Штамм вируса иммунодефицита человека 1-го типа ив735 субтипа в для диагностических и вакцинных препаратов

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу B, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И. Ивановского Минздравсоцразвития России под номером №1189. Штамм обладает стабильной репродуктивной активностью. Инфекционный титр составляет 6 lg ТЦД 50. Штамм является удобной природной моделью для изучения антивирусной активности химиопрепаратов нового поколения, а также для создания вакцины. 1 ил., 3 табл., 3 пр.


Изобретение относится к области вирусологии и биотехнологии и может быть использовано для получения диагностических и экспериментальных вакцинных препаратов.

ВИЧ-1 отличается многообразием генетических вариантов. На сегодняшний день известно 9 субтипов ВИЧ-1 и 15 рекомбинантных форм [1]. На территории бывшего Советского Союза в середине 90-х циркулировали 7 подтипов ВИЧ-1 (от А до Н) [2, 3]. Наибольшее распространение в России на тот период получил субтип В, доминирующий среди мужчин-гомосексуалистов [4]. Ситуация резко изменилась в 1996 г., когда ВИЧ-1 проник в среду лиц, практикующих внутривенное введение психотропных препаратов (ПИН), где темпы передачи инфекции очень высоки. На данный момент на территории Российской Федерации одновременно циркулируют 3 генетических варианта ВИЧ-1: субтип А, субтип В и рекомбинант gagA/envB с преобладанием на большей части территории субтипа А [5, 6]. Надо отметить, что варианты ВИЧ-1 субтипа В, циркулирующие в настоящее время на территории РФ, среди ПИН (потребители инъекционных наркотиков) генетически отличаются от субтипа В, который распространен в Западной Европе и Америке и который характерен для мужчин, практикующих секс с мужчинами, а также от вариантов вируса данного субтипа, которые доминировали в начале развития эпидемии ВИЧ-инфекции [7, 8]. Поэтому для разработки диагностических и вакцинных препаратов представляется чрезвычайно важным использовать штамм субтипа В, циркулириующий на территории РФ.

Задача изобретения - получение штамма вируса иммунодефицита человека, принадлежащего к субтипу В, циркулирующему в настоящее время на территории РФ, среди ПИН (потребители инъекционных наркотиков).

Технический результат, который может быть получен при осуществлении изобретения, заключается в использовании его для изучения антивирусного действия химиопрепаратов нового поколения и для создания вакцины.

Штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В для диагностических и вакцинных препаратов хранится в коллекции вирусов НИИВС им. И.И.Мечникова РАМН и депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И.Ивановского Минздравсоцразвития России под номером 1189 от 16.01.12 и имеющий нуклеотидную последовательность, приведенную на фиг. 1.

Штамм вируса выделен из лимфоцитов периферической крови больного СПИД, не получавшего антиретровирусную терапию. При получения штамма использованы методы сокультивации лимфоцитов больного с лимфоцитами крови здорового донора, стимулированных митогеном, а также с человеческими перевиваемыеми клеточными линиями.


Штамм ВИЧ-1 ИВ710 обладает высокой репродуктивной активностью и реплицируется в лимфоцитах периферической крови, а также в лимфобластоидных клеточных культурах МТ-4 и Jurkat. Репродукция вируса сопровождается характерным цитопатическим действием и синицитиобразованием. Штамм может поддерживаться длительное время при пассировании на клеточных линиях. Через 5-6 дней после инфицирования клеток вируссодержащей культуральной жидкостью инфицированная клеточная взвесь замораживается и после размораживания и осветления при 1000 об/мин вносится к свежим неинфицированным клеткам, в соотношении 1:10.

Инфекционный титр вируса определяли по 50% тканевой цитопатической дозе вируса на модели вышеуказанных клеточных культур в сравнении со штаммом-аналогом ВИЧ-1 LAV, который является первым изолятом ВИЧ-1, выделенным от больного СПИД [9]. Продуктивная активность штамма составляет 6,0 lg ТЦД50 и сопоставима с инфекционным титром штамма-аналога (таблица 1).

Антигенные свойства.

