Способ выявления вируса лейкоза крс по нуклеотидным последовательностям консервативных областей вирусного генома



Способ выявления вируса лейкоза крс по нуклеотидным последовательностям консервативных областей вирусного генома
Способ выявления вируса лейкоза крс по нуклеотидным последовательностям консервативных областей вирусного генома
Способ выявления вируса лейкоза крс по нуклеотидным последовательностям консервативных областей вирусного генома
Способ выявления вируса лейкоза крс по нуклеотидным последовательностям консервативных областей вирусного генома

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2521330:

Государственное научное учреждение Центр экспериментальной эмбриологии и репродуктивных биотехнологий Российской академии сельскохозяйственных наук (ГНУ ЦЭЭРБ Россельхозакадемии) (RU)

Изобретение относится к области ветеринарии и предназначено для выявления вируса лейкоза крупного рогатого скота (ВЛКРС) с использованием полимеразной цепной реакции. В реакции используют олигонуклеотиды, обладающие последовательностью не менее 15 последовательных оснований внутри любой из последовательностей оснований локусов генома ВЛКРС, представленных SEQ ID NO с 1 по 11. Изобретение обеспечивает универсальный способ детектирования ВЛКРС независимо от принадлежности ВЛКРС к определенной популяции за счет использования консервативных областей генома - gag и pol. 6 з.п. ф-лы, 4 ил., 4 табл., 4 пр.

 

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики и ветеринарной медицины и может найти применение в ветеринарии при диагностике крупного рогатого скота на носительство вируса лейкоза. В частности, изобретение относится к способу выявления вируса лейкоза крупного рогатого скота в тканях животных, а также во внешней среде при помощи молекулярно-биологических методов, и к наборам олигонуклеотидов, пригодных для осуществления данного способа.

Уровень техники

Лейкоз крупного рогатого скота - хроническая ретровирусная пролиферативная болезнь, возбудителем которой является вирус лейкоза крупного рогатого скота (ВЛКРС) - Bovine Leukemia virus (BLV), относящийся к семейству Retroviridae. Первое сообщение о болезни было сделано в 1871 году (Leisering, 1871 по Rodriguez et al., 2011), а тремя годами позже Bollinger описал лейкоз КРС как ясно очерченную нозологическую форму (Bollinger, 1874 по Rodriguez et. al., 2011). У большинства животных, инфицированных ВЛКРС (около 70%), заболевание протекает бессимптомно, приблизительно у трети животных развивается легкая форма - персистентный лимфоцитоз (Rodriguez et al., 2011). Летальная лимфосаркома возникает менее чем у 5-10% зараженных животных, преимущественно взрослых (старше 4-5 лет).

ВЛКРС передается горизонтально, особенно при переносе инфицированных клеток (Johnson R., 1985). Поскольку свободный вирус нестабилен, чаще всего средствами передачи служат клетки, зараженные ВЛКРС (В лимфоциты, моноциты/макрофаги) и присутствующие в крови или молоке. Животные с персистентным лимфоцитозом (ПЛ) с большей вероятностью выступают в качестве источника заражения, вследствие высокого уровня зараженных клеток в крови. В стадах распространение заболевания зачастую связано с ятрогенными факторами: несоблюдение правил асептики и антисептики при проведении ветеринарных и зоотехнических процедур (таких как удаление рогов, нанесение татуировки, ректальные исследования, инъекции), что влечет за собой перемещение инфицированной крови (Kobayashi et al., 2010; Kohara et al., 2006). Длительный прямой контакт между зараженным и здоровым животным должен также рассматриваться как фактор, повышающий риск. Согласно экспериментальным данным вирус может переноситься с участием питающихся кровью насекомых (Perino L.J., 1990). Возможна передача ВЛКРС от коров телятам посредством молока (Ferrer et al., 1981a; Ferrer et al., 1981b; Meas et al., 2002). Передача ВЛКРС in utero происходит с частотой 4-18%, для коров с персистентным лимфоцитозом вероятность передачи выше (Lassauzet et al., 1991; Meas et al., 2002). Значительная часть телят, получивших материнские антитела к антигенам ВЛКРС, остаются не зараженными (Burridge et al., 1982). В сперме инфицированных быков-производителей ВЛКРС не выявлен (Dus Santos et al., 2007).

ВЛКРС широко распространен на всех континентах, за исключением Европы. Усилия, направленные на внедрение системы мер контроля и реализацию программы по искоренению ВЛКРС в ряде стран Европы, увенчались успехом (Nuotio L., 2003; Knapen et al.,1993). Программа по уничтожению ВЛКРС инфекции в молочных стадах Австралии и Новой Зеландии была запущена в середине 1990-х годов, по данным за 2005 год более 98% стад было свободно от вируса (NAHIS-AHA Enzootic Bovine Leukosis). Согласно данным National Animal Health Monitoring за 2007 год, 83,9% ферм в США имеют в своем составе зараженных животных. Доступна информация о ситуации в нескольких провинциях Канады: 89% стад и 20,8 - 37,4% животных заражено ВЛКРС (VanLeeuwen J.A. F.L., 2005; VanLeeuwen J.A. T.A., 2006). 34-50% зараженных животных в Чили, Венесуэле, Колумбии и Уругвае. В Аргентине уровень зараженности животных и ферм - 32,8% и 84% соответственно (Trono K.G., 2001). В Японии 28,6% и 68,1% (Murakami К., 2011). По информации International Organization of Epizootics ВЛКРС встречается в Китае, Монголии и Индонезии. В странах Среднего Востока за исключением Турции и Ирана распространенность ВЛКРС на уровне 20%.

Вероятность инфицирования человека ВЛКРС изучалась с применением ряда молекулярных методов (иммуноцитохимия, ПЦР, ОТ-ПЦР). Анализ выборки здоровых людей, контактирующих с коровами, (257 человек) в 74% случаев показал наличие специфических антител к ВЛКРС (Buehring et al., 2003). Опасность развития лейкоза у человека в результате инфекции ВЛКРС оценивается как маловероятная, но не исключена полностью (Calattini et al., 2006).

