, или C1-6 алифатическую группу, замещенную (i) - (CH2)0-4N(Ro)C(O)Ro или (ii) -(CH2)0-4Ro и -(CH2)0-4S(Ro), при этом два Ro совместно образуют 3-12-членное насыщенное бициклическое кольцо, содержащее 0-4 гетероатома, выбранных из азота, кислорода или серы, и при этом Ro представляет собой C1-6 алифатическую группу;
R6 представляет собой C1-6 алифатическую группу.

21. Соединение по п.20, отличающееся тем, что Y выбран из


22. Соединение, выбранное из группы, состоящей из










































или фармацевтически приемлемая соль указанного соединения.

23. Фармацевтическая композиция для ингибирования вируса гепатита С (ВГС), содержащая эффективное количество соединения по п.1 или 22, и фармацевтически приемлемый адъювант, носитель или растворитель.

24. Способ ингибирования активности протеазы вируса гепатита С или мутантной формы указанного фермента, включающий этап приведения в контакт протеазы вируса гепатита C с соединением по п.1 или 22 или композицией по п.23.

25. Способ по п.24, отличающийся тем, что активность протеазы вируса гепатита C или мутантной формы указанного фермента ингибируют необратимо.

26. Способ по п.25, отличающийся тем, что активность протеазы вируса гепатита C или мутантной формы указанного фермента необратимо ингибируют путем ковалентной модификации консервативного остатка цистеина, который находится в положении, эквивалентном остатку Cys159 протеазы вируса гепатита C подтипа 1b.

27. Способ по п.25, отличающийся тем, что активность протеазы вируса гепатита C или мутантной формы указанного фермента необратимо ингибируют путем ковалентной модификации Cys16.

28. Способ лечения заболевания, опосредованного протеазой вируса гепатита C, у пациента, включающий этап введения указанному пациенту эффективного количества соединения по любому из пп.1-22 или композиции по п.23.

29. Способ по п.28, отличающийся тем, что этап введения осуществляют один раз в день.

30. Способ по п.29, отличающийся тем, что указанное заболевание представляет собой гепатит C.

31. Способ лечения заболевания, опосредованного протеазой вируса гепатита C, у пациента, включающий этап введения указанному пациенту эффективного количества соединения по любому из пп.1-22, при этом указанное соединение необратимо ингибирует протеазу ВГС путем ковалентной модификации консервативного остатка цистеина, который находится в положении, эквивалентном остатку Cys159 протеазы ВГС подтипа 1b.

32. Способ по п.31, отличающийся тем, что генотип или подтип протеазы вируса гепатита C выбран из группы, состоящей из 1a, 1b, 1c, 2a, 2b, 2c, 2i, 2k, 3a, 3b, 3k, 4a, 4d, 4f, 5a, 6a, 6b, 6c, 6d, 6e, 6f, 6g, 6h, 6i, 6j, 6k, 6l, 6m, 6n, 6o, 6p, 6q, 6t и 7a.

33. Способ по п.32, отличающийся тем, что генотип или подтип протеазы вируса гепатита C представляет собой 1a, 1b, 2a или 3a.

34. Способ лечения заболевания, опосредованного протеазой ВГС, у пациента, включающий этап введения указанному пациенту эффективного количества соединения по любому из пп.1-22, при этом указанное соединение необратимо ингибирует протеазу вируса гепатита C путем ковалентной модификации Cys16 протеазы ВГС.

35. Конъюгат, полученный приведением во взаимодействие соединения по любому из пп.1-22 с протеазой ВГС.

36. Конъюгат по п.35, отличающийся тем, что указанный конъюгат получен путем ковалентного связывания заместителя R3 и сульфгидрильной группы цистеина протеазы ВГС, при этом цистеин является консервативным в положении, эквивалентном Cys159 в полипептидной цепи протеазы ВГС подтипа 1b.

37. Конъюгат по п.35, отличающийся тем, что указанный конъюгат получен путем ковалентного связывания заместителя R3 и сульфгидрильной группы цистеина протеазы ВГС, при этом цистеин находится в положении 16 полипептидной цепи протеазы ВГС.



 

Похожие патенты:

Изобретение относится к пептидным альдегидам с тирозином в качестве C-концевого остатка, которые являются особенно эффективными для стабилизации протеаз типа субтилизина в жидких моющих средствах.

