Растение, устойчивое к насекомым



Растение, устойчивое к насекомым
Растение, устойчивое к насекомым

 


Владельцы патента RU 2522477:

ЗИНГЕНТА ПАРТИСИПЕЙШНС АГ (CH)

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum. Описан способ идентификации в гибридном растении Capsicum annuum локуса количественного признака («QTL»), который способствует устойчивости к Bemisia. Изобретение позволяет эффективно идентифицировать в гибридном растении Capsicum annuum QTL, который способствует устойчивости к Bemisia. 2 н.п. ф-лы, 11 табл., 3 пр.

 

Настоящее изобретение относится к новым растениям перцев, устойчивых к насекомым, и к семенам и плодам этих растений. Настоящее изобретение относится также к способам получения и применения таких растений и их плодов. Кроме того, изобретение относится к маркерам и их применению в связанной с маркерами селекции и в идентификации признака устойчивости к насекомым.

Перцы являются важной в мировом масштабе сельскохозяйственной культурой с оцениваемой коммерческой стоимостью около 500 миллионов долларов в год. Перцы относятся к пасленовым рода Capsicum, которые включают виды Capsicum annuum, Capsicum frutescence и Capsicum chinense. Коммерческие перцы являются диплоидами с n=12 хромосомами. Перцы культивируют и используют во всем мире как сладкие перцы, такие как салатный перец, или жгучие чилийские перцы, перцы халапеньо и перцы TABASCO®; или в качестве источника сухих порошков различных цветов, таких как паприка. Типы культивируемых перцев могут быть дифференцированы по жгучести, форме плода, цвету и размеру (см., например, патент US 6,498,287).

Плоды перца, обычно также называемые «перцами», являются весьма скоропортящимися. Они подвержены потере влаги и сморщиванию, что делает их непривлекательными для потребителей. Кроме того, растения перца являются хозяевами для ряда заболеваний. Эти заболевания уменьшают урожай культур, а также влияют на внешний вид плодов, делая их непригодными для продажи. В частности, насекомые вызывают существенные потери урожая культур, приводящие к значительным коммерческим убыткам. В некоторых случаях насекомые прямо воздействуют на растения или плоды, в других случаях они действуют в качестве переносчика растительных вирусов. Обычно повреждение от насекомого уменьшает рост растения, но, как правило, не приводит к его гибели. Для уменьшения вреда, причиняемого насекомыми, может использоваться химический контроль и ротация сельскохозяйственных культур, но эти стратегии дороги и иногда неприемлемы.

Среди насекомых-вредителей, поражающих перцы, особенно вредными являются белокрылка Bemisia tabaci (Hemiptera:Aleyrodidae) и различные виды трипса, такие как Западный Обыкновенный Трипс: Frankliniella occidentalis, Трипс Табачный: Thrips tabaci. Чилийский Трипс Scirtothrips dorsalis и Дынный Трипс Thrips palmi.

Описано около 5000 видов трипса (насекомые Порядка Thysanoptera).Qvin,bi, которые питаются на высших растениях, в большинстве своем принадлежат Семейству Thripidae. Это семейство охватывает важные виды вредителей, включая серьезных вредителей декоративных, овощных и плодовых культур, выращиваемых на полях и в теплицах. Питание и откладывание яиц трипсом приводит к скручиванию, обесцвечиванию, посеребрению и увяданию листьев и плодов овощей, уменьшая их товарную ценность. Некоторые виды трипса являются переносчиками буньявирусов (семейство Bunyaviridae, род Tospovirus, типовые виды, вызывающие пятнистое увядание томата). В тропических и субтропических регионах мира ежегодно имеют место сильные вспышки массового размножения насекомых на продовольственных, волокнистых и декоративных культурах.

Западный Обыкновенный Трипс (Frankliniella occidentalis) является условно-патогенным насекомым-вредителем в теплицах, который серьезно поражает множество культур. За последние два десятилетия Frankliniella occidentalis распространилась почти по всему миру. Этот вид трипса причиняет очень большой ущерб и трудно поддается контролю. Он легко размножается на перце и создает физические повреждения на растении, цветках и плодах, начиная с ранней стадии выращивания в питомнике вплоть до зрелости культуры. Личинки и взрослые особи питаются на эпидермальных клетках листьев, почек, цветков и плодов. Они поражают кожуру плода и снижают товарную ценность. Ценные тепличные культуры, такие как овощи, особенно чувствительны к экономическим потерям, связанным с повреждением трипсом. Трипс также является эффективным переносчиком вредного вируса - вируса Пятнистого Увядания Томата (TSWv), который причиняет большие потери производителям. Инфицированные растения показывают интенсивную мозаичность и некроз на растениях и плодах.