ВИЧ-1 относится к семейству Retroviridae, род Lentivirus. Вирусы этой подгруппы являются оболочечными РНК-содержащими вирусами с размером частиц около 100-150 нм. В составе частиц обнаруживают не менее 6 основных структурных антигенов, обладающих иммуногенными свойствами, которые могут быть выявлены в инфицированных клетках с помощью различных иммунологических и вирусологических методов.


Исследование штамма ИВ735 методом непрямой иммунофлюоресценции с использованием сыворотки больного СПИД, содержащей антитела к ВИЧ-1, показало наличие антигенов ВИЧ-1 в 50-60% инфицированных клеток.


Исследование в иммуноблоте показало, что вирус обладает антигенными детерминантами, характерными для ВИЧ-1: 120/160, 65, 55, 41, 31, 24, 17 кД (таблица 2).


Генетический анализ области, кодируемой геном pol, проведенный с помощью субтипспецифических праймеров (CCAAAGGTTAAACAATGG, TTAGATTCTTAAATGGCTCC), подходящих для изучения вариантов ВИЧ-1, циркулирующих на территории России, показал, что данный штамм вируса относится к субтипу В.

Возможность использования изобретения иллюстрируется примерами, которые не ограничивают объем и сущность притязаний, связанных с ними.

Пример 1. Сравнительное исследование инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 по цитопатическому действию.

Исследование инфекционной активности штаммов ВИЧ проводили на модели лимфобластоидных клеток МТ-4 и Jurkat в пластиковой 24-луночной панели (Costar, США). Клетки инфицировали вирусом в дозе 0,01 инфекционных единиц на клетку. Далее инкубировали культуры клеток при 37С° в течение 1 часа и дважды отмывали. После этого к культуре клеток добавляли питательную среду RPMI-1640 с 10% сыворотки эмбрионов коров (производства Sigma) и 100 мкг/мл гентамицина (конечная концентрация клеток 400000 клеток/мл). Учет результатов противовирусной активности производили по жизнеспособности клеток путем окрашивания клеток красителем трипановым синим на 6-7 сутки. За титр вируса принимали величину обратную его максимальному разведению, вызывающему как минимум двухкратное превышение показателя гибели клеток по сравнению с контролем. Результаты исследования представлены в таблице 1.

Сравнительный анализ показал, что инфекционные титры штамма ИВ735 сопоставимы с инфекционным титром штамма-аналога LAV, что свидетельствует об их сходной активности. Данный инфекционный титр позволяет успешно инфицировать лимфобластоидные клеточные культуры с целью дальнейшей наработки инфекционного материала.

Пример 2. Диагностика антител к белкам ВИЧ-1 методом иммуноблота.

Материал для исследования антител к ВИЧ-1 представлен 10 сыворотками, полученными от ВИЧ-инфицированных лиц и содержащих анти-ВИЧ антитела. Сыворотки были предварительно охарактеризованны в коммерческой тест-системе фирмы «Биорад» (США). В качестве антигена использован штамм ИВ735 и штамм-аналог LAV. Выявление антител к ВИЧ-1 проводили с помощью нитроцеллюлозных стрипованных мембран (стрип) с нанесенными на них антигенами ВИЧ-1 фирмы «Биорад» (США). Готовую стрипованную мембрану предварительно замачивали на 5 мин в фосфатно-солевом буфере с твином (ФСБ-Т). Сыворотку крови в количестве 20 мкл разводили в 1 мл ФСБ-Т, содержащего 0,5% БСА (бычий сывороточный альбумин), и вносили в лунку со стрипом. После инкубации в течение 1 час при комнатной температуре и отмывки ФСБ-Т вносили конъюгат, разведенный в 1 мл ФСБ-Т. Далее снова проводили инкубацию в течение 1 час при комнатной температуре и после отмывки ФСБ-Т вносили 1 мл раствора тетраметилбензидина (ТМБ) в цитратно-фосфатном буфере (ЦФБ). Затем инкубировали в темноте до появления четких полос в контрольном стрипе. Реакцию останавливали 1 н. серной кислотой. После промывки стрипа дистиллированной водой его высушивали при комнатной температуре и визуально проводили учет результатов.

