Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца



Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2515926:

БОРД ОФ РИДЖЕНТС, ДЗЕ ЮНИВЕРСИТИ ОФ ТЕХАС СИСТЕМ (US)

Изобретение относится к биотехнологии, конкретно к использованию микроРНК (miRNA) для лечения патологической гипертрофии сердца, инфаркта миокарда или сердечной недостаточности. Способ предусматривает введение индивидууму с патологией сердечной деятельности первого антисмыслового олигонуклеотида, содержащего последовательность, которая по меньшей мере частично комплементарна зрелой последовательности miR-208a или miR-208b, и второго антисмыслового олигонуклеотида, содержащего последовательность, которая по меньшей мере частично комплементарна зрелой последовательности miR-499. Совместное введение указанных олигонуклеотидов за счет проявления синергетического эффекта позволяет более эффективно понизить экспрессию или активность miR-208a или miR-208b и miR-499 в клетках сердца индивидуума. 2 н. и 28 з.п. ф-лы, 7 ил., 5 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

По настоящей заявке испрашивается приоритет для предварительной заявки США № 61/149915, поданной 4 февраля 2009, которая приводится в настоящем документе в качестве ссылки в полном объеме.

ДОГОВОР О ПОДДЕРЖКЕ ПРАВИТЕЛЬСТВА

Настоящее изобретение создавалось при поддержке правительства в виде гранта номер HL53351-06, присужденного Национальными Институтами Здоровья. Правительство обладает определенными правами в изобретении.

ОПИСАНИЕ ТЕКСТОВОГО ФАЙЛА, ПРЕДСТАВЛЕННОГО В ЭЛЕКТРОННОМ ВИДЕ

Содержание текстового файла, представленного при этом в электронном виде, приводится в настоящем документе в качестве ссылки в полном объеме: Копия в читаемом компьютером формате списка последовательностей (название файла: MIRG_013_01WO_SeqList_ST25.txt, запись данных: 1 февраля 2010, размер файла 5 килобайт).

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Изобретение относится к лечению расстройств сердца и скелетных мышц путем введения агентов, которые модулируют активность или экспрессию микроРНК (miРНК). В частности, изобретение относится к способу лечения или профилактики заболеваний сердца путем ингибирования экспрессии или активности как miR-208a/miR-208b, так и miR-499 в клетках сердца индивидуума, включая человека. Кроме того, изобретение относится к способу лечения или профилактики мышечно-скелетных нарушений путем увеличения экспрессии или активности как miR-208b, так и miR-499 в клетках скелетных мышц индивидуума.

УРОВЕНЬ ТЕХНИКИ

Заболевание сердца и его проявления, к которым относятся заболевание коронарной артерии, инфаркт миокарда, застойная сердечная недостаточность и гипертрофия сердца, на сегодняшний день в Соединенных Штатах несомненно представляют наибольший риск для здоровья. Затраты на диагностику, лечение и поддержку пациентов, страдающих этими заболеваниями, обходятся в биллионы долларов. Два особенно тяжелых проявления заболевания сердца представляют собой инфаркт миокарда и гипертрофия сердца.

Инфаркт миокарда, широко известный как сердечный приступ, вызывается внезапной и длительной недостаточностью кровотока в ткани сердца, которая обычно является результатом сужения или окклюзии коронарной артерии. В отсутствие адекватного кровоснабжения ткань становится ишемичной, что приводит к гибели кардиомиоцитов (например, клеток сердечной мышцы) и сосудистых структур. Некротизированная вследствие гибели кардиомиоцитов ткань, как правило, замещается рубцовой тканью, которая не является сократимой, теряет способность выполнять функцию сердца и часто играет пагубную роль в работе сердца, вследствие расширения в процессе сердечного сокращения или вследствие увеличения размера и эффективного радиуса желудочка, например, становящегося гипертрофичным.

Гипертрофия сердца представляет собой приспособительную реакцию сердца практически на все формы заболевания сердца, к которым относятся формы, вызываемые гипертензией, механической нагрузкой, инфарктом миокарда, аритмиями сердца, эндокринными нарушениями и генетическими мутациями в генах сократительных белков сердца. Несмотря на то что гипертрофическая реакция исходно представляет собой компенсаторный механизм, который увеличивает сердечный выброс, длительная гипертрофия может приводить к дилатационной кардиомиопатии (DCM), сердечной недостаточности и внезапной смерти. В Соединенных Штатах ежегодно сердечная недостаточность диагностируется приблизительно у полумиллиона индивидуумов со смертностью, приближающейся к 50%.

Большое число сигнальных путей, особенно включающих искаженную передачу сигнала с участием кальция, приводит к гипертрофии сердца и патологическому ремоделированию (Heineke & Molkentin, 2006). Гипертрофическое разрастание в ответ на нагрузку вовлекает различные сигнальные пути и паттерны экспрессии генов, отличные от включаемых при физиологической гипертрофии, которая наблюдается в ответ на физическую нагрузку. Опосредованная нагрузкой гипертрофия миокарда представляет собой сложное явление, ассоциированное с большим числом пагубных последствий, с различными молекулярными и гистологическими характеристиками, приводящее к фиброзу, дилятации и декомпенсации сердца, что через стадию дегенерации и гибели кардиомиоцитов часто завершается сердечной недостаточностью. По существу, имелось сильное желание расшифровать лежащие в основе этого молекулярные механизмы и открыть новые терапевтические мишени для подавления пагубного разрастания сердца и в конечном счете недостаточности. Понимание этих механизмов важно для создания новых способов лечения гипертрофии сердца и сердечной недостаточности.

В последнее время микроРНК были вовлечены в большое число биологических процессов, к которым относятся среди прочего регуляция сроков развития, апоптоза, жирового метаболизма и дифференциации гематопоэтических клеток. МикроРНК (miРНК) представляют собой небольшие некодирующие белок РНК от около 18 до около 25 нуклеотидов в длину, которые происходят из отдельных генов miRNA, из интронов генов, кодирующих белок, или из полицистронных транскриптов, которые часто кодируют большое число близкородственных miRNA. См. обзор Carrington et al. (Science, Vol. 301(5631):336-338, 2003). MiRNA действуют в качестве репрессоров мРНК-мишеней путем усиления их деградации при полной комплементарности их последовательностей или путем ингибирования трансляции, если их последовательности содержат несоответствия.

MiRNA транскрибируются с помощью РНК-полимеразы II (pol II) или РНК-полимеразы III (pol III; см. статью Qi et al. (2006) Cellular & Molecular Immunology, Vol. 3:411-419) и происходят из исходных транскриптов, обозначаемых первичными транскриптами miRNA (pri-miRNA), размер которых обычно составляет несколько тысяч нуклеотидов. Pri-miRNA процессируются в ядре с помощью РНКазы Drosha до предшественников, имеющих форму шпильки, размером от около 70 до около 100 нуклеотидов (pre-miRNA). После переноса в цитоплазму pre-miRNA в виде шпильки дополнительно процессируется с помощью дайсера до получения двуцепочечной miRNA. Зрелая цепь miRNA затем встраивается в индуцированный РНК комплекс сайленсинга (RISC), где она ассоциируется со своими мРНК-мишенями за счет комплементарности пар оснований. В относительно редких случаях, при которых miRNA полностью спаривается с мРНК-мишенью, она активирует деградацию мРНК. Чаще miRNA образуют несовершенные гетеродуплексы с мРНК-мишенями, либо влияющие на стабильность мРНК, либо ингибирующие трансляцию мРНК.

Недавно авторы изобретения сообщили о специфичной для сердца микроРНК, miR-208a, которая кодируется интроном гена тяжелой цепи α-миозина (МНС) и необходима для активации экспрессии β-МНС в ответ на нагрузку на сердце и для подавления в сердце генов быстрых скелетных мышц (van Rooij et al., (2007) Science, Vol. 316: 575-579). Настоящее изобретение основано на этом открытии и предлагает новый терапевтический подход в лечении расстройств сердца и нарушений скелетных мышц.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение основано, в частности, на обнаружении того, что систематическое подавление как miR-208a, так и miR-499 в клетках сердца синергетически влияет на развитие гипертрофии сердца, повышенной сократимости и патологического ремоделирования сердца в ответ на нагрузку. Авторы изобретения неожиданно обнаружили, что период времени для регуляции экспрессии генов стресса, таких как β-МНС, критически падает при подавлении как miR-208a, так и miR-499 путем либо одновременного, либо последовательного введения ингибиторов miR-208a и miR-499. Такое двойное нацеливание оказывает незамедлительное воздействие на экспрессию генов стресса по сравнению с задержкой в несколько месяцев, необходимой для наблюдения подобных эффектов при подавлении только miR-208a. Соответственно, настоящее изобретение относится к новому терапевтическому подходу в лечении патологической гипертрофии сердца, сердечной недостаточности и инфаркта миокарда у нуждающегося в этом индивидуума, включая человека.

В одном из вариантов осуществления способ содержит введение индивидууму ингибитора miR-208a или miR-208b и ингибитора miR-499, причем после введения экспрессия или активность miR-208a или miR-208b и miR-499 в клетках сердца индивидуума снижается. В некоторых вариантах осуществления после введения ингибиторов экспрессия или активность miR-208a или miR-208b и miR-499 в клетках сердца индивидуума снижается больше чем на 60 процентов. К ингибиторам miR-208 и miR-499 относятся антагомиры или антисмысловые олигонуклеотиды. В одном из вариантов осуществления ингибиторы miRNA кодируются на векторе экспрессии.

В другом варианте осуществления после введения ингибитора miR-208a или miR-208b и ингибитора miR-499 у индивидуума снижается ответ на нагрузку на сердце. К ответу на нагрузку на сердце относится гипертрофия кардиомиоцитов, фиброз сердца, пониженная экспрессия α-МНС и/или повышенная экспрессия β-МНС в клетках сердца указанного индивидуума. В некоторых вариантах осуществления снижение ответа на нагрузку на сердце наблюдается менее чем через два месяца после введения ингибиторов miR-208a/miR-208b и miR-499. В предпочтительном варианте осуществления снижение ответа на нагрузку на сердце наблюдается менее чем через одну неделю после введения ингибиторов.

В некоторых вариантах осуществления ингибитор miR-208a/miR-208b и ингибитор miR-499 вводятся последовательно. Введение двух ингибиторов может быть разделено интервалом, который может составлять порядка от минут до недель. В одном из вариантов осуществления ингибитор miR-208a/miR-208b и ингибитор miR-499 вводятся с интервалом по меньшей мере 24 часа. В другом варианте осуществления ингибитор miR-208a/miR-208b и ингибитор miR-499 вводятся совместно. Каждый из двух ингибиторов может быть введен в дозе от около 1 мг/кг до около 200 мг/кг.

Настоящее изобретение также относится к способу лечения или профилактики нарушения скелетных мышц у индивидуума, нуждающегося в этом, содержащему введение индивидууму агониста miR-208 и агониста miR-499, где после введения в клетках скелетных мышц индивидуума экспрессия или активность miR-208 и miR-499 повышается. В одном из вариантов осуществления способ содержит введение индивидууму агониста miR-208b и агониста miR-499. Агонисты miРНК могут представлять собой полинуклеотиды, кодирующие зрелые последовательности miR-208a, miR-208b или miR-499. В некоторых вариантах осуществления такие полинуклеотиды функционально связаны с последовательностью промотора и доставляются в клетки индивидуума в векторе экспрессии.

Агонисты miRNA могут вводиться вместе или последовательно, разделенные определенным временным интервалом. В некоторых вариантах осуществления после введения индивидууму агонистов miR-499 и miR-208a или miR-208b в клетках скелетных мышц индивидуума снижается экспрессия одного или нескольких генов быстрых скелетных мышц. К одному или нескольким генам быстрых скелетных мышц могут относиться тропонин I2, тропонин Т3, легкая цепь миозина быстрых скелетных мышц и альфа-актин скелетных мышц.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фигура 1. У животных с нокаутом miR-208 наблюдаются менее выраженная гипертрофия сердца и фиброз в ответ на сужение грудной аорты. А. Схематическая иллюстрация процедуры сужения грудной аорты (ТАВ) (слева). Гистологические срезы сердца мышей дикого типа и miR-208-/-, окрашенные после процедуры ТАВ или процедуры имитации трихромом по Массону (справа). Отсутствие miR-208 уменьшает гипертрофию и фиброз, наблюдаемые у мышей дикого типа, подвергнутых ТАВ в течение 21 дня. В. Относительные уровни экспрессии тяжелой цепи бета-миозина (β-МНС), предсердного натрийуретического фактора (ANF) и натрийуретического пептида мозга (BNP) в сердце животных дикого типа и miR-208-/- после процедуры имитации или ТАВ. С. Вестерн-анализ уровней белков α-МНС и β-МНС в сердце животных дикого типа и miR-208-/- после процедуры имитации или ТАВ. В качестве контроля нагрузки определяли GAPDH.

Фигура 2. Долговременный нокдаун miR-208 фенокопирует ингибирование ответа на нагрузку у животных с нокаутом miR-208. А. Последовательность синтетического олигонуклеотида, нацеленного на зрелую последовательность miR-208 (SEQ ID NO:16). Последовательность контроля несоответствий содержит четыре несоответствия оснований по сравнению с последовательностью anti-miR-208 (SEQ ID NO:17). В. Анализ ПЦР в режиме реального времени указывает на эффективный нокдаун miR-208 в сердце животных, обработанных олигонуклеотидом анти-miR-208. С. Относительные уровни экспрессии тяжелой цепи бета-миозина (β-МНС), предсердного натрийуретического фактора (ANF) и натрийуретического пептида мозга (BNP) в сердце животных, которые получили олигонуклеотид anti-miR-208 (анти 208) или контроль несоответствий (mm) после процедуры имитации или сужения грудной аорты (ТАВ). В то время как в ответ на ТАВ индуцируются маркеры стресса ANF и BNP, у животных, которые получали anti-miR-208, наблюдается сниженная индукция экспрессии βМНС.

