Композиции и способы для улучшенной иммуногенности соматостатина в лечении дефицита гормона роста и инсулиноподобного фактора роста

Группа изобретений относится к медицине и касается способов лечения дефицита гормона роста или инсулиноподобного фактора роста 1 у пациента, включающих введение иммуногенного количества вакцины, содержащей химерный полипептид соматостатина-14, связанный с инактивированной хлорамфениколацетилтрансферазой (САТ), и адъювант; вакцины для лечения пациента, имеющего дефицит гормона роста или инсулиноподобного фактора роста 1; способа лечения ожирения у пациента, включающего введение иммуногенного количества вакцины. Группа изобретений обеспечивает иммуногенность для соматостатина и повышенное высвобождение эндогенно продуцируемого гормона роста и/или инсулиноподобного фактора роста 1. 5 н. и 17 з.п. ф-лы, 8 пр., 6 ил., 2 табл.

 

РОДСТВЕННЫЕ ЗАЯВКИ

Эта заявка является связанной с заявкой РСТ с номером PCT/US08/68195 под названием "Слитый белок дефектная хлорамфеникол ацетилтрансфераза - соматостатин и его применение", которая подана 25 июня 2008 года и является введенной в данную заявку в качестве ссылки для всех целей.

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к способам лечения пациентов, имеющих дефицит гомона роста (GH) и/или инсулиноподобного фактора роста 1 (IGF-1). В частности, изобретение относится к лечению, а также композициям и способам, вовлеченным в указанное лечение пациентов, обладающих дефицитом GH и/или IGF-1, путем применения вакцин на основе антигена соматостатина/адъюванта.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

Предотвращение инфекционных заболеваний при использовании вакцин было введено в практику с поздних 1700-х (вакцина против оспы 1798 года), включая применение вакцин для предотвращения полиомиелита, гепатита В и гриппа. В последнее время вакцины также были идентифицированы для применения в лечении рака, где вакцины помогают добиться того, чтобы иммунная система пациента идентифицировала и разрушала целевые раковые клетки, то есть для лечения рака молочных желез, рака толстого кишечника, рака кожи и подобных им. Другие новые и полезные мишени для лечения с помощью вакцин развиваются благодаря преимуществу использования собственной иммунной системы пациента для подавления вторжения или канцерогенного агента. В большинстве случаев вакцины объединяют антиген, против которого направлен иммунитет, и адъювант для повышения ответа на этот антиген реципиентом вакцины.

Гормон роста представляет собой полипептидный гормон, содержащий 191 аминокислоту, который синтезируется и высвобождается из передней доли гипофиза. Гормон роста в общем случае считается анаболическим гормоном, который требуется для роста/высоты у детей, повышения удержания кальция (прочность костей), ускорения расщепления жира, повышения синтеза белков, ускорения глюконеогенеза в печени и для других подобных функций. Пациенты, страдающие от дефицита эндогенного гормона роста, часто имеют невысокую плотность костей, сниженный безжировой компонент массы, сниженную энергетику и другие подобные общие симптомы.

В настоящее время, пациентов, страдающих от дефицита гормона роста, подвергают лечению с помощью замещения гормона роста, типично, при использовании рекомбинантного гормона роста, который экспрессируется в генетически сконструированных бактериях. Такие прописи лечения типично являются очень дорогими (оцениваются в пределах от $10000 до $30000 в год) и основываются на экзогенном замещении гормона (типичными являются ежедневные инъекции, которые часто охватывают 18 месяцев жизни пациента). В результате этого являются необходимыми новые, не экзогенные, длительные и менее дорогие способы терапии для пациентов, страдающих от дефицита гормона роста.

Кроме того, способы терапии также требуются для лечения пациентов, которые нуждаются в дополнительных количествах, превышающих базовые уровни, гормона роста, например, такие пациенты часто нуждаются в дополнительном количестве гормона роста для лечения ожирения, лечения ран и лечения ожогов и т.д.

Настоящее изобретение является направленным на преодоление одной или более проблем, которые обсуждаются в данной заявке.

КРАТКОЕ ИЗЛОЖЕНИЕ ВОПЛОЩЕНИЙ

Воплощения в соответствии с настоящим изобретением обеспечивают композиции и способы для лечения дефицита гормона роста. Для целей настоящего изобретения дефицит гормона роста представляет собой любое снижение уровней гормона роста, ассоциированное с болезненным состоянием или недостаточным ростом по причине отсутствия адекватной секреции и/или уровней эндогенного гормона роста. Дефицит гормона роста часто включает ситуации, когда существует нормальный эндогенный уровень (для этого пациента) гормона роста, однако дополнительное количество гормона роста предполагается как благоприятное для лечения заболевания или состояния, например, для лечения ожирения, лечения ран и лечения ожогов.

Воплощения в соответствии с настоящим изобретением также обеспечивают композиции и способы для лечения дефицита инсулиноподобного фактора роста 1. Для целей настоящего изобретения, дефицит инсулиноподобного фактора роста 1 представляет собой любое снижение уровней инсулиноподобного фактора роста 1, ассоциированное с болезненным состоянием или симптомом, связанным с отсутствием адекватной секреции и/или уровней эндогенного инсулиноподобного фактора роста 1. Дефицит инсулиноподобного фактора роста 1 также включает ситуации, когда существует нормальный эндогенный уровень инсулиноподобного фактора роста 1, однако дополнительное количество инсулиноподобного фактора роста 1 предполагается как благоприятное для лечения заболевания или состояния, например, недостаточного роста, диабета типа 1 и восстановления хрящевой ткани и/или замещения.

В одном воплощении обеспечиваются способы для лечения дефицита гормона роста у пациента, который в этом нуждается. Способы включают введение иммуногенного количества вакцины на основе антигена соматостатина в соответствии с изобретением пациенту и наблюдение за состоянием пациента. Могут вводиться дополнительные вакцинации для того, чтобы способствовать лечению дефицита гормона роста у пациента. Пациенты, которые нуждаются в таком лечении, включают: взрослых и детей, которые имеют отсутствие эндогенного гормона роста, что приводит к недостаточному росту, врожденные болезни сердца или другие подобные заболевания сердца, ожирение, пациентов, которые нуждаются в усиленном лечении ожогов, и пациентов, которые нуждаются в усиленном лечении ран.

В другом воплощении способы обеспечиваются для лечения дефицита инсулиноподобного фактора роста 1 у пациента, который в этом нуждается. Способы включают введение иммуногенного количества вакцины на основе антигена соматостатина в соответствии с изобретением пациенту и наблюдение за состоянием пациента. Дополнительные вакцинации могут вводиться для того, чтобы способствовать лечению дефицита инсулиноподобного фактора роста 1 у пациента. Пациенты, которые нуждаются в таком лечении, включают: новорожденных, которые имеют ретролентальную фиброплазию (ROP), взрослых и/или детей, которые страдают ожирением, взрослых и/или детей, которые имеют диабет типа 1 или типа 2, взрослых и/или детей, которые имеют синдром Ретта, собак и/или котов, которые страдают ожирением, лошадей, которые нуждаются в замещении и/или восстановлении хряща, и другие подобные лечения.

Настоящее изобретение также обеспечивает новые полипептиды и полинуклеотиды, которые их кодируют, обладающие улучшенной иммуногенностью соматостатина для применения в лечении пациента, имеющего дефицит гормона роста или инсулиноподобного фактора роста 1. Полипептиды в соответствии с изобретением включают соматостатин-14, слитый с инактивированным белком хлорамфеникол ацтилтрансферазы с помощью функционально оптимизированного линкера. Полипептиды в соответствии с изобретением являются полезными у всех видов позвоночных животных благодаря высоко консервативной природе соматостатина-14, стабильного при долгосрочном хранении, высокоиммуногенного и устойчивого к разложению у пациента. Как таковые химерные полипептиды в соответствии с изобретением обеспечивают высокоэффективные и дешевые материалы для применения в лечении дефицита гормона роста и/или инсулиноподобного фактора роста 1 у всех позвоночных животных.

Настоящее изобретение также обеспечивает новые адъюванты для применения в лечении пациента, который нуждается в иммуногенном ответе, в частности в отношении пациента, который нуждается в лечении либо дефицита гормона роста, либо инсулиноподобного фактора роста. Новые адъюванты, описанные в данной заявке, являются высокоэффективными и безопасными для применения у позвоночных животных, включая людей, собак, коней, котов и других.

Настоящее изобретение также обеспечивает новые вакцины для применения в лечении пациента, который имеет либо дефицит гормона роста, либо инсулиноподобного фактора роста. Вакцины являются высокоэффективными и безопасными для применения у позвоночных животных, включая людей, собак, коней, котов и других животных.

Эти и другие признаки и преимущества в соответствии с изобретением будут понятными из чтения следующего подробного описания и обзора приложенных пунктов формулы изобретения.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фигура 1 представляет собой схематическую иллюстрацию рЕТ30b CatSom плазмиды в соответствии с воплощением настоящего изобретения. Плазмида включает маркер устойчивости к канамицину, Lac оператор, Т7 промотор, кодирующую последовательность CAT, все в соответствии с воплощениями изобретения, также являются включенными линкерный участок в соответствии с изобретением и кодирующий участок соматостатина в соответствии с изобретением,

Фигура 2 представляет собой иллюстрацию окрашенного SDS-ПАГЭ, демонстрирующего полоску 28 кДа, соответствующую спрогнозированному размеру оптимизированного по кодонам полипептида на основе дефектной CAT и соматостатина в соответствии с изобретением. Дорожка 1 представляет собой LB+IPTG, восстанавленный. Дорожка 2 представляет собой LB, восстанавленный. Дорожка 3 представляет собой LB+IPTG и Дорожка 4 представляет собой LB.

Фигура 3 представляет собой график дисперсии процента базовой линии веса тела против вакцинаций, содержащих соматостатин, на беспородных мышах.

Фигура 4 представляет собой график, демонстрирующий потребление пищи на группу мышей в течение периода времени 7 дней.

Фигура 5 представляет собой график, демонстрирующий среднее значение веса тела групп обработки мышей в течение периода 39 дней, каждая группа, которую подвергали анализу, представлена с величиной ошибки.

Фигура 6 представляет собой график, демонстрирующий процент базовой линии веса тела групп обработки мышей в течение периода 39 дней, каждая группа, которую подвергали анализу, представлена с величиной ошибки.

ПОДРОБНОЕ ОПИСАНИЕ

Настоящее изобретение обеспечивает композиции и способы для лечения дефицита гормона роста у пациентов, которые нуждаются в таком лечении. Для целей настоящего изобретения и так, как описано ранее, дефицит гормона роста представляет собой любое снижение уровней гормон роста, ассоциированное с болезненным состоянием или симптомом, вызванным отсутствием адекватной секреции и/или уровней эндогенного гормона роста у пациента. Дефицит гормона роста также включает ситуации, когда существует нормальный эндогенный уровень гормона роста, то есть, нормальный для этого пациента, однако дополнительное количество гормона роста предполагается как благоприятное для лечения целевого заболевания или состояния, например лечения ожирения, лечения ран и лечения ожогов и т.д.

Настоящее изобретение также обеспечивают композиции и способы для лечения дефицита инсулиноподобного фактора роста 1. Для целей настоящего изобретения дефицит инсулиноподобного фактора роста 1 представляет собой любое снижение уровней инсулиноподобного фактора роста 1, ассоциированное с болезненным состоянием, связанным с отсутствием адекватной секреции эндогенного инсулиноподобного фактора роста 1. Дефицит инсулиноподобного фактора роста 1 также включает ситуации, когда существует нормальный уровень эндогенного инсулиноподобного фактора роста 1, то есть, нормальный для этого пациента, однако дополнительный фактор 1 является благоприятным для пациента с целью лечения заболевания или состояния, например, ожирения, диабета типа 1 и 2 и синдрома Ретта.

В одном воплощении обеспечиваются новые полипептиды и полинуклеотиды, которые их кодируют, включая полипептиды соматостатина-14, слитые с инактивированным белком хлорамфеникол ацтилтрансферазы с помощью функционально оптимизированного линкера. Химерные полипептиды в соответствии с изобретением обеспечивают высокоэффективные и дешевые материалы для применения в лечении дефицита гормон роста и/или инсулиноподобного фактора роста 1.