Результаты исследований представлены в таблице 2. В результате проведенных исследований установлено, что антиген штамма ИВ735 позволяет выявлять антитела ко всем основным структурным белкам ВИЧ-1 и, следовательно, может быть использован для изучения сероконверсии лиц, инфицированных ВИЧ-1, а также для изучения противовирусного действия химиопрепаратов и создания вакцины против ВИЧ.

Пример 3. Сравнительный анализ инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 по уровню антигена вируса (р24).

Определение уровня вирусного антигена в вируссодержащей жидкости проводили с помощью иммуноферментного анализа с использованием коммерческого иммуноферментного набора фирмы Биорад (США) на 96-луночных панелях. В лунки, в которые предварительно был внесены исследуемые образцы, добавляли конъюгат, содержащий биотилинированные поликлональные антитела к р24 ВИЧ-1. После инкубации в течение 1 часа при 37°С панель отмывали трис-солевым буфером и вносили стрептавидин-пероксидазный конъюгат. Проводили инкубацию в течение 30 мин при комнатной температуре, отмывали панель трис-солевым буфером и затем для визуализации реакции добавляли тетраметилбензидин (ТМБ). После инкубации в течение 30 минут в темноте при комнатной температуре в лунки для остановки реакции вносили 1 н серную кислоту. Результаты учитывали с помощью фотометра "Multiscan" при длине волны 630 нм. За положительный контроль принимали не менее чем 3-кратное превышение оптической плотности по сравнению с таковым показателем неинфицированной клеточной линии.

Результаты исследований представлены в Таблице 3. В результате проведенных исследований установлено, что штамм ИВ735 не уступает по уровню выработки антигена ВИЧ-1, штамму-аналогу LAV и обладает высокой репродуктивной активностью, что позволяет успешно инфицировать им лимфобластоидные клеточные культуры, с целью дальнейшей наработки инфекционного материала.

Таблица 1
Сравнительное исследование инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 на модели клеток МТ-4 и Jurkat
Титр, lg ТЦД 50 Штаммы ВИЧ-1 (модель клеток МТ-4) Штаммы ВИЧ-1 (модель клеток Jurkat)
6,0 6,0 6,0 6,0
Таблица 2
Исследование штамма ИВ735 методом иммуноблота
Вирусный антиген Выявленные антитела
Контроль (LAV) 160 120 65 55 53 41 31 24 17
ИВ735 160 120 65 55 53 41 31 24 17
Таблица 3
Сравнительный анализ инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 по уровню антигена вируса (р24).
Контроль клеток Штаммы ВИЧ-1
Контроль (LAV) ИВ735
0,061* 2,991 2,903
* оптическая плотность

Источники информации

1. Spira S., Wainberg M.A., Loemba H. et al. Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance // J. Antimicrob. Chem. - 2003. - V.51. - P.229-240.

2. Leitner Т., Korovina G., Marquina S. et al. Molecular and biological characterization of Russian HIV-1 strains // AIDS Res. Hum. Retroviruses. - 1996. - V.12 - P.1595-1603.

3. Lukashov V., Cornelissen MTE, Goudsmith J. et al. Simultaneous introducrion of distinct HIV-1 subtypes into different risk groups in Russia, Byelorussia and Lithuania // AIDS. - 1995. - V.9. - P.435-439.

4. Bobkov A., Cheingsong-Popov R., Karasyova N. et al. Sequence analysis of glycoprotein 120 coding region of a new human immunodeficiency virus type 1 subtype G from Russia // AIDS Res. Hum. Retroviruses. - 1996. - V.12. - P.1385-1388.

5. K.A.Ryzhov, M.N.Nossik, V.V.Pokrovsky et al. The genetic diversity of human immunodeficency virus-1 circulating in the territory of Russia // 5th IAS Conference on HIV Pathogenesis, Treatment and Prevetntion, 19-22 July 2009, Cape Town, South Africa, Fbs. CDAO34

6. M.H.Носик, K.A.Рыжов, С.Н.Кузин и др. Пути передачи ВИЧ-инфекции на территории Северо-Западного и Дальневосточного регионов России // Русский журнал СПИД, рак и общественное здоровье. - 2010. - Т.14. - №1(29). - С.32-33.

7. Bobkov A., Cheingsong-Popov R., Selimova L. et al. Genetic heterogeneity of HIV type 1 in Russia: identification of H variants and relationship with epidemiological data // AIDS. - 1996. - V.12. - P.1687-1690.