С трипсом трудно бороться химическими препаратами, поскольку насекомые развивают устойчивость к сильным инсектицидам, применяемым последние 15 лет. В условиях теплиц использование биологических хищников либо Orius в жарких условиях, либо Amblyseius в холодных условиях, которые поддерживают низкий уровень трипса в культуре, является широко распространенной, но не всегда достаточной практикой.

Для белокрылки, Bemisia tabaci, описано по крайней мере два биотипа: В-тип, идентичный Bemisia argentifolii, и Q-тип.

Борьба с Bemisia и трипсом особенно трудна также из-за широкого круга хозяйских растений. Bemisia и виды трипса атакуют множество овощных культур, включая томат, бобы, огурцы, дыни, китайскую горькую тыкву, перец, баклажан, тыкву, патиссон и кабачок. Перец относится к наиболее повреждаемым культурам.

Вследствие повреждений на растении и плоде и передаче вредного вируса существует неудовлетворенная потребность в удобных и экономически сбалансированных стратегиях защиты перечных культур от этих вредителей. Устойчивость хозяйских растений является хорошей стратегией борьбы с Bemisia и трипсом. Она является экологически благоприятной альтернативой использованию пестицидов, позволяет увеличить эффективность мер биологического контроля и способствует успешным комплексным программам по борьбе с вредителями.

Настоящее изобретение направлено на удовлетворение этой потребности за счет обеспечения устойчивых растений перца, которые являются менее привлекательными для насекомых и/или способны сопротивляться поражению насекомыми и/или такому развитию, как например, откладывание яиц и/или образование куколок, и, следовательно, были бы в значительной степени защищены от заражения насекомыми, в частности от поражения белокрылкой Bemisia tabaci и/или трипсом.

Настоящее изобретение обеспечивает культивируемые растения Capsicum annuum, которые являются устойчивыми, в частности устойчивыми в промежуточной степени, к поражению насекомыми семейства Thripidae и/или рода Bemisia, но особенно к поражению Bemisia tabaci и Frankliniella occidentalis.

Устойчивость к «поражению Bemisia» или «устойчивые к Bemisia растения» относится к способности растений сопротивляться нападению, поражению или заселению насекомым. Уровень устойчивости, обнаруживаемый некоторыми растениями, может быть оценен, например, посредством стандартного Анализа Устойчивости к Насекомым, как описывается далее в Примере 2А, использующего шкалу от 1 до 9 для оценки степени поражения.

В одном воплощении, изобретение обеспечивает культивируемые растения Capsicum annuum, которые являются устойчивыми, в частности устойчивыми в промежуточной степени, к поражению Bemisia, где упомянутая устойчивость может быть оценена стандартным анализом устойчивости, в частности анализом, описанным ниже в Примере 2А, и где показатель устойчивости получают с отклонением не более чем 3 балла по шкале, предпочтительно не более чем 2 балла по шкале, и особенно предпочтительно не более чем 1 балл по шкале, от показателя устойчивости, получаемого от растения Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В одном воплощении обеспечивается устойчивое к Bemisia растение Capsicum annuum, которое способно сопротивляться развитию насекомых, в частности откладыванию яиц и/или образованию куколок на растении, так что количество куколок на листьях растений, определяемое стандартным анализом устойчивости, в частности анализом, описанным ниже в Примере 2А, отклоняется не более чем на один фактор из 20, предпочтительно не более чем на один фактор из 15, более предпочтительно не более чем на один фактор из 10, еще более предпочтительно не более чем на один фактор из 5, и особенно предпочтительно не более чем на один фактор из 2, от количества куколок, получаемых с растения Capsicum annuum линии 061М4387, представленной семенем, которое депонировано под номером доступа в NCIMB 41428, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В другом воплощении обеспечивается устойчивое к Bemisia растение Capsicum annuum, которое способно сопротивляться развитию насекомых, в частности откладыванию яиц и/или образованию куколок на растении, по существу в такой же степени, как растение Capsicum annuum линии 061М4387, представленной семенем, которое депонировано под номером доступа в NCIMB 41428, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В одном воплощении обеспечивается устойчивое к Bemisia растение Capsicum annuum, которое способно сопротивляться развитию насекомых, в частности откладыванию яиц и/или образованию куколок на растении, где упомянутая устойчивость может быть оценена стандартным анализом устойчивости, в частности анализом, описанным ниже в Примере 2А, и где получают показатель устойчивости, который по меньшей мера на 2 шкализированных балла, предпочтительно по крайней мере на 3 шкализированных балла, более предпочтительно по крайней мере на 4 шкализированных балла, но особенно предпочтительно по крайней мере на 5 шкализированных баллов выше, чем показатель устойчивости, получаемый от приемлемого стандартного коммерческого сорта, такого как, например, Vergasa или Bikingo, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В еще одном воплощении обеспечивается культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению трипсом, особенно к поражению F.occidentalis, в частности посредством предотвращения повреждения растения, вызываемого питанием трипса на эпидермальных клетках листьев, почек, цветков и плодов растения Capsicum annuum, которое приводит к посеребрению и потере цвета листьями, а также к деформации развития плода. Способность растений Capsicum предотвращать вред поедания, вызванный трипсом, может быть оценена стандартным анализом устойчивости, в частности анализом, описанным ниже в Примере 2В, посредством определения степени повреждения серебристостью в соответствии со шкалой в интервале от 1 до 9.