В течение последних десятилетий был предпринят ряд попыток по созданию вакцины против ВЛКРС. Ни одна из разработанных вакцин не обеспечивает полной и продолжительной защиты (Rodriguez S.M., 2011). Единственный подход, применяемый для борьбы с ВЛКРС, заключаются в идентификации и последующей элиминации или изоляции зараженных ВЛКРС животных.

Диагностика лейкоза может осуществляться с использованием серологических, молекулярно-генетических (ПЦР), гематологических, клинических, патоморфологических методов и метода биопробы. В настоящее время в государственных программах по борьбе с лейкозом КРС основу диагностики ВЛКРС составляют серологические методы исследования - реакция иммунодиффузии (РИД) и иммуноферментный анализ (ИФА); гематологические, клинические и патоморфологические методы служат для уточнения диагноза.

Реакция иммунной диффузии (РИД) основана на выявлении антител к вирусу и обладает, при высокой специфичности, довольно низкой чувствительностью. Характерными недостатками метода являются возможность возникновения перекрестных (неспецифических) реакций, наличие латентной стадии инфекционного процесса, низкая критическая масса возбудителя, физиологическое состояние животного, а также иммунологическая супрессия, инициированная воздействием негативных факторов внешней среды, паразитозами, сопутствующими инфекциями, многочисленными вакцинными нагрузками. На чувствительность метода влияет также специфичность сывороток (Simard, 2000).

Иммуноферментный анализ (ИФА), или enzyme-linked immunosorbent assay (ELISA), основан на иммунохимической реакции взаимодействия антиген-антитело и использовании в качестве индикатора этой реакции маркированных ферментами антител или антигенов. Обладает более высокой по сравнению с РИД чувствительностью. Кроме того, с помощью ИФА можно обнаружить антитела к ВЛКРС в молоке и моче (Carii, 1993; Carii, 1999). Несмотря на очевидные достоинства достоверность ИФА все же связана с иммунологическими реакциями, и поэтому не всегда адекватна. Еще одним недостатком ИФА является невозможность выявить антитела в сыворотке крови в течение первых 1,5-2 месяца после заражения.

Молодняк до 6-ти месячного возраста остается вне плановых исследований в связи с тем, что методы РИД и ИФА практически не пригодны для диагностики лейкоза у телят, что связано с особенностями формирования их иммунитета. Как показала практика, при использовании серологических методов оздоровление стад затягивается на годы, так как невозможно выявить всех инфицированных животных, особенно на ранних стадиях заболевания, и изолировать их от здоровых (Макаров, 2005).

Гематологическому исследованию подвергают животных, в сыворотке крови которых методами РИД или ИФА обнаружены специфические антитела к вирусу лейкоза КРС. Данным методом выявляют больных животных среди вирусоносителей.

Наиболее перспективной альтернативой серологическим методам диагностики является подход с использованием полимеразной цепной реакции (ПЦР-диагностика), позволяющий детектировать наличие провирусной ДНК в крови КРС, выявляя, таким образом, не только больных животных, но и животных-носителей; отсутствие возрастных ограничений дает возможность тестировать телят с 15-дневного возраста. Метод ПЦР позволяет выявлять вирус в материале уже через 1-2 недели после заражения. Этот метод обладает максимальной чувствительностью и высокой специфичностью (Sherman, 1992; Gonzalez, 1999), что зависит от оптимальности подбора праймеров (Marisolais, 1994; Limansky, 2002; Markiewicz, 2003). Известен способ ПЦР-диагностики ВЛКРС на основании амплификации фрагмента гена Pol (RU 2445370 Cl).

Новые возможности для быстрой количественной детекции ВЛКРС предоставляет использование ПЦР в реальном времени (Kuckleburg, 2003). Подобный подход позволяет обнаружить провирусную ДНК в геноме хозяина, даже если она представлена в одной копии (Jimba, 2010). ПЦР позволяет с высокой достоверностью выявлять животных на самых ранних стадиях заболевания (Макаров, 2005).

В настоящее время показано, что существует несколько генотипов ВЛКРС, ассоциированных с географическими изолятами (Rodriguez, 2009). На сегодняшний день секвенировано 6 геномов ВЛКРС (accretion number в базе NCBI): EF600696.1, NC_001414.1, K02120.1, AF257515.1, FJ914764.1, AF033818. Также в базах данных представлено более 700 фрагментов генома вируса из разных географических изолятов, в том числе из России. Однако ДНК-типирование ВЛКРС как в нашей стране, так и за рубежом проводится без учета полиморфизма генома вируса, что дает долю ложноотрицательных результатов. В настоящее время актуальной является задача создания способа диагностики, позволяющего выявлять BLV независимо от его разновидности.

В качестве прототипа изобретения был выбран способ диагностики ВЛКРС методом ПЦР, известный из документа WO/2012/053666. В известном способе для проведения ПЦР используют так называемые "вырожденные", или "дегенеративные" праймеры, которые фактические представляют собой смесь олигонуклеотидов различной структуры, в той или иной степени специфичных к вирусной ДНК различных генотипов. Способ позволяет выявлять различные вирусные варианты путем исследования образца вирусной ДНК в процессе одной процедуры ПЦР, таким образом облегчая проведение скрининговых исследований, однако вырожденность праймеров отрицательно сказывается на специфичности и чувствительности ПЦР.

Раскрытие изобретения

В настоящем изобретении для осуществления диагностики ВЛКРС при проведении ПЦР с подготовленным образцом вирусной нуклеиновой кислоты (ДНК или кДНК) предложено применять строго локус-специфичные праймеры и зонды, каждый из которых представляет собой олигонуклеотид, комплементарный внутренней области одной из специально подобранных нуклеотидных последовательностей генома ВЛКРС, принадлежащих локусам генов pol и gag, в которых авторы изобретения обнаружили короткие участки, представленные SEQ ID NO с 1 по 11, последовательность которых одинакова у всех известных разновидностей вируса. Данные участки нуклеотидных последовательностей идентичны у всех известных в настоящее время разновидностей ВЛКРС (всего 110 последовательностей). Настоящее изобретение раскрывает использование олигонуклеотидов, комплементарных внутренней области данных консервативных участков, в качестве праймеров и зондов для ПЦР при проведении диагностики ВЛКРС, что делает возможным детекцию в образце ДНК ВЛКРС, независимо от разновидности вируса. Перечень нуклеотидных последовательностей, ограничивающих структуру олигонуклеотидов, пригодных для создания праймеров и зондов и их использования в ПЦР-диагностике ВЛКРС, приведен в табл.1., их взаимное расположение в геноме ВЛКРС показано на рис.1.