В другом воплощении обеспечиваются новые адъювантные композиции для применения в лечении пациента, имеющего дефицит гормона роста и/или инсулиноподобного фактора роста. В одном частном воплощении антиген на основе соматостатина может соединяться с новыми адъювантами и использоваться в лечении болезненных состояний или симптомов, связанных с дефицитом гормона роста или инсулиноподобного фактора роста 1, например, недостаточного роста у детей, недостаточного роста у взрослых, отсутствия адекватной секреции эндогенного гормона роста, лечения ожогов, ожирения, заболеваний сердца и т.д. Адъюванты, описанные в данной заявке, являются созданными для оптимального применения у позвоночных животных и, в частности, у людей. Адъюванты, описанные в данной заявке, обеспечивают повышенную иммуногенность по сравнению с традиционными адъювантами, позволяя, таким образом, включать в вакцины меньшие количества антигена. Воплощения адъюванта, описанные в данной заявке, являются полезными при использовании с другими комбинациями антигенов, отличных от тех, которые являются полезными в лечении дефицитов гормона роста и/или инсулиноподобного фактора роста 1. Новые самостоятельные воплощения адъюванта, таким образом, входят в объем настоящего изобретения, но адъюванты, описанные в данной заявке, будут прежде всего описываться в соответствии с антигеном на основе соматостатина.

Еще в одном воплощении вакцины обеспечиваются таким образом, что приводят к иммуногенности против соматостатина, что приводит к снижению уровня соматостатина и, таким образом, к частичному удалению ингибирования, которое соматостатин оказывает на высвобождение гормона роста и высвобождение инсулиноподобного фактора роста 1. Воплощения вакцин, описанных в данной заявке, являются оптимизированными как для безопасности, так и функции, и имеют высокую иммуногенность конструкций соматостатина в безопасной и высокоэффективной адъювантной композиции. Вакцины в соответствии с настоящим изобретением требуют относительно более низких количеств антигена (по сравнению с традиционными вакцинами), имеют более длительный период хранения и являются более дешевыми.

Несмотря на то, что настоящее изобретение является нацеленным на лечение дефицита гормона роста и/или инсулиноподобного фактора роста 1 у людей, лечение таких дефицитов у других позвоночных животных предполагается как таковое, которое входит в объем настоящего изобретения. Например, собаки и коты, демонстрирующие симптомы ожирения, и лошади, нуждающиеся в восстановлении или замене хряща, могут подвергаться лечению при использовании композиций и способов, описанных в данной заявке.

Следующие определения обеспечиваются для улучшения понимания некоторых терминов, которые часто используются в данной заявке, и не подразумеваются для ограничения объема настоящего раскрытия.

Определения

Термин "аминокислота" относится к любой из двадцати существующих в природе аминокислот, а также к любой модифицированной аминокислотной последовательности. Модификации могут включать природные процессы, такие, как посттрансляционный процессинг, или могут включать, но без ограничения, фосфорилирование, убиквитинизацию, ацетилирование, гликозилирование, ковалентное присоединение флавина, АДФ-рибозилирование, перекрестное связывание, иодирование, метилирование и тому подобное.

"Антитело" относится к вилкообразной молекуле, содержащей пару сайтов связывания антигена, шарнирный участок и константный участок. Фрагменты антител, например, антигенсвязывающий фрагмент (Fab), химерные антитела, антитела, содержащие константный участок человека, слитый с мышиным участком, связывающим антиген, их фрагменты, а также другие хорошо известные рекомбинантные антитела являются включенными в определение антитела в соответствии с настоящим изобретением.

"Изоляция" относится к полинуклеотиду или полипептиду, который был отделен от или извлечен из, по крайней мере, одного загрязняющего вещества его природного окружения. В некоторых случаях полинуклеотиды или полипептиды являются отделенными от или извлеченными из 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% загрязняющих веществ их природного окружения. Как правило, изолированные полинуклеотиды или полипептиды получают при использовании, по крайней мере, одного этапа очистки. В этой связи чистота или очистка относится к целевому полипептиду, свободному от, по крайней мере, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, 96%, 97% 98% или 99% загрязняющих полипептидов. Очистка полипептида от загрязняющих полипептидов может осуществляться с помощью любого количества хорошо известных методик, включая осаждение с помощью сульфата аммония или этанола, анионо- или катионообменную хроматографию, хроматографию на основе фосфоцеллюлозы, хроматографию на основе гидрофобного взаимодействия, аффинную хроматографию, хроматографию на основе гидроксилапатита и хроматографию на основе лецитина.

"Ожирение" относится к субъекту, имеющему вес тела, превышающий, по крайней мере, на 20% идеальный вес. Для людей, например, идеальный вес тела определяется с учетом высоты, возраста, пола и конституции. Ожирение, как употребляется в данной заявке, включает термины: легкая степень ожирения (20-40% превышение идеального веса), средняя степень ожирения (40-100% превышение идеального веса) и тяжелая степень ожирения (более 100% превышение идеального веса).

"Пациент" относится к позвоночному животному, типично млекопитающему, нуждающемуся в композиции и/или способах в соответствии с настоящим изобретением, например, к человеку, нуждающемуся в потере веса (например, страдающему ожирением), или лошади, нуждающейся в восстановлении хряща.

"Процент" идентичности последовательности нуклеиновой кислоты или аминокислотной последовательности описывает процентное значение остатков последовательности нуклеиновой кислоты или аминокислотной последовательности, идентичных с эталонным полинуклеотидом или полипептидом. В некоторых случаях последовательности подвергают выравниванию и вводят пробелы для достижения максимальной идентичности последовательности. В некоторых случаях используется компьютерная программа для подсчета процента идентичности, например, Gap программа (Wisconsin Sequence Analysis package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wisconsin), которая использует алгоритм Смита и Вотермана, 1981, Adv. Appl. Math., 2: 482-489 (каждая из которых введена в данную заявку в качестве ссылки в своей целостности) или компьютерная программа ALIGN-2 для сравнения последовательностей (смотри WO 00/15796).

"Полинуклеотид" относится к линейной последовательности нуклеотидов. Полинуклеотиды представляют собой либо линейные последовательности полирибонуклеотидов, либо полидезоксирибонуклеотидов, или смесь обоих. Примеры полинуклеотидов в контексте настоящего изобретения включают одно- и двуцепочечную ДНК, одно- и двуцепочечную РНК и гибридные молекулы, которые содержат смеси одно- и двухцепочечных ДНК и РНК. Полинуклеотиды также включают один или более модифицированных нуклеотидов и пептид-нуклеиновые кислоты (PNA).

Термины "белок", пептид" и "полипептид" используются попеременно для обозначения аминокислотного полимера или набора двух или более взаимодействующих или связанных аминокислотных полимеров.

Термин "лечение" или "подвергать лечению" относится к улучшению состояния субъекта по отношению к субъекту, которого не подвергают лечению в относительно идентичной ситуации. "Лечение" или "подвергать лечению" в общем случае означает, что желаемый фармакологический и/или физиологический эффект достигнут при использовании композиций и способов в соответствии с настоящим изобретением. "Лечение" или "подвергать лечению" включает также профилактическое лечение.

Термин "вакцина" относится к любой композиции, которая может стимулировать иммунную систему вакцинированного субъекта к выработке антител для целей, описанных в данной заявке.

Гормон роста

Гормон роста представляет собой состоящий из 191 аминокислоты пептид, который вырабатывается и высвобождается из соматотрофных клеток в передней доле гипофиза. Уровни гормона роста в организме подвергаются регуляции с помощью гормона, высвобождающего гормон роста (GHRH), и соматостатина. GHRH приводит к синтезу и высвобождению гормона роста (стресс, физические упражнения и т.п. также являются известными стимуляторами высвобождения гормона роста), в то время, как соматостатин ингибирует высвобождение гормона роста.

Гормон роста (GH) в общем случае является вовлеченным в разнообразные физиологические функции в организме, включая: увеличение роста на всем протяжении детства, увеличение мышечной массы посредством гиперплазии саркомера, стимуляцию липолиза, стимуляцию глюконеогенеза в печени и вовлеченность в энергетический гомеостаз. Дефицит гормона роста типично проявляется в ряде известных заболеваний или физиологических состояний, включая:

низкий рост/недостаточность роста, если дефицит появляется в детстве, дефицит силы, потеря костной массы, повышение риска сердечно-сосудистых заболеваний, например, хроническая сердечная недостаточность (Tien и др.. Growth Hormone: A Promising Treatment for the Failing Heart, 2000, Pharmacotherapy 20(9): 1096-1106, который является введенным в данную заявку в качестве ссылки во всей своей целостности) и другие подобные состояния. Кроме того, дополнительное введение гормона роста субъекту является потенциально полезным в лечении ран, ожогов, ожирения и тому подобного. Vickers и др., 2002, Adult growth hormone treatment reduces hypertension and obesity induced by an adverse prenatal environment, J. Endocrinol, 175(3): 615-623; Ramirez и др., 1998, Is there a role for growth hormone in the clinical management или burn injuries, Growth Hormone IGF Res. Suppl. B: 99-105; и Lal и др., 2000, Growth Hormone, burns and tissue healing, Growth Hormone IGF Res. 10 Suppl. B: 539-543, каждый из которых является введенным в данную заявку в качестве ссылки для всех целей.

Традиционные способы терапии для борьбы с дефицитом гормона роста включают дополнительное введение больному индивидууму рекомбинантного человеческого гормона роста (смотри, например, патенты США №№4446235 и 4601980). Терапии на основе дополнительного введения гормона роста типично требуют подкожной инъекции рекомбинантного гормона роста на постоянной основе, то есть, ежедневные инъекции на протяжении, по крайней мере, 18 месяцев являются типичными, несмотря на то, что значительное количество индивидуумов требуют лечения на протяжении жизни. Недавно способы терапии на основе дополнительного введения гормона роста были использованы в лечении рассеянного склероза (MS), лечении фибромиалгии, лечении болезни Крона и/или язвенного колита, лечении для обратного развития эффектов старения, лечении ожогов и лечении идиопатической низкорослости. Однако лечение с помощью терапии на основе рекомбинантного гормона роста было продемонстрировано как такое, которое потенциально повышает риск диабета, рака толстого кишечника и т.д. Кроме того, лечение пациента с помощью рекомбинантного белка типично является таким, в котором отсутствует внутреннее управление с обратной связью, обеспечивающее постоянный контроль окружающей среды и заботу о пациенте, с повышением ассоциированных рисков тогда, когда пациент имеет активное злокачественное образование. Кроме того, рекомбинантный гормон роста является весьма дорогим для поставки, и затраты на применение курса в течение одного или более лет могут быть чрезмерно высокими, поскольку существует строго регламентированный режим ежедневных введений посредством инъекции. Как таковые воплощения в соответствии с настоящим изобретением обеспечивают неожиданное и существенное преимущество в лечении этих заболеваний и состояний, связанных с дефицитом гормона роста.

Инсулиноподобный фактор роста 1 (IGF-1)

IGF-1 представляет собой полипептид белкового гормона, подобный по структуре инсулину. IGF-1 вырабатывается в печени и других целевых тканях в ответ на гормон роста и в общем случае оказывает анаболические эффекты при высвобождении. Типично, IGF-1 действует с помощью АКТ пути передачи сигнала (АКТ представляет собой семейство специфических для серина/треонина протеинкиназ). В общем случае, анаболические эффекты IGF-1 включают рост и размножение клеток, а также ингибирование апоптоза в целевых сайтах.

Ряд факторов является вовлеченным во влияние на уровни IGF-1 в системе кровообращения пациента, включая: уровень гормона роста, генетические особенности, время суток, возраст, пол, физическое состояние, стресс, индекс массы тела и болезненное состояние. Дефицит IGF-1 может характеризоваться замедлением роста или его недостаточностью и ассоциируется с некоторыми состояниями, включая ожирение, диабет типа 1 и 2, сердечно-сосудистое заболевание, различные стрессовые расстройства и тому подобное.