В одном воплощении изобретения обеспечивается культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению трипсом, особенно к поражению F. occidentalis, в частности посредством предотвращения повреждения растения, вызываемого питанием трипса на эпидермальных клетках листьев, почек, цветков и плодов растения Capsicum annuum, где упомянутая устойчивость может быть оценена стандартным анализом устойчивости, в частности анализом, описанным ниже в Примере 2В, и где показатель устойчивости получают отклонением с помощью не более чем 2 шкализированных балла, предпочтительно с помощью не более чем 1 балл по шкале, но особенно предпочтительно не более чем 0,5 балла по шкале от показателя, получаемого от растения Capsicum annuum линии 061М4387, представленной семенем, которое депонировано под номером доступа в NCIMB 41428, если оценивается в таком же анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В другом воплощении изобретения, изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению трипсом, особенно к поражению F.Occidentalis, в частности посредством предотвращения повреждения растения, вызываемого питанием трипса на эпидермальных клетках листьев, почек, цветков и плодов растения Capsicum annuum, где упомянутая устойчивость может быть оценена стандартным анализом устойчивости, в частности анализом, описанным ниже в Примере 2В, и где наблюдаемый вред от посеребрения не отклоняется более чем на 8%, предпочтительно более чем на 5%, более предпочтительно более чем на 2%, еще более предпочтительно более чем на 1%, и особенно предпочтительно более чем на 0,5% от поражения, обнаруживаемого на растении Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В одном воплощении изобретения, изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению трипсом, особенно к поражению F.occidentalis, в частности посредством предотвращения повреждения растения, вызываемого питанием трипса на эпидермальных клетках листьев, почек, цветков и плодов растения Capsicum annuum, до по существу такой степени, что и растение Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В другом воплощении обеспечивается культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, особенно к поражению Bemisia tabaci и F.occidentalis, в частности предотвращению откладывания яиц и/или развития куколок Bemisia и предотвращению вреда растению, вызываемому питанием трипса на эпидермальных клетках листьев, почек, цветков и плодов растения Capsicum annuum соответственно, где упомянутая устойчивость может быть оценена стандартным анализом устойчивости, в частности анализом, описанным ниже в Примерах 2А и 2В, и где для Bemisia оценку устойчивости получают отклонением не более чем 3 шкализированных балла, предпочтительно не более чем 2 шкализированных балла, но особенно предпочтительно не более чем 1 балл по шкале от оценки, получаемой от растения Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, и для трипса оценку устойчивости получают отклонением не более чем 2 шкализированных балла, предпочтительно не более 1 балла по шкале, но особенно предпочтительно не более чем 0,5 шкализированных балла от оценки, получаемой от растения Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, если оценивается в таком же анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В одном воплощении обеспечивается культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, особенно к поражению Bemisia tabaci и F.occidentalis, в частности предотвращению откладывания яиц и/или развития куколок Bemisia и предотвращению вреда растению, вызываемого питанием трипса на эпидермальных клетках листьев, почек, цветков и плодов растения Capsicum annuum соответственно, до по существу такой степени, что и растение Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, если оценивается в таком же самом анализе на статистически значимой выборке и при идентичных условиях окружающей среды, в частности при одинаковом давлении насекомых.

В другом воплощении, настоящее изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, в частности культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, где упомянутый QTL расположен на хромосоме 3 и/или хромосоме 5.

В одном воплощении, настоящее изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia, где упомянутое растение содержит геном, включающий по меньшей мере два локуса количественного признака («QTL»), которые способствуют устойчивости к Bemisia, где первый QTL расположен на хромосоме 3, а второй QTL расположен на хромосоме 5.

В другом воплощении, настоящее изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению трипсом, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, в частности культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению трипсом, где упомянутое растение содержит геном, включающий локус количественного признака («QTL»), который способствует устойчивости к трипсу, где упомянутый QTL расположен на хромосоме 5.