8. Nabatov A.A., Kravchenko O.N., Lyulchuk M.G. et al. Simultaneous introduction of HIV type 1 subtype A and В viruses into injecting drug users in Southern Ukraine at the beginning of the epidemic in the former Soviet Union // AIDS Res. Hum. Retroviruses. - 2002. - V.18. - P.891-895.

9. Barre-Sinoussi F., Mugeyre M., Dauguet C. Isolation of a T-lymphotropic retroviruses from a patient at risk for AIDS // Science. - 1983. - Vol.220. - P.868-871.

Штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В для диагностических и вакцинных препаратов, депонированный в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И.Ивановского Минздравсоцразвития России под номером 1189 и имеющий нуклеотидную последовательность, приведенную на фигуре 1.


Похожие патенты:

Изобретение относится к области фармацевтики. Создана иммуногенная композиция, способная индуцировать иммунный ответ в отношении по меньшей мере двух штаммов и/или серотипов Streptococcus uberis, включающая по меньшей мере один выделенный и/или рекомбинантный белок, имеющий определенную аминокислотную последовательность, полученный способом, включающим трансформацию прокариотической, эукариотической клеток или микроорганизма, такого как бактерия, дрожжи или грибы, конструкцией нуклеиновой кислоты, кодирующей указанный протеин, рекомбинантную молекулу нуклеиновой кислоты, рекомбинантный носитель и/или их иммуногенную часть, производное и/или аналог.

Изобретение относится к области биотехнологии и представляет собой способ определения неспецифической устойчивости патогенных микроорганизмов к антибиотикам и факта присутствия бактериальных биопленок на основании измерения каталитической активности фосфодиэстераз, расщепляющих циклический дигуанозинмонофосфат, с пороговой чувствительностью 50 пг/мл, включающий: 1) выделение фосфодиэстеразы-мишени из лизированных бактериальных клеток; 2) связывание фосфодиэстеразы биотинилированными антителами, специфичными к некаталитическим доменам фосфодиэстеразы; 3) аффинную очистку комплексов, сформированных фосфодиэстеразой-мишенью и биотинилированным антителом при помощи парамагнитных частиц, содержащих нейтравидин или его аналоги, связывающие биотин; 4) взаимодействие комплексов фосфодиэстераза/биотинилированное антитело, иммобилизованных на парамагнитных частицах, с комплексами, содержащими с-di-GMP в форме G-квадруплексов с интеркалированным красителем, сопровождающееся падением интенсивности флуоресценции по мере разрушения комплексов интеркалирующего красителя c-di-GMP; 5) измерение падения флуоресценции при гидролизе c-di-GMP и разрушении комплекса c-di-GMP с интеркалирующим красителем с последующим количественным определением активности фосфодиэстеразы на основании калибровочных кривых, построенных с использованием известных количеств рекомбинантного фермента фосфодиэстеразы, идентичного исследуемой мишени; 6) выявление повышенного уровня фосфодиэстеразной активности, обнаруживаемого тестируемыми антибиотикоустойчивыми бактериальными штаммами, способными к формированию биопленок, по сравнению с уровнем фосфодиэстеразной активности, обнаруживаемым для контрольных штаммов бактерий того же вида, не обладающих антибиотикоустойчивостью и способностью к формированию биопленок.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу А, и может быть использовано в вирусологии, медицине и биотехнологии. Штамм вируса иммунодефицита человека I-го типа ИВ742 депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу А, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ710 депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.
Изобретение относится к вирусологии и биотехнологии, в частности к культивированию клеток с целью изучения вирусов и конструирования новых антигенных препаратов.