Рекомбинантный IGF-1 использовался в лечении некоторых из этих заболеваний со смешанными результатами. В настоящий момент, Increlex® (рекомбинантный IGF-1, который производится Tercica) является доступным в Соединенных Штатах для лечения целевых расстройств, несмотря на то, что клинические результаты варьируют.

Соматостатин

Соматостатин представляет собой пептидный гормон, который ингибирует, среди прочих, высвобождение гормона роста из передней доли гипофиза. Соматостатин регулирует различные эндокринные функции путем взаимодействия со слитыми с G-белком рецепторами соматостатина. Соматостатин секретируется из сайтов в гипоталамусе, желудке, кишечнике и поджелудочной железе. Контроль уровней соматостатина у целевого животного совсем недавно был идентифицирован в качестве точки интереса для повышения продуктивности сельскохозяйственных животных, то есть, контроль уровней соматостатина повышает продукцию молока коровами молочных пород или размер сельскохозяйственных животных и т.п. (смотри находящуюся на одновременном рассмотрении заявку S/N 12/198,579, под названием "Слитый белок дефектная хлорамфеникол ацетилтрансфераза - соматостатин и его применение", которая является введенной в данную заявку в качестве ссылки для всех целей).

В этих исследованиях продуктивность сельскохозяйственных животных была оптимизирована путем применения прописей вакцинации при использовании антигенов соматостатина. В общем случае сельскохозяйственные животные, иммунизированные с помощью соматостатина, имели среднюю прибавку веса тела 10-20%, аппетит, сниженный на 9%, и 11% повышение эффективности усвоения пищи. Животные, иммунизированные с помощью соматостатина, и также их приплод, имели правильные пропорции, а распределение веса животных между мышцами, костями и жиром является таким же, что и у контрольных животных (смотри Reichlin, 1987). Однако альтернативные способы лечения с помощью соматостатина, например, непосредственное лечение целевых животных с помощью антител к соматостатину, зарекомендовало себя как излишне дорогое и функционально не эффективное, что, таким образом, исключило непосредственную обработку животных с помощью антител как непрактичную. Muromtsev G.S., и др., 1990, Basics of agricultural biotechnology, Agropromizdat, Moscow, стр.102-106. Эти исследования, таким образом, свидетельствуют о том, что индукция соматостатина у целевого животного может обеспечить безопасные и эффективные результаты.

Изобретатели в соответствии с настоящей заявкой выявили удивительный и неожиданный результат, заключающийся в том, что модификация таких прописей вакцинации (включая способы и композиции, описанные в данной заявке) может использоваться в лечении заболеваний и физиологических состояний человека и, в частности, в лечении дефицита человеческого гормона роста и/или IGF-1.

Воплощения в соответствии с настоящим изобретением обеспечивают основанное на соматостатине лечение дефицита гормона роста у позвоночных животных и, в частности, у млекопитающих. Типичные воплощения являются направленными на лечение людей, собак, котов и лошадей. Люди и другие млекопитающие, иммунизированные с помощью соматостатина, подвергаются лечению при использовании вакцин в соответствии с изобретением (смотри ниже) для ограничения и ингибирования эффектов, которые нативный соматостатин оказывает на высвобождение гормона роста. Например, если рекомбинантный гормон роста будет вводиться пациенту с дефицитом гормона роста или нуждающемуся в избытке гормона роста, для лечения ожогов, терапии сердечных заболеваний, диабета и т.д., то вакцины в соответствии с изобретением будут обеспечиваться для того, чтобы приводить к дополнительному высвобождению эндогенного гормона роста. Вакцинные антигены и адъюванты являются оптимизированными для применения у позвоночных животных и, в частности, для применения у человека при лечении заболеваний. Поскольку соматостатин является высоко консервативным у позвоночных животных, воплощения в соответствии с настоящим изобретением являются полезными для того, чтобы вызвать иммунный ответ у всех целевых позвоночных, вакцинированных при использовании способов и композиций, описанных в данной заявке. Значительная выгода в соответствии с настоящим изобретением заключается в том, что вакцинированные пациенты могут вести активный образ жизни в течение недель - месяцев между бустер-инъекциями, что позволяет иммунной системе пациента ограничить или устранить соматостатин из системы.

Воплощения в соответствии с настоящим изобретением также обеспечивают способы лечения на основе соматостатина для дефицита IGF-1 у позвоночного животного, и, в частности, у млекопитающих, например, людей, собак, котов, лошадей и т.п. Позвоночные животные, вакцинированные с помощью вакцин в соответствии с изобретением, ограничивают или ингибируют влияние соматостатина на уровни IGF-1 у такого животного. Воплощения лечения могут использоваться для лечения любого количества заболеваний и/или состояний, ассоциированных с дефицитом IGF-1, или там, где являются необходимыми дополнительные количества IGF-1 для улучшения здоровья или состояния животного, подвергнутого лечению.

Как таковые аспекты в соответствии с настоящим изобретением способствуют вакцинации на основе иммунизации с помощью соматостатина путем обеспечения высокоиммуногенных материалов для применения в предотвращении и лечении заболевания и/или других состояний. Такие соединения для иммунизации на основе соматостатина были оптимизированы для экспрессии и антигенности.

В некоторых воплощениях соматостатин-14 подвергается экспрессии как оптимизированный по кодонам, химерный полипептид дефектной CAT и соматостатина. Эти материалы обеспечивают неожиданное терапевтическое средство для применения в лечении основанных на дефиците гормона роста и IGF-1 заболеваний, а также там, где дополнительные уровни либо гормона роста, либо IGF-1 будут полезными в режиме лечения. Как описывается более полно ниже, настоящее изобретение также обеспечивает оптимизированные адъюванты для максимизации эффектов, оптимизированных по кодонам, химерных полипептидов дефектной CAT и соматостатина. Антигены на основе соматостатина в соответствии с изобретением являются сконструированными для вакцинации и обеспечивают молекулы большого размера (27000 + Дальтон против 1600 для нативного соматостатина), иммуногенность и устойчивость к деградации. Таким образом, антиген на основе соматостатина в соответствии с изобретением является присутствующим дольше (дольше 1/2 жизни у пациента), с более высоким эффектом (большая иммуногенность) у подвергнутого лечению пациента. Такие новые антигены для применения у позвоночных животных обеспечивают оптимальное воздействие для ответа иммунной системы пациента.

Новые воплощения вакцины для применения в лечении дефицита гормона роста

Соматостатин имеет две активные формы, которые получают путем альтернативного расщепления полипептида. Costoff A. Раздел 5, Глава 4: Structure, Synthesis, and Secretion of Somatostatin. Endocrinology: The Endocrine Pancreas. Medical College of Georgia, стр.16, введено в данную заявку в своей целостности для всех целей. Несмотря на то, что предполагается, что любая форма соматостатина в данной заявке может использоваться как воплощение антигена на основе соматостатина, соматостатин-14 будет описан подробно. Соматостатин-14 представляет собой биологически активный тетрадекапептид, который вырабатывается гипоталамусом и желудочно-кишечным трактом. Аминокислотная последовательность тетрадекапептида является следующей: AGCKNFFWKTFTSC (SEQ ID NO: 1). Последовательность соматостатина-14 является высоко консервативной среди млекопитающих (Lin XW и др. Evolution of neuroendocrine peptide systems:

gonadotropin-releasing hormon and somatostatin. Comp Biochem Physiol С Pharmacol Toxicol Endocrinol. 1998 119(3): 375-88.) Тетрадекапептид кодируется последовательностью нуклеиновой кислоты GCTGGCTGCAAGAATTTCTTCTGGAAGACTTTCACATCCTGT (SEQ ID NO: 15) (следует отметить, что могут использоваться другие последовательности нуклеиновой кислоты для кодирования SEQ ID NO: 1, однако, SEQ ID NO: 15 обеспечивается с целью иллюстрации).

Соматостатин-14 является известным как такой, который обладает сильным ингибиторным эффектом на большое количество гормонов, вовлеченных в рост и усвоение пищи у животных. Как было описано ранее в патенте США №6316004 и патентной заявке США №12/198579 (каждый из них введен в данную заявку в качестве ссылки для всех целей), соматостатин и химерные варианты соматостатина могут использоваться в иммунизации животных для повышения суточной прибавки веса, а там, где это является применимым, продукции молока. Такие процедуры иммунизации осуществляют с традиционными адъювантами. Иммунизации с помощью соматостатина-14 не использовались в лечении любого специфического состояния дефицита гормона роста.

Один аспект в соответствии с изобретением обеспечивает изолированные молекулы нуклеиновой кислоты, которые кодируют химерные белки, обладающие оптимизированной иммуногенной активностью для соматостатина. В частности, воплощения в соответствии с изобретением включают новые конструкции нуклеиновых кислот, которые кодируют CAT слитые белки, обладающие иммуногенной активностью по отношению к соматостатину. Такие полипептиды были идентифицированы для оптимальной функциональной активности в процедурах иммунизации и применяются в лечении дефицитов гормона роста и/или инсулиноподобного фактора роста 1 и, в частности, в лечении дефицитов гормона роста и/или инсулиноподобного фактора роста 1 у млекопитающих.

В одном воплощении конструкция, которая схематически представлена на Фигуре 1, обеспечивается для кодирования химерных полипептидов в соответствии с изобретением. Конструкции нуклеиновых кислот в соответствии с изобретением в общем случае кодируют неактивный CAT фермент без 10 С-терминальных аминокислот и включают одну или две аминокислоты, заменяющие гистидин. Фермент CAT подвергают инактивации путем удаления группы имидазола His 193 (His l95 в каноническом САТIII варианте, смотри Lewendon и др., ниже). В другом воплощении фермент CAT инактивируют путем удаления групп имидазола как His 193, так и соседнего His l92 (соответственно, His l95 и His l94 для САТIII). Удаление существенной для His 193 (His l95 в САТIII) группы имидазола из активного сайта CAT и замена его аланином, глицином или другими подобными аминокислотами приводит к существенной инактивации CAT фермента (смотри, например, Lewendon А и др. (1994) Replacement of catalytic histidine-195 of chloramphenicol acetyl transferase: evidence for a general base role for glutamate. Biochemistry. 33(7); 1944-50; White и др., (2000) Characterization of Chloramphenicol and Florfenicol Resistance in Escherichia coli associated with Bovine Diarrhea. J. Clin. Micro 38(12), стр.4593-4598, каждый из приведенных источников является введенным в данную заявку в качестве ссылки для всех целей). В заключение, воплощения данной заявки могут также включать инактивацию CAT фермента путем удаления только группы имидазола His l92 (His 194 для САТIII). Что касается His 193, то замена может осуществляться с помощью аланина, глицина и другой подобной аминокислоты.

В некоторых аспектах одна или более замененных аминокислот гистидина кодируются нуклеиновыми кислотами, которые размещаются в положениях 574-576 и 577-579 последовательности SEQ ID NO: 2 (соответствует номерам аминокислот 192 и 193 в последовательности SEQ ID NO: 3). В некоторых воплощениях последовательности нуклеиновой кислоты в соответствии с изобретением включают SEQ ID NO: 4, SEQ ID NO: 5 и SEQ ID NO: 6. Химерные белки в соответствии с изобретением, которые включают конструкции с замещенным гистидином, описанные в данной заявке, обеспечивают высокоиммуногенные белки с небольшой или с отсутствующей CAT активностью, значительное усовершенствование по сравнению с существующим уровнем техники. Существенно инактивированный CAT фермент воплощения присоединяют к полипептиду соматостатина в соответствии с изобретением. Такое присоединение может осуществляться непосредственно или с помощью линкера (как более полно описано ниже).

Инактивация CAT в сайтах his 192 и his 193 может быть выполнена при использовании любого количества известных квалифицированному специалисту в данной области техники процедур, включая сайт-направленный мутагенез и соединение синтетических генов. В одном воплощении последовательность нуклеиновой кислоты, которая кодирует гистидин в положении 193, модифицируют для кодирования аланина, глицина или других подобных аминокислот. В другом воплощении последовательности нуклеиновой кислоты, которая кодирует как гистидин в положении 192, так и положении 193 химерного полипептида, модифицируют для кодирования аланина, глицина или других подобных аминокислот. Типичные замены для положений 192 и 193 химерного полипептидна включает: аланин, аланин; аланин, глицин; глицин, аланин; и глицин, глицин.