В другом воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, и по крайней мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, соответственно. В частности изобретение относится к культивируемому растению Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, как описано выше, где упомянутый QTL, способствующий устойчивости к Bemisia, расположен на хромосоме 3 и/или хромосоме 5, а упомянутый QTL, обеспечивающий устойчивость к трипсу, расположен на хромосоме 5.

В другом воплощении обеспечивается культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, где упомянутое растение содержит геном, включающий локусы количественного признака («QTL»), которые способствуют устойчивости к Bemisia и трипсу, где первый QTL, способствующий устойчивости к Bemisia, расположен на хромосоме 3 и второй QTL, способствующий устойчивости к Bemisia, расположен на хромосоме 5, а упомянутый QTL, способствующий устойчивости к трипсу, расположен на хромосоме 5.

В другом воплощении QTL на хромосоме 5 является единственным QTL, способствующим устойчивости как к Bemisia, так и к трипсу.

В другом воплощении, упомянутый QTL получают из растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL.

В следующем воплощении, изобретение относится к культивируемому растению Capsicum annuum, как оно описано выше, которое содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, где упомянутый QTL характеризуется генетическим сцеплением по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами, и еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, но особенно предпочтительно по меньшей мере с 5 и 6 маркерными локусами, причем маркерные локусы находятся на хромосоме 3, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР-олигонуклеотидных праймеров, выбранной из группы пар: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6; или с помощью любого другого маркерного локуса, который статистически коррелирует с признаком устойчивости к Bemisia.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, где упомянутый QTL получен из донорного растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, причем QTL в донорном растении генетически связан по крайней мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 3, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР-олигонуклеотидных праймеров, выбранных из группы пар 1-6 праймеров, представленных последовательностями SEQ ID NOs: 1-12.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, как оно описано выше, которое содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, где упомянутый QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР-олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13; или с помощью любого другого маркерного локуса, который статистически коррелирует с признаком устойчивости к Bemisia.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, где упомянутый QTL получен из донорного растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, причем QTL в донорном растении генетически сцеплен по крайней мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5 и ко-сегрегированы с признаком устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранных из группы пар 7-13 праймеров, представленных последовательностями SEQ ID NOs: 13-26.

В следующем воплощении, изобретение относится к культивируемому растению Capsicum annuum, как описано выше, содержащему геном, включающий по меньшей мере два локуса количественного признака («QTL»), которые способствуют устойчивости к Bemisia, где

а) первый QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами и еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, но особенно по меньшей мере с пятью и шестью маркерными локусами, причем маркерные локусы находятся на хромосоме 3 и ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6; или с помощью любого другого маркерного локуса, который статистически коррелирует с признаком устойчивости к Bemisia; и

b) второй QTL характеризуется наличием генетического сцеления по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13; или с помощью любого другого маркерного локуса, который статистически коррелирует с признаком устойчивости к Bemisia.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, которое содержит геном, включающий по меньшей мере два локуса количественного признака («QTL»), который способствует устойчивости к Bemisia, где упомянутый QTL получен из донорного растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, при этом первый QTL расположен на хромосоме 3 в донорном растении и генетически сцеплен по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3 и ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров 1-6, представленных последовательностями SEQ ID NOs: 1-12, а второй QTL расположен на хромосоме 5 в донорном растении и генетически сцеплен по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР-олигонуклеотидных праймеров, выбранных из группы пар 7-13 праймеров, представленных последовательностями SEQ ID NOs: 13-26.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, как оно описано выше, которое содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, где упомянутый QTL характеризуется наличием генетической связи по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5 и ко-сегрегированы с признаком устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР-олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13; или с помощью любого другого маркерного локуса на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, где упомянутый QTL получен из донорного растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, представленной семенем, которое депонировано под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, причем QTL в донорном растении генетически сцеплен по крайней мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5 и ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранных из группы пар 7-13 праймеров, представленных последовательностями SEQ IDNOs: 13-26.

В другом воплощении, настоящее изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, и по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, соответственно, где упомянутый QTL, способствующий

а) устойчивости к Bemisia, характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами, еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, а особенно предпочтительно по меньшей мере с пятью и с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3 и ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6; или с помощью любого другого маркерного локуса на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia; и

b) устойчивости к трипсу, характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5 и ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13; или с помощью любого другого маркерного локуса на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу.