Изобретение относится к области биохимии, в частности к применению олигопептида, выбранного из группы, состоящей из трипептида общей формулы X-Pro-Tyr (X-P-Y), в которой X может быть выбран из группы, состоящей из Ile (I), Val (V), Ala (A), Trp (W), Leu (L), Phe (F), Gly (G), Glu (E) и Asn (N), или пептидов, включающих указанный трипептид, в медицине для иммуномодуляции.

Изобретение относится к производным пептидов и пептидомиметикам в качестве ингибиторов трансглутаминаз, к способам их получения, фармацевтическим композициям, содержащим указанные соединения, а также к применению указанных ингибиторов трансглутаминазы, в частности, для лечения целиакии и заболеваний, зависимых от трансглутаминазы.

Изобретение относится к области молекулярной медицины и мишень-ориентированной доставки терапевтических средств. .

Изобретение относится к органической химии, конкретно к новым биологически активным пептидам, которые могут найти применение в фармакологии и медицине при создании новых лекарственных средств, обладающих цитопротекторной активностью.

Изобретение относится к производным 1-(1-адамантил)этиламина (ремантадина)общей формулы: где R - функциональная группа аминокислотного остатка (I-IV) или остаток липоевой кислоты (V): , которые обладают избирательной противовирусной активностью в отношении штаммов гриппа А, включая штаммы вируса, резистентные к действию ремантадина.

Изобретение относится к соединениям на основе пептидов, включающим в себя трехчленные циклы, содержащие гетероатом, которые эффективно и селективно ингибируют специфические активности N-концевых нуклеофильных (Ntn) гидролаз, связанных с протеасомой.

Изобретение относится к новым ингибиторам IAP общей формулы I, где Q, X1, X2, Y, Z1 , Z2, Z3, Z4, R1, R2, R3, R3', R4 , R4', R5, R6, R6' и n имеют указанные в настоящем описании значения. .

Изобретение относится к соединению, имеющему структуру формулы (I), или его фармацевтически приемлемой соли, где указанные радикалы являются такими, как представлено в описании, а также относится к соединению, представляющему собой или его фармацевтически приемлемой соли.

Изобретение относится к соединениям формулы (I), его фармацевтически приемлемой соли, где каждая пунктирная линия (представленная как ) представляет собой необязательную двойную связь; Х представляет собой N или СН; R1a и R1b независимо представляют собой водород или С1-6-алкил; L представляет собой -O-; R2 представляет собой водород; R3 представляет собой водород или C1-6-алкил; R4 представляет собой хинолинил, замещенный одним, двумя или тремя заместителями, выбранными из С1-6-алкила, С1-6 -алкилокси, тиазолила или пиразолила, где указанные тиазолил или пиразолил замещены на любом атоме углерода C1-6 -алкилом; n равно 3, 4, 5 или 6; р равно 1 или 2.
Изобретение относится к области биохимии. .

Изобретение относится к новым полифункциональным аминокислотным производным фуллерена С60, обладающим биологической активностью, а также к способам их получения и способу ковалентного связывания производных фуллерена с SH-содержащими белками.

Изобретение относится к производным 1-(1-адамантил)этиламина (ремантадина)общей формулы: где R - функциональная группа аминокислотного остатка (I-IV) или остаток липоевой кислоты (V): , которые обладают избирательной противовирусной активностью в отношении штаммов гриппа А, включая штаммы вируса, резистентные к действию ремантадина.

Изобретение относится к новым соединениям, обладающим свойствами ингибитора репликации вируса HCV. В формуле I: A1 представляет собой С6арил, замещенный -X1-R7; X1 является -S-; R7 является С6арилом, необязательно замещенным одним RA; Z1 является -N(Rb)-; каждый из W1 и W2 является N; R1 является водородом; R3 и R4 вместе с атомами углерода, к которым они присоединены, образуют 6-членное гетероциклическое кольцо, содержащее в качестве гетероатома N, где 6-членное гетероциклическое кольцо, необязательно замещенное одним RA; A2 представляет собой С6арил или 5-членный гетероциклил, содержащий в качестве гетероатома N; R2 представляет собой -N(RB)C(O)C(R5R6)N(R8)-T-RD, , или -LK-B; R6 и R8 совместно с атомами, к которым они присоединены, образуют 5-членное гетероциклическое кольцо; значения радикалов RA, R5, Т, RC, RD, RD' и RD", LK, В приведены в формуле изобретения.
Наверх