Воплощения в соответствии с настоящим изобретением также включают аминокислотные последовательности для дефектных по CAT полипептидов в соответствии с изобретением, включая аминокислотную последовательность, содержащую SEQ ID NO: 7, 8 и 3 (соответствует his → gly в положении 193, his → ala в положении 193, и his → gly в положениях 192 и 193).

Реализация того, что фермент CAT может быть инактивирован и использован в качестве белка для презентации соматостатина-14 в лечении заболеваний и/или состояний, описанных в данной заявке, в частности, у млекопитающих, представляло собой неожиданное открытие авторов изобретения. Неактивированный CAT был описан как фермент, который является ответственным за опосредованную плазмидой резистентность бактерий как к хлорамфениколу, так и флорфениколу (фторированный аналог) у многочисленных известных грамнегативных изолятов бактерий. Применение неактивированного CAT, как описывается в US 6316004 В1, предшествует этим научным открытиям. В соответствии с современными представлениями и установленными стандартами применение инактивированного CAT как таковое может быть противопоказано по причинам безопасности (то есть, образование более устойчивых к антибиотику хозяев). Хлорамфеникол был открыт более 60 лет назад и первоначально использовался в качестве антибиотика. Некоторые проблемы, связанные со здоровьем, возникли при таком его применение, включая реципиентов с развившейся вследствие приема лекарственного средства апластической анемией. Кроме того, там, где продолжали использовать фторированный аналог, например, в животноводстве, нескоторым образом повышалось количество бактерий, которые становились устойчивыми к антибиотику благодаря кодируемым плазмидой генам. Несмотря на то, что хлорамфеникол продолжает использоваться в глазных каплях для лечения бактериальных конъюнктивитов, он не используется в Соединенных Штатах для лечения других заболеваний, вызванных бактериями. Как таковые, реализация и развитие применения фермента CAT во многих случаях у млекопитающих и, в частности, у человека, являются удивительными, где применение белка-носителя, обеспечивающего преимущества, представленные в данном описании, при устранении значительных проблем, связанных со здоровьем, известных для активной CAT, обеспечивает значительное усовершенствование для вакцин, описанных в данной заявке.

Следует отметить, что эти связанные с "носителем" усовершенствования CAT для применения с малыми молекулами обсуждаются в одновременно поданной и связанной с данной заявке США S/N PCT/US08/68195, а также в патенте США №6316004, оба указанных источника введены в данную заявку в качестве ссылки для всех целей. В частности, изобретатели в соответствии с данной заявкой неожиданно обнаружили, что инактивированный фермент CAT в качестве белка носителя для соматостатина-14 может устранить значительные риски для здоровья, связанные с ферментом, в то время как применение химерных белков повышает иммуногенность, устойчивость к разложению фермента, увеличивает период полураспада и повышает поглощение макрофагами пациента.

Как показано на Фигуре 1, неактивный фермент CAT может связываться с соматостатином-14 с помощью спейсера или линкера вариабельной длины. Спейсер является необходимым для презентации кодируемого соматостатина на общей поверхности. Воплощения спейсера, описанные в данной заявке, обеспечиваются для оптимальной резистентности к протеазам и для оптимального воздействия эпитопов и демонстрируют неожиданное усовершенствование по сравнению с конструкциями, которые не содержат линкерной(ых) последовательности(ей) в соответствии с настоящим изобретением.

Воплощения спейсера, таким образом, были оптимизированы по длине и составу для обеспечения экспрессии химерного белка на сонове дефектной CAT и соматостатина в различных микроорганизмах, и, в частности, в Е. coli. Оригинальные конструкции, как описывается в патенте США №6316004, включают спейсер, содержащий редкие кодоны Е. coli, и требуют для коэкспрессии редких тРНК из второй или хелперной плазмиды. Воплощения спейсера, описанные в данной заявке, удаляют эти редкие кодоны Е. coli и, таким образом, удаляют необходимость во второй хелперной плазмиде, что представляет собой усовершенствование по сравнению с предыдущей технологией.

В типичном воплощении спейсер имеет последовательность нуклеиновой кислоты tgggaactgcaccgttctggtccacgcccgcgccctcgcccacgtccggaattcatg (SEQ ID NO:9). Один пример спейсера в соответствии с изобретением имеет аминокислотную последовательность welhrsgprprprprpefm (SEQ ID: NO: 10). Типичная аминокислотая последовательность для спейсера в соответствии с изобретением представляет собой welhrsgp(rp)nefm, где n>1 (SEQ ID NO: 11). Как отмечалось выше, такие новые спейсерные последовательности обеспечивают улучшенную резистентность к протеазам (тем самым позволяя повысить продукцию по сравнению с конструкциями, раскрытыми в патенте США №6316004), и обеспечивают оптимальное воздействие соматостатина-14. Комбинация соматостатина-14, присоединенного к существенно инактивированному ферменту CAT (конструкции, замещенные гистидином) с помощью линкеров с оптимальной конфигурацией, демонстрирует неожиданное усовершенствование при использовании для иммунизации пациентов при лечении заболеваний. Эти конструкции используются в лечении заболеваний, связанных с дефицитом гормона роста и инсулиноподобного фактора роста 1.

Кроме того, эти химерные конструкции демонстрируют улучшенную стабильность при хранении по сравнению с одним соматостатином-14. В дополнение к этому, антигены на основе соматостатина в соответствии с настоящим изобретением обеспечивают более длительный период распада у пациента, а также повышенную резистентность к разложению в этих материалах. Следует отметить, что другой полипептидный носитель может заменять CAT, присоединенный к соматостатину. Например, соматостатин-14 может сочетаться с KLH, столбнячными токсоидами или CRM вместо инактивированного фермента CAT.

Воплощения в соответствии с изобретением также обеспечивают новые адъювантные композиции для улучшенной индукции гуморального иммунитета у целевого пациента. Эти адъювантные композиции обеспечивают значительное усовершенствование по сравнению с традиционными материалами для индукции гуморального ответа и являются безопасными для применения у людей, на которых они направлены. Адъювантные композиции, описанные в данной заявке, используются с антигенами на основе соматостатина для получения вакцины в соответствии с изобретением. Вакцины в соответствии с изобретением являются полезными в лечении заболеваний или состояний, связанных с дефицитом GH и/или IGF-1.

В воплощениях, описанных в данной заявке, все компоненты адъювантной композиции имеют не животное происхождение, устраняя, таким образом, потенциальную перекрестную контаминацию вакцинированных людей с потенциально загрязненными компонентами адъюванта. Например, воплощения, описанные в данной заявке, могут использовать Твин 80, не содержащий веществ животного происхождения. Неожиданно было показано, что Твин 80, свободный от веществ животного происхождения, продемонстрировал значительно улучшенный результат в применении вакцин, описанных в данной заявке, по сравнению с Твином, имеющим животное происхождение, и устраняет возможность контаминации вакцин веществами животного происхождения, например, губкообразной энцефалопатией крупного рогатого скота (BSE). Кроме того, Твин 80, свободный от веществ животного происхождения, демонстрирует лучшую способность к эмульгированию по сравнению с Твином животного происхождения, демонстрируя неожиданное преимущество для его применения в соответствии с воплощениями, описанными в данной заявке.

Кроме того, воплощения адъюванта, описанные в данной заявке, являются свободными от бензола и других подобных канцерогенных соединений. Эти воплощения обеспечивают преимущество безопасности, которое является недоступным для большинства традиционных адъювантных соединений. Например, воплощения, описанные в данной заявке, могут использовать Карбопол 974Р или полициклическую кислоту, свободную от бензола.

В одном воплощении иммунологический адъювант включает основу Карбопола, основу сквалена и раствор арабиногалактана. Более подробно, основу Карбопола получают при использовании Карбопола 974Р в воде или физиологическом растворе. Основу сквалена получают из комбинации сквалена, Твина 80 не животного происхождения и Span 85. В некоторых воплощениях основа сквалена представляет собой MF59 (Chiron Corp., Emeryville, CA). Арабиногалактан растворяют в PBS или физиологическом растворе. Адъювантную композицию соединяют с химерными полипептидами в соответствии с изобретением с получением вакцины настоящего изобретения.

Еще в одном воплощении иммунологический адъювант включает основу Карбопола, основу сквалена и раствор трагакантина Более подробно, основу Карбопола получают при использовании Карбопола 974Р в воде или физиологическом растворе. Основу сквалена получают из комбинации сквалена, Твина 80 не животного происхождения и Span 85. Очищенный трагакантин растворяют в PBS или физиологическом растворе. Адъювантную композицию соединяют с химерными полипептидами в соответствии с изобретением с получением вакцины настоящего изобретения.

Специфические комбинации и концентрации адъюванта приведены в Примере 3, Адъюванты в соответствии с настоящим изобретением являются безопасными и эффективными для применения у человека, не содержат продуктов животного происхождения, углеводородов на основе нефти и не содержат канцерогенных соединений.

Векторы и хозяйские клетки

Настоящее изобретение также относится к векторам, включающим полинуклеотидные молекулы в соответствии с изобретением, а также к хозяйским клеткам, трансформированным с помощью таких векторов. Любая из полинуклеотидных молекул в соответствии с изобретением может присоединяться к вектору, который обычно включает селективный маркер и источник репликации, для размножения хозяина, который представляет интерес. Хозяйские клетки являются генетически сконструированными для включения этих векторов и, таким образом, экспрессируют полипептиды в соответствии с изобретением. В общем случае, векторы, описанные в данной заявке, включают полинуклеотидные молекулы в соответствии с изобретением, оперативно связанные с приемлемыми последовательностями для регуляции транскрипции или трансляции, такими, как те, что используются в микробных хозяйских клетках или вирусах. Примеры регуляторных последовательностей включают транскрипционные промоторы, операторы, или энхансеры, рибосомальные сайты связывания мРНК и приемлемые последовательности, которые контролируют транскрипцию и трансляцию. Нуклеотидные последовательности являются оперативно связанными, когда регуляторные последовательности, описанные в данной заявке, являются функционально связанными с полинуклеотидами, кодирующими химерный полипептид в соответствии с изобретением.

Типичные векторы включают плазмиды, дрожжевые челночные векторы, бакуловирус, инактивированный аденовирус и подобные им. В одном воплощении вектор представляет собой модифицированную рЕТ30b CatSom плазмиду (смотри Фигуру 1). Целевые хозяйские клетки для применения в данной заявке включают бактериального хозяина, например, Е. coli, дрожжи, SF-9 клетки насекомых, клетки млекопитающих, клетки растений и тому подобное.

В одном воплощении регуляторные последовательности включают Т7lас, CAT, Тrp или Т5 промотор для экспрессии химерных полипептидов в соответствии с изобретением в Е. coli или других подобных бактериях. Такие регуляторные последовательности являются известными в области техники и используются при приемлемых и известных условиях.

Были сконструированы различные плазмиды в соответствии с изобретением для экспрессии химерных полипептидов в соответствии с изобретением при использовании целевых регуляторных последовательностей. Иллюстративные плазмиды могут включать Т7lac промотор (смотри Фигуру 1).

Хозяйские клетки для экспрессии целевых химерных полипептидов включают прокариот, дрожжи и клетки высших эукариотических организмов. Иллюстративные прокариотические хозяева включают бактерии родов Escherichia, Bacillus и Salmonella, а также родов Pseudomonas и Streptomyces. В типичном воплощении хозяйская клетка является таковой рода Escherichia и может представлять собой Escherichia coli (Е. coli). Хозяйские клетки (дрожжевые или бактериальные) могут также использоваться для продукции полипептидов в соответствии с изобретением в виде вирусоподобных частиц (VLP).

Как показано в примерах, приведенных ниже, конструкции в соответствии с изобретением обеспечивают оптимальную экспрессию соматостатина при различных условиях. Такие конструкции являются особенно эффективными для экспрессии в прокариотических хозяевах и, в частности, в бактериях рода Escherichia.