Таблица 1.
Ген pol
SEQ ID NO: 1
SEQ ID NO: 2
SEQ ID NO: 3
SEQ ID NO: 4
SEQ ID NO: 5
SEQ ID NO: 6
SEQ ID NO: 7
Ген gag
SEQ ID NO: 8
SEQ ID NO: 9
SEQ ID NO: 10
SEQ ID NO: 11

Дополнительно, для оценки качества реакции и вирусной нагрузки (при проведении количественной ПЦР в режиме реального времени) в качестве контрольной (референсной) последовательности может быть выбрана 5′-область гена Ablim2 Bos taurus, не имеющая гомологии ни с одной из консервативных последовательностей. Для этого участка была показана уникальность в геномах млекопитающих (Klimov et al., 2005), т.е. она не имеет гомологии с другими последовательностями генома вида, а также отличается от сходных последовательностей геномов других видов.

Техническим результатом, получаемым при реализации настоящего изобретения, является расширение возможностей диагностирования ВЛКРС за счет использования в ПЦР универсальных праймеров и зондов, комплементарных консервативным областям двух локусов генома вируса - gag и pol. ДНК-диагностика по двум локусам увеличивает специфичность реакции и позволяет выявлять все известные варианты вируса, исключая возможность получения ложноотрицательных результатов. Также существенным моментом является использование референсной последовательности генома КРС, позволяющей избежать ложноположительных результатов. Проведение реакции в формате мультиплекс (все локусы тестируются в одной пробирке) позволяет существенно снизить себестоимость ДНК-диагностики без потери чувствительности. Настоящее изобретение может быть использовано при создании различных модификаций универсальных диагностических ПЦР - тест-систем, предназначенных для выявления ДНК ВЛКРС. Специалист в данной области техники на основании перечня последовательностей SEQ ID NO: 1-11 и приведенных в описании условий подбора праймеров и зондов без проведения дополнительных исследований легко выберет праймеры и зонды, пригодные для любых известных в настоящее время модификаций ПЦР, например, вложенная, или гнездовая, ПЦР (nested-PCR), инвертированная ПЦР, ПЦР с обратной транскрипцией (ОТ-ПЦР, RT-PCR), асимметричная ПЦР (single-strande PCR), ПЦР в реальном времени (real-time PCR), ступенчатая ПЦР, RAPD, ПЦР с использованием горячего старта (hot-start PCR).

В описании изобретения раскрыт весь список локусов, необходимый для выбора ПЦР-праймеров и зондов, раскрыта процедура выбора праймеров и зондов, приведены экспериментальные примеры, демонстрирующие создание различных модификаций универсальных ПЦР - тест- систем для выявления вируса ВЛКРС, таким образом, изобретение соответствует условию "промышленная применимость".

Настоящее изобретение впервые раскрывает специалисту набор локусов, которые могут быть использованы в способе диагностики ВЛКРС, предназначенном для выявления любых известных с настоящему моменту разновидностей ВЛКРС, таким образом изобретение соответствует критерию патентоспособности "новизна".

Строго ограниченный перечень последовательностей был выбран на основании проведения теоретических и экспериментальных исследований из значительного массива нуклеотидных последовательностей различных вариантов ВЛКРС, имеющегося в базе данных GenBank. Первичная структура и количество последовательностей, которые могли бы быть отобраны для создания данного перечня, как и само существование данного перечня, не является очевидным для специалиста, таким образом, изобретение отвечает условию патентоспособности "изобретательский уровень".

Краткое описание чертежей

Рис.1. Иллюстрирует расположение последовательностей SEQ ID NO: 1-11 по отношению к последовательностям генов gag и pol ВЛКРС.

Рис.2. Иллюстрирует электрофоретическое разделение продуктов ПЦР с праймерами BA1F/BA1R.

Рис.3. Иллюстрирует электрофоретическое разделение вирус-отрицательных и вирус-положительных продуктов ПЦР.

Рис.4. Иллюстрирует накопление продуктов ПЦР в реальном времени.

Осуществление изобретения

Отбор образцов, выделение и очистку вирусной нуклеиновой кислоты проводят при помощи стандартных приемов, известных специалисту в данной области.

При конструировании праймеров и зондов на основании набора олигонуклеотидов, комплементарных непрерывной последовательности внутри любого из локусов, представленных SEQ ID NO с 1 по 11, следует придерживаться следующих условий:

содержание оснований G и С в праймере должно находиться в пределах 40-60%;

длина праймера 15-25 нуклеотидов;

не допускается наличие 3 и более оснований G или С на 3′-конце праймера, т.к. это может приводить к неспецифическому отжигу;

все праймеры не должны формировать стабильных шпилек и дуплексов сами на себя или друг с другом (димеры и кросс-димеры);

температура плавления праймеров и матрицы должна быть сходной и находиться в пределах 55-65°С.

Детекцию ПЦР-фрагментов проводят в режиме реального времени или с помощью электрофоретического разделения в ПААГ или агарозном геле.

Примеры воплощения изобретения.

Пример 1.

На основании набора олигонуклеотидов, комплементарных непрерывной последовательности внутри любого из локусов, представленных SEQ ID NO: 1-11, для проведения диагностики ВЛКРС было подобрано две пары праймеров для амплификации последовательностей, входящих в состав генов gag и pol генома провируса. Еще одна пара праймеров была сконструирована для амплификации уникального фрагмента генома Bos taurus 5′-область гена Ablim2. Характеристика подобранных праймеров представлена в таблице 2. Диапазон температур отжига подобранных праймеров составил 55-57°С, что позволяет использовать для амплификации общую программу. Компьютерный анализ показал, что между выбранными последовательностями нет критических комплементарных участков (не образуют димеров и кросс-димеров), а сами праймеры не образуют шпильки, т.е. они могут быть использованы для проведения мультиплексной ПЦР. Для всех праймеров показано отсутствие в геноме Bos taurus и в геноме ВЛКРС дополнительных мест посадки.