В другом воплощении, настоящее изобретение обеспечивает культивируемое растение Capsicum annuum по любому из предшествующих пунктов, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, и по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, соответственно, где упомянутый QTL, способствующий

а) устойчивости к Bemisia, характеризуется наличием генетического сцепления с

i. по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами, еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, а особенно предпочтительно по меньшей мере с пятью и с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3 и ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ IDNO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6; или с помощью любого другого маркерного локуса на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia; и/или

ii. по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5 и ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13; или с помощью любого другого маркерного локуса на хромосоме 5, который статистически коррелирует с признаком устойчивости к Bemisia; и

b) устойчивостью к трипсу, характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами и с семью маркерными локусами, причем маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13; или с помощью любого другого маркерного локуса на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу.

В другом воплощении, настоящее изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, и по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, соответственно, где упомянутый QTL получен из донорного растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, и где

a) первый QTL, способствующий устойчивости к Bemisia, генетически сцеплен в донорном растении по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами, еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, а особенно предпочтительно по меньшей мере с пятью и с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3 и ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы праймерных пар 1-6, представленных прямым и обратным праймерами, приведенными в последовательностях SEQ ID NOs: 1-12; и/или

b) второй QTL, способствующий устойчивости к Bemisia, генетически сцеплен в донорном растении по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности предпочтительно по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности с шестью маркерными локусами и с семью маркерными локусами, при этом маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы праймерных пар 7-13, представленных прямым и обратным праймерами, приведенными в последовательностях SEQ ID NOs: 13-26; и

c) QTL, способствующий устойчивости к трипсу, генетически сцеплен в донорном растении по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности с шестью маркерными локусами и с семью маркерными локусами, при этом маркерные локусы находятся на хромосоме 5 и ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы праймерных пар 7-13, представленных прямым и обратным праймерами, приведенными в последовательностях SEQ ID NOs: 13-26.

В другом воплощении настоящее изобретение обеспечивает культивируемое растение Capsicum annuum, которое является устойчивым, в частности устойчивым в промежуточной степени, к поражению Bemisia и трипсом, где упомянутое растение содержит геном, включающий по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к Bemisia, и по меньшей мере один локус количественного признака («QTL»), который способствует устойчивости к трипсу, соответственно, где упомянутый QTL получен из донорного растения, которое имеет генетический фон линии 061М4387, в частности из растения, которое имеет генетический фон или архитектуру на QTL линии 061М4387, но особенно из растения линии 061М4387, образец семени которого депонирован под номером доступа в NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, и где упомянутый QTL, способствующий

a) устойчивости к Bemisia, генетически сцеплен в донорном растении по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами, еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, а особенно предпочтительно по меньшей мере с пятью и с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3 и ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, выбранной из группы праймерных пар 1-6, представленных прямым и обратным праймерами, приведенными в последовательностях SEQ ID NOs: 1-12; и

b) устойчивости к трипсу, генетически сцеплен в донорном растении по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности с шестью маркерными локусами и с семью маркерными локусами, при этом маркерные локусы находятся на хромосоме 5 и ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР-олигонуклеотидных праймеров, выбранной из группы праймерных пар 7-13, представленных прямым и обратным праймерами, приведенными в последовательностях SEQ ID NOs: 13-26.

В другом воплощении изобретения, для идентификации маркерных локусов согласно изобретению могут быть сконструированы один или более праймеров или зондов, в частности одна или более пар праймеров, и предпочтительно одна или более пар праймеров, состоящих из прямого праймера и обратного праймера, путем использования одного или более праймеров или зондов или упомянутой одной или более пар праймеров, предпочтительно с помощью комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 1-12, чтобы в результате пара праймеров позволила идентифицировать один или более маркерных локусов на хромосоме 3, которые ко-сегрегированы по признаку устойчивости к Bemisia.

В другом воплощении изобретения, для идентификации маркерных локусов согласно изобретению могут быть сконструированы один или более праймеров или зондов, в частности одна или более пар праймеров, и предпочтительно одна или более пар праймеров, состоящих из прямого праймера и обратного праймера, путем использования одного или более праймеров или зондов или упомянутой одной или более пар праймеров, предпочтительно с помощью комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 13-26, чтобы в результате пара праймеров позволила идентифицировать один или более маркерных локусов на хромосоме 5, которые ко-сегрегированы по признаку устойчивости к трипсу и/или к Bemisia.

Кроме того, настоящее изобретение охватывает праймеры и/или зонды, в частности пары праймеров, и предпочтительно пары праймеров, состоящих из прямого и обратного праймеров, имеющих нуклеотидную последовательность, которая по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична последовательностям, которые представлены в SEQ ID NOs: 1-12 и в SEQ ID NOs: 13-26 соответственно, а также пары праймеров, происходящие от комбинации упомянутых прямого и обратного праймеров.