Свободный от эндотоксина слитый белок для применения в вакцинах в соответствии с изобретением

Аспекты в соответствии с настоящим изобретением включают применение свободного от эндотоксина, оптимизированного по кодонам соматостатина, слитого с дефектной CAT. В одном воплощении химерные иммуногенные белки, включающие соматостатин в соответствии с изобретением, получают путем трансформации целевых клеток с помощью приемлемых содержащих соматостатин векторов. Как отмечалось выше, векторы для применения в данной заявке включают известные плазмидные и векторные системы, приемлемые для экспрессии в выбранных целевых клетках.

В одном аспекте в соответствии с изобретением химерные иммуногенные, содержащие соматостатин белки экспрессируются в целевых хозяйских клетках. Экспрессию химерного белка осуществляют при использовании целевой регуляторной последовательности. В некоторых аспектах химерные полипептиды были оптимизированы (в частности, в отношении спейсерной последовательности, раскрытой в данной заявке) для экспрессии в Е. coli.

Химерный белок может подвергаться очистке в соответствии с известными технологиями очистки белка, включая, например, лизис при использовании лизоцима, дифференциальное центрифугирование телец включения, хроматографию на молекулярных ситах и подобные им. Процедуры рефолдинга могут осуществляться в хлориде гуанидина и мочевине при щелочном значении рН, после чего осуществляют диализ и лиофилизацию.

В одном воплощении клетки Е. coli подвергают трансформации при использовании плазмиды, содержащей оптимизированный по кодонам САТ-дефектный соматостатин - рЕТ30b CatSom; при этом рЕТ30b CatSom содержит приемлемые для Е. coli основные регуляторные последовательности для экспрессии. В некоторых случаях осуществление ферментации этих клеток в объеме приблизительно 10 литров обеспечивает получение, по крайней мере, 500 грамм и в некоторых случаях 600 грамм общей биомассы, что дает выход, составляющий 4-6 грамм общего белка. С помощью окрашивания серебром и Кумасси голубым было показано, что вплоть до половины белка может представлять собой химерный белок (смотри Пример 2 и Фигуру 2).

В некоторых воплощениях, описанных в данной заявке, химерный белок в соответствии с изобретением очищают из трансформированных хозяйских клеток в существенно свободном от эндотоксина состоянии. Дополнительная очистка будет удалять или снижать количество эндотоксина до приемлемых уровней для использования у людей в соответствии со стандартами Управления по контролю за продуктами и лекарствами.

Как таковые некоторые воплощения, описанные в данной заявке, являются направленными на получение существенно свободных от эндотоксина химерных белков для применения в вакцинах. В некоторых воплощениях уровни эндотоксина находятся на уровне 1 ед. эндотоксина/мл, а в других воплощениях уровни эндотоксина являются существенно устраненными, то есть, химерные полипептиды в соответствии с изобретением являются существенно свободными от эндотоксина.

В одном воплощении извлеченный из лизированных хозяйских клеток IB многократно промывают при использовании промывочного буфера, свободного от эндотоксина. Восстановленный IP осадок может подвергаться необязательному промыванию до тех пор, пока уровни эндотоксина не станут ниже значения приблизительно 1 ед. эндотоксина/мл (анализы эндотоксина можно осуществлять при использовании одного или более известных методов, включая коммерчески доступные аналитические наборы от МР Biochemicals, Charles River, и т.п.). В некоторых воплощениях промывочный буфер является свободным от эндотоксина и включает один или более ингибитор(ов) протеолиза белка, например, фенилметансульфонилфторид (PMSF). В некоторых воплощениях промывочный буфер представляет собой забуференный фосфатом физиологический раствор (PBS), содержащий ингибиторно эффективные количества PMSF или гидрохлорида аминоэтилбензолсульфонил фторида (AEBSF).

В некоторых аспектах существенно свободные от эндотоксина образцы могут подвергаться обработке с помощью раствора для разворачивания белка со значением рН 12,5, который содержит мочевину, и подвергаться повторной сборке в растворе для сборки белка, имеющем сниженную молярность мочевины, с аргинином, глицерином и/или сахарозой. Концентрацию очищенного химерного белка подвергают модификации в интервале от 1 до 3 мг/мл и типично приблизительно от 1,4 до 1,8 мг/мл. В некоторых случаях существенно свободный от эндотоксина химерный белок обеспечивают для вакцинных композиций при концентрации приблизительно от 1,5 до 5 мг/2 мл дозы и более типично, от 2,0 до 3,5 мг/2 мл дозы.

Вакцины

Вакцины в соответствии с изобретением представляют собой комбинацию иммунологических адъювантов, как описывается в данной заявке, и целевых антигенов, полезных в предотвращении или лечении болезненных состояний человека.

Фармацевтическая дозировка для воплощения вакцины, как описывается в данной заявке, включает 1-5 мг химерного полипептида. Во всех воплощениях, описанных в данной заявке, вакцина должна быть стерильной, жидкой и стабильной при условиях производства и хранения. Предотвращение действия микроорганизмов может быть достигнуто путем прибавления различных противобактериальных и противогрибковых агентов, например, парабенов, хлорбутанола, сорбиновой кислоты, тиомерсала и подобных им.

Вакцины, описанные в данной заявке, типично включают антиген в общем количестве белка от приблизительно 1 мг/2 мл до 3 мг/2 мл дозы, где приблизительно от 5% до 25% дозы составляет адъювант и более типично от приблизительно 10% до 20% дозы составляет адъювант. В некоторых воплощениях адъювант составляет приблизительно 18% дозы.

Для целей иллюстрации, адъюванты в соответствии с изобретением объединяют с полипептидом на основе соматостатина для того, чтобы обеспечить вакцину, полезную в лечении заболеваний и/или состояний человека, связанных с дефицитом гормона роста и/или инсулиноподобного фактора роста 1. Следует отметить, что адъюванты, описанные в данной заявке, могут быть соединены с другими антигенами с получением новых вакцин, полезных в лечении другого целевого заболевания человека.

Способ лечения заболевания человека

Изобретение обеспечивает фармацевтические вакцины, содержащие химерные полипептиды и адъюванты в соответствии с изобретением. Такие вакцины могут вводиться пациентам, которые имеют дефицит гормона роста и/или инсулиноподобного фактора роста 1, для того, чтобы способствовать высвобождению из эндогенных источников у пациента.

Вакцины в соответствии с изобретением обеспечиваются для пациентов, которые имеют дефицит гормона роста и/или инсулиноподобного фактора роста 1. В одном воплощении вакцины в соответствии с изобретением обеспечиваются от 1 до 2 раз, с 3 - 5 бустер-инъекциями в течение курса лечения. Типичное количество вакцинного антигена составляет от 1 до 5 мг/мл химерного полипептида. Вакцины могут вводиться с помощью известных способов. В одном воплощении вакцину вводят с помощью подкожной инъекции. В другом воплощении вакцину вводят путем интрадермальной инъекции, внутримышечной инъекции или инфузии.

Воплощения вакцины в соответствии с изобретением могут дополнительно включать диспергирующие и смачивающие агенты, суспензионные агенты или другие подобные материалы. Например, воплощения могут включать стерильные масла, синтетические моно- или диглицериды, жирные кислоты или масляные кислоты.

Вакцины типично получают в виде стерильных водных растворов. Эти растворы являются стабильными при условиях производства и хранения. В некоторых аспектах в вакцины могут включаться дополнительные агенты для предотвращения действия микроорганизмов, например, противобактериальные и противогрибковые агенты.

Растворы вакцин в соответствии с изобретением получают путем введения материалов в необходимых количествах (антигена, адъюванта, других ингредиентов), после чего может осуществляться заключительная стерилизация, например, с помощью УФ излучения или обработки озоном. Альтернативно, растворы вакцины в соответствии с изобретением могут быть получены при использовании индивидуально стерилизованных перед их заключительным соединением компонентов (в случае чего никакой заключительной стерилизации не требуется).

Процесс лечения для пациентов, которые получают воплощения вакцины в соответствии с изобретением, может подвергаться контролю и могут обеспечиваться дополнительные введения. Повышение уровней гормона роста, повышение уровней инсулиноподобного фактора роста 1 и функциональные преимущества (например, приемлемая потеря веса у пациентов, страдающих ожирением) представляют собой мишени для мониторинга эффективности лечения. Кроме того, там, где подвергают лечению диабет типа 1 или типа 2 или ожирение, могут подвергаться мониторингу для определения эффективности лечения у пациента уровни глюкозы в крови, уровни IGF-1, профили липидов, уровни инсулина и уровни связанного гемоглобина Alc (HbAlc). Основываясь на динамике процесса лечения индивидуального пациента, могут осуществляться дополнительные инъекции вакцины при использовании большего или меньшего количества антигена в соответствии с настоящим изобретением. Кроме того, могут использоваться альтернативные адъювантные комбинации для модификации индивидуального ответа пациента на вакцинацию, как определяется специалистами в области охраны здоровья.

Воплощения, описанные в данной заявке, могут сочетаться с другими традиционными способами терапии для целевого болезненного состояния или симптома, связанного с дефицитом гормона роста и/или инсулиноподобного фактора роста 1. Например, вакцинации в соответствии с изобретением могут сочетаться с замещением инсулина в лечении диабета типа 1 или вакцинации могут сочетаться с хирургической потерей веса или низкокалорийными диетами у пациента, который страдает тяжелой формой ожирения.

Описанное в общих чертах изобретение будет более понятным путем ссылки на следующие примеры, которые обеспечиваются как иллюстрация и не являются предназначенными для ограничения.

ПРИМЕРЫ

Приведенные ниже примеры обеспечиваются только для иллюстративных целей и не предназначены для ограничения объема в соответствии с изобретением.

Пример 1: Конструирование слитого белка дефектная CAT - соматостатин

Данный пример иллюстрирует продукцию слитого белка САТ-дефектного соматостатина в соответствии с воплощениями настоящего изобретения. Осуществляли сайт-направленный мутагенез на плазмиде рЕТ30b-Cat-Som для замены His l92 и His l93 остатками глицина (после модификации: Gly l92 и Gly l93).

Инактивация His l93 (и His l92) остатков устраняла способность фермента CAT принимать протоны, обеспечивая, таким образом, полную инактивацию CAT.

Спейсер в той же плазмиде рЕТ30b-Cat-Som (имеющей замену(ы) His) был оптимизирован по кодонам для экспрессии с помощью Е. coli при отсутствии совместно экспрессируемых молекул тРНК.

Модифицированная конструкция нуклеиновой кислоты САТ-дефектного соматостатина является представленной как SEQ ID NO: 12. Последовательность слитого белка дефектная CAT - соматостатин является раскрытой как SEQ ID NO: 13, по сравнению с немодифицированным слитым белком CAT - соматостатин (SEQ ID NO: 14).

Пример 2: Слитый белок САТ-дефектного соматостатина может экспрессироваться на высоком уровне

Оптимизированную по кодонам конструкцию САТ-дефектного соматостатина, как описано в Примере 1, использовали для экспрессии слитого белка в клетках BL21(DE3). Трансформированные клетки выращивали в среде LB и индуцировали с помощью 0,4 мМ IPTG в течение приблизительно трех часов. Один миллилитр клеток из культуры с оптической плотностью OD 0,7 осаждали и нагревали при 70°С в течение 10 минут в 100 мкл SDS буфера для образцов. Образец объемом 40 мкл клеточного экстракта загружали на каждую дорожку SDS ПАГЭ.

Как показано на Фигуре 2, полоса 28 кДа, соответствующая предсказанному размеру оптимизированного по кодонам слитого белка САТ-дефектного соматостатина, была видимой в дорожках 1 (LB + IPTG, восстанавленный) и 3 (LB+IPTG) после индукции с помощью IPTG. Никакой экспрессии не наблюдали в дорожках 2 (LB, восстанавленный) и 4 (LB). Как и ожидалось, не было различия в размерах белка при осуществлении разгонки при стандартных условиях и восстанавливающих условиях.