Фигура 3. Myh7b и miR-499 регулируются посредством miR-208. Нозерн-блот, показывающий экспрессию miR-499 в сердце мышей дикого типа (+/+), гетерозиготных по miR-208 (+/-) и мышей с нокаутом miR-208 (-/-). Существует прямая корреляция между экспрессией miR-208 и miR-499, а также Myh7b у мышей дикого типа и мутантов. В качестве контроля измеряли экспрессию GAPDH.

Фигура 4. Myh7b и miR-499 экспрессируются в сердечной и медленных скелетных мышцах. А. Нозерн-анализ указывает, что miR-499 экспрессируется в сердце и медленных скелетных мышцах (например, камбаловидной мышце). ОТ-ПЦР на Myh7b указывает, что miR-499 экспрессируется совместно со своим геном-хозяином. В. Анализ ПЦР в режиме реального времени на miR-499 на сердечной и четырех типах скелетных мышц (икроножной/подошвенной (GP), передней большеберцовой (ТА), длинном разгибателе пальцев (EDL) и камбаловидной) подтверждает, что miR-499 экспрессируется преимущественно в сердце и камбаловидной мышце. В ТА и EDL могут быть детектированы лишь незначительные уровни экспрессии miR-499. С. Гибридизация in situ указывает на то, что в процессе эмбриогенеза Myh7b экспрессируется специфически в сердце и сомитах.

Фигура 5. MiR-499 не влияет на экспрессию миозина. А. Анализ ОТ-ПЦР Myh7b показывает, что генетическая делеция miR-499 не влияет на экспрессию ее гена-хозяина Myh7b. GP-икроножная/подошвенная мышца; TA-передняя большеберцовая мышца; EDL-длинный разгибатель пальцев. В качестве контроля измеряли экспрессию GAPDH. В. Анализ вестерн-блот сердец животных дикого типа (WT), гетерозиготных (+/-) и с нокаутом (КО) miR-499 как на α-, так и β-МНС показывает, что делеция miR-499 не влияет на экспрессию того и другого гена на уровне белка. С. Пропилтиоурацил (PTU), который блокирует биогенез тиреоидных гормонов и является сильным индуктором β-МНС, продуцирует снижение α-МНС и повышение β-МНС как у животных дикого типа (WT), так и с нокаутом (КО) miR-499.

Фигура 6. Регуляция miR-499 с помощью in vivo нокдауна miR-208. A. Нозерн-анализ экспрессии miR-208 и miR-499 через три дня после инъекции в хвостовую вену указанного количества олигонуклеотида anti-miR-208 или физиологического раствора (Sal). B. Нозерн-анализ экспрессии miR-208 и miR-499 в ткани сердца животных, которым ввели либо одну дозу 80 мг/кг anti-miR-208, 2 дозы по 80 мг/кг anti-miR-208 за два последовательных дня, либо ошибочный контрольный олигонуклеотид (mm), через два месяца после обработки. С. Анализ ПЦР в режиме реального времени экспрессии miR-208, miR-499, miR-208b, α-MHC, Myh7b и β-МНС в ткани сердца через два месяца после обработки однократной дозой anti-miR-208, двумя дозами anti-miR-208 за два последовательных дня или двумя дозами олигонуклеотида с несоответствиями за два последовательных дня. D. Анализ вестерн-блот экспрессии β-МНС в ткани сердца через два месяца после обработки anti-miR-208 (однократной дозой 80 мг/кг или двумя последовательными дозами 80 мг/кг) или обработки контролем с несоответствиями (mm).

Фигура 7. Двойное нацеливание на miR-208 и miR-499. А. Нозерн-анализ miR-208, miR-208b и miR-499 в ткани сердца животных дикого типа и с нокаутом miR-499 указывает на сильную индукцию miR-208b в ответ на PTU. MiR-208b экспрессируется совместно с β-МНС и указывает на ее экспрессию. У животных с нокаутом miR-499 индукция miR-208b сопоставима с индукцией у животных дикого типа. Тем не менее, нокдаун miR-208 у животных с нокаутом miR-499 супрессирует индукцию экспрессии miR-208b с помощью PTU. B. Анализ ПЦР в режиме реального времени miR-208, α-MHC и β-МНС в ткани сердца животных дикого типа, животных с нокаутом miR-208, животных с нокаутом miR-499 и животных с нокаутом miR-499, обработанных с помощью anti-miR-208 при наличии и в отсутствие PTU.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Сердечная и скелетные мышцы отвечают на большое число патофизиологических стимулов, таких как нагрузка, передача сигнала тироидных гормонов и повреждение, путем модуляции экспрессии изоформ миозина, которые регулируют эффективность сокращения.

Соотношение изоформ α- и β-МНС в сердце взрослого индивидуума представляет собой определяющий фактор сократимости сердца. У β-МНС, основной изоформы миозина в сердце взрослого индивидуума, наблюдается относительно низкая активность АТФазы, тогда как α-MHC обладает высокой активностью АТФазы. В ответ на большое число патологических стимулов, таких как инфаркт миокарда, гипертензия и другие расстройства, экспрессия β-МНС возрастает, тогда как экспрессия α-MHC падает с последующим снижением активности АТФазы миофибрилл и сниженной скоростью сокращения мышечных волокон сердца, что приводит в конечном счете к нарушению сократительной функции. Удивительно, что небольшие изменения в содержании α-MHC в сердце могут значительно влиять на функцию сердца.

Недавно авторы изобретения сообщили о специфичной для сердца miRNA miR-208a, которая кодируется интроном гена тяжелой цепи α-миозина и необходима для активации экспрессии β-МНС в ответ на нагрузку на сердце и для репрессии генов быстрых скелетных мышц в сердце (см. одновременно находящуюся на рассмотрении заявку WO 2008/016924, которая приводится в настоящем документе в качестве ссылки в полном объеме).

Авторы изобретения недавно также обнаружили, что miR-208a также необходима для экспрессии в сердце близкородственной miRNA miR-499, которая кодируется интроном гена Myh7b (см. одновременно находящуюся на рассмотрении заявку РСТ/US08/71837, которая приводится в настоящем документе в качестве ссылки в полном объеме). Экспрессия Myh7b и miR-499 в сердце, а также в медленных скелетных мышцах контролируется фактором транскрипции MEF2, сигнал-зависимым регулятором экспрессии генов поперечно-полосатых мышц. Усиленной экспрессии miR-499 или miR-208 достаточно, чтобы опосредовать превращение миофибрилл из быстрых в медленные in vivo. MiR-208 и miR-499 могут отрицательно регулировать экспрессию Thrap1, корегулятора рецептора тиреоидных гормонов, и членов семейства PUR факторов транскрипции, которые в свою очередь отрицательно регулируют экспрессию β-МНС в сердечной и скелетных мышцах. Sox6 действует в качестве репрессора типоспецифических генов медленных волокон. Нокдаун экспрессии Sox6 в мышечных трубочках дикого типа приводит к существенному повышению экспрессии β-МНС. Анализ промотора β-МНС выявил консенсусную последовательность Sox, что указывает на то, что Sox6 имеет решающее значение в дифференциации типа волокон фетальной скелетной мускулатуры и регуляции β-МНС в сердце. Эти находки раскрывают типичный механизм регуляции, в котором гены Myh регулируют паттерны экспрессии генов поперечно-полосатых мышц, кодируя регуляторные miRNA, которые определяют сократимость и способность отвечать на сигнал (van Rooij et al. (2009) Developmental Cell, Vol. 17: 662-673).

Настоящее изобретение основано, в частности, на обнаружении того, что подавление и miR-208, и miR-499 в клетках сердца создает синергетический эффект в супрессии ответа на нагрузку на сердце. Ингибирование экспрессии miR-208a в клетках сердца приводит к снижению индуцированной нагрузкой экспрессии β-МНС. Тем не менее, этот эффект не проявляется до двух месяцев после введения ингибитора miR-208. Авторы изобретения неожиданно обнаружили, что ингибирование и miR-208a, и miR-499 приводит к супрессии экспрессии β-МНС, индуцированной нагрузкой, почти сразу же после введения, таким образом, ускоряя эффект при ответе на нагрузку на сердце. Соответственно, в свете этих находок описываются стратегии воздействия на экспрессию генов скелетных и сердечной мышц путем модуляции экспрессии miR-208a и miR-499 либо одновременно, либо последовательно для лечения и профилактики заболеваний сердца.

MiR-208a локализована в интроне гена α-МНС. Точное расположение интрона зависит от конкретного вида и конкретного транскрипта. Например, у людей miR-208a кодируется в 28-м интроне гена α-МНС, тогда как у мышей она кодируется в 29-м интроне. Кодирующие pre-miRNA последовательности miR-208a человека, мыши, крысы и собаки представлены ниже в виде SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 и SEQ ID NO:4 соответственно. Последовательность зрелой miR-208a представлена в SEQ ID NO:5. Подобно α-МНС, miR-208a экспрессируется исключительно в сердце.

Pre-miR-208a человека (SEQ ID NO:1)

ACGGGCGAGC TTTTGGCCCG GGTTATACCT GATGCTCACG TATAAGACGA GCAAAAAGCT TGTTGGTCAG A

Pre-miR-208a мыши (SEQ ID NO:2)

ACGGGTGAGC TTTTGGCCCG GGTTATACCT GACTCTCACG TATAAGACGA GCAAAAAGCT TGTTGGTCAG A

Pre-miR-208a крысы (SEQ ID NO:3)

ACGGGTGAGC TTTTGGCCCG GGTTATACCT GACTCTCACG TATAAGACGA GCAAAAAGCT TGTTGGTCAG A

Pre-miR-208a собаки (SEQ ID NO:4)

ACGCATGAGC TTTTGGCTCG GGTTATACCT GATGCTCACG TATAAGACGA GCAAAAAGCT TGTTGGTCAG A

Зрелая miR-208a (SEQ ID NO:5)

AUAAGACGAGCAAAAAGCUUGU

Анализ геномной локализации гена miR-499 показал, что он должен содержаться в 20-м интроне гена Myh7b, гомолога гена α-МНС. Кодирующие pre-miRNA последовательности miR-499 мыши, крысы, человека, собаки, опоссума, курицы и X. tropicalis представлены в SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12 соответственно. SEQ ID NO:13 представляет собой структуру стебель-петля последовательности предшественника мыши, и SEQ ID NO:14 представляет собой последовательность зрелой miR-499. Ген Myh7b консервативен у позвоночных и экспрессируется лишь в сердце и медленных скелетных мышцах (например, камбаловидной мышце).

Pre-miR-499 мыши (SEQ ID NO:6)

TCCCTGTGTC TTGGGTGGGC AGCTGTTAAG ACTTGCAGTG ATGTTTAGCT CCTCTGCATG TGAACATCAC AGCAAG

Pre-miR-499 крысы (SEQ ID NO:7)

TCCCTGTCTT GGGTGGGCAG CTGTTAAGAC TTGCAGTGAT GTTTAGCTCC TCTCCATGTG AACATCACAG CAAG

Pre-miR-499 человека (SEQ ID NO:8)

CCCCTGTGCC TTGGGCGGGC GGCTGTTAAG ACTTGCAGTG ATGTTTAACT CCTCTCCACG TGAACATCAC AGCAAG

Pre-miR-499 собаки (SEQ ID NO:9)

CCCTTGCACC CTGGGCGGGC GGCCGTTAAG ACTTGCAGTG ATGTTTAACT CCTCTCCACG TGAACATCAC AGCAAG

Pre-miR-499 опоссума (SEQ ID NO:10)

CCCCTGCCTC CCCGGCGGGC AGCTGTTAAG ACTTGCAGTG ATGTTTAATT CTTCTCTATG TGAACATCAC AACAAG

Pre-miR-499 курицы (SEQ ID NO:11)

GGAGCGGCAG TTAAGACTTG TAGTGATGTT TAGATAATGT ATTACATGGA CATCACTTTA AG

Pre-miR-499 X. tropicalis (SEQ ID NO:12)

GTCTTAGCGA GGCAGTTAAG ACTTGCAGTG ATGTTTAGTT AAAATCTTTT CATGAACATC ACTTTAAG

Структура стебель-петля мыши последовательности pre-miR-499 (SEQ ID NO:13)

GGGUGGGCAG CUGUUAAGAC UUGCAGUGAU GUUUAGCUCC UCUGCAUGUG AACAUCACAG CAAGUCUGUG CUGCUGCCU

Зрелая miR-499 (SEQ ID NO:14)

UUAAGACUUG CAGUGAUGUU U

Авторы изобретения также обнаружили, что геном содержит вторую версию miR208a, обозначаемую miR-208b, которая локализована в гене β-МНС в интроне 31 и, подобно β-МНС, miRNA-208b экспрессируется лишь в сердце и медленных скелетных мышцах (например, камбаловидной мышце). К генам, регулируемым посредством miR-208b, относятся, например, Sp3, миостатин, PURбета, THRAP1 и гены белков быстрых скелетных мышц. Последовательность этой miRNA в значительной степени перекрывается с miR-208а с гомологией 100% в «затравочном регионе», регионе, который определяет мРНК-мишени определенной miRNA. Таким образом, miR-208b может существенно влиять на сократимость сердечной и скелетных мышц у людей. Последовательность pre-miR-208b консервативна между некоторыми видами млекопитающих (например, человеком, мышью, крысой и собакой). Ниже представлена последовательность pre-miR-208b, а также последовательность зрелой miR-208b:

pre-miR-208b (SEQ ID NO:18)

TTTCTGATCC GAATATAAGA CGAACAAAAG GTTTGTCTGA GGG

Зрелая miR-208b (SEQ ID NO:19)

AUAAGACGAA CAAAAGGUUU GU

Понятно, что при использовании последовательностей РНК, описанных в настоящем документе, в вариантах осуществления, где требуются дезоксирибонуклеотиды, тимидиновый остаток замещается на уридиновый остаток. Аналогично в вариантах осуществления, где необходимы рибонуклеотиды, в последовательностях ДНК, описанных в настоящем документе, уридиновый остаток замещается на тимидиновый остаток.