Изобретение относится к вирусологии, в частности к области культивирования клеток и тканей для наработки и изучения вирусов. Целью изобретения является получение штамма клеток синовиальной мембраны поросенка (СМП), стабильного по биологическим характеристикам, пригодного для вирусологических и диагностических исследований, обладающего чувствительностью к вирусам-возбудителям болезням свиней, таких как африканская и классическая чума, болезнь Ауески.
Настоящее изобретение относится к области медицины, а именно к клинической лабораторной диагностике, и описывает способ конструирования полимерного иммуноглобулинового диагностикума для выявления Legionella pneumophila 1, 3 и 6 серогрупп, включающий получение иммунных кроличьих сывороток с последующей их сенсибилизацией на полимерный носитель в виде микросфер для обнаружения клеток штаммов L.
Изобретение относится к области биотехнологии, а именно к способу определения антител к Mycobacterium leprae. Способ включает выявление в сыворотках крови антител к Mycobacterium leprae с помощью иммуноферментного метода.
Изобретение относится к области лабораторных исследований и может быть использовано для оценки эффективности лечения хронического тонзиллита. Способ оценки эффективности терапии хронического тонзиллита включает микробиологическое исследование содержимого лакун небных миндалин с определением видов микроорганизмов и их концентрации, которое осуществляют на 5-7 сутки от начала лечения и при наличии в составе слизистой микрофлоры микроорганизмов S.
Изобретение относится к области ветеринарии, а именно к способам получения R-бруцеллезного эритроцитарного антигена для реакции непрямой гемагглютинации (РНГА). .

Изобретение относится к области биохимии, в частности к полипептидам, которые являются ингибиторами клетки метанопродуцента и биологическими маркерами для детекции фага φmru, а также к полинуклеотидам, которые кодируют эти полипептиды.
Изобретение относится к области биотехнологии и может быть использовано при производстве медико-биологических препаратов. Фармацевтическая композиция содержит бактериофаги, полученные путем культивирования на питательной среде, содержащей глюкозу, натрий хлористый, натрий двузамещенный фосфорнокислый, дрожжевой автолизат жидкий и очищенную воду в заданном соотношении, и высушенные с наполнителем без лиофилизации, в виде таблеток с желудочно-резистентным покрытием.

Изобретение относится к области биотехнологии и вирусологии. Представлены выделенные штаммы вируса гриппа, которые способны инфицировать собачьих и вызывать респираторное заболевание в собачьих.
Изобретение относится к области пищевой промышленности, биотехнологии и касается композиции антибактериальной и штамма бактериофага Escherichia coli, используемого для получения такой композиции.
Изобретение относится к области ветеринарной биотехнологии и вирусологии и касается штамма диплоидных клеток легкого плода крупного рогатого скота. Охарактеризованный штамм выделен из легкого плода коровы и депонирован в Специализированной Коллекции перевиваемых соматических клеточных культур сельскохозяйственных и промысловых животных РККК(П) (СХЖ РАСХН) при Всероссийском научно-исследовательском институте экспериментальной ветеринарии им.
Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается вакцины против вирусной диареи, ротавирусной и коронавирусной инфекций крупного рогатого скота.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу А, и может быть использовано в вирусологии, медицине и биотехнологии. Штамм вируса иммунодефицита человека I-го типа ИВ742 депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу А, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ710 депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.

Изобретение относится к области биотехнологии и касается способа количественного определения фиксированного вируса бешенства штамма «Москва 3253». Способ предусматривает обеззараживание и выделение РНК из вируссодержащего материала, постановку реакции обратной транскрипции и полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов в режиме «реального времени» с использованием специфичных праймеров RV5-5'-GTTGGGCACTGAAACTGCTA-3', RV6-5'-GAATCTCCGGGTTCAAGAGT-3' и зонда RV7-5'-ROX-AATCCTCCTTGAACTCCATGCGACAGA-BHQ2.

Изобретение относится к области медицинской биотехнологии и касается штаммов вируса гриппа. Представлен штамм вируса гриппа A/Гонконг/1/68/162/35 (H3N2), депонированный в Государственную коллекцию вирусов научно-исследовательского института вирусологии им.
Изобретение относится к области пищевой промышленности, биотехнологии и касается композиции антибактериальной и штамма бактериофага Escherichia coli, используемого для получения такой композиции.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу B, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И. Ивановского Минздравсоцразвития России под номером №1189. Штамм обладает стабильной репродуктивной активностью. Инфекционный титр составляет 6 lg ТЦД 50. Штамм является удобной природной моделью для изучения антивирусной активности химиопрепаратов нового поколения, а также для создания вакцины. 1 ил., 3 табл., 3 пр.