Пример 3: Свободная от эндотоксина, оптимизированная по кодонам вакцина. содержащая CAT-дефектный соматостатин

Иллюстративная вакцина в соответствии с настоящим изобретением:

Раствор реагента:

1. Основа Карбопола

а. Растворяли 0,5 грамма Карбопола 974Р в воде или физиологическом растворе;

b. Перемешивали и нагревали для растворения. После этого подвергали автоклавированию;

с. Хранили при 4°С.

2. Основа сквалена

а. Смешивали 58,1 мл сквалена, 4,6 мл Твина 80 не животного происхождения и 5,2 мл Span 85.

b. Смесь фильтровали через фильтр 0,2 мкм.

с. Хранили при 4°С.

3. Раствор трагакантина

а. Готовили экстракт трагакантовой камеди с метанолом.

b. Собирали нерастворимую фракцию метанола.

с. Высушивали при комнатной температуре.

d. Хранили при комнатной температуре в обезвоженном состоянии.

е. Прибавляли 1 грамм высушенного трагакантина к воде или физиологическому раствору.

f. Перемешивали и нагревали для растворения, после этого подвергали автоклавированию.

g. Хранили при 4°С.

Получение вакцины

1. Вакцинные антигены получали в физиологическом растворе или PBS при концентрации 5 мг/мл или ниже.

2. Прибавляли 6,79 мл основания сквалена к перемешанному содержимому флакона.

3. Прибавляли 10 мл основы Карбопола к основе сквалена. (CS)

4. Перемешивали флакон.

5. Прибавляли 10 мл раствора трагакантина к раствору CS.

6. Перемешивали содержимое флакона.

7. Вакцинные антигены, неразведенные или разведенные для применения в физиологическом растворе или PBS, прибавляли до получения заключительного объема 82 мл.

8. Прибавляли 1 мл 1% раствора тиомерсала и перемешивали содержимое флакона.

9. Хранили вакцину при 4°С до применения.

Альтернативная иллюстративная вакцина в соответствии с настоящим изобретением

Раствор реагентов:

1. Основа Карбопола:

а. Растворяли 0,5 грамма Карбопояа 974Р в воде или физиологическом растворе;

а. Перемешивали и нагревали для растворения, потом автоклавировали.

b. Хранили при 4°С.

2. Основа сквалена:

а. Смешивали 58,1 мл сквалена, 4,6 мл Твина 80 не животного происхождения и 5,2 мл Span 85 и фильтровали через фильтр 0,2 мкм;

b. Хранили при 4°С.

3. Раствор арабиногалактана:

а. Прибавляли 1-10 грамм арабиногалактана в PBS или физиологический раствор;

b. Перемешивали и нагревали для растворения; автоклавировали;

с. Хранили при 4°С.

Получение вакцины:

1. Вакцинные антигены получали в физиологическом растворе или PBS при концентрации 5 мг/мл или ниже.

2. Прибавляли 6,79 мл основы сквалена к перемешанному содержимому флакона.

3. Прибавляли 10 мл основы Карбопола к основе сквалена.

4. Тщательно перемешивали и прибавляли 10 мл раствора арабиногалактана.

5. Антигены в соответствии с изобретением, неразведенные или разведенные для применения в физиологическом растворе или PBS, прибавляли до получения заключительного объема 82 мл.

6. Прибавляли 1 мл 1% раствора тиомерсала и перемешивали вакцину; и

7. Хранили вакцину при 4°С до применения/

Пример 4: Лечение сердечносо-судистого заболевания при использовании вакцины в соответствии с Примером 3

В данном примере использовали крыс с дисфункцией левого желудочка, которых готовили в соответствии с прописью, опубликованной в Genentech, 1995. Крыс разделяли на две группы (каждый член каждой группы имел лигатуру, наложенную на левую коронарную артерию), первая группа лечения получала вакцины в соответствии с изобретением, вторая представляла собой контрольную группу (при отсутствии вакцинации, но обработанная таким же образом). Каждый член группы лечения получал первую вакцинацию, а потом через 21 день вторую вакцинацию, которые вводили внутримышечно (1 мл/доза). Сывороточные уровни IGF-1 и антитела к соматостатину подвергали измерению в день 0, день 21 и день 42. В день 42 также измеряли гемодинамические параметры в обоих группах, а также определяли размер инфаркта и индекс объемной скорости кровотока сердца.

Предполагалось, что группа крыс, которая получала две вакцинации, как описано в Примере 3, будет иметь существенно улучшенную функцию сердца (уменьшение размера инфаркта и индекса объемной скорости кровотока сердца) по сравнению с контрольной группой.

Пример 5: Лечение ожирения при использовании вакцины Примера 3

Модель ожирения крыс, как описывается у Vickers и др. (2001), использовали для определения эффекта, который вакцины в соответствии с изобретением оказывают на ожирение. Крыс выдерживали на гиперкалорийной диете от 30 до 60 дней. Гиперкалорийных крыс взвешивали и разделяли на три группы - контрольная группа физиологического раствора и вакцинная группа, которых продолжали содержать на гиперкалорийной диете, и группа нормальной по калорийности диеты. Крысы, которых подвергали вакцинации, получали 2 вакцинации в дозе 1 мл внутримышечно в день 0 и в день 21. Всех крыс взвешивали еженедельно в течение периода исследования. В день 42 всех крыс взвешивали и собирали сыворотку для анализа на IGF-1, анализа на мочевину и уровень антител к соматостатину.

Предполагалось, что крысы, получающие вакцинацию так, как описано в Примере 3, будут иметь существенно улучшенный контроль веса тела по сравнению с контрольными группами и будут демонстрировать соответствующие сывороточные результаты, которые коррелируют с контролем веса тела благодаря модификации гормона роста. Вакцинированная группа продемонстрировала существенно такой же контроль веса тела, что и группа, которая имела нормальное потребление калорий.

Пример 6: Лечение дефицита гормона роста при использовании вакцины Примера 3

Крыс Сох (CD) в возрасте трех недель подвергали вакцинации каждый месяц на протяжении 3 месяцев при использовании дозы 1 мл. Каждую вакцинацию осуществляли внутримышечно или подкожно. Контрольные крысы получали инъекции физиологического раствора при использовании того же способа введения и того же материала для введения. Всех крыс взвешивали для определения роста еженедельно и брали кровь через 0, 4, 8, 12 и 16 недель. Сыворотку отбирали в соответствии с таким же режимом и подвергали анализу на IGF-1, мочевину и уровень антител к соматостатину.

Предполагалось, что CD крысы, получающие вакцинации так, как описано в Примере 3, будут иметь существенно улучшенный рост по сравнению с CD крысами. Подвергнутые обработке крысы продемонстрировали сывороточные результаты, которые подтверждают эффект вакцинаций на крыс, подвергнутых обработке.

Пример 7: Повышенные уровни соматостатина приводят к прибавке веса у мышей

Изучение ожирения у мышей осуществляли для того, чтобы увидеть, будет ли вызывать экзогенно введенный соматостатин прибавку веса у мышей. Семидневное исследование осуществляли на аутбредных мышах, при этом три различных адъюванта соединяли с рекомбинантным соматостатином (адъюванты имели названия JH14, JH17 и JH18). Каждый адъювант соединяли с 1 мг/мл соматостатина, полученного рекомбинантным путем (полученный в 2009 году), и один адъювант (JH14) также соединяли с соматостатином, полученным в 2007, при концентрации 2,57 мг/мл. Контрольная группа мышей получала инъекцию стерильного физиологического раствора.

Каждую мышь взвешивали в начале исследования для определения базового веса. Вакцинации каждой мыши осуществляли в день 0 с помощью интраперитонеальной инъекции 0,5 мл вакцины. Соматостатин в JH17 и 18 адъювантах вводили самкам мышей, а JH14 - самцам мышей. Мышей выдерживали на нормальной диете в течение периода времени 7 дней, при этом каждую мышь взвешивали в день 7.

Как показано на Фигуре 3, аутбредные мыши, получающие соматостатин, оставались здоровыми и продемонстрировали незначительные побочные эффекты в течение недельного исследования. Самки мышей в группе JH17 увеличивали вес, в то время как самки в группе JH18 мышей были подобными по прибавке веса контрольным мышам. Самцы мышей в двух группах JH14 (2007 и 2009 года) продемонстрировали прибавку веса по сравнению с контрольной группой самцов мышей. Общие результаты, представленные на Фигуре 3, иллюстрируют, что JH14, JH17 и JH18 адъюванты являются безопасными для применения у мышей, в высокой степени однородными и способными к хранению, и что экзогенно вводимый соматостатин в общем случае приводит к увеличению веса у целевой мыши, обеспечивая подтверждение того, что соматостатин является вовлеченным в прибавление веса. Все эти эффекты наблюдались в течение нескольких дней после интраперитонеальной иммунизации. Это происходит благодаря непосредственному преобразованию в макрофагах антигена, а также презентации В лимфоцитов при ускоренных темпах, благодаря способу введения, природе химерных полипептидов и эффекту адъюванта.

JH14, 17 и 18 премиксы являются описанными в этой заявке и заявке США S/N PCT/US08/68195, под названием "Слитый белок дефектная хлорамфеникол ацетилтрансфераза - соматостатин и его применение". Заключительная рецептура содержала 1 мг белкового антигена на дозу 1 мл. С этой целью готовили следующие композиции:

JH17

Подвергнутый повторной сборке белок 12 мл (5,86 мг/мл)

Фосфатно-солевой буфер (PBS) Дюльбекко 24,5 мл

JH 17 Премикс 13,4 мл

1% Тиомерсал 0,5 мл

37% Формальдегид 0,1 мл

JH18

Подвергнутый повторной сборке белок 12 мл (5,86 мг/мл)

Фосфатно-солевой буфер (PBS) Дюльбекко 24,5 мл

JH 18 Премикс 13,4 мл

1% Тиомерсал 0,5 мл

37% Формальдегид 0,1 мл

JH14

Подвергнутый повторной сборке белок 12 мл (5,86 мг/мл)

Фосфатно-солевой буфер (PBS) Дюльбекко 27,8 мл

JH 14 Премикс 10 мл

1% Тиомерсал 0,5 мл

37% Формальдегид 0,1 мл

Следует отметить, что композиции, приведенные выше, включают тиомерсал и формальдегид для ограничения контаминации вакцин. Эти материалы используются только тогда, когда применяются мультидозовые флаконы для многократного использования для разлива используемой вакцины, типично, прописи для лечения человека и животных будут упаковываться вместе с флаконами однократного применения, устраняя, таким образом, необходимость в использовании консервантов. Также следует отметить, что более высокий уровень антигена использовали в партии 2007 JH14 для компенсации деградации белка.

Пример 8: Лечение ожирения у мышей

Исследование ожирения у мышей осуществляли при использовании мышей из Jackson Laboratories, Bar Harbor, Maine. Ряд инбредных мышей линии C57BL/6J получали из Jackson Laboratories, мыши представаляли собой: самцов, которые демонстрировали индуцированное тяжелое ожирение, имели полиэтиологичную генетику и демонстрировали развитое начало ожирения. В проведенных ранее исследования, Jackson Laboratories определили, что эта особая порода мышей при содержании на корме с высоким содержанием жира развивает фенотипы метаболического синдрома, очень подобные по своей природе тем, которые описываются для популяции людей. Например, C57BL/6J мыши, которых содержали на корме с высоким содержанием жира, будут демонстрировать висцеральное ожирение, устойчивость к инсулину, гиперинсулинемию, гиперлептинемию, устойчивость к лептину и гипертензию.

Исследования осуществляли для определения эффективности воплощений вакцин, описанных в данной заявке, для лечения ожирения, то есть, включая некоторое ограничение прибавки веса у мышей для того, чтобы вызвать потерю веса у C57BL/6J мышей. Мышей в возрасте 6 недель содержали на 60% ккал корма с высоким содержанием жира в течение 6 недель. Мышей в возрасте 12 недель потом распределяли в одну из четырех групп: группа 1 включала мышей, которых подвергали обработке с помощью вакцины, содержащей JH14; группа 2 включала мышей, которых подвергали обработке с помощью вакцины, содержащей JH17, группа 3 включала мышей, которых подвергали обработке с помощью вакцины, содержащей JH18, и группа 4 - контрольных мышей, которых подвергали обработке с помощью PBS вместо какого-либо антигена антисоматостатинового типа. Мышей в каждой группе вакцинировали при использовании 0,5 мл указанной вакцины или PBS путем интраперитонеального введения. Спустя двадцать два дня мышей вновь подвергали обработке при использовании второй интраперитонеальной дозы 0,1 мл вакцины.