В одном из вариантов осуществления настоящее изобретение относится к способу лечения патологической гипертрофии сердца, инфаркта миокарда или сердечной недостаточности у индивидуума, нуждающегося в этом, включая человека, путем нацеливания экспрессии и/или активности одной из двух или обеих miR-208 (например, miR-208а и/или miR-208b или, другими словами, miR-208а/miR-208b) и miR-499 в клетках сердца индивидуума. В некоторых вариантах осуществления для снижения экспрессии или активности miR-208а/miR-208b и miR-499 в клетках сердца индивидуума индивидууму вводят ингибитор miR-208а/miR-208b и ингибитор miR-499.

В другом варианте осуществления индивидуум, нуждающийся в этом, может иметь риск развития патологической гипертрофии сердца, сердечной недостаточности или инфаркта миокарда. У такого индивидуума могут наблюдаться один или несколько факторов риска, к которым относятся, но ими не ограничиваясь, длительная устойчивая неконтролируемая гипертензия, некорректируемое заболевание клапанов, хроническая стенокардия, недавно перенесенный инфаркт миокарда, наследственная предрасположенность к заболеванию сердца или патологической гипертрофии. У индивидуума, находящегося в группе риска, может быть установлена генетическая предрасположенность к гипертрофии сердца, или он может иметь семейный анамнез гипертрофии сердца.

Предпочтительно, чтобы введение индивидууму как ингибитора miR-208а/miR-208b, так и ингибитора miR-499 приводило к смягчению у индивидуума одного или нескольких симптомов гипертрофии сердца, сердечной недостаточности или инфаркта миокарда или к задержке превращения гипертрофии сердца в сердечную недостаточность. Одним или несколькими улучшенными симптомами могут быть, например, увеличенная способность к физической нагрузке, увеличенный объем сердечного выброса, пониженное конечное диастолическое давление левого желудочка, пониженное заклинивающее давление легочных капилляров, увеличенный сердечный выброс, увеличенный сердечный индекс, пониженное давление в легочных артериях, пониженные конечные систолический и диастолический объемы левого желудочка, уменьшенный фиброз сердца, уменьшенное отложение коллагена в сердечной мышце, сниженная нагрузка на стенку левого и правого желудочка, сниженное напряжение стенки, улучшенное качество жизни и сниженные показатели заболеваемости или смертности вследствие заболевания.

В одном из вариантов осуществления изобретения у индивидуума после введения ингибиторов miR-208 (например, miR-208а и/или miR-208b) и miR-499 снижается ответ на нагрузку на сердце. К ответу на нагрузку на сердце относятся в числе прочего гипертрофия кардиомиоцитов, фиброз сердца, пониженная экспрессия α-МНС в клетках сердца и/или повышенная экспрессия β-МНС в клетках сердца. Введение индивидууму как ингибитора miR-208а/miR-208b, так и ингибитора miR-499 приводит к ускоренному эффекту при ответе на нагрузку на сердце по сравнению с введением какого-либо одного ингибитора. Например, уменьшение ответа на нагрузку на сердце происходит меньше чем через восемь недель, меньше чем через шесть недель, меньше чем через четыре недели, меньше чем через три недели, меньше чем через две недели, меньше чем через одну неделю, меньше чем через пять дней, меньше чем через три дня или меньше чем через один день после введения ингибиторов. В другом варианте осуществления уменьшение ответа на нагрузку на сердце происходит меньше чем через двенадцать часов после введения ингибиторов.

В некоторых вариантах осуществления ингибиторы miR-208 (например, miR-208а и/или miR-208b) и miR-499 могут представлять собой антисмысловые олигонуклеотиды, нацеленные на последовательности зрелой miR-499 и/или miR-208а или miR-208b. Антисмысловые олигонуклеотиды могут представлять собой рибонуклеотиды или дезоксирибонуклеотиды. Предпочтительно, чтобы антисмысловые олигонуклеотиды имели по меньшей мере одну химическую модификацию. Например, подходящие антисмысловые олигонуклеотиды могут содержать одну или несколько «конформационно вынужденных» или бициклических модификаций сахара нуклеозида, например «замкнутые нуклеиновые кислоты». «Замкнутые нуклеиновые кислоты» (LNA) представляют собой модифицированные рибонуклеотиды, которые содержат внешний мостик между 2' и 4' углеродами фрагмента сахара рибозы, получая «замкнутую» конформацию, которая придает олигонуклеотидам, содержащим LNA, повышенную температурную стабильность. Антисмысловые олигонуклеотиды, нацеленные на miR-208а/miR-208b и miR-499, могут содержать комбинации LNA или иначе модифицированных нуклеотидов и рибонуклеотидов или дезоксирибонуклеотидов. Альтернативно антисмысловые олигонуклеотиды могут содержать пептидные нуклеиновые кислоты (PNA), которые вместо сахаро-фосфатного остова содержат пептидный остов. К другим химическим модификациям, которые могут содержать антисмысловые олигонуклеотиды, относятся, но ими не ограничиваясь, модификации сахара, такие как модификации 2'-О-алкил (например, 2'-О-метил, 2'-О-метоксиэтил), 2'-фтор и 4'-тио, и модификации остова, такие как одна или несколько фосфоротиоатных, морфолино или фосфонокарбоксилатных связей (см., например, патенты США 6693187 и 7067641, которые приводятся в настоящем документе в качестве ссылки в полном объеме). Например, антисмысловые олигонуклеотиды, в частности более короткие, (например, меньше чем 15 нуклеотидов) могут содержать одну или несколько модификаций, усиливающих сродство, таких как, но ими не ограничиваясь, LNA, бициклические нуклеозиды, фосфоноформаты, 2'-О-алкил и подобное. В некоторых вариантах осуществления подходящие антисмысловые олигонуклеотиды представляют собой 2'-О-метоксиэтильные «олигомеры с пропусками», которые содержат 2'-О-метоксиэтил-модифицированные рибонуклеотиды как на 5', так и на 3'-концах по меньшей мере с десятью дезоксирибонуклеотидами в центре. Эти «олигомеры с пропусками» способны запускать РНКаза Н-зависимые механизмы деградации РНК-мишеней. В данной области известны и подходят для применения в способах по изобретению и другие модификации антисмысловых олигонуклеотидов для усиления стабильности и повышения эффективности, такие как описанные в патенте США 6838283, который приводится в настоящем документе в качестве ссылки в полном объеме. Предпочтительные антисмысловые олигонуклеотиды, используемые для ингибирования активности miRNA, имеют от около 5 до около 50 нуклеотидов в длину, от около 10 до около 30 нуклеотидов в длину или от около 20 до около 25 нуклеотидов в длину. В некоторых вариантах осуществления антисмысловые олигонуклеотиды, нацеленные на miR-208а/miR-208b и miR-499, составляют от около 8 до около 18 нуклеотидов в длину и в других вариантах от около 12 до около 16 нуклеотидов в длину. В частности, может быть использован любой 8-мер или более длинный олигонуклеотид, который комплементарен miR208a или miR-208b, т.е. любая последовательность anti-mir, которая комплементарна любой непрерывной последовательности в miR208a или miR-208b, начиная с 5'-конца miR до 3'-конца зрелой последовательности. Антисмысловые олигонуклеотиды в некоторых случаях могут содержать последовательность, которая по меньшей мере частично комплементарна последовательности зрелой miRNA, например, по меньшей мере на около 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% комплементарна последовательности зрелой miRNA. В некоторых вариантах осуществления антисмысловой олигонуклеотид может быть по существу комплементарен последовательности зрелой miRNA, то есть по меньшей мере на около 95%, 96%, 97%, 98% или 99% комплементарен последовательности полинуклеотида-мишени. В одном из вариантов осуществления антисмысловой олигонуклеотид содержит последовательность, которая на 100% комплементарна последовательности зрелой miRNA.

В других вариантах осуществления антисмысловые олигонуклеотиды являются антагомирами. «Антагомиры» представляют собой одноцепочечные химически модифицированные рибонуклеотиды, которые по меньшей мере частично комплементарны последовательности miRNA. Антагомиры могут содержать один или несколько модифицированных нуклеотидов, таких как нуклеотиды с модификациями сахара 2'-О-метил. В некоторых вариантах осуществления антагомиры содержат лишь модифицированные нуклеотиды. Антагомиры также могут содержать одну или несколько фосфоротиоатных связей, что приводит к получению частично или полностью фосфоротиоатного остова. Для содействия in vivo доставке и стабильности антагомир может быть связан на своем 3'-конце со стероидом, таким как холестерин, жирная кислота, витамин, углевод, пептид или другой низкомолекулярный лиганд. Антагомиры, подходящие для ингибирования miRNA, могут иметь от около 15 до около 50 нуклеотидов в длину, более предпочтительно, от около 18 до около 30 нуклеотидов в длину и, наиболее предпочтительно, от около 20 до около 25 нуклеотидов в длину. Под «частично комплементарной» понимают последовательность, которая по меньшей мере на около 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% комплементарна последовательности полинуклеотида-мишени. Антагомиры могут быть по меньшей мере на около 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% комплементарны последовательности зрелой miRNA. В некоторых вариантах осуществления антагомир может быть по существу комплементарен последовательности зрелой miRNA, то есть по меньшей мере на около 95%, 96%, 97%, 98% или 99% комплементарен последовательности полинуклеотида-мишени. В других вариантах осуществления антагомиры на 100% комплементарны последовательности зрелой miRNA.

В некоторых вариантах осуществления ингибиторы miR-499 и miR-208а/miR-208b представляют собой антагомиры, содержащие последовательность, которая полностью комплементарна последовательности зрелой miR-499 и зрелой miR-208а или miR-208b. В одном из вариантов осуществления ингибитор miR-499 представляет собой антагомир, имеющий последовательность, которая частично или полностью комплементарна 5'-UUAAGACUUGCAGUGAUGUUU-3' (SEQ ID NO:14). В другом варианте осуществления ингибитор miR-208а представляет собой антагомир, имеющий последовательность, которая частично или полностью комплементарна 5'-AUAAGACGAGCAAAAAGCUUGU-3' (SEQ ID NO:5). В другом варианте осуществления ингибитор miR-208а представляет собой антагомир, имеющий последовательность 5'-ACAAGCUUUUUGCUCGUCUUAU-3' (SEQ ID NO:15). В еще одном варианте осуществления ингибитор miR-208а представляет собой антагомир, имеющий последовательность SEQ ID NO:16. В другом варианте осуществления ингибитор miR-208b представляет собой антагомир, имеющий последовательность, которая частично или полностью комплементарна 5'-AUAAGACGAACAAAAGGUUUGU-3' (SEQ ID NO:19).

В некоторых вариантах осуществления ингибиторы miR-499 и miR-208а или miR-208b представляют собой химически модифицированные антисмысловые олигонуклеотиды. В одном из вариантов осуществления ингибитор miR-499 представляет собой химически модифицированный антисмысловой олигонуклеотид, содержащий последовательность, по существу комплементарную 5'-UUAAGACUUGCAGUGAUGUUU-3' (SEQ ID NO:14). В другом варианте осуществления ингибитор miR-208а представляет собой химически модифицированный антисмысловой олигонуклеотид, содержащий последовательность, по существу комплементарную 5'-AUAAGACGAGCAAAAAGCUUGU-3' (SEQ ID NO:5). В еще одном варианте осуществления ингибитор miR-208b представляет собой химически модифицированный антисмысловой олигонуклеотид, содержащий последовательность, по существу комплементарную 5'-AUAAGACGAACAAAAGGUUUGU-3' (SEQ ID NO:19). Под используемым в настоящем документе выражением «по существу комплементарная» понимают последовательность, которая по меньшей мере на около 95%, 96%, 97%, 98%, 99% или 100% комплементарна последовательности полинуклеотида-мишени (например, последовательности зрелой miRNA или miRNA-предшественника).

Антисмысловые олигонуклеотиды могут содержать последовательность, которая по существу комплементарна последовательности miRNA-предшественника (pre-miRNA) для miR-499 или miR-208а/miR-208b. В некоторых вариантах осуществления антисмысловой олигонуклеотид содержит последовательность, которая по существу комплементарна последовательности, локализованной вне региона стебель-петля последовательности pre-miR-499 или pre-miR-208а/miR-208b. В одном из вариантов осуществления ингибитор функции miR-499 представляет собой антисмысловой олигонуклеотид, имеющий последовательность, которая по существу комплементарна последовательности pre-miR-499, выбранной из группы, состоящей из SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12. В другом варианте осуществления ингибитор функции miR-208а представляет собой антисмысловой олигонуклеотид, имеющий последовательность, которая по существу комплементарна последовательности pre-miR-208а, выбранной из группы, состоящей из SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 и SEQ ID NO:4. В еще одном варианте осуществления ингибитор функции miR-208b представляет собой антисмысловой олигонуклеотид, имеющий последовательность, которая по существу комплементарна последовательности pre-miR-208b SEQ ID NO:18.