В частности, признак устойчивости к Bemisia в соответствии с изобретением, локализованный на хромосоме 3, может быть идентифицирован парой ПЦР олигонуклеотидных праймеров, выбранных из группы: пара 1 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 1, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 3, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 5, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 7, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 9, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 10, идентифицирующая маркерный локус 5; пара 6 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 11, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 12, идентифицирующая маркерный локус 6, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia.

В другом воплощении, признак устойчивости к трипсу и признак устойчивости к Bemisia, согласно изобретению находящиеся на хромосоме 5, могут быть идентифицированы парой ПЦР олигонуклеотидных праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, в частности по меньшей мере 95%, в частности по меньшей мере 96%, в частности по меньшей мере 97%, в частности по меньшей мере 98%, в частности по меньшей мере 99% идентичности с последовательностью, приведенной в SEQ ID NO: 13, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 15, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 17, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 19, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 21, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 23, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 25, и обратный праймер, который имеет по меньшей мере 90%, предпочтительно по меньшей мере 95%, предпочтительно по меньшей мере 96%, предпочтительно по меньшей мере 97%, предпочтительно по меньшей мере 98%, предпочтительно по меньшей мере на 99% идентичность последовательности с последовательностью, приведенной в SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу и/или к Bemisia.

В другом воплощении изобретения, олигонуклеотидные праймеры охватывают, в частности пары праймеров, предпочтительно пары праймеров, состоящие из прямого и обратного праймеров, обнаруживающих нуклеотидную последовательность, которая гибридизуется с нуклеотидными последовательностями прямого и обратного праймеров, приведенными в SEQ ID NOs: 1-12, показанными в Таблице 10, и нуклеотидными последовательностями прямого и обратного праймеров, приведенными в SEQ ID NOs: 13-26, показанными в Таблице 11, соответственно, в условиях средней, предпочтительно от средней до высокой, предпочтительно высокой строгости.

В другом воплощении, изобретение относится к олигонуклеотидным последовательностям, в частности к олигонуклеотидным последовательностям, которые могут быть использованы в качестве праймеров и/или зондов, в частности к парам праймеров, предпочтительно к парам праймеров, которые состоят из прямого и обратного праймеров, обнаруживающих нуклеотидную последовательность, которая гибридизуется с нуклеотидными последовательностями, получаемыми при использовании прямого и обратного праймеров, обнаруживающих нуклеотидную последовательность, которая гибридизуется с нуклеотидными последовательностями прямого и обратного праймером, приведенными в SEQ ID NOs: 1-12, показанными в Таблице 10, и нуклеотидными последовательностями прямого и обратного праймеров, приведенными в SEQ ID NOs: 13-26, показанными в Таблице 11, соответственно, в условиях средней, предпочтительно от средней до высокой, предпочтительно высокой строгости.

В другом воплощении изобретения обеспечивается культивируемое растение Capsicum annuum, как оно описано выше, где упомянутое растение включает локус количественного признака («QTL»), ассоциированный с устойчивостью к Bemisia, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 3, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, сцепленном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранных из группы пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12, включая пары праймеров, происходящих из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 1-12, или из любого другого праймера или пары праймеров, которые идентифицируют маркерный локус на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia, причем продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из упомянутых пар 1-6 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum.

В частности, культивируемое растение Capsicum annuum, как оно описано выше, включает локус количественного признака («QTL»), ассоциированный с устойчивостью к Bemisia, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 3, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, связанном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде пары олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентифицированными выше парами 1-6 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В другом воплощении изобретения обеспечивается культивируемое растение Capsicum annuum, как оно описано выше, где упомянутое растение включает локус количественного признака («QTL»), который связан с устойчивостью к Bemisia, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 5, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, сцепленном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранной из группы пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26, включая пары праймеров, происходящих из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 13-26, или из любого другого праймера или пары праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к Bemisia, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 7-13 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В частности, культивируемое растение Capsicum annuum, как оно описано выше, включает локус количественного признака («QTL»), ассоциированный с устойчивостью к Bemisia, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 5, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, связанном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12; и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 7-13 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В другом воплощении изобретения, обеспечивается культивируемое растение Capsicum annuum, как оно описано выше, где упомянутое растение включает локус количественного признака («QTL»), ассоциированный с устойчивостью к трипсу, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 5, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, связанном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранной из группы пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26, включая пары праймеров, происходящие из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 13-26, или из любого другого праймера или пары праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 7-13 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В частности, культивируемое растение Capsicum annuum, как оно описано выше, включает локус количественного признака («QTL»), ассоциированный с устойчивостью к трипсу, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 5, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, связанном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 7-13 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В другом воплощении изобретения обеспечивается культивируемое растение Capsicum annuum, как оно описано выше, где упомянутое растение включает по меньшей мере один локус количественного признака («QTL»), ассоциированный с устойчивостью к Bemisia, и один локус количественного признака («QTL»), ассоциированный с устойчивостью к трипсу, при этом каждый QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 3 и на хромосоме 5соответственно, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, сцепленном с

a) первым QTL на хромосоме 3, при этом маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранной из группы пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia, и

b) вторым QTL на хромосоме 5, при этом маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранной из группы пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к Bemisia и/или к трипсу,