На протяжении курса исследования (6 недель) каждую мышь взвешивали два раза в неделю и подвергали мониторингу потребление корма, то есть, убеждались в том, что изменение веса не возникало по причине снижения или повышения потребления корма (смотри Фигуру 4, которая показывает кумулятивное потребление корма в пределах каждой из 4 групп). Заключительное обескровливание осуществляли у каждой мыши в завершение исследования и определяли уровни IGF-1 (уровни IGF-1 в плазме крови определяли при использовании Active Mouse/Rat IGF-1 ELISA (DSL-10-29200) от Diagnostic Systems Laboratories Inc.

Как показано на Фигурах 5 и 6, а также в Таблице 1, мыши, которые подвергались обработке с помощью JH 14, 17 и 18, все продемонстрировали высоко

значимые различия (р<0,0001) при использовании параметрического и непараметрического статистического анализа в процентах заключительной массы тела против базового веса. Значительную потерю веса наблюдали в каждой из вакцинированных групп в первые 7 дней, в то время как контрольная группа продемонстрировала небольшую прибавку веса в течение того же периода времени. Небольшую потерю веса также наблюдали после введения второй дозы вакцины (1/5 дозы, которая обеспечивается в день 1) группам JH14, JH17 и JH18 в день 22,

Данные, полученные из изучения ожирения у мышей, обеспечивают следующие выводы: (1) несмотря на то, что не существует статистически значимого различия между группой JH18 и контролями в отношении IGF-1 нг/мл, существовало высоко значимое различие между этими группами (Р<0,0001) при использовании параметрического и непараметрического статистического анализа в процентах заключительной массы тела против базового веса; (2) в процентах заключительного веса тела против базового веса группа JH17 против контролей обеспечивала статистически значимое различие при использовании обоих статистических анализов;

(3) группа JH18 (которая имела среднее значение уровня IGF-1 135,8 нг/мл, большее, чем группа JH17) продемонстрировала статистически значимое различие против группы JH17 в процентах от базового веса (только для непараметрического анализа);

(4) антиген химерного соматостатина в соответствии с изобретением в группах JH17 и JH18 адъювантов индуцировал статистически значимое различие в процентах заключительного веса тела против базового веса тела; (5) группа JH18 была статистически значимой при сравнении с группой JH17 при использовании непараметрического анализа в отношении процента заключительного веса тела против базового веса тела; (6) уровни IGF-1 могут быть соотнесены с большей потерей веса в конце исследования против обоих контролей и вакцинированных JH17 животных (смотри Таблицу 2); (7) поскольку все вакцинированные животные имели одни и те же количества дозы антигена на основе химерного соматостатина в соответствии с изобретением, в исследовании наблюдали эффект адъюванта; (8) инбредные самцы C57BL/6J мышей, которые получали корм с 60% ккал жира, продемонстрировали значительную потерю веса в течение первой недели после интраперитонеальной вакцинации; и (9) потеря веса, продемонстрированная в данном опыте, сохранялась даже тогда, когда мыши получали корм с 60% ккал жира в течение всего периода исследования.

Таблица 1
Заключительный вес тела против базового веса
Группа # % от базовой линии Стандартное отклонение Критерий Манна-Уитни (двусторонний) Критерий Стьюдента для одной выборки (двусторонний)
Контроли 10 115,5 6,3 Не проводили Не проводили
JH17 10 107,1 4,7 Р=0,0021 Р=0033
JH18 10 104 3,0 Р<0,0001 Р<0,0001
JH17 против - - - Р=0,0355 Р=0,1016
JH18
Таблица 2
Статистический анализ IGF-1
Группа # Среднее значение IGF-1 (нг/мл) Стандартное отклонение Критерий Манна-Уитни (односторонний)
Контроли 10 365,6 88,7 Не проводили
JH17 10 304,2 99,2 Р=0,0827
JH18 10 440,4 103,7 Р=0,105

Является понятным, что для целей настоящего раскрытия могут быть внесены изменения в изобретение, которые будут находиться в рамках объема изобретения. Могут быть осуществлены многочисленные другие изменения, которые легко предполагаются сами по себе для специалиста в данной области техники и которые охватывают суть изобретения, как раскрывается в данной заявке, и так как определено в приложенных пунктах формулы изобретения. Описание содержит многочисленные ссылки на патенты и публикации. Каждая из них является введенной в качестве ссылки для всех целей.

1. Способ лечения дефицита гормона роста у пациента, при этом способ включает: введение иммуногенного количества вакцины пациенту, где вакцина включает (а) химерный полипептид соматостатина-14, связанный с инактивированной хлорамфениколацетилтрансферазой (CAT), и (б) адъювант.

2. Способ по п.1, где адъювант включает эффективное количество Карбопола 974P.

3. Способ по п.2, где адъювант дополнительно включает сквален и Твин 80 не животного происхождения.

4. Способ по п.1, где пациент представляет собой взрослого человека, имеющего недостаточный рост.

5. Способ по п.1, где пациент представляет собой ребенка, имеющего недостаточный рост.

6. Способ по п.1, где пациент, которого подвергают лечению по поводу дефицита гормона роста, имеет заболевание слизистой оболочки.

7. Способ по п.1, где пациент, которого подвергают лечению по поводу дефицита гормона роста, имеет заболевание сердца.

8. Способ по п.1, где пациент, которого подвергают лечению по поводу дефицита гормона роста, страдает ожирением.

9. Способ по п.1, где пациент представляет собой собаку, страдающую ожирением.

10. Способ по п.1, где пациент представляет собой кота, страдающего ожирением.

11. Способ по п.1, где пациент представляет собой лошадь, нуждающуюся в восстановлении хряща.

12. Способ лечения дефицита инсулиноподобного фактора роста 1 у пациента, при этом способ включает:
введение иммуногенного количества вакцины пациенту, где вакцина включает (а) химерный полипептид соматостатина-14, связанный с инактивированной хлорамфениколацетилтрансферазой (CAT), и (б) адъювант.

13. Способ по п.12, где пациент, которого подвергают лечению по поводу дефицита инсулиноподобного фактора роста 1, имеет диабет типа 1 или типа 2.

14. Способ по п.12, где пациент, которого подвергают лечению по поводу дефицита инсулиноподобного фактора роста 1, имеет стрессовое расстройство.

15. Способ по п.12, где пациент, которого подвергают лечению по поводу дефицита инсулиноподобного фактора роста 1, имеет заболевание сердца.

16. Адъювант для применения в вакцине для лечения позвоночных животных, где адъювант включает:
основу Карбопола 974P;
основу сквалена; и
раствор арабиногалактана;
где адъювант действует в качестве носителя для химерного полипептида
соматостатина-14, связанного с инактивированной
хлорамфениколацетилтрансферазой (CAT), для лечения дефицита человеческого гормона роста или инсулиноподобного фактор роста 1 у позвоночного животного.

17. Адъювант по п.16, где основа сквалена представляет собой комбинацию сквалена, Твина 80 не животного происхождения и Span 85.

18. Адъювант по п.16, где инактивированный фермент CAT имеет один или более остатков гистидина дикого типа, замененных аланином, глицином или другой подобной аминокислотой.

19. Вакцина для лечения пациента, имеющего дефицит гормона роста и/или инсулиноподобного фактора роста 1, где вакцина включает:
(а) иммуногенное количество химерного полипептида соматостатина-14, связанного с инактивированной хлорамфениколацетилтрансферазой; и (б) адъювант, включающий по крайней мере Карбопол 974P, сквален и арабиногалактан.

20. Вакцина по п.19, где инактивированный фермент CAT имеет один или более остатков гистидина дикого типа, замененных аланином, глицином или другой подобной аминокислотой.

21. Способ лечения ожирения у пациента, включающий:
введение иммуногенного количества вакцины пациенту, страдающему ожирением, где вакцина включает (а) химерный полипептид соматостатина-14, связанного с инактивированной хлорамфениколацетилтрансферазой, и (б) адъювант; и наблюдение за развитием процесса лечения у пациента.

22. Способ по п.21, где пациент представляет собой человека, собаку, кота или лошадь.



 

Похожие патенты:

Настоящее изобретение относится к кристаллической соли (1R*,2R*,4R*)-2-(2-{[3-(4,7-диметокси-1H-бензоимидазол-2-ил)пропил]метиламино}этил)-5-фенилбицикло[2.2.2]окт-5-ен-2-илового эфира изомасляной кислоты.

Настоящее изобретение относится к области органической химии, а именно к новому соединению формулы (I), где Y и Z, каждый независимо, выбраны из группы, состоящей из: a) фенила, в случае необходимости замещенного 1 или 2 R6; b) пиридина, имидазола, тиазола, фурана, триазола, хинолина или имидазопиридина, в случае необходимости замещенного 1 R6; и c) заместителя, независимо выбранного из группы, состоящей из водорода, C1-C6алкила или пиперидина; R1, R2 и R3, каждый независимо, выбраны из группы, состоящей из водорода и галогена; A и B, каждый независимо, выбраны из водорода, OH и C1-C6алкила; RA и RB независимо выбраны из группы, состоящей из водорода, C1-C6алкила и C3-C8циклоалкила; или RA и RB вместе с атомом, к которому они присоединены, образуют 4-6-членный гетероцикл, в случае необходимости имеющий дополнительно один гетероатом или функциональную гетерогруппу, выбранные из группы, состоящей из -O-, -NH, -N(C1-C6-алкила)- и -NCO(C1-C6-алкила)-, и 6-членный гетероцикл может быть дополнительно замещен одной или двумя C1-C6алкильными группами; R4 и R5, каждый, обозначают водород; и каждый R6 выбран из Br, Cl, F, I, C1-C6алкила, пирролидина, в случае необходимости замещенного одним C1-C6алкилом, C1-C6алкокси, галоген-C1-C6алкила, гидрокси-C1-C6алкилена, -(NRARB)C1-C6алкилена и (NRARB)карбонила; или к его индивидуальному изомеру, стереоизомеру или энантиомеру, или их смеси, в случае необходимости фармацевтически приемлемой соли.

Изобретение относится к спиро-5,6-дигидро-4H-2,3,5,10b-тетрааза-бензо[е]азуленовым производным Формулы I где X-Y представляет собой C(RaRb)-O, где каждый из Ra и Rb независимо представляет собой Н или C1-4-алкил, C(RcRd)-S(O)p, где каждый из Rc и Rd независимо представляет собой Н, С(O)O, СН2ОСН2, СН2СН2О, Z представляет собой CH или N; R1 представляет собой галогено, R2 представляет собой Н, C1-6-алкил, незамещенный или имеющий в качестве заместителей один ОН, -(CH2)q-Re, где Re представляет собой пиридил, -С(O)-С1-6-алкил, -C(O)(CH2)qNRiRii, -С(O)O-С1-6-алкил, -S(O)2NRiRii, каждый из Ri и Rii независимо представляет собой C1-6-алкил, R3 представляет собой Cl или F, n имеет значение 1 или 2, m имеет значение 0, 1, р имеет значение 0 или 2, q имеет значение 1, или к их фармацевтически приемлемым солям.

Изобретение относится к новым соединениям формулы (1), которые обладают сродством к µ-опиоидному рецептору и к ORL1-рецептору, к лекарственному средству, содержащему эти соединения, и к их применению для получения лекарственного средства для лечения боли и других заболеваний.