В другом варианте осуществления изобретения для ингибирования одновременно и miR-208 и miR-499 может быть использована одна молекула нуклеиновой кислоты. Например, одна нуклеиновая кислота может содержать последовательность, которая по меньшей мере частично комплементарна последовательности зрелой miR-208а (например, SEQ ID NO:5), и последовательность, которая по меньшей мере частично комплементарна последовательности зрелой miR-499 (например, SEQ ID NO:14). В другом варианте осуществления одна нуклеиновая кислота может содержать последовательность, которая по меньшей мере частично комплементарна последовательности зрелой miR-208b (например, SEQ ID NO:19), и последовательность, которая по меньшей мере частично комплементарна последовательности зрелой miR-499 (например, SEQ ID NO:14). В еще одном варианте осуществления одна молекула нуклеиновой кислоты может содержать последовательность, которая по меньшей мере частично комплементарна последовательности pre-miR-208а (например, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 и SEQ ID NO:4), и последовательность, которая по меньшей мере частично комплементарна последовательности pre-miR-499 (например, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12). В другом варианте осуществления одна молекула нуклеиновой кислоты может содержать последовательность, которая по меньшей мере частично комплементарна последовательности pre-miR-208b (например, SEQ ID NO:18), и последовательность, которая по меньшей мере частично комплементарна последовательности pre-miR-499 (например, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12). Одна молекула нуклеиновой кислоты дополнительно может содержать один или несколько спейсерных нуклеотидов между последовательностями, нацеливающими miR-208 (например, miR-208а или miR-208b) и miR-499. Например, одна молекула нуклеиновой кислоты может содержать от около 1 до около 200 спейсерных нуклеотидов, более предпочтительно, от около 5 до около 100 спейсерных нуклеотидов, наиболее предпочтительно, от около 10 до около 50 спейсерных нуклеотидов между последовательностями, нацеливающими miR-208а/miR-208b и miR-499.

Любой из ингибиторов miR-208а/miR-208b и miR-499, описанных в настоящем документе, может быть доставлен к клетке-мишени (например, клетке сердца, клетке скелетной мышцы) посредством доставки к клетке вектора экспрессии, кодирующего ингибиторы miR-208а/miR-208b и miR-499. Ингибитор miR-208а/miR-208b и ингибитор miR-499 могут кодироваться одним и тем же вектором экспрессии. Альтернативно ингибитор miR-208 (например, miR-208а или miR-208b) и ингибитор miR-499 кодируются на отдельных векторах экспрессии. «Вектор» представляет собой композицию, которая может быть использована для доставки интересующей нуклеиновой кислоты во внутреннее пространство клетки. В данной области известно большое число векторов, к которым относятся, но ими не ограничиваясь, линейные полинуклеотиды, полинуклеотиды, ассоциированные с ионными и амфифильными соединениями, плазмиды и вирусы. Таким образом, термин «вектор» включает самостоятельно реплицирующуюся плазмиду или вирус. К примерам вирусных векторов относятся, но ими не ограничиваясь, аденовирусные векторы, аденоассоциированные вирусные векторы, ретровирусные векторы и подобное. Экспрессирующая конструкция может быть реплицирована в живой клетке или она может быть создана синтетическим путем. Для целей настоящей заявки термины «экспрессирующая конструкция», «вектор экспрессии» и «вектор» используются взаимозаменяемо для демонстрации применения изобретения в общем, иллюстративном, смысле и не предполагают ограничивать изобретение.

В одном из вариантов осуществления вектор экспрессии для экспрессии ингибитора miR-208а/miR-208b и/или miR-499 содержит промотор, функционально связанный с полинуклеотидом, кодирующим антисмысловой олигонуклеотид, где последовательность экспрессируемого антисмыслового олигонуклеотида частично или полностью комплементарна зрелой последовательности miR-208 (например, miR-208а или miR-208b) и/или miR-499. Под фразой «функционально связанный» или «под транскрипционным контролем», используемой в настоящем документе, понимают, что промотор находится в правильном месте и ориентации относительно полинуклеотида, чтобы контролировать инициацию транскрипции посредством РНК-полимеразы и экспрессии полинуклеотида. В другом варианте осуществления вектор экспрессии может кодировать одну нуклеиновую кислоту, которая нацеливает обе miR-208 (например, miR-208а или miR-208b) и miR-499, как описано в настоящем документе, где одна нуклеиновая кислота функционально связана с промотором. В другом варианте осуществления один вектор экспрессии может кодировать ингибитор miR-208а/miR-208b и ингибитор miR-499, где ингибитор miR-208а/miR-208b запускается промотором, отличным от промотора ингибитора miR-499.

Под используемым в настоящем документе «промотором» понимают последовательность ДНК, распознаваемую синтетическим аппаратом клетки или встроенным синтетическим аппаратом, необходимую для инициации специфической транскрипции гена. К подходящим промоторам относятся, но ими не ограничиваясь, промоторы РНК-pol I, pol II, pol III и вирусные промоторы (например, промотор ранних генов цитомегаловируса (CMV) человека, ранний промотор SV40 и длинный терминальный повтор вируса саркомы Рауса). В одном из вариантов осуществления промотор представляет собой тканеспецифический промотор. Особенный интерес представляют специфичные для мышц промоторы и конкретнее специфичные для сердца промоторы. К ним относятся промотор легкой цепи-2 миозина (Franz et al. (1994) Cardioscience, Vol. 5(4): 235-43; Kelly et al. (1995) J. Cell Biol., Vol.129(2): 383-396), промотор альфа-актина (Moss et al. (1996) Biol. Chem., Vol. 271(49):31688-31694), промотор тропонина 1 (Bhavsar et al. (1996) Genomics, Vol. 35(1):11-23); промотор обменника Na+/Ca2+ (Barnes et al. (1997) J. Biol. Chem., Vol. 272(17):11510-11517), промотор дистрофина (Kimura et al. (1997) Dev. Growth Differ., Vol. 39(3):257-265), промотор альфа7 интегрина (Ziober and Kramer (1996) J. Bio. Chem., Vol. 271(37):22915-22), промотор натрийуретического пептида мозга (LaPointe et al. (1996) Hypertension, Vol. 27(3 Pt 2):715-22) и промотор альфа В-кристаллина/малого белка теплового шока (Gopal-Srivastava (1995) J. Mol. Cell. Biol., Vol. 15(12):7081-7090), промотор тяжелой цепи альфа-миозина (Yamauchi-Takihara et al. (1989) Proc. Natl. Acad. Sci. USA, Vol. 86(10):3504-3508) и промотор ANF (LaPointe et al. (1988) J. Biol. Chem., Vol. 263(19):9075-9078).

В некоторых вариантах осуществления промотор, функционально связанный с полинуклеотидом, кодирующим ингибитор miR-499 и/или miR-208a/miR-208b, может представлять собой индуцибельный промотор. Индуцибельные промоторы известны в данной области и к ним относятся, но ими не ограничиваясь, промотор тетрациклина, промотор металлотионеина IIA, промотор теплового шока, элементы, отвечающие на стероид/тиреоидный гормон/ретиноевую кислоту, аденовирусный поздний промотор и индуцибельный вирус опухоли молочных желез мышей LTR. Вектор экспрессии может кодировать одну нуклеиновую кислоту, которая нацеливает как miR-208 (например, miR-208a или miR-208b), так и miR-499, как описано в настоящем документе, где одна нуклеиновая кислота функционально связана с индуцибельным промотором. Альтернативно один вектор экспрессии может кодировать ингибитор miR-208a/miR-208b и ингибитор miR-499, где ингибитор miR-208a/miR-208b запускается первым индуцибельным промотором и ингибитор miR-499 запускается вторым индуцибельным промотором. В другом варианте осуществления первый вектор экспрессии может кодировать ингибитор miR-208a/miR-208b, где ингибитор miR-208a/miR-208b функционально связан с первым индуцибельным промотором, и второй вектор экспрессии может кодировать ингибитор miR-499, где ингибитор miR-499 функционально связан со вторым индуцибельным промотором. Также рассматриваются и другие сочетания индуцибельных и конститутивных промоторов для контроля экспрессии ингибиторов miR-208 (например, miR-208a или miR-208b) и miR-499. Например, ингибитор miR-208a/miR-208b может быть экспрессирован с вектора, использующего конститутивный промотор, тогда как ингибитор miR-499 может быть экспрессирован с вектора, использующего индуцибельный промотор.

Настоящее изобретение также относится к способам удаления или очистки от ингибиторов miR-499 и miR-208a/miR-208b после лечения. Способ может содержать сверхэкспрессию сайтов связывания ингибиторов miR-499 и miR-208a/miR-208b в ткани сердца. В другом варианте осуществления настоящее изобретение относится к способу удаления или очистки miR-499 и miR-208 (например, miR-208a или miR-208b) после лечения. В одном из вариантов осуществления способ содержит сверхэкспрессию регионов сайтов связывания miR-499 и miR-208a/miR-208b в скелетной мускулатуре, используя промотор, специфичный для скелетной мускулатуры и сердечной мышцы (мышечной креатинкиназы (МСК)). Регионы сайтов связывания предпочтительно содержат последовательность затравочного региона miR-499 и miR-208a или miR-208b. Затравочный регион представляет собой 5' участок miRNA, охватывающий нуклеотиды 2-8, который важен для распознавания мишени. В некоторых вариантах осуществления сайт связывания может содержать последовательность из 3'UTR одной или нескольких мишеней miR-499 или miR-208, таких как THRAP1 или PURбета. В другом варианте осуществления для ослабления или прекращения действия miRNA после miR-499 и miR-208 может быть введен ингибитор miR-499 и miR-208.

В другом варианте осуществления изобретения ингибитор miR-208 (например, miR-208a или miR-208b) и ингибитор miR-499 вводятся совместно. Ингибитор miR-208 и miR-208 могут быть введены в одной препаративной форме. Например, для совместного введения двух ингибиторов может быть использована фармацевтическая композиция, содержащая ингибитор miR-208 и ингибитор miR-499. Альтернативно ингибиторы miR-208 и miR-499 могут кодироваться одной нуклеиновой кислотой, такой как вектор экспрессии, описанный в настоящем документе. Большое число совместных введений двух ингибиторов может быть осуществлено в течение продолжительного периода времени, например, одной недели, двух недель, трех недель, одного месяца, двух месяцев, трех месяцев, четырех месяцев, пяти месяцев, шести месяцев, девяти месяцев, одного года, двух лет, трех лет, четырех лет или пяти лет.

В некоторых вариантах осуществления ингибитор miR-208 (например, miR-208a или miR-208b) и ингибитор miR-499 вводятся последовательно. В одном из вариантов осуществления ингибитор miR-208 вводится перед ингибитором miR-499. В другом варианте осуществления ингибитор miR-499 вводится перед ингибитором miR-208. Интервал, отделяющий введение ингибиторов miR-208 и miR-499, может находиться в диапазоне от нескольких минут до нескольких дней. Например, интервал может составлять от одного часа до около 72 часов, от шести часов до около 48 часов или от около 12 часов до около 24 часов. В предпочтительном варианте осуществления интервал между введением ингибитора miR-208 и ингибитора miR-499 составляет по меньшей мере 24 часа. Авторы изобретения обнаружили, что введение ингибитора miR-499 по меньшей мере за около 24 часов до ингибитора miR-208 приводит по меньшей мере к около 50% снижению индуцированной нагрузкой экспрессии β-МНС через около трех дней после введения ингибитора miR-208. В отсутствие ингибитора miR-499 сопоставимое влияние на индуцированную нагрузкой экспрессию β-МНС не наблюдается по меньшей мере до около двух месяцев после введения ингибитора miR-208.

В других вариантах осуществления изобретения для получения длительного эффекта может быть использовано более чем одно последовательное введение ингибиторов miR-208 и miR-499. При этом может быть использовано большое число сочетаний. В качестве иллюстрации, если ингибитор miR-499 - это «А», а ингибитор miR-208 (например, miR-208a или miR-208b) - это «В», то в качестве примера приводятся следующие перестановки на основе 3 и 4 суммарных введений:

А/В/А В/А/В В/В/А А/А/В В/А/А А/В/В В/В/В/А В/В/А/В

А/А/В/В А/В/А/В А/В/В/А В/В/А/А В/А/В/А В/А/А/В В/В/В/А

А/А/А/В В/А/А/А А/В/А/А А/А/В/А А/В/В/В В/А/В/В В/В/А/В

Также рассматриваются и другие комбинации.

Предпочтительно, чтобы после введения индивидууму ингибитора miR-208 и ингибитора miR-499 экспрессия или активность miR-208 (например, miR-208a или miR-208b) и miR-499 в клетках сердца индивидуума снижалась. В некоторых вариантах осуществления после введения ингибитора miR-208 и miR-499 экспрессия или активность miR-208a/miR-208b и/или miR-499 снижается больше чем на 50%, больше чем на 60%, больше чем на 70%, больше чем на 75%, больше чем на 80%, больше чем на 85%, больше чем на 90% или больше чем на 95%. В одном из вариантов осуществления после введения ингибиторов экспрессия или активность miR-208a/miR-208b и miR-499 в клетках сердца индивидуума снижается больше чем на 60 процентов. В другом варианте осуществления после введения ингибиторов экспрессия или активность miR-208a/miR-208b и miR-499 в клетках сердца индивидуума снижается больше чем на 80 процентов. В еще одном варианте осуществления после введения ингибиторов экспрессия или активность miR-208a/miR-208b и miR-499 в клетках сердца индивидуума снижается больше чем на 90 процентов.

Настоящее изобретение также относится к способу регуляции сократимости сердечной и/или скелетных мышц. Волокна скелетной мускулатуры взрослой особи могут быть классифицированы на подтипы быстро и медленно сокращающихся на основе специфических сократительных и метаболических свойств. Эти свойства отражают экспрессию конкретных наборов быстрых и медленных изоформ сократительных белков тяжелых и легких цепей миозина, тропомиозина и тропонинов, а также миоглобина (Naya et al. (2000) J. Biol Chem, Vol. 275(7):4545-4548). Медленно сокращающиеся мышцы используются в основном при продолжительных действиях, таких как поддержание положения тела и длительная двигательная активность. Быстро сокращающиеся волокна используются в основном при импульсных активностях, требующих больших усилий. Фенотип скелетной мускулатуры взрослой особи не статичен, но зато сохраняет способность приспосабливаться к разнообразию выполняемой нагрузки и паттернам использования сократимости, адаптируясь в морфологических, фенотипических и сократительных свойствах.