Таблица 2.
Примеры наборов праймеров, подобранных согласно настоящему изобретению.
Название праймера Ген Длина, нуклеотидов Последовательность, 5′-3′ Тотжига, °С Размер продукта амплификации (п.н.)
ВР2-F* pol 19 GCAGGCCGATATAACCCAT 55 229
ВР2-R* 21 TGCTGGCAAAACCTGACAAAG 56
BG1-F gag 20 TATATTGCTTCCCCGGTCGA 55 292
BG1-R 25 GCTAATGAAATTTGTAACCGGTTGA 55
BA1-F Ablim2 18 CGTGTCACACACCTCTCC 57 100
BA1-R 19 CGCTCCTTTGCTTTTCTCC 55
* - F - forward (прямой праймер), R - reverse (обратный праймер)

Для постановки ПЦР были рассчитаны следующие условия, позволяющие использовать данные праймеры в мультиплексной ПЦР: денатурация 95°С - 20 с, отжиг 57°С - 15 с, элонгация цепи (синтез) 72°С - 20 с.

При этих условиях были проведены реакции с каждой парой праймеров отдельно и мультиплексная ПЦР с тремя парами праймеров. Реакция проводилась с использованием набора GenPakTM PCR Core (OOO «Лаборатория Изоген», Россия) (рисунок 2).

Для выявления дальнейшей возможности использования подобранной системы праймеров в ПЦР в режиме реального времени была поставлена реакция с набором qPCRmix-HS (ЗАО «Евроген», Россия), разработанным специально для проведения ПЦР в режиме реального времени с использованием зондов.

При проведении ПЦР с использованием смеси qPCRmix-HS были получены неспецифичные высокомолекулярные продукты. Для повышения специфичности реакции было принято решение о снижении времени синтеза до 15 секунд и повышении температуры отжига до 60°.

Оптимизированные программы выглядят следующим образом:

Таблица 3.
Оптимизированные программы.
набор Условия
GenPak™ PCR Core (ООО «Лаборатория Изоген», Россия) - начальная денатурации (94°С - 3 мин)
- 35 циклов:
денатурация (94°С, 20 с)
отжиг (58°С, 30 с)
синтез (72°С, 20 с)
- финальная элонгации (72°С, 5 мин)
qPCRmix-HS (Евроген, Россия) - начальная денатурации (94°С - 3 мин)
- 35 циклов:
денатурация (94°С, 20 с)
отжиг (60°С, 30 с)
синтез (72°С, 15 с)
- финальная элонгации (72°С, 5 мин)

Таким образом, были подобраны оптимальные условия проведения ПЦР с праймерами, созданными на основании олигонуклеотидов, комплементарных к последовательностями SEQ ID NO 1-11 консервативных локусов генов pol и gag генома ВЛКРС. Не было обнаружено неспецифических продуктов реакции. Показана возможность проведения мультиплексной ПЦР.

Пример 2.

С использованием разработанных в примере 1 праймеров было проанализировано 1240 образцов ДНК, выделенной из крови 13 животных (в том числе из крови телят 2-4 месячного возраста, около 500, и стельных животных, около 100). На рисунке 3 представлен пример электрофоретического разделения продуктов МПЦР в 2% агарозном геле.

Всего выявлено 638 вирусположительных животных и 602 вирусотрицательных. Доля вирусоносителей составляет 51,45%.

Пример 3.

К разработанным парам праймеров были подобраны зонды для проведения ПЦР в режиме реального времени (тип TaqMan, для зондов формата Beacon за основы были взяты те же последовательности) на внутренние консервативные участки амплифицируемых фрагментов:

Р2 5′-GATACTTACTCTGGAGCTACTCATGCCTC-3′

G1 5′-ACCCAACAATCAGCTCAGCCCAACGC-3′

A1 5′-CCGCAGGGTCTACGGCAGCC-3′

С использованием разработанных праймеров и зондов была поставлена мультиплексная ПЦР в режиме реального времени с ДНК зараженного и здорового животного. На рисунке 4 представлены графики накопления продуктов реакции.

На рисунке видно, что в реакции 1 с образцом ДНК от зараженного животного кривые ПЦР с праймерами к последовательностям локусов gag и pol пересекли базовую линию, что является положительным ответом. В реакции 2 со здоровым животным - кривые не пересекли базовую линию. Синие кривые, характеризующие динамику накопления продукта внутреннего положительного контроля, пересекли базовую линию в обоих случаях.

Пример 4.

Для оценки возможности применения локусов, представленных SEQ ID NO: 4-7 и 11, для проведения диагностики ВЛКРС к ним были подобраны обратные праймеры для использования в реакции с прямым праймером к гену pol (BP2-F) и прямым праймером к гену gag (BG1-F). Последовательности праймеров представлены в таблице 4.

Таблица 4.
Примеры наборов праймеров, подобранных согласно настоящему изобретению.
Название праймера Ген Длина, нуклеотидов Последовательность, 5′-3′ Тотжига, °С Размер продукта амплификации (п.н.)*
ВР2-R3 pol 21 ACTTGTGGGGTTGTAGGGAAC 58 275 (274)
ВР2-R4 19 ATGGGAAGGTGGGGTTCGT 57 355 (354)
ВР2-R5 17 AGGGCTCGAGAAAGGGCCT 57 379 (378)
ВР2-R6 21 CTCCCATCTGGTCTTTAGAAT 51 431 (430)
BG1-R2 gag 17 GGCATCTTGGGCCCTGG 57 498 (491, 494)
* - размер при использовании с прямыми праймерами к генам pol (BP2-F) и gag (BG1-F) согласно последовательностям, представленным на рисунке 1. В скобках указаны размеры, полученные с использованием полных последовательностей генома вируса.

Полученные праймеры были проверены на комплементарность и специфичность отжига с помощью in silico PCR (использовалась программа FastPCR 6.4). В качестве последовательностей 6 геномов ВЛКРС (accretion number в базе NCBI): EF600696.1, NC_001414.1, K02120.1, AF257515.1, FJ914764.1, AF033818.