включая пары праймеров, происходящие из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 1-12 и из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 13-26 соответственно, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из упомянутых пар 1-6 и 7-13 праймеров соответственно, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В частности, культивируемое растение Capsicum annuum, как оно описано выше, включает локус количественного признака («QTL»), ассоциированный

a) с устойчивостью к Bemisia, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 3, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, связанном с QTL, причем маркерный локус характеризуется с помощью продукта ПЦР амплификации пары олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, или любым другим маркерным локусом на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia; и

b) с устойчивостью к трипсу и/или к Bemisia, при этом QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности с маркерным локусом на хромосоме 5, и где упомянутый QTL далее определяется по меньшей мере одним маркерным аллелем на упомянутом по меньшей мере одном маркерном локусе, сцепленном с QTL, причем упомянутый маркерный аллель характеризуется с помощью продукта ПЦР амплификации в виде олигонуклеотидного праймера или пары праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим маркерным локусом на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу и/или к Bemisia,

где каждый продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 1-6 и 7-13 праймеров соответственно, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

В другом воплощении, изобретение относится к продукту амплификации, получаемому в ПЦР-реакции, включая олигонуклеотидный праймер или пару праймеров, выбранную из пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12, и пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями 13-26 соответственно, включая пары праймеров, происходящие из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 1-12 и SEQ ID NOs: 13-26 соответственно, или любой другой праймер или группу праймеров, которые идентифицируют маркерный локус на хромосоме 3 и/или хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу и/или к Bemisia, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 1-6 и 7-13 праймеров соответственно, или комбинацией пар праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum и/или может считаться его аллелем.

Изобретение также касается полинуклеотида, который имеет по меньшей мере 90%, в частности по меньшей мере 95%, в частности по меньшей мере на 96%, в частности по меньшей мере 98%, в частности по меньшей мере 99% идентичность последовательности с последовательностью упомянутого продукта амплификации.

В одном воплощении изобретения, представлен полинуклеотид с нуклеотидной последовательностью, которая гибридизуется с нуклеотидными последовательностями продукта амплификации, получаемого в ПЦР реакции, включая пару олигонуклеотидных праймеров, выбранную из пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12, и пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26 соответственно, включая пары праймеров, происходящие из комбинации прямого и обратного праймеров с последовательностями SEQ ID NOs: 1-12 и SEQ ID NOs: 13-26 соответственно.

В конкретном воплощении, изобретение относится к продукту амплификации, получаемому в ПЦР реакции, включая пару олигонуклеотидных праймеров, выбранную из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 1-6 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum.

В другом конкретном воплощении, изобретение относится к продукту амплификации, получаемому в ПЦР реакции, включая пару олигонуклеотидных праймеров, выбранную из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, при этом продукт амплификации соответствует продукту амплификации, получаемому из инбредной линии 061М4387 (NCIMB 41428) в ПЦР реакции с идентичными праймерами, получаемыми из идентифицированных выше пар 7-13 праймеров, при условии, что соответственный маркерный локус все еще присутствует в упомянутом растении Capsicum.

Описанный выше продукт амплификации согласно изобретению затем может быть использован для создания новых праймеров или зондов, которые можно использовать для идентификации маркерного локуса, в частности маркерного локуса на хромосоме 3 и/или 5 соответственно, генетически сцеленного с QTL, ассоциированного с устойчивостью к Bemisia и/или к трипсу.

В одном воплощении, изобретение относится к маркеру, в частности к праймерам или зондам, полученным из описанного выше продукта амплификации согласно изобретению с помощью известных в данной области техники методов.

В другом воплощении изобретения, обеспечивается культивируемое растение Capsicum annuum согласно изобретению и как оно описано выше, где упомянутый аллель или аллели, связанные с устойчивостью к Bemisia, получают из линии 061М4387 или любой другой линии, имеющей такую же самую генетическую архитектуру в QTL на хромосоме 3 и/или хромосоме 5, образец семян которой депонирован под номером доступа NCIMB 41428, или из их потомства или предка, включающих упомянутые QTL или QTL-архитектуру.

Изобретение также охватывает растения, из которых раскрытые здесь конкретные маркеры рекомбинированы и, таким образом, более не присутствуют в растительном геноме.