Активация нескольких генов сократительных белков быстрых скелетных мышц наблюдалась в сердце мышей с отсутствием обоих аллелей miR-208a. Эта активация генов сократительных белков быстрых скелетных мышц в сердце мышей с нокаутом miR-208а указывает на то, что miR-208 обычно действует как репрессор генной программы быстрых скелетных мышц. У мышей, мутантных по miR-208а, наблюдалось сопутствующее снижение экспрессии miR-499 (см. пример 3), указывая на то, что miR-499 также может отрицательно регулировать экспрессию генов сократительных белков быстрых скелетных мышц. Как указано выше, miR-208b также экспрессируется преимущественно в медленных скелетных мышцах (например, камбаловидной мышце). Таким образом, miR-208b может существенно влиять на сократимость сердечной и скелетных мышц у людей, а также может регулировать генную программу быстрых скелетных мышц и определять характер волокна. Авторы изобретения недавно показали, что miR-208b и miR-499 имеют важное значение в определении характера мышечного волокна за счет активации программы генов медленных мышечных волокон и подавления быстрых. Действия этих miРНК опосредуются, в частности, посредством набора транскрипционных репрессоров генов медленных миофибрилл, подобных Sox6, PURβ, Sp3 и НР1β. Использование трансгенных по miR-499 животных с МСК-промотором, специфичным для скелетных мышц, также показало превращение в более замедленный тип миофибрилл. Еще удивительнее, что при воздействии на мышей режимом вынужденной беговой дорожки трансгенные по miR-499 животные бежали более чем на 50% дольше, чем однопометные животные дикого типа, что указывает на повышенную выносливость вследствие перепрограммирования быстрых миофибрилл в более медленный тип волокон. См. статью van Rooij et al. (2009) Developmental Cell, Vol. 17:662-673).

В одном из вариантов осуществления способ регуляции сократимости сердечной и/или скелетных мышц содержит введение модулятора экспрессии или активности miR-499 и miR-208 (например, miR-208a или miR-208b) в клетки сердца и/или скелетных мышц. В другом варианте осуществления способ содержит введение модулятора miR-499 и miR-208b. В другом варианте осуществления предлагается способ регуляции экспрессии генов сократительных белков сердца, содержащий введение в клетки сердца модулятора экспрессии или активности miR-499 и miR-208 (например, miR-208a или miR-208b). В другом варианте осуществления предлагается способ регуляции экспрессии генов сократительных белков скелетных мышц, содержащий введение в клетки скелетных мышц модулятора экспрессии или активности miR-499 и miR-208 (например, miR-208a или miR-208b). В другом варианте осуществления предлагается способ регуляции экспрессии генов сократительных белков скелетных мышц, содержащий введение в клетки скелетных мышц модулятора экспрессии или активности miR-499 и miR-208b. В еще одном варианте осуществления настоящее изобретение относится к способу индуцирования переключения типа волокна клетки скелетных мышц, содержащему введение в клетки скелетных мышц модулятора экспрессии или активности miR-499 и miR-208 для клетки скелетных мышц. В другом варианте осуществления способ индуцирования переключения типа волокна клетки скелетных мышц содержит введение в клетки скелетных мышц модулятора экспрессии или активности miR-499 и miR-208b. Модулятор может представлять собой агонист или ингибитор экспрессии или активности miR-499, miR-208 и/или miR-208b. В некоторых вариантах осуществления за счет контактирования клетки с ингибитором miR-499 и miR-208а (или miR-208b) в клетке повышается экспрессия THRAP1, PURбета, миостатина, Sp3, HP1β и Sox 6. В других вариантах осуществления экспрессия THRAP1, PURбета, миостатина, Sp3, HP1β и Sox 6 в клетке понижается за счет контактирования клетки с агонистом miR-499 и miR-208а (или miR-208b).

В некоторых вариантах осуществления изобретения предлагается способ снижения экспрессии β-МНС в клетках сердца, содержащий введение в клетки сердца ингибитора экспрессии или активности miR-499 и miR-208 (например, miR-208a или miR-208b). В одном из вариантов осуществления предлагается способ снижения экспрессии β-МНС в клетках скелетных мышц, содержащий введение в клетки скелетных мышц ингибитора экспрессии или активности miR-499 и miR-208b. В других вариантах осуществления изобретения предлагается способ повышения экспрессии β-МНС в клетках сердца и/или клетках скелетных мышц, содержащий повышение экспрессии или активности эндогенных miR-499 и miR-208a (или miR-208b) или введение в клетки сердца и/или клетки скелетных мышц экзогенных miR-499 и miR-208a (или miR-208b).

В одном из вариантов осуществления изобретения предлагается способ повышения экспрессии гена сократительного белка быстрых скелетных мышц в клетках сердца, содержащий введение в клетки сердца ингибитора экспрессии или активности miR-499 и miR-208 (например, miR-208а или miR-208b). В других вариантах осуществления предлагается способ повышения экспрессии гена сократительного белка быстрых скелетных мышц в клетках скелетных мышц, содержащий введение в клетки скелетных мышц ингибитора экспрессии или активности miR-499 и miR-208b. В другом варианте осуществления предлагается способ снижения экспрессии гена сократительного белка быстрых скелетных мышц в клетках сердца и/или клетках скелетных мышц, содержащий повышение экспрессии или активности эндогенных miR-499 и miR-208а (или miR-208b) или введение в клетки сердца и/или клетки скелетных мышц экзогенных miR-499 и miR-208а (или miR-208b). К примерам генов сократительных белков быстрых скелетных мышц, экспрессия которых может быть повышена или снижена согласно способам настоящего изобретения, относятся, но ими не ограничиваясь, тропонин I2; тропонин Т3, легкая цепь быстрого скелетного миозина или альфа-актин скелетных мышц.

В скелетной мускулатуре репрессия генов медленных волокон и активация генов быстрых волокон ассоциирована с большим числом мышечно-скелетных нарушений, к которым относятся, но ими не ограничиваясь, дисфункциональная атрофия, мышечная атрофия в ответ на антигравитацию и денервация. Таким образом, экспрессия miR-499 в сочетании с miR-208а или miR-208b в клетках скелетных мышц может быть использована для репрессии генов быстрых волокон, таким образом, активируя ответную экспрессию генов медленных волокон. Соответственно, настоящее изобретение также охватывает способ лечения или профилактики мышечно-скелетного нарушения у индивидуума, нуждающегося в этом. В одном из вариантов осуществления способ содержит введение индивидууму агониста miR-208 (например, miR-208а или miR-208b) и агониста miR-499, где после введения в клетках скелетных мышц индивидуума повышается экспрессия или активность miR-208a/miR-208b и miR-499. В другом варианте осуществления способ содержит введение индивидууму агониста miR-208b и агониста miR-499, где после введения в клетках скелетных мышц индивидуума повышается экспрессия или активность miR-208b и miR-499. Предпочтительно, чтобы после введения агонистов miR-499 и miR-208а (или miR-208b) в клетках скелетных мышц индивидуума снижалась экспрессия одного или нескольких генов быстрых скелетных мышц. К одному или нескольким генам быстрых скелетных мышц могут относиться, но ими не ограничиваясь, тропонин I2; тропонин Т3, легкая цепь быстрого скелетного миозина или альфа-актин скелетных мышц.

В другом варианте осуществления настоящее изобретение относится к способу лечения или профилактики мышечной атрофии в ответ на условия пониженной гравитации путем введения в скелетную мышцу агониста miR-499 и miR-208 (например, miR-208а или miR-208b). В другом варианте осуществления способ лечения или профилактики мышечной атрофии в ответ на условия пониженной гравитации содержит введение в скелетную мышцу агониста miR-499 и miR-208b. В еще одном варианте осуществления настоящее изобретение относится к способу лечения или профилактики мышечной атрофии путем введения в скелетную мышцу агониста miR-499 и агониста miR-208 (например, miR-208а и/или miR-208b). В другом варианте осуществления способ лечения или профилактики мышечной атрофии содержит введение в скелетную мышцу агониста miR-499 и агониста miR-208b.

В некоторых вариантах осуществления агонист miR-208 (miR-208а или miR-208b) и агонист miR-499 представляют собой полинуклеотиды, кодирующие последовательность зрелой miR-208 (miR-208а или miR-208b) и/или miR-499. В одном из вариантов осуществления полинуклеотид содержит последовательность зрелой miR-208а (SEQ ID NO:5) и последовательность зрелой miR-499 (SEQ ID NO:14). В другом варианте осуществления полинуклеотид содержит последовательность зрелой miR-208b (SEQ ID NO:19) и последовательность зрелой miR-499 (SEQ ID NO:14). В другом варианте осуществления агонист miR-499 и агонист miR-208 (miR-208а или miR-208b) могут представлять собой полинуклеотид, содержащий последовательность pri-miRNA или pre-miRNA для miR-499 и miR-208 (miR-208а или miR-208b). Альтернативно агонист miR-208 (miR-208а или miR-208b) и агонист miR-499 могут представлять собой отдельные полинуклеотиды, каждый из которых содержит последовательность зрелой miRNA или последовательность pre-miRNA. Полинуклеотид, содержащий последовательность зрелой miR-499 и/или miR-208 (miR-208а или miR-208b), может быть одноцепочечным или двухцепочечным. Полинуклеотиды могут содержать одну или несколько химических модификаций, таких как замкнутые нуклеиновые кислоты, пептидные нуклеиновые кислоты, модификации сахара, такие как 2'-O-алкил (например, 2'-O-метил, 2'-O-метоксиэтил), 2'-фтор и 4' тио-модификации, и модификации остова, такие как одна или несколько фосфоротиоатных, морфолино или фосфонокарбоксилатных связей. В одном из вариантов осуществления полинуклеотид, содержащий последовательность miR-499, miR-208 и/или miR-208b, конъюгируют с холестерином.

В другом варианте осуществления агонист miR-499 и miR-208 (miR-208а или miR-208b) может кодироваться на векторе экспрессии. Вектор экспрессии для экспрессии miR-499 и miR-208 (miR-208а или miR-208b) содержит по меньшей мере один промотор, функционально связанный с полинуклеотидом, кодирующим miR-499 и/или miR-208 (miR-208а или miR-208b). Полинуклеотид, кодирующий miR-499, может кодировать последовательность первичной miR-499 (pri-miR-499), последовательность предшественника miR-499 (pre-miR-499) или последовательность зрелой miR-499. Полинуклеотид, кодирующий miR-208а/miR-208b, может кодировать последовательность первичной miRNA-208а/208b (pri-miR-208/pri-miR-208b), последовательность предшественника miRNA-208/208b (pre-miR-208а/pre-miR-208b) или последовательность зрелой miR-208а/208b. В некоторых вариантах осуществления вектор экспрессии содержит полинуклеотид, функционально связанный с промотором, где указанный полинуклеотид содержит последовательность SEQ ID NO:5 и SEQ ID NO:14. В других вариантах осуществления вектор экспрессии содержит полинуклеотид, функционально связанный с промотором, где указанный полинуклеотид содержит последовательность SEQ ID NO:19 и SEQ ID NO:14. Такие полинуклеотиды могут иметь от около 18 до около 2000 нуклеотидов в длину, от около 70 до около 200 нуклеотидов в длину, от около 20 до около 50 нуклеотидов в длину или от около 18 до около 25 нуклеотидов в длину. В другом варианте осуществления вектор экспрессии может экспрессировать агониста miR-499 (например, полинуклеотид, содержащий последовательность miR-499) и агониста miR-208 (например, полинуклеотид, содержащий последовательность miR-208а или miR-208b) с различных промоторов. Полинуклеотиды, кодирующие miR-499, miR-208а и/или miR-208b, могут быть локализованы в нуклеиновой кислоте, кодирующей интрон, или в нуклеиновой кислоте, кодирующей нетранслируемый регион мРНК, или в некодирующей РНК. В одном из вариантов осуществления вектор экспрессии может содержать последовательности из 20-го интрона гена Myh7b или последовательности из 31-го интрона гена Myh7b (β-МНС).

Агонист miR-208а или miR-208b может быть введен индивидууму совместно с агонистом miR-499. Два агониста могут быть введены в одной препаративной форме, например, фармацевтической композиции, содержащей агонист miR-208а или miR-208b и агонист miR-499. Альтернативно два агониста (например, miR-208а и miR-499 или miR-208b и miR-499) могут представлять собой один полинуклеотид, кодирующий последовательность зрелой miRNA или последовательность pre-miRNA двух miRNA. Большое число сочетанных введений двух агонистов может быть осуществлено в течение длительного периода времени, например одной недели, двух недель, трех недель, одного месяца, двух месяцев, трех месяцев, четырех месяцев, пяти месяцев, шести месяцев, девяти месяцев, одного года, двух лет, трех лет, четырех лет или пяти лет.

В некоторых вариантах осуществления агонист miR-208а или miR-208b и агонист miR-499 вводят последовательно. В одном из вариантов осуществления агонист miR-208а или miR-208b вводят перед агонистом miR-499. В другом варианте осуществления агонист miR-499 вводят перед агонистом miR-208а или miR-208b. Интервал, отделяющий введение агонистов, может находиться в диапазоне от нескольких минут до недель, например от около одного часа до около 72 часов, от шести часов до около 48 часов или от около 12 часов до около 24 часов. В предпочтительном варианте осуществления интервал между введением агониста miR-208а или miR-208b и агониста miR-499 составляет по меньшей мере 24 часа.

Настоящее изобретение также относится к фармацевтическим композициям, содержащим ингибитор или агонист miR-499, miR-208а и/или miR-208b. Рассматривая клиническое применение, фармацевтические композиции должны быть получены в форме, подходящей для намеченного применения. Как правило, это будет означать получение композиций, которые по существу свободны от пирогенов, а также других примесей, которые могут быть опасны для человека и животных.