Результаты показали высокую степень гомологии последовательностей праймеров вариантам геномов ВЛКРС. Это подтверждает возможность использования локусов SEQ ID NO: 4-7 и 11 для ПЦР диагностики ВЛКРС.

СПИСОК ЦИТИРУЕМОЙ ЛИТЕРАТУРЫ (содержание которой полностью включено в настоящее описание посредством ссылки)

Макаров В.В., Гринишин, Д.П. Эпизоотологические перспективы лейкоза крупного рогатого скота // Вестник Российской академии сельскохозяйственных наук. 2005. Т.2, С.70-72.

Buehring G.C., Philpott S.M., Choi K.Y. Humans have antibodies reactive with Bovine leukemia virus // AIDS Res Hum Retroviruses. 2003. V.19. №12. P.1105-1113.

Burridge M.J., Thurmond M.C., Miller J.M., Schmerr M.J., Van Der Maaten M.J. Fall in antibody titer to bovine leukemia virus in the periparturient period // Canadian Journal of Comparative Medicine. 1982. V.46. №3. P.270-271.

Carli К.Т., Sen A., Batmaz H., Kennerman E. Detection of IgG antibody to bovine leukaemia virus in urine and serum by two enzyme immunoassays // Lett. Appl. Microbiol. 1999. V.28. №6. P.416-418.

Carli К.Т., Sen A., Batmaz H., Minbay A. Comparison of serum, milk and urine as samples in an enzyme immunoassay for bovine leukaemia virus infection // Res. Vet. Sci. 1993. V.55. №3. P.394-395.

Delebecque F., Suspene R., Calattini S., Casartelli N, Saib A., Froment A., Wain-Hobson S., Gessain A., Vartanian J.P., Schwartz O. Restriction of foamy viruses by APOBEC cytidine deaminases // J. Virol. 2006. V.80. №2. P.605-614.

Dus Santos M.J., Trono K., Lager I., Wigdorovitz A. Development of a PCR to diagnose BLV genome in frozen semen samples // Vet. Microbiol. 2007. V.119. P.10-18.

Ferrer J.F., Kenyon S.J., Gupta P. Milk of dairy cows frequently contains a leukemogenic virus // Science. 1981. V.213 №4511. P.1014-1016.

Ferrer J.F., Piper C.E. Role of colostrum and milk in the natural transmission of the bovine leukemia virus // Cancer Res. 1981. V.41. №12. P.4906-4909.

Gonzalez E.T., Norimine J., Valera A.R., Traveria G., Oliva G.A., Etcheverrigaray M.E. A rapid and sensitive diagnosis of bovine leukaemia virus infection using the nested shuttle polymerase chain reaction // Pesq. Vet. Bras. 1999. V.19. №2. P.63-67.

Jimba M., Takeshima S.N., Matoba K., Endoh D., Aida Y. BLV-CoCoMo-qPCR: Quantitation of bovine leukemia virus proviral load using the CoCoMo algorithm // Retrovirology. 2010. V.2. №7. P.91.

Johnson R., Gibson C.D., Kaneene J.B. Bovine leukemia virus: A herd-based control strategy // Preventive Veterinary Medicine. 1985. V.3. №4. P.339-349.

Klimov E., Rud′ko O., Rakhmanaliev E., Sulimova G. Genomic organisation and tissue specific expression of ABLIM2 gene in human, mouse and rat // BBA - Gene Structure and Expression. 2005. V.1730/1. P.1-9.

Knapen К., Kerkhofs P., Mammerickx M. Eradication of enzootic bovine leukosis in Belgium: Results of the mass detection on the national cattle population in 1989, 1990 and 1991 // Ann. Med. Vet. 1993. V.137. P.197-201.

Kobayashi S., Tsutsui Т., Yamamoto Т., Hayama Y., Kameyama K., Konishi M., Murakami K. Risk factors associated with within-herd transmission of bovine leukemia virus on dairy farms in Japan // BMC Vet. Res., 2010, 6, 1.

Kohara J., Konnai S., Onuma M.. Experimental transmission of Bovine leukemia virus in cattle via rectal palpation // Jpn. J. Vet. Res., 2006. V.54. №1. P.25-30.

Kuckleburg C.J., Chase C.C., Nelson E.A., Marras S.A., Dammen M.A., Christopher-Hennings J. Detection of bovine leukemia virus in blood and milk by nested and real-time polymerase chain reactions // J. Vet. Diagn. Invest. 2003. V.15. №1. P.72-76.

Lassauzet M.L., Thurmond M.C., Johnson W.O., Holmberg C.A. (). Factors associated with in utero or periparturient transmission of bovine leukemia virus in calves on a California dairy // Can. J. Vet. Res. 1991. V.55. №3. P.264-268.

Limansky A.P., Limanskya O. Comparison of primer sets for the detection of bovine leukemia virus by polymerase chain reaction // Bull. Vet. Inst. Pulawy. 2002. V.46. P.27-36.

Markewicz L., Rulkax J., Kamiski S. Detection of BLV provirus in different cells by Nested-PCR // Bull. Vet. Inst. Pulawy. 2003. V.47. P.325-331.

Marsolais G., Dubuc R., Bergeron J., Morrey J.D., Kelly E.J., Jackson M.K. Importance of primer selection in the application of PCR technology to the diagnosis of bovine leukemia virus // J. Vet. Diagn. Invest. 1994. V.6. №3. P.297-301.

Meas S., Usui Т., Ohashi K., Sugimoto C., Onuma M. Vertical transmission of bovine leukemia virus and bovine immunodeficiency virus in dairy cattle herds // Vet. Microbiol. 2002. V.84. №3. P.275-282.

Murakami К., Kobayashi S., Konishi M., Kameyama K., Yamamoto Т., Tsutsui T. The recent prevalence of bovine leukemia virus (BLV) infection among Japanese cattle // Vet. Microbiol. 2011. V.148. №1. P.84-88.

Nuotio L.,. Rusanen H., Sihvonen L., Neuvonen E.. Eradication of enzootic bovine leukosis from Finland // Prev. Vet. Med. 2003. V.59. №1-2. P.43-49.