Изобретение относится к средству для лечения или предупреждения заболевания, возникшего на основе структурных и/или функциональных, и/или композиционных изменений липидов в клеточных мембранах, выбранного из рака, сосудистых заболеваний, воспалительных заболеваний, метаболических заболеваний, ожирения и избыточной массы тела, неврологических или нейродегенеративных расстройств, которое представляет собой соединение формулы (I) или его фармацевтически приемлемые соли и производные, выбранные из сложных эфиров, простых эфиров, алкила, ацила, фосфата, сульфата, этила, метила или пропила: в которой а и с могут иметь независимые значения от 0 до 7; b может иметь независимые значения от 2 до 7, где R1 выбран из следующих радикалов: Н, Na, К, СН3О, СН3-CH2O и ОРО(О-СН2-СН3)2, и R2 выбран из следующих радикалов: ОН, ОСН3, O-СН3СООН, СН3, Cl, СН2ОН, ОРО(O-СН2-СН3)2, NOH, F, НСОО и N(ОСН2СН3)2.

Изобретение относится к соединению, имеющему формулу I, или его фармацевтически приемлемой соли, где: X обозначает -O-; Z обозначает -C(=O)-; Y обозначает -(CRR1)-, где R1 выбран из -C1-C2алкила; R обозначает H или -C1-C5алкил; R5 обозначает H; R2 и B каждый выбран из A1 и A2, где один из R2 и B обозначают A1, а другой из R2 и B обозначают A2; где A1 имеет структуру (а); A2 выбран из группы, включающей фенил, пиридил, пиразолил, тиенил, 1,2,4-триазолил и имидазолил; A3 выбран из группы, включающей фенил, тиазолил и пиразолил; A4 выбран из группы, включающей фенил, пиридил, тиазолил, пиразолил, 1,2,4-триазолил, пиримидинил, пиперидинил, пирролидинил и азетидинил; A2 необязательно замещен 1-3 заместителями, независимо выбранными из атома галогена, -OCH3 и -OCF3 и -C1-C3алкила, необязательно замещенного 1-3 атомами галогена; A3 замещен одной группой A4 и необязательно замещен 1-2 заместителями, независимо выбранными из атома галогена, -OH, -OCH3, -OCF3 и -C1-C3алкила, необязательно замещенного 1-3 атомами галогена; A4 необязательно замещен 1-3 заместителями, независимо выбранными из группы, которая включает: (a) -C1-C5алкил, необязательно замещенный 1-3 атомами галогена и необязательно замещенный группой -OH, (b) -C2-C4алкенил, необязательно замещенный 1-3 атомами галогена, (c) -C(=O)C1-C2алкил, необязательно замещенный 1-3 атомами галогена и необязательно замещенный одной группой, выбранной из -OH, -CO2CH3, -C(=O)CH3, -NR3R4 и -OC1-C2алкиленOC1-C2алкила, (d) -C(=O)H, (e) -CO2H, (f) -CO2С1-С4алкил, необязательно замещенный одной группой, выбранной из -C(=O)C1-C2алкила, -OH, -CO2CH3, -CO2H, -NR3R4 и -OC1-C2алкиленOC1-C2алкила, (g) -OH, (h) -S(O)xC1-C2алкил, (i) атом галогена, (j) -CN, (k) -NO2, (l) -C(=O)NR3R4, (m) -OC1-C2алкиленOC1-C2алкил, (n) -OC1-C3алкил, необязательно замещенный 1-3 атомами галогена, (o) -C(=O)OC1-C2алкил, необязательно замещенный 1-3 атомами галогена и необязательно замещенный одной группой, выбранной из -OH, -CO2CH3, -NR3R4 и -OC1-C2алкиленOC1-C2алкила, (q) -NR3R4 и (r) -S(O)xNR3R4, при условии, что если А4 обозначает гетероциклическую группу, присоединенную к А3 посредством кольцевого атома углерода в А4, то, по крайней мере, один заместитель в А4 должен быть выбран из Re, где Re выбран из группы, которая включает: (a) -C1-C5алкил, замещенный группой -OH и необязательно замещенный 1-3 атомами галогена, (b) -C2-C4алкенил, необязательно замещенный 1-3 атомами галогена, (c) -C(=O)C1-C2алкил, необязательно замещенный 1-3 атомами галогена и необязательно замещенный одной группой, выбранной из -OH, -CO2CH3, -C(=O)CH3, -NR3R4 и -OC1-C2алкиленOC1-C2алкила, (d) -C(=O)H, (e) -CO2H, (f) -CO2C1-C4алкил, необязательно замещенный одной группой, выбранной из -C(=O)C1-C2алкила, -OH, -CO2CH3, -CO2H, -NR3R4 и -OC1-C2алкиленOC1-C2алкила, (g) -OH, (h) -S(O)xC1-C2алкил, (i) -CN, (j) -NO2, (k) -C(=O)NR3R4, (l) -OC1-C2алкиленOC1-C2алкил, (m) -C(=O)C1-C2алкил, необязательно замещенный 1-3 атомами галогена и необязательно замещенный одной группой, выбранной из -OH, -CO2CH3, -NR3R4 и -OC1-C2алкиленOC1-C2алкила, (n) -NR3R4(=O)OC1-С2алкил, (o) -NR3R4 и (p) -S(O)xNR3R4; p равно 0, 1 или 2; и Ra выбран из атома галогена, -CH3, -CF3, -OCH3 и -OCF3; R3 и R4 каждый независимо выбраны из H и CH3; и x равно 0, 1 или 2.

Изобретение относится к новому способу синтеза сложных соединений хелатор-нацеливающий лиганд, которые могут быть использованы для лечения и диагностирования заболеваний, например, путем получения изображений новообразования или мио-кардиальной ишемии.

Описываются новые алкилциклогексилэфиры 5,6-дигидро-4Н-2,3,5,10b-тетрааза-бензо[е]азуленовых производных формулы I R1 - C1-8-алкил, возможно замещенный галогено, гидрокси или С1-12-алкокси, CF3, С3-7-циклоалкил, 4-6-членный гетероциклоалкил, содержащий один O; R2 - Н, С1-8-алкил, возможно замещенный OH, -(CH2)q-Ra, где Ra - 6-членный гетероарил, содержащий один N, -С(O)-С1-8-алкил, где алкил возможно замещен OH, -С(O)(СН2)qOC(O)-С1-8-алкил, -C(O)O-С1-8-алкил, -S(O)2-С1-8-алкил или -S(O)2NRiRii, где Ri и Rii одинаковы и означают С1-8-алкил, q=1; R3 - Cl или F, и фармацевтическая композиция, их содержащая.

Изобретение относится к новому соединению- N-(2-(диметиламино)этил)-1-(3-((4-((2-метил-1Н-индол-5-ил)окси)пиримидин-2-ил)амино)фенил)метансульфонамиду формулы А и/или его фармацевтически приемлемой соли, которые обладают свойствами ингибитора KDR и/или FGFR1 киназы.

Изобретение относится к новым омега-3 липидным соединениям общей формулы (I) или к их любой фармацевтически приемлемой соли, где в формуле (I): R1 и R2 являются одинаковыми или разными и могут быть выбраны из группы заместителей, состоящей из атома водорода, гидроксигруппы, С1-С7алкильной группы, атома галогена, C1-С7алкоксигруппы, С1-С7алкилтиогруппы, С1-С7алкоксикарбонильной группы, карбоксигруппы, аминогруппы и С1-С7алкиламиногруппы; Х представляет собой карбоновую кислоту или ее карбоксилат, выбранный из этилкарбоксилата, метилкарбоксилата, н-пропилкарбоксилата, изопропилкарбоксилата, н-бутилкарбоксилата, втор-бутилкарбоксилата или н-гексилкарбоксилата, карбоновую кислоту в форме триглицерида, диглицерида, 1-моноглицерида или 2-моноглицерида, или карбоксамид, выбранный из первичного карбоксамида, N-метилкарбоксамида, N,N-диметилкарбоксамида, N-этилкарбоксамида или N,N-диэтилкарбоксамида; и Y является С16-С22 алкеном с двумя или более двойными связями, имеющими Е- и/или Z-конфигурацию.
Изобретение относится к экспериментальной медицине и касается разработки способов лечения невынашивания беременности и других заболеваний матки, связанных с несостоятельностью эндометрия.
Группа изобретений относится к медицине и касается фармацевтической композиции для лечения дефицита чГР в виде твердой оральной дозированной формы, которая включает гормон роста человека (чГР) и N(5-хлорсалицилоил)-8-аминокаприловую кислоту (5-CNAC); способа лечения дефицита чГР, который включает введение пациенту указанной фармацевтической композиции.

Изобретение относится к области биотехнологии, конкретно к получению модифицированного гормона роста, и может быть использовано в медицине. .

Изобретение относится к области генной инженерии, конкретно к получению вариантов сплайсинга грелина, и может быть использовано в медицине. .

Изобретение относится к области фармацевтической химии, а именно к химии пептидов и более конкретно к новому способу получения нонапептидэтиламида формулы и промежуточным соединениям для его получения.

Изобретение относится к области фармацевтической химии, конкретно к новому способу получения бусерелина формулы pGlu-His-Trp-Ser-Tyr-D-Ser(But)-Leu-Arg-Pro-NH-C 2H5·2AcOH (I), заключающемуся в том, что синтез осуществляют путем конденсации C-концевого защищенного дипептида формулы X-pGlu-His-OH (IIa), где X - защитная группа, с N-концевым защищенным гептапептидом формулы H-Trp-Ser-Tyr-D-Ser(Bu t)-Leu-Arg-Pro-NH-C2H5 (III) и полученный N-защищенный нонапептидэтиламид формулы X-pGlu-His-Trp-Ser-Tyr-D-Ser(Bu t)-Leu-Arg-Pro-NH-C2H5 (IV) обрабатывают деблокирующим агентом для удаления N-защитной группы и выделяют конечный продукт с помощью хроматографии.
Изобретение относится к области медицины, а именно к акушерству, и касается лечения плацентарной недостаточности во II-III триместре беременности. .

Изобретение относится к пептидным аналогам формул (I) и (II):(R2R3 )-A1-A2-A3-A4-A 5-A6-A7-A8-A9 -A10-A11-A12-A13-A 14-A15-A16-A17-A18 -A19-A20-A21-A22-A 23-A24-A25-A26-A27 -A28-R1, в которых определения А1 -А28 и R2-R3 приведены в описании для каждой из формул (I) и (II), их фармацевтически приемлемым солям и фармацевтическим композициям, содержащим эффективное количество соединения формулы (I), которые могут быть использованы в способе подавления секреции гормона роста и в способе скрининга соединения, способного связываться с рецептором GHS.

Изобретение относится к соединениям формулы (I) либо формулы (II) или к их фармацевтически приемлемым солям, в которых Х представляет собой или ; Y представляет собой Н; Z представляет собой -С(O)-; R1 и R3 каждый, независимо друг от друга, представляет собой Н или (C1-C 4) алкил; R2 и R4, каждый, независимо друг от друга, представляет собой , , или ; R5 представляет собой Н или (C1 -С6) алкил; R8 и R9 каждый, независимо друг от друга, представляет собой (С1-С 6) алкил и Q представляет собой Н.

Изобретение относится к производным 4-изопропилфенилглюцита, которые не склонны накапливаться в организме и которые ингибируют активность SGLT1, подавляя постпрандиальную гипергликемию (или ухудшенную переносимость глюкозы) за счет ингибирования абсорбции глюкозы в тонком кишечнике, вследствие чего соединения по настоящему изобретению могут, например, замедлять наступление диабета или метаболического синдрома или лечить эти заболевания.

Группа изобретений относится к медицине и касается способов лечения дефицита гормона роста или инсулиноподобного фактора роста 1 у пациента, включающих введение иммуногенного количества вакцины, содержащей химерный полипептид соматостатина-14, связанный с инактивированной хлорамфениколацетилтрансферазой, и адъювант; вакцины для лечения пациента, имеющего дефицит гормона роста или инсулиноподобного фактора роста 1; способа лечения ожирения у пациента, включающего введение иммуногенного количества вакцины. Группа изобретений обеспечивает иммуногенность для соматостатина и повышенное высвобождение эндогенно продуцируемого гормона роста иили инсулиноподобного фактора роста 1. 5 н. и 17 з.п. ф-лы, 8 пр., 6 ил., 2 табл.

Наверх