В одном из вариантов осуществления фармацевтическая композиция содержит эффективную дозу ингибитора miR-499 и/или эффективную дозу ингибитора miR-208а или miR-208b. В другом варианте осуществления фармацевтическая композиция содержит эффективную дозу агониста miR-499 и/или эффективную дозу агониста miR-208а или miR-208b. Под «эффективной дозой» понимают количество, достаточное для получения полезного или желательного клинического результата. Эффективная доза ингибитора miRNA или агониста miRNA по изобретению может составлять от около 1 мг/кг до около 200 мг/кг, от около 20 мг/кг до около 160 мг/кг или от около 40 мг/кг до около 100 мг/кг. В одном из вариантов осуществления ингибитор miR-208а или miR-208b и ингибитор miR-499 вводят каждый в дозе от около 20 мг/кг до около 200 мг/кг. В другом варианте осуществления ингибитор miR-208а или miR-208b и ингибитор miR-499 вводят каждый в дозе около 80 мг/кг. В другом варианте осуществления агонист miR-208а или miR-208b и агонист miR-499 вводят каждый в дозе от около 20 мг/кг до около 200 мг/кг. В еще одном варианте осуществления агонист miR-208а или miR-208b и агонист miR-499 вводят каждый в дозе около 80 мг/кг. Точное определение, какую дозу полагать эффективной, может быть основано на факторах, индивидуальных для каждого пациента, к которым относятся его телосложение, возраст, тип расстройства (например, инфаркт миокарда, сердечная недостаточность, гипертрофия сердца или мышечно-скелетное нарушение) и природа ингибитора или агониста (например, антагомир, экспрессирующая конструкция, антисмысловой олигонуклеотид и т.д.). Поэтому дозы могут быть без труда установлены специалистом в данной области исходя из настоящего описания и знаний в данной области.

В качестве носителей для доставки олигонуклеотидных ингибиторов функции miРНК, полинуклеотидов, кодирующих агонистов miRNA, или конструкций, экспрессирующих определенных ингибиторов или агонистов miRNA, могут быть использованы коллоидные дисперсные системы, такие как макромолекулярные комплексы, нанокапсулы, микросферы, шарики и системы на основе липидов, к которым относятся эмульсии масло-в-воде, мицеллы, смешанные мицеллы и липосомы. К коммерчески доступным жировым эмульсиям, которые подходят для доставки нуклеиновых кислот по изобретению к тканям сердца и скелетных мышц, относятся интралипид®, липозин®, липозин® II, липозин® III, нутрилипид и другие аналогичные липидные эмульсии. Предпочтительной коллоидной системой для применения в качестве носителя для доставки in vivo является липосома (т.е. искусственный пузырек мембраны). Получение и применение таких систем хорошо известно в данной области. Типичные препаративные формы также описываются в патентах США 5981505; 6217900; 6383512; 5783565; 7202227; 6379965; 6127170; 5837533; 6747014 и WO03/093449, которые приводятся в настоящем документе в качестве ссылки в полном объеме.

Для получения стабильных носителей для доставки и содействия поглощению клетками-мишенями обычно будет желательно использовать подходящие соли и буферы. Водные композиции по настоящему изобретению содержат эффективное количество системы доставки, содержащей полинуклеотиды ингибиторов или последовательности полинуклеотидов miRNA (например, липосом или других комплексов или векторов экспрессии), растворенной или диспергированной в фармацевтически приемлемом носителе или водной среде. Под фразами «фармацевтически приемлемый» или «фармакологически приемлемый» понимают молекулярные частицы и композиции, которые при введении животному или человеку не приводят к негативным, аллергическим или другим неблагоприятным реакциям. Под используемым в настоящем документе термином «фармацевтически приемлемый носитель» понимают растворители, буферы, растворы, дисперсионные среды, покрытия, антибактериальные и противогрибковые агенты, изотонические и замедляющие всасывание агенты и подобное, приемлемые для применения в составлении фармацевтических препаратов, таких как фармацевтические препараты, подходящие для введения человеку. Применение таких сред и агентов для фармацевтически активных веществ хорошо известно в данной области. За исключением случаев несовместимости каких-либо принятых сред или агента с активными ингредиентами по настоящему изобретению их применение рассматривается в терапевтических композициях. В композиции могут быть введены также добавочные активные ингредиенты при условии, что они не инактивируют векторы или полинуклеотиды композиций.

К активным композициям по настоящему изобретению могут относиться классические фармацевтические препараты. Введение этих композиций по настоящему изобретению может происходить любым обычным путем, если ткань-мишень доступна этим способом. К такому способу введения относятся пероральный, назальный и буккальный. Альтернативно введение можно осуществить посредством внутрикожной, подкожной, внутримышечной, внутрибрюшинной или внутривенной инъекции или непосредственным введением в ткань сердца. Фармацевтические композиции, содержащие ингибиторы miРНК, полинуклеотиды, кодирующие последовательность miРНК, или экспрессирующие конструкции, содержащие последовательности miРНК, также могут быть введены с помощью катетерных систем или систем, которые отключают коронарное кровообращение для доставки терапевтических агентов к сердцу. В данной области известно большое число катетерных систем для доставки терапевтических агентов к сердцу и коронарным сосудам. Некоторые неограниченные примеры способов доставки посредством катетера или способов отключения коронарных сосудов, подходящие для применения по настоящему изобретению, описаны патенте США 6416510; патенте США 6716196; патенте США 6953466, WO 2005/082440, WO 2006/089340, патентной публикации США 2007/0203445, патентной публикации США 2006/0148742 и патентной публикации США 2007/0060907, которые приводятся в настоящем документе в качестве ссылки в полном объеме. Такие композиции обычно вводились бы в виде фармацевтически приемлемых композиций, описанных в настоящем документе.

Активные соединения также могут быть введены парентерально или внутрибрюшинно. В качестве иллюстрации, растворы активных соединений в виде свободного основания или фармакологически приемлемых солей могут быть получены в воде, подходящим образом смешанной с сурфактантом, таким как гидроксипропилцеллюлоза. Дисперсии также могут быть получены в глицерине, жидких полиэтиленгликолях и их смесях и в маслах. При обычных условиях хранения и использования эти препараты обычно содержат консервант для предотвращения роста микроорганизмов.

К фармацевтическим формам, подходящим для применения в виде инъекций или катетерной доставки, относятся, например, стерильные водные растворы или дисперсии и стерильные порошки для приготовления для немедленного приема стерильных растворов или дисперсий для инъекций. Как правило, эти препараты являются стерильными и текучими до величины, которая без труда вводится в виде инъекции. Препараты должны быть стабильными при условиях производства и хранения и должны быть защищены от контаминирующего действия микроорганизмов, таких как бактерии и грибы. Подходящие растворители или дисперсионные среды могут содержать, например, воду, этанол, полиол (например, глицерин, пропиленгликоль и жидкий полиэтиленгликоль и подобное), их подходящие смеси и растительные масла. Должная текучесть может поддерживаться, например, используя покрытие, такое как лецитин, в случае дисперсии сохраняя требуемый размер частиц и используя сурфактанты. Предотвращение действия микроорганизмов может быть обусловлено большим числом антибактериальных и противогрибковых агентов, например парабенов, хлорбутанола, фенола, сорбиновой кислоты, тимерозала и подобное. Во многих случаях будет предпочтительно включать изотонические агенты, например сахара или хлорид натрия. Длительное всасывание композиций для инъекций может быть обусловлено применением в композициях агентов, замедляющих всасывание, например моностеарата алюминия и желатина.

Стерильные растворы для инъекций могут быть получены путем введения активных соединений в подходящем количестве в растворитель при желании наряду с другими ингредиентами (например, перечисленными выше) с последующей стерилизацией. Как правило, дисперсии получают путем введения большого числа стерилизованных активных ингредиентов в стерильный носитель, который содержит основную дисперсионную среду и желательные другие ингредиенты, например перечисленные выше. В случае стерильных порошков для получения стерильных растворов для инъекций к предпочтительным способам получения относятся техники высушивания вакуумом и высушивания замораживанием, с помощью которых получают порошок активного(ых) ингредиента(ов) плюс любой дополнительный желательный ингредиент из его ранее стерилизованного-отфильтрованного раствора.

Композиции по настоящему изобретению, как правило, могут быть смешаны в нейтральной или солевой форме. К фармацевтически приемлемым солям относятся, например, кислотно-аддитивные соли (образованные свободными аминогруппами белка), полученные из неорганических кислот (например, соляной или фосфорной кислот) или из органических кислот (например, уксусной, щавелевой, винной, миндальной и подобное). Соли, образованные свободными карбоксильными группами белка также могут быть получены из неорганических оснований (например, гидроксидов натрия, калия, аммония, кальция и железа) или из органических оснований (например, изопропиламина, триметиламина, гистидина, прокаина и подобное).

После смешивания растворы предпочтительно вводят способом, совместимым с дозированной препаративной формой, и в таком количестве, которое является терапевтически эффективным. Препаративные формы могут быть без труда введены в большом числе лекарственных форм, таких как растворы для инъекций, капсулы, высвобождающие лекарственное средство, и подобных. Для парентерального введения в водном растворе, например, раствор, как правило, подходящим образом забуферивают, и жидкий разбавитель сначала делают изотоничным, например, с помощью достаточного количества солевого раствора или глюкозы. Такие водные растворы могут быть использованы, например, для внутривенного, внутримышечного, подкожного и внутрибрюшинного введения. Предпочтительно, чтобы использовались стерильные водные среды, известные специалистам в данной области, в частности с учетом настоящего описания. В качестве иллюстрации, одна доза может быть растворена в 1 мл изотоничного раствора NaCl и либо добавлена к 1000 мл жидкости для подкожного вливания, либо введена в заданный участок инфузии (см., например, руководство «Remington's Pharmaceutical Sciences» 15-е издание, страницы 1035-1038 и 1570-1580). Дозировка обязательно должна несколько варьировать в зависимости от состояния индивидуума, получающего лечение. Специалист, отвечающий за введение, в любом случае должен определять подходящую дозу для конкретного индивидуума. Более того, для введения человеку препараты должны соответствовать стандартам стерильности, апирогенности, общей безопасности и чистоты, предъявляемым службой стандартов в биологии FDA.

Любая из композиций, описанных в настоящем документе, может содержаться в наборе. В одном из вариантов осуществления набор содержит первую фармацевтическую композицию, содержащую ингибитор miR-208a или miR-208b, и вторую фармацевтическую композицию, содержащую ингибитор miR-499. В другом варианте осуществления набор содержит единственную фармацевтическую композицию, содержащую ингибитор miR-208a или miR-208b и ингибитор miR-499. В другом варианте осуществления набор содержит первую фармацевтическую композицию, содержащую агонист miR-208a или miR-208b, и вторую фармацевтическую композицию, содержащую агонист miR-499. В еще одном варианте осуществления набор содержит единственную фармацевтическую композицию, содержащую агонист miR-208a или miR-208b и агонист miR-499. В некоторых вариантах осуществления набор также может включать один или несколько реагентов для трансфекции, содействующих доставке агонистов или ингибиторов miРНК в клетку.

Компоненты наборов могут быть упакованы либо в водных средах, либо в лиофилизированной форме. К устройствам для контейнеров наборов, как правило, будут относиться по меньшей мере один пузырек, тестовая пробирка, флакон, бутылка, шприц или другие устройства для контейнеров, в которые компонент может быть помещен и предпочтительно подходящим образом разделен на аликвоты. При наличии в наборе больше одного компонента набор также обычно будет содержать второй, третий или другой дополнительный контейнер, в который дополнительные компоненты могут быть помещены раздельно (например, стерильный фармацевтически приемлемый буфер и/или другие разбавители). Вместе с тем в одном пузырьке может содержаться большое число комбинаций компонентов. Наборы по настоящему изобретению также обычно будут включать устройство для содержания нуклеиновых кислот и контейнеры для любых других реагентов, плотно упакованные для продажи. К таким контейнерам могут относиться пластиковые контейнеры, изготовленные инъекционным или выдувным формованием, в которых содержаться желательные ампулы.

Если компоненты набора предлагаются в одном и/или нескольких жидких растворах, то жидкий раствор представляет собой водный раствор, причем особенно предпочтителен стерильный водный раствор.

Тем не менее, компоненты набора могут быть предложены в виде сухого(их) порошка(ов). Если реагенты и/или компоненты предлагаются в виде сухого порошка, порошок может быть восстановлен добавлением подходящего растворителя. Предполагается, что растворитель также может быть предложен в другом контейнере.

Такие наборы также могут включать компоненты, которые сохраняют или поддерживают агонист miRNA или ингибиторы miRNA или которые защищают их от деградации. Такие компоненты могут быть свободными от ДНКаз, свободными от РНКаз или защищать от нуклеаз (например, РНКаз и ДНКаз). Такие наборы, как правило, будут содержать в подходящем виде различные контейнеры для каждого отдельного реагента или раствора.

Набор также будет включать инструкции по использованию компонентов набора, а также применению любого другого реагента, не включенного в набор. Инструкции могут включать вариации, которые могут быть осуществлены. Набор также может включать принадлежности или устройства для введения агониста или ингибитора miRNA большим числом способов введения, таких как парентеральное или чрескатетерное введение.

Предполагается, что такие реагенты представляют собой варианты осуществления наборов по изобретению. Такие наборы, тем не менее, не ограничиваются конкретными позициями, указанными выше, и могут включать любой реагент, используемый для манипуляции или характеристики miRNA.

Последующие примеры включены исключительно для иллюстрации большого числа аспектов изобретения. Ссылка на miR208 в примерах и фигуре относится к miR208a у мышей. Тем не менее, специалист в данной области должен в свете настоящего описания понимать, что изобретение в равной степени применимо к любому человеку или другому животному и охватывает модулирование и miR208a и/или miR208b.

ПРИМЕРЫ

Пример 1. У мышей с нокаутом miR-208 в ответ на перегрузку давлением наблюдаются уменьшенные гипертрофия и фиброз сердца

MiR-208 кодируется в интроне гена α-МНС. Подобно α-МНС, miR-208 экспрессируется специфически в сердце со следовой экспрессией в легком. miR-208 процессируется вне pre-mRNA α-МНС, а не транскрибируется в виде отдельного транскрипта. Удивительно, тем не менее, что у miR-208 наблюдается необычайно длительный период полураспада - по меньшей мере 14 дней, и благодаря этому она может функционировать даже при подавлении экспрессии mRNA α-МНС.