Perino L.J., Wright R.E., Hoppe K.L., Fulton R.W. Bovine leukosis virus transmission with mouthparts from Tabanus abactor after interrupted feeding // Am. J. Vet. Res. 1990. V.51. №8. P.1167-1169.

Rodriguez S.M., Florins A., Gillet N., de Brogniez A., Sanchez-Alcaraz M.T., Boxus M., Boulanger F., Gutiérrez G., Trono K., Alvarez I., Vagnoni L., Willems L. Preventive and Therapeutic Strategies for Bovine Leukemia Virus: Lessons for HTLV // Viruses. 2011. V.3. P.1210-1248.

Rodriguez S.M., Golemba M.D., Campos R.H., Trono K., Jones L.R. Bovine leukemia virus can be classified into seven genotypes: evidence for the existence of two novel clades // J. Gen. Virol. 2009. V.90. Pt.ll. P.2788-2797.

Sherman M.P., Ehrlich G.D., Ferrer J.F., Sninsky J.J., Zandomeni R., Dock N.L., Poiesz B. Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction // J. Clin. Microbiol. 1992. V.30. №1. P.185-191.

Simard С., Richardson S., Dixon P., Belanger C., Maxwell P. Enzyme-linked immunosorbent assay for the diagnosis of bovine leukosis: comparison with the agar gel immunodiffusion test approved by the Canadian Food Inspection Agency // Can. J. Vet. Res. 2000. V.64. №2. P.101-106.

Trono K.G., Perez-Filgueira D.M., Duffy S., Borca M.V., Carrillo C. Seroprevalence of bovine leukemia virus in dairy cattle in Argentina: comparison of sensitivity and specificity of different detection methods // Vet. Microbiol. 2001. V.83. №3. P.235-248.

Van Leeuwen J.A., Forsythe L., Tiwari A., Chartier R. Seroprevalence of antibodies against bovine leukemia virus, bovine viral diarrhea virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum in dairy cattle in Saskatchewan // Can. Vet. J. 2005. V.46. №1. P.56-58.

Van Leeuwen J.A., Tiwari A., Plaizier J.C., Whiting T.L. Seroprevalences of antibodies against bovine leukemia virus, bovine viral diarrhea virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum in beef and dairy cattle in Manitoba // Can. Vet. J. 2006. V.47. №8. P.783-786.

Перечень последовательностей

SEQ ID NO: 1 5′-GCAGGCCGATATAACCCATTATAAATACAAACAG-3′

SEQ ID NO: 2 5′-GTGTTTGTAGATACTTACTCTGGAGCTACTCATGCCTC-3′

SEQ ID NO: 3 5′-AACTGCTGGCAAAACCTGACAAAGGTTTT-3′

SEQ ID NO: 4 5′-GAACTTGTGGGGTTGTAGGGAAC-3′

SEQ ID NO: 5 5′-CATGGGAAGGTGGGGTTCGTCTA-3′

SEQ ID NO: 6 5′-TGAGTCCAGAGGGCTCGAGAAAGGGCCTGAG-3′

SEQ ID NO: 7 5′-CTCCCATCTGGTCTTTAGAAT-3′

SEQ ID NO: 8 5′-CTTTGCCAATATATTGCTTCCCCGGTCGA-3′

SEQ ID NO: 9 5′-ACCCAACAATCAGCTCAGCCCAACGCCGG-3′

SEQ ID NO: 10 5′-TTAGGGACTCCGTCGGGAAGGTTGTCAGCTAATGAAATTTGTAACCGGTTGACAAA-3′

SEQ ID NO: 11 5′-GGCATCTTGGGCCCTGGGGTGTGGACGAG-3′

1. Способ выявления вируса лейкоза крупного рогатого скота путем полимеразной цепной реакции, отличающийся тем, что в реакции используют олигонуклеотиды, обладающие последовательностью не менее 15 последовательных оснований внутри любой из последовательностей оснований локусов генома ВЛКРС, представленных SEQ ID NO с 1 по 11.

2. Способ по п.1, где олигонуклеотиды, используемые в реакции, специфичны гену gag.

3. Способ по п.1, где олигонуклеотиды, используемые в реакции, специфичны гену pol.

4. Способ по п.1, где в реакции дополнительно используют олигонуклеотиды, комплементарные 5′-области гена Ablim2 генома Bos taurus.

5. Способ по пп.1-4, где реакцию амплификации каждого целевого фрагмента проводят раздельно.

6. Способ по пп.1-4, где реакцию амплификации каждого целевого фрагмента проводят в составе мультиплексной реакции.

7. Способ по пп.1-4, где разновидности полимеразной цепной реакции выбраны из списка: вложенная ПЦР, инвертированная ПЦР, ПЦР с обратной транскрипцией, асимметричная ПЦР, ПЦР в реальном времени, ступенчатая ПЦР, RAPD, ПЦР с использованием горячего старта.



 

Похожие патенты:
Изобретение относится к медицинским токсикологическим исследованиям, в частности к санитарной токсикологии, и может быть использовано для количественного определения 2,4-дихлорфенола в крови.

Изобретение относится к химико-фармацевтической промышленности и представляет собой средство для вовлечения мезенхимальной стволовой клетки костного мозга в периферическую кровь из костного мозга, которое вводят в кровеносный сосуд или мышцу и которое содержит любой из компонентов: (a) белок HMGB1; (b) клетка, которая секретирует белок HMGB1; (c) вектор, в который встроена ДНК, кодирующая белок HMGB1; (d) белок HMGB2; (e) клетка, которая секретирует белок HMGB2; (f) вектор, в который встроена ДНК, кодирующая белок HMGB2; (g) белок HMGB3; (h) клетка, которая секретирует белок HMGB3; и (i) вектор, в который встроена ДНК, кодирующая белок HMGB3.
Настоящее изобретение относится к медицине, в частности к кардиологии, и касается прогнозирования течения инфаркта миокарда. Для этого у больного с острым инфарктом миокарда на фоне стандартной терапии проводят измерение уровня ферментов анаэробного цикла - сукцинатдегидрогеназы, молочной и пировиноградной кислот и перекисного окисления липидов - малонового диальдегида.
Изобретение относится к области медицины, а именно к педиатрии, и может быть использовано для диагностики поражения отдела нефрона при заболеваниях почек у детей. Способ включает взятие суточной мочи больного и определение максимального удельного веса, титруемой кислотности, α1-микроглобулина и альбумина мочи, вычисление индекса поражения почек по формуле, и при значении индекса поражения почек X<800 наблюдение может быть отнесено к группе с преимущественным поражением канальцев, при значении функции X≥800 - к группе с преимущественным поражением клубочков.
Изобретение относится к медицине и касается способа обследования субъекта, у которого присутствуют симптомы и/или биомаркеры аутоиммунного заболевания, на предмет наличия инфекции Helicobacter Pylori и атрофического гастрита тела или антрального отдела желудка, включающего отбор образца крови, сыворотки или плазмы у указанного субъекта; и количественное измерение концентрации биомаркеров, включающих пепсиноген I, пепсиноген II, отношение пепсиногенов I/II, гастрин-17 и антитела IgG и IgA к Helicobacter Pylori из указанного образца крови, сыворотки или плазмы, и сравнение полученного значения с граничными значениями или эталонными диапазонами значений.

Изобретение относится к устройству и способу для количественного измерения аналита с использованием камеры. В частности, для сбора данных идентификационного кода, необходимых для получения точного результата анализа аналита.

Изобретение относится к способам определения эффективности лиганда ионного канала. Ex vivo способ определения эффективности лиганда ионного канала in vivo в зависимости от присутствия плазмы, включает стадии: a) приведение клетки, экспрессирующей ионный канал, в контакт с i) плазмой животного и ii) лигандом ионного канала и b) определение эффекта лиганда ионного канала на клетку, или a) приведение клетки, экспрессирующей ионный канал, в контакт с i) плазмой животного и ii) соединением, которое определяют как лиганд ионного канала, и b) определение эффекта соединения на клетку, или a) приведение клетки, экспрессирующей ионный канал, в контакт с плазмой животного, которому был введен лиганд ионного канала, и b) определение эффекта лиганда ионного канала на клетку.
Изобретение относится к медицине, а именно к способу прогнозирования развития атопического дерматита у детей грудного возраста. Сущность способа состоит в том, что в мембранах эритроцитов пуповинной крови новорожденного с помощью газовой хроматографии определяют уровень гамма-линоленовой кислоты.
Изобретение относится к области медицины, в частности к оздоровительной нейрогормональной коррекции и омоложению с использованием музыкально-акустических воздействий и может использоваться в различных лечебно-профилактических учреждениях.
Изобретение относится к медицине, точнее к профилактической медицине, гигиене, и может быть использовано для определения дермальной экспозиции при оценке риска вредного воздействия пестицидов на работающих при их применении в условиях сельскохозяйственного производства, фермерских и личных хозяйствах и других отраслях.
Изобретение относится к области медицины, в частности к физиологии, неврологии, нейропсихологии, восстановительной медицине, и касается способа выявления групп риска лиц, склонных к агрессивным видам поведения, путем определения уровня элементов в волосах, где определяют содержание Са, Mg, Fe, находят соотношение Ca/Mg, Fe/Ca, Fe/Mg, и при значении Ca/Mg выше 7,5, Fe/Ca выше 0,04, Fe/Mg выше 0,29 у человека диагностируют склонность к агрессии. Способ обеспечивает более раннее и достоверное выявление групп риска людей, склонных к агрессии, в криминалистике и профилактической работе по предотвращению правонарушений по признаку агрессивности и дополняет клинико-психологическое предварительное обследование. 6 табл., 4 пр.
Изобретение относится к медицине, а именно к способу диагностики инфекции желудка, вызванной Helicobacter pylori. Сущность способа состоит в том, что проводят фиброгастродуоденоскопию, во время которой производят забор пробы воздуха из желудка, анализируют ее состав на наличие аммиака, вводят нагрузочный раствор мочевины путем внутрижелудочного его распыления через катетер, производят повторный забор пробы воздуха из желудка, анализируют ее состав и при повышении концентрации аммиака в повторной пробе диагностируют инфекцию желудка, вызванную Helicobacter pylori. Использование заявленного способа позволяет с высокой точностью диагностировать инфекцию желудка, вызванную Helicobacter pylori. 1 табл., 1 пр.
Изобретение относится к медицине, а именно к ортопедии, и может быть использовано для прогнозирования интраоперационной кровопотери при операциях на позвоночнике по поводу хирургической коррекции идиопатического сколиоза. Для оптимизации индивидуальной предоперационной подготовки больного исследуют нарушения баланса системы гемостаза, при этом определяют дополнительно количественное содержание сульфатированных гликозаминогликанов в сыворотке крови и при повышении уровня сульфатированных гликозаминогликанов в сыворотке более 2,14 мкг/мл, снижении количественного содержания фактора XII до 80 мкг/мл и менее, замедлении фибринолитической активности до 17 мин и более, снижении уровня Д-димеров крови до 160 нг/мл и менее прогнозируют кровопотерю свыше 20% объема циркулирующей крови. Способ позволяет разработать рациональную схему заготовки аутокрови, подготовить адекватный резерв ее компонентов и провести соответствующую предоперационную медикаментозную подготовку. 2 пр.