Мышей с нокаутом miR-208 создавали путем получения вектора, нацеливающего miR-208, с помощью SacII и NotI отщепляя фрагмент 0,4 т.п.н. (5' плечо), продолжающийся выше региона, кодирующего miR-208, и лигируя фрагмент в нацеливающую плазмиду pGKneoF2L2dta выше сайтов loxP и Frt-фланкированной неомициновой кассеты. Фрагмент размером 3,3 т.п.н. (3' плечо) отщепляли с помощью SalI и HindIII и лигировали в вектор между кассетой резистентности к неомицину и кассетой отрицательной селекции Dta. Нацеленные ES-клетки, несущие разрушенный аллель, идентифицировали с помощью анализа Саузерн-блот посредством 5' и 3' зондов. Три нацеленных на miR-208 клона ES идентифицировали и использовали для введения в бластоцисту. Полученных химерных мышей скрещивали с мышами C57BL/6 для трансмиссии зародышевой линии мутантного аллеля.

Несмотря на то что генетической делеции miR-208 у мышей не хватило для индукции явного фенотипа, анализ на микрочипе сердец животных дикого типа и miR-208-/- в возрасте 2 месяцев выявил устранение miR-208, что привело к ярко выраженной экспрессии большого числа генов сократительных белков быстрых скелетных мышц, которые обычно не экспрессируются в сердце. Таким образом, эти результаты указывают на то, что при обычных условиях miR-208 экспрессируется совместно с единственным специфичным для сердца геном МНС для поддержания уникальности кардиомиоцитов за счет подавления в сердце экспрессии генов скелетных мышц.

Самую удивительную функцию miR-208 обнаружили с помощью ошибочного ответа мышей с молчащим miR-208 на нагрузку на сердце (van Rooij et al., (2007) Science, Vol. 316: 575-579). В ответ на перегрузку давлением за счет сужения грудной аорты (ТАВ), что запускает патологическое ремоделирование сердца, гистологические срезы сердца мышей с нокаутом miR-208 показали практически отсутствие гипертрофии кардиомиоцитов или фиброза по сравнению со срезами от мышей дикого типа (фигура 1А). Кроме того, животные с нокаутом miR-208 оказались неспособны активировать экспрессию β-МНС в ответ на перегрузку давлением (фигура 1В и С). Напротив, другие отвечающие на стресс гены, такие как гены, кодирующие ANF и BNP, у мутантных по miR-208 животных индуцировались значительно (фигура 1В), указывая на то, что miR-208 предназначен специально для контролирования экспрессии β-МНС, которая может быть отделена от других аспектов ответа на нагрузку на сердце.

Пример 2. Нокдаун miR-208 фенокопирует животных с нокаутом miR-208 при ответе на нагрузку

Для оценки специфичности влияния отсутствия miR-208 на ответ на нагрузку на сердце животным ежедневно внутривенно вводили либо антагомир, имеющий последовательность, комплементарную последовательности зрелой miR-208 (анти 208; SEQ ID NO:16), либо несовпадающую последовательность (mm; SEQ ID NO:17). Все нуклеозиды являлись 2'-ОМе модифицированными, и два 5' концевых и четыре 3' концевых основания содержали фосфоротиоатный интернуклеозид. Холестерин присоединяли к 3' концу сопровождающей цепи через линкер гидроксипролинол (фигура 2А). Анализ ПЦР в режиме реального времени сердец животных, которым вводили антагомир miR-208, через два месяца после лечения показал эффективный нокдаун miR-208 (фигура 2В).

Для тестирования влияния in vivo подавления miR-208 на ответ на нагрузку на сердце животных, получающих либо антагомир anti-miR-208, либо несовместимый контроль, подвергали процедуре имитации или процедуре сужения грудной аорты для индукции перегрузки давлением. У животных, которых обрабатывали несовместимым контролем, наблюдался характерный ответ на нагрузку с активацией β-МНС, а также других генов стресса (ANF и BNP). Напротив, у животных, которых обрабатывали антагомиром anti-miR-208, в ответ на стрессовый стимул активации β-МНС не наблюдалось. Тем не менее, наблюдалось повышение экспрессии других генов стресса (ANF и BNP) (фигура 2С). Ответ на нагрузку животных, обработанных антагомиром anti-miR-208, оказался заметно похожим на ответ животных с нокаутом miR-208, указывая, что miR-208 имеет решающее значение в регуляции экспрессии β-МНС при ответе на нагрузку.

Пример 3. MiR-208 необходима для экспрессии miR-499

Для дальнейшего понимания механизма действия miR-208 в сердце авторы изобретения определили паттерны экспрессии miRNA в сердце мышей дикого типа и с нокаутом miR-208 с помощью анализа на микрочипе. Среди нескольких miRNA, которые активировались и подавлялись в сердце с нокаутом miR-208, авторы изобретения обнаружили, что miR-499 очень часто встречался в нормальном сердце, но не экспрессировался выше фоновых уровней у животных с нокаутом miR-208. Эти находки подтверждали нозерн-блотом (фигура 3). Анализ геномной локализации гена miR-499 показал, что он должен содержаться в 20-м интроне гена Myh7b, гомолога гена α-МНС. Представляется, что miR-208 регулирует Myh7b и таким образом экспрессию miR-499 на уровне транскрипции, поскольку ОТ-ПЦР на Myh7b указывает, что мРНК гена-хозяина дозозависимым образом аннулируется в отсутствие miR-208 (фигура 3).

Ген Myh7b является консервативным у позвоночных и экспрессируется исключительно в сердце и медленных скелетных мышцах (например, камбаловидной мышце) (фигура 4А). Подобным образом, miR-499 имеет такой же паттерн экспрессии, как и его ген-хозяин, что подтвердилось анализом ПЦР в режиме реального времени (фигура 4А и В). Посредством гибридизации in situ, используя зонд, направленный против 3' конца гена Myh7b, было показано, что этот миозин (и miR-499) экспрессировался в сердце так же рано, как и Е10.5 (фигура 4С). Позднее в процессе эмбриогенеза Myh7b/miR-499 также экспрессируется в сомитах. Эти данные указывают на то, что miR-208 необходима для запуска дополнительного миозина, Myh7b, что приводит к появлению связанной с ним miR-499. Кроме того, miR-499 подавляется в условиях гипертрофии сердца.

Для дальнейшего понимания значения miR-499 в патологической гипертрофии сердца и регуляции сократимости мышц получали животных с нокаутом miR-499. Генетическая делеция miR-499 не влияла на экспрессию ее гена-хозяина Myh7b (фигура 5А). Анализ вестерн-блот сердца животных мутантных по miR-499 и дикого типа как на как α-, так и β-МНС показал, что делеция miR-499 не влияет на экспрессию и того и другого гена на белковом уровне (фигура 5В). Для оценки, влияла ли miR-499 на регуляцию β-МНС, животные дикого типа и с нокаутом miR-499 получили пропилтиоурацил (PTU), который индуцирует гипотиреоидизм и активирует β-МНС. В ответ на PTU как у животных дикого типа, так и у животных с нокаутом miR-499 наблюдалось снижение α-МНС и повышение β-МНС (фигура 5С). Удивительно, что в отличие от miR-208, miR-499 не требуется для регуляции экспрессии как α-, так и β-МНС.

Пример 4. Двойное нацеливание на miR-208 и miR-499

MiR-208 регулирует экспрессию miR-499, что показано дозозависимым снижением экспрессии miR-499 у животных гетерозиготных по miR-208 и с нокаутом miR-208 (фигура 3 и пример 3). Для дальнейшего понимания взаимодействия между miR-208 и miR-499 животным дикого типа внутривенно вводили физиологический раствор или одну из четырех доз (20 мг/кг, 40 мг/кг, 80 мг/кг и 160 мг/кг) синтетического олигонуклеотида (например, антагомира), имеющего последовательность, комплементарную последовательности зрелой miR-208 (anti-miR-208; SEQ ID NO:16). Нозерн-анализ ткани сердца через три дня после введения в хвостовую вену выявил дозозависимое снижение экспрессии зрелой miR-208, в то же время оставляя экспрессию pre-miR-208 интактной (фигура 6А). Тем не менее, в отличие от модели генетической делеции, экспрессия miR-499 осталась неизмененной. Кроме того, уровни экспрессии β-МНС также оказались неизмененными через три дня после введения антагомира anti-miR-208 (данные не представлены).

Во второй серии экспериментов животным дикого типа внутривенно вводили либо одну дозу anti-miR-208 (80 мг/кг), две последовательных дозы (80 мг/кг) anti-miR-208 за два последовательных дня, либо две последовательных дозы (80 мг/кг) олигонуклеотида несовместимого контроля (SEQ ID NO:17) за два последовательных дня. Посредством нозерн-анализа ткани сердца через два месяца после обработки было показано, что у животных, обработанных с помощью anti-miR-208, снижалась экспрессия как miR-208, так и miR-499 (фигура 6В). Анализ ПЦР в режиме реального времени подтвердил эти результаты (фигура 6С). Кроме того, также было показано снижение экспрессии miR-208b, которая кодируется в интроне β-МНС и экспрессируется совместно с β-МНС. Анализ ПЦР в режиме реального времени на соответствующие гены-хозяева миозина выявил, что нокдаун miR-208 не влияет на экспрессию α-МНС, но индуцирует снижение экспрессии β-МНС и Myh7b (фигура 6С). Снижение белка β-МНС также наблюдалось через два месяца после обработки с помощью anti-miR-208 (фигура 6D). Эти результаты указывают на то, что регуляция посредством miR-208 экспрессии miR-499 и β-МНС наблюдается после задержки, указывая, что miR-208 лежит выше miR-499, который в свою очередь лежит выше β-МНС. Таким образом, для ускоренного снижения экспрессии β-МНС необходимо, чтобы снижались как miR-208, так и miR-499. Снижение лишь miR-208 приводит к последующему снижению экспрессии miR-499, что в свою очередь индуцирует снижение экспрессии β-МНС. Для получения ранее возникающего эффекта на экспрессию β-МНС могут быть нацелены как miR-499, так и miR-208 для их подавления.

Для оценки сочетанного влияния подавления как miR-208, так и miR-499 животным с нокаутом miR-499 до получения пропилтиоурацила (PTU), индуктора экспрессии β-МНС, вводили олигонуклеотиды anti-miR-208. Аналогично полученным ранее результатам PTU индуцировал снижение экспрессии α-МНС и повышение экспрессии β-МНС/miR-208b (miR-208b экспрессируется совместно с β-МНС) как у животных дикого типа, так и с нокаутом miR-499 без обработки олигонуклеотидами anti-miR-208 (фигура 7А, В). Такие эффекты характерны для ответа на нагрузку на сердце. Напротив, нозерн-анализ и анализ ПЦР в режиме реального времени ткани сердца животных с нокаутом miR-499, обработанных олигонуклеотидами anti-miR-208, через две недели после обработки показали, что повышения экспрессии β-МНС/miR-208b в ответ на PTU не наблюдалось (фигура 7А, В). Ответ животных с нокаутом miR-499, обработанных с помощью anti-miR-208, напоминал ответ животных с нокаутом miR-208 (фигура 7В). Эти результаты указывают на то, что эффективное и быстрое снижение β-МНС может быть достигнуто путем нацеливания как miR-208, так и miR-499. Доза олигонуклеотидов anti-miR-208, которые вводили животным, привела к 60% снижению экспрессии miR-208. Этот процент снижения оказался достаточным для супрессии индукции β-МНС с помощью PTU в отсутствие miR-499 (фигура 7В). Эти находки указывают на то, что снижение как miR-499, так и miR-208 может представлять собой эффективную терапевтическую стратегию в лечении расстройств сердца, таких как патологическая гипертрофия сердца и сердечная недостаточность.

Пример 5. Нокдаун miR-208 и miR-499 ингибирует ответ на нагрузку на сердце

Для дальнейшей оценки терапевтического значения нацеливания miR-208 и miR-499 в лечении расстройств сердца мышам внутривенно вводили антисмысловой олигонуклеотид, имеющий последовательность, комплементарную последовательности зрелой miR-208а (анти-208), антисмысловой олигонуклеотид, имеющий последовательность, комплементарную последовательности зрелой miR-499 (анти-499), или олигонуклеотидные последовательности как анти-208, так и анти-499. И анти-208 и анти-499 содержат комбинацию замкнутых нуклеиновых кислот (LNA) и дезоксирибонуклеиновых кислот (ДНК), связанных фосфоротиоатными межнуклеозидными связями. Для оценки нокдауна miR-208 и miR-499 используют анализ ПЦР в режиме реального времени сердец животных, которым вводили антисмысловые олигонуклеотиды, через промежуток времени от трех недель до двух месяцев после обработки.

Для тестирования влияния in vivo подавления miR-208 и miR-499 на ответ на нагрузку на сердце животных, получающих анти-208, анти-499 или оба олигонуклеотида и анти-208 и анти-499, подвергают процедуре имитации или процедуре сужения грудной аорты для индукции перегрузки давлением. Предполагается, что у необработанных животных наблюдается типичный ответ на стресс с активацией β-МНС, а также других генов стресса (ANF и BNP). Напротив, предполагается, что у животных, которых обрабатывают и анти-208 и анти-499, наблюдается сниженная активация β-МНС в ответ на стрессовый стимул, которая выражена сильнее, чем у животных, получающих какой-нибудь один антисмысловой олигонуклеотид.

Все публикации, патенты и патентные заявки, описанные и процитированные в настоящем документе, приводятся в настоящем документе в качестве ссылки в полном объеме. Понятно, что описанное изобретение не ограничивается определенными методологией, протоколами и материалами, описанными в качестве их возможного варианта. Также понятно, что терминология, использованная в настоящем документе, предназначена лишь для целей описания определенных вариантов осуществления и не предназначена для ограничения объема настоящего изобретения, который должен быть ограничен лишь прилагаемой формулой изобретения.

Специалист в данной области поймет или способен убедиться, используя не более чем принятое экспериментирование, что в настоящем документе описано большое число эквивалентов конкретных вариантов осуществления изобретения. Предполагается, что такие эквиваленты должны охватываться последующей формулой изобретения.

1. Способ лечения патологической гипертрофии сердца, инфаркта миокарда или сердечной недостаточности у индивидуума, нуждающегося в этом, содержащий введение первого антисмыслового олигонуклеотида, содержащего последовательность, которая по меньшей мере частично комплементарна зрелой последовательности miR-208a или miR-208b, и второго антисмыслового олигонуклеотида, содержащего последовательность, которая по меньшей мере частично комплементарна зрелой последовательности miR-499, где первый и второй олигонуклеотиды имеют от около 8 до около 18 нуклеотидов в длину, и где экспрессия или активность miR-208a или miR-208b и miR-499 снижается в клетках сердца индивидуума после введения первого и второго антисмысловых олигонуклеотидов.

2. Способ по п.1, в котором зрелая последовательность miR-208a представляет собой SEQ ID NO:5.

3. Способ по п.1, в котором зрелая последовательность miR-208b представляет собой SEQ ID NO:19.

4. Способ по п.1, в котором зрелая последовательность miR-499 представляет собой SEQ ID NO:14.

5. Способ по п.1, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид вводятся совместно.

6. Способ по п.1, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид кодируются вектором экспрессии.

7. Способ по п.6, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид кодируются одним и тем же вектором экспрессии.

8. Способ по п.1, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид содержатся в одной молекуле нуклеиновой кислоты, и где первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид разделены одним или несколькими спейсерными нуклеотидами.

9. Способ по п.8, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид разделены от около 10 до около 50 спейсерными нуклеотидами, или около 5 спейсерными нуклеотидами.

10. Способ по п.1, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид вводятся последовательно.

11. Способ по п.10, в котором первый антисмысловой олигонуклеотид вводится перед вторым антисмысловым олигонуклеотидом.

12. Способ по п.10, в котором второй антисмысловой олигонуклеотид вводится перед первым антисмысловым олигонуклеотидом.

13. Способ по п.10, в котором первый и второй антисмысловые олигонуклеотиды вводятся с интервалом по меньшей мере 24 часа.

14. Способ по п.1, в котором первый антисмысловой олигонуклеотид и/или второй антисмысловой олигонуклеотид содержат по меньшей мере одну модификацию сахара и/или остова.

15. Способ по п.14, в котором модификация сахара представляет собой бициклическую модификацию сахара нуклеозида, модификацию 2'-O-алкила или 2'-фтор модификацию.

16. Способ по п.15, в котором бициклическая модификация сахара нуклеозида представляет собой замкнутую нуклеиновую кислоту.

17. Способ по п.14, в котором модификация остова представляет собой фосфоротиоатную связь.

18. Способ по п.1, в котором первый антисмысловой олигонуклеотид и/или второй антисмысловой олигонуклеотид составляют от около 12 до около 16 нуклеотидов в длину.

19. Способ по п.1, в котором первый антисмысловой олигонуклеотид и второй антисмысловой олигонуклеотид, каждый, вводятся в дозе от около 1 мг/кг до около 200 мг/кг.

20. Способ лечения патологической гипертрофии сердца, инфаркта миокарда или сердечной недостаточности у индивидуума, нуждающегося в этом, содержащий введение антисмыслового олигонуклеотида, содержащего последовательность, которая по меньшей мере частично комплементарна зрелой последовательности miR-208a или miR-208b, и зрелой последовательности miR-499, где экспрессия или активность miR-208a или miR-208b и miR-499 снижается в клетках сердца индивидуума после введения.

21. Способ по п.20, в котором антисмысловой олигонуклеотид составляет от около 8 до около 18 нуклеотидов в длину, и содержит последовательность, которая комплементарна непрерывной аминокислотной последовательности начиная с 5' конца SEQ ID NO:5.

22. Способ по п.20, в котором антисмысловой олигонуклеотид кодируется вектором экспрессии.

23. Способ по п.20, в котором антисмысловой олигонуклеотид содержит по меньшей мере одну модификацию сахара и/или остова.

24. Способ по п.23, в котором модификация сахара представляет собой бициклическую модификацию сахара нуклеозида, модификацию 2'-O-алкила или 2'-фтор модификацию.

25. Способ по п.24, в котором бициклическая модификация сахара нуклеозида представляет собой замкнутую нуклеиновую кислоту.

26. Способ по п.23, в котором модификация остова представляет собой фосфоротиоатную связь.

27. Способ по п.20, в котором антисмысловой олигонуклеотид составляют от около 8 до около 18 нуклеотидов в длину или от около 12 до около 16 нуклеотидов в длину.

28. Способ по п.1 или п.20, в котором экспрессия или активность miR-208a или miR-208b и miR-499 в клетках сердца индивидуума снижается более чем на 60 процентов после введения.

29. Способ по п.1 или п.20, в котором у индивидуума снижается ответ на нагрузку на сердце через две недели после введения.

30. Способ по п.29, в котором ответ на нагрузку на сердце включает гипертрофию кардиомиоцитов, фиброз сердца, пониженную экспрессию α-МНС в клетках сердца и/или повышенную экспрессию β-МНС в клетках сердца указанного индивидуума.



 

Похожие патенты:

Изобретение относится к области биотехнологии и представляет собой рекомбинантную плазмидную ДНК pHIG05, направляющую синтез гибридного белка человека с проинсулином Glargine человека, содержащую ДНК, кодирующую гибридный белок с проинсулином Glargine человека размером 134 а.о.

Изобретение относится к области биохимии, в частности к способам направленного изменения дуплексной акцепторной ДНК-последовательности и улучшения эффективности направленного мутагенеза в растительных протопластах.

Изобретение относится к области биотехнологии и представляет собой рекомбинантную плазмидную ДНК pHI03, направляющую синтез гибридного белка человека с проинсулином человека, содержащую ДНК, кодирующую гибридный белок с проинсулином человека размером 134 а.о.

Изобретение относится к биотехнологии. Способ получения глоботриозы заключается в ферментативном переносе галактозного мономера от донора галактозила на лактозу, выполняющую роль акцептора.

Изобретение относится к области биотехнологии и представляет собой рекомбинантную плазмидную ДНК pHIAsp03, направляющую синтез гибридного белка человека с проинсулином Aspart человека, содержащую ДНК, кодирующую гибридный белок с проинсулином Aspart человека размером 134 а.о.

Изобретение относится к области биотехнологии и представляет собой рекомбинантную плазмидную ДНК pHILP07, направляющую синтез гибридного белка человека с проинсулином Lispro человека, содержащую ДНК, кодирующую гибридный белок с проинсулином Lispro человека размером 134 а.о.
Изобретение относится к области биотехнологии. Штамм гриба Aspergillus oryzae Аmу Т-52-3-21 продуцирует мальтогенную α-амилазу и депонирован в ВКМ ИБФМ им.

Изобретение относится к области молекулярной биологии и биотехнологии. Предложен способ получения дрожжевой библиотеки, включающий инкубацию клеток дрожжей в растворе с 0,01-1 М ацетата лития и 1-100 мМ дитиотреитола, получение суспензии, содержащей линеаризованный ДНК вектор и ДНК вставку в соотношении 1:0,5-1:10, сорбит и CaCl2 или МgCl2 при соотношении 4 мкг ДНК вектора к 400 мкл 1,6×109 клеток дрожжей/мл, и электропорацию раствора дрожжевых клеток суспензией при напряжении 0,5-12,5 кВ/см с емкостью 10-50 мкФ.

Изобретение относится к области биотехнологии, конкретно к способу получения неприродных искусственных олигонуклеотидов, потенциально способных образовывать стабильные в физиологических и близких к физиологическим условиях неканонические структуры - несовершенные G-квадруплексы (ImGQ), включающие одну нуклеотидную замену в G4 плоскости в G-квадруплексах (GQ).

Изобретение относится к молекулярной генетике. Способ включает: получение кДНК EML4-ALK с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) на матрице РНК гена EML4-ALK с использованием специфичных праймеров; амплификацию фрагментов гена EML4-ALK методом мультиплексной ПЦР на матрице кДНК, полученной на первом этапе ОТ-ПЦР, с помощью набора высокоспецифичных праймеров; получение флуоресцентно-меченого ПЦР-продукта на втором этапе ОТ-ПЦР; создание биочипа для анализа транслокаций EML4-ALK, содержащего набор иммобилизованных зондов; гибридизацию флуоресцентно-меченого ПЦР-продукта с зондами в гелевых ячейках на пластиковой подложке биочипа; регистрацию и интерпретацию результатов гибридизации.

Настоящее изобретение относится к области органической химии, а именно к новому соединению формулы (I), где Y и Z, каждый независимо, выбраны из группы, состоящей из: a) фенила, в случае необходимости замещенного 1 или 2 R6; b) пиридина, имидазола, тиазола, фурана, триазола, хинолина или имидазопиридина, в случае необходимости замещенного 1 R6; и c) заместителя, независимо выбранного из группы, состоящей из водорода, C1-C6алкила или пиперидина; R1, R2 и R3, каждый независимо, выбраны из группы, состоящей из водорода и галогена; A и B, каждый независимо, выбраны из водорода, OH и C1-C6алкила; RA и RB независимо выбраны из группы, состоящей из водорода, C1-C6алкила и C3-C8циклоалкила; или RA и RB вместе с атомом, к которому они присоединены, образуют 4-6-членный гетероцикл, в случае необходимости имеющий дополнительно один гетероатом или функциональную гетерогруппу, выбранные из группы, состоящей из -O-, -NH, -N(C1-C6-алкила)- и -NCO(C1-C6-алкила)-, и 6-членный гетероцикл может быть дополнительно замещен одной или двумя C1-C6алкильными группами; R4 и R5, каждый, обозначают водород; и каждый R6 выбран из Br, Cl, F, I, C1-C6алкила, пирролидина, в случае необходимости замещенного одним C1-C6алкилом, C1-C6алкокси, галоген-C1-C6алкила, гидрокси-C1-C6алкилена, -(NRARB)C1-C6алкилена и (NRARB)карбонила; или к его индивидуальному изомеру, стереоизомеру или энантиомеру, или их смеси, в случае необходимости фармацевтически приемлемой соли.

Изобретение относится к новым соединениям формулы (1), которые обладают сродством к µ-опиоидному рецептору и к ORL1-рецептору, к лекарственному средству, содержащему эти соединения, и к их применению для получения лекарственного средства для лечения боли и других заболеваний.

Изобретение относится к медицинским устройствам, в частности к устройствам для доставки лекарства. Устройство включает расширяемый элемент, имеющий внешнюю поверхность и выполненный с возможностью контакта внешней поверхности с окружающей тканью.
Изобретение относится к медицине, в частности к экспериментальной фармакологии, и может быть использовано для изучения средств, предназначенных для коррекции ишемии.

Изобретение относится к медицинским устройствам, в частности к имплантируемым устройствам для лечения сосудистого заболевания у пациентов с диабетом типа 2. Устройство содержит внутрипросветную каркасную структуру и первый и второй агенты в сочетании, совместно связанные с внутрипросветной каркасной структурой.

Изобретение относится к производному селеназола или его фармацевтически приемлемой соли. Соединение представлено формулой I: где А представляет собой О, NR, S, S(=O), S(=O)2 или Se; В представляет собой водород или ; R1 представляет собой водород, С1-С8 алкил или галоген; R2 представляет собой водород, С1-С8 алкил, или ; Xa и Xb независимо представляют собой CR или N; R представляет собой водород или С1-С8 алкил; R3 представляет собой водород, С1-С8 алкил; R4 и R5 независимо представляют собой водород, галоген или С1-С8 алкил; R6 представляет собой водород, С1-С8 алкил, или фармацевтически приемлемую органическую соль; R21, R22 и R23 независимо представляют собой водород, галоген, NO2, С1-С7 алкил, замещенный или незамещенный галогеном, С3-С12 гетероарил, содержащий один или несколько гетероатом(ов), выбранных из N, О и S; m равно целому числу от 1 до 4; р равно целому числу от 1 до 5; s равно целому числу от 1 до 5; и равно целому числу от 1 до 3; w равно целому числу от 1 до 4; и алкил в R1, R3, R4, R5 и R6 могут быть дополнительно замещены одним или несколькими галогеном, С3-С7 циклоалкилом или С1-С5 алкиламином.

Способ относится к медицине, а именно к терапии, и касается коррекции избыточного накопления микроэлементов в сосудах при атеросклерозе. Для этого вводят эффективные количества бисфосфонатов - ксидифон, или медифон, или золедронат.

Изобретение относится к области медицины, конкретно - к средству, которое может быть использовано для лечения нарушений липидного обмена. Фармацевтическая композиция включает розувастатин кальция в терапевтически эффективном количестве, в качестве наполнителя - модифицированную лактозу, включающую 94,7-98,3 мас.% лактозы моногидрата и повидон, кроссповидон в качестве дезинтегранта, диоксид кремния коллоидный в качестве глиданта, соль стеариновой кислоты в качестве лубриканта, при этом композиция не содержит неорганическую соль с поливалентным катионом.

Изобретение относится к новому средству, обладающему ноотропной и антигипоксической активностью, представляющему собой ариламиды 2-[4-оксо-3(4H)хиназолинил]уксусной кислоты общей формулы где R=о-СН3, n-СН3 или 2,3-фенилен.

Изобретение относится к лекарственному средству для лечения заболевания периферических артерий или расстройства мозгового кровообращения. Заявленное лекарственное средство включает комбинацию 6-[4-(1-циклогексил-1H-тетразол-5-ил)бутокси]-3,4-дигидрокарбостирила или его соли и L-карнитина или его соли или левокарнитина хлорида.

Изобретение относится к области биотехнологии, вирусологии и медицины. Предложен поксвирус осповакцины, который содержит дефектный F2L ген и суицидальный ген.
Наверх