Изобретение относится к области медицины и предназначено для прогнозирования развития злокачественных новообразований у лиц, находящихся в условиях хронического радиационного воздействия низкой интенсивности. Осуществляют генотипирование биологических сред организма при помощи ПЦР в режиме реального времени, причем в качестве матрицы для ПЦР используют слюну. При наличии комбинации генотипов XRCC1 280(GG) hOGG1 326(CC/CG) XPD1 751(AA) GSTM1(-) NOS3 774(TT/CT) прогнозируют высокий риск развития злокачественных новообразований. При наличии любого из мажорных генотипов XRCC1 280G>A, XPD1 751А>С, hOGG1 326C>G, CYP2C19 681G>A и NOS3 VNTR прогнозируют невысокий риск развития злокачественных новообразований. Изобретение позволяет провести тестирование в течение 2-х часов и даже в экспедиционных условиях и может быть использовано в процедурах отбора персонала для работы на производствах, деятельность которых связана с долговременным контактом с источниками ионизирующего излучения. 4 табл., 1 пр.
Изобретение относится к медицине, а именно к дерматологии, и касается способа диагностики атопического дерматита у детей. Способ включает определение функционального состояния клеточных мембран, которое оценивают по максимальной скорости Na+-Li+-противотранспорта в мембране эритроцита, заключающийся в измерении обмена внутриклеточного лития в загруженных этим ионом клетках на внеклеточный натрий из среды инкубации. Скорость натрий-литиевого противотранспорта V определяют как разность между концентрацией лития в среде, богатой натрием, и в среде, свободной от натрия, по формуле V=(ANa-AMg)·K мкМ лития/литр клеток/час, где ANa - концентрация лития в среде, богатой натрием; AMg - концентрация лития в среде, богатой магнием (свободной от натрия); K - коэффициент, связанный с разбавлением сред и с отношением количества надосадочной жидкости с эритроцитами к количеству сред прединкубации и инкубации на предыдущих этапах. При значении скорости натрий-литиевого противотранспорта в мембране эритроцита, превышающем 258 мкМ лития/литр клеток/час, диагностируют атопический дерматит у детей. Способ обеспечивает достоверное и эффективное диагностирование атонического дерматита у детей для последующего лечения и послелечебного анализа. 11 з.п. ф-лы, 2 пр.
Изобретение относится к области медицины, а именно к судебной медицине. Более подробно изобретение относится к способу диагностики состояний, обуславливающих дорожно-транспортные происшествия. Изобретение реализуется изъятием из трупа в первые 24 ч после смерти биологической жидкости и определением уровня таких биохимических показателей, как глюкоза и миоглобин в крови из бедренной вены, желудочков сердца, перикардиальной жидкости. При соотношении уровня глюкозы в крови в правом желудочке сердца к уровню глюкозы в крови из бедренной вены 2 и более, содержании миоглобина в крови бедренной вены в 20 и более раз, а в перикардиальной жидкости в 30 и более раз выше нормы делают заключение о том, что вероятной причиной смерти водителя явились сердечно-сосудистые нарушения, при иных значениях исследуемых биохимических показателей - причина смерти другая. Изобретение позволяет быстро и эффективно определить причины смерти вследствие ДТП. 5 табл., 2 пр.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы). Способ включает взятие у спортсмена контрольного образца до интенсивной тренировки и опытного образца после интенсивной тренировки. В качестве образца используется образец крови или соскоба или смыва с ротовой полости. Отбирают и промывают полученные клетки. Выделяют из клеток тотальную РНК. Проводят обратную транскрипцию, а затем амплификацию полученных кДНК. Оценивают экспрессии гена ТРСазы в опытном и контрольном образцах. Состояние утомления и состояние «перетренированности» определяется в случае значительного увеличения уровня экспрессии гена ТРСазы в опытном образце по сравнению с контрольным образцом, а именно более чем в 1,45 раза. Предложенное изобретение позволяет существенно повысить информативность, упростить и ускорить процедуру тестирования. 3 з.п. ф-лы, 1 табл., 3 ил.
Изобретение относится к медицине, а именно к способу прогнозирования повышения сердечно-лодыжечно сосудистого индекса жесткости у больных хронической обструктивной болезнью легких в сочетании с ишемической болезнью сердца, при котором исследуют исходные значения биомаркеров системного воспаления C-реактивного белка (СРБ), фактора некроза опухоли-альфа (ФНО-альфа) и противовоспалительного интерлейкина 4 (ИЛ-4) и решают дискриминантное уравнение Д=1,42*(ФНО-α)+0,78*(СРБ)-0,534*(ИЛ-4), и при величине Д больше 4,82 прогнозируют повышение сердечно-лодыжечно сосудистого индекса жесткости в течение года, а при Д меньше или равной 4,82 прогнозируют отсутствие повышения сердечно-лодыжечно сосудистого индекса жесткости. Изобретение обеспечивает повышение эффективности прогнозирования повышения сердечно-лодыжечно сосудистого индекса жесткости. 2 пр.

Группа изобретений относится к системе и способу контроля по меньшей мере одного параметра крови конкретного пациента при использовании устройства доступа для создания доступа к крови пациента через кожу, устройства забора для забора крови для получения пробы крови, устройства анализа крови, вычислительного устройства для вычисления медикаментозных параметров лекарственного средства, которое необходимо ввести пациенту, и подающего устройства для подачи лекарственного средства с вычисленными медикаментозными параметрами. Идентификация образцов крови осуществляется с использованием штрих-кодов. Достигается повышение точности и надежности контроля. 2 н. и 9 з.п. ф-лы, 3 ил.

Изобретение относится к области медицины и предназначено для прогнозирования тяжести течения хронической обструктивной болезни легких (ХОБЛ). При учете количества курсов приема антибиотиков по поводу обострения ХОБЛ за предшествующие 12 месяцев, проводят стандартный тест с 6-минутной ходьбой с оценкой расстояния, пройденного пациентом за 6 минут, частоты сердечных сокращений до проведения теста с ходьбой и уровня сатурации кислорода после выполнения теста с ходьбой, осуществляют забор биоматериала с задней стенки глотки методом орофарингеальных мазков с последующим выделением ДНК, проведением секвенирования и, при обнаружении протеобактерий, осуществляют перекодирование полученных данных в качественную переменную, выделяют геномную ДНК из крови пациентов с ХОБЛ с последующим проведением генотипирования по генам CD14 rs2569190 и IL18 rs1946518, предварительно перекодируют данные генотипирования в цифровые значения, рассчитывая дискриминантную функцию, и осуществляют прогноз. Предлагаемый способ обладает повышенной точностью, информативностью и чувствительностью и позволяет эффективно прогнозировать тяжесть течения ХОБЛ, а именно дифференцировать тяжелое и очень тяжелое течения заболевания от ХОБЛ средней и легкой степени тяжести. 1 ил., 4 табл., 2 пр.
Наверх