В одном воплощении изобретения, обеспечивается культивируемое растение Capsicum annuum согласно изобретению и как оно описано выше, где упомянутый аллель, связанный с устойчивостью к трипсу, получают из линии 061М4387 или любой другой линии, имеющей такую же самую генетическую архитектуру в QTL на хромосоме 5, образец семян которой депонирован под номером доступа NCIMB 41428, или из их потомства или предка, включающих упомянутые QTL или QTL-архитектуру.

Изобретение также охватывает растения, из которых раскрытые здесь конкретные маркеры рекомбинированы и, таким образом, более не присутствуют в растительном геноме.

В одном аспекте изобретения культивируемое растение Capsicum annuum, согласно изобретению и как оно описано выше, является гомозиготным по признаку устойчивости к Bemisia и/или к трипсу.

В другом аспекте изобретения культивируемое растение Capsicum annuum, согласно изобретению и как оно описано выше, является гомозиготным по с-локусу (Blum et al. (2002) Genome, 45: 702-705) или punl аллелю (Stewart et al. (2005) The Plant Journal, 42: 675-688) или как по с-локусу, так и punl-аллелю.

В еще одном аспекте изобретения, растение согласно изобретению и как оно описано выше имеет плод, который в зрелом состоянии весит более 2 грамм или имеет длину более 1 см и диаметр более 0,5 см и не обнаруживает вреда от поедания трипсом и/или Bemisia, когда это растение выращивают в условиях, обычно используемых фермерами в регулярной практике культивирования в открытом поле или в теплице.

Растение согласно изобретению и как оно описано выше может представлять собой растение сладкого перца, салатного перца, большого прямоугольного перца, конического перца, продолговатого конического перца или глыбообразного перца. Плод упомянутого растения может быть зеленым, желтым, оранжевым, кремовым или красным плодом.

Растение согласно изобретению может быть растением стручкового перца, например слегка жгучего перца, используемого для продажи на зеленном рынке или для обработки, включая продолговатый сердцевидный с тонкой мякотью анчоусной формы и продолговатый тупоконечный с тонкой мякотью тосканского типа перец, плод несколько более жгучего чилийского перца с мякотью средней толщины, и жгучий перец, используемый как для продажи на зеленном рынке, так и для обработки, включая продолговатый цилиндрической формы с толстой мякотью халапеньо, маленький узкий конусообразный Серрано и неправильной формы с тонкой мякотью кайенский перец.

Растение, согласно изобретению и как оно описано выше, может быть инбредным, двойным гаплоидом или гибридом и/или обладать мужской стерильностью.

В одном воплощении, изобретение относится к растительному материалу, получаемому из растения согласно настоящему изобретению и как оно описано выше, включая, но без ограничения ими, листья, стебли, корни, цветки или части цветков, плоды, пыльцу, зародышевые клетки, зиготы, семена, отводки, клеточные или тканевые культуры или любая другая часть или продукт растения, который обнаруживает устойчивый фенотип согласно изобретению, в частности, когда он вырастает в растение.

Далее изобретение относится к частям растения, получаемым из растения согласно изобретению и как оно описано выше, включая, но без ограничения ими, к семени растения, органам растения, таким как, например, корень, стебель, лист, бутон цветка или зародыш и т.п., семяпочки, микроспоры пыльцы, клетки растении, ткань растения, культуры растительных клеток, таких, например, как протопласты, клеточные культуры, клетки в тканях, пыльца, пыльцевые трубки, семяпочки, зародышевые мешки, зиготы и зародыши на разных стадиях развития и т.д., которые все еще обнаруживают устойчивый фенотип согласно изобретению, в частности, когда он вырастает в растение.

В одном аспекте, изобретение относится к способу введения аллеля в локус количественного признака («QTL»), способствующего устойчивости к Bemisia у растения Capsicum annuum, у которого упомянутый аллель отсутствует, включающему:

а) получение первого растения рода Capsicum согласно изобретению и как оно описано выше, в частности растения Capsicum annuum, включающему

i) по меньшей мере один маркерный аллель, характеризуемый с помощью продукта ПЦР амплификации, в частности продукта ПЦР амплификации, получаемого с использованием ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia, или

ii) по меньшей мере один маркерный аллель, характеризуемый с помощью продукта ПЦР амплификации, в частности продукта ПЦР амплификации, получаемого с использованием ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к Bemisia, или iii комбинацию i) и ii);

b) скрещивание упомянутого первого растения рода Capsicum, в частности растения Capsicum annuum, со вторым растением Capsicum annuum, где у упомянутого второго растение Capsicum annuum отсутствует упомянутая нуклеиновая кислота; и

c) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и включающего по меньшей мере один упомянутый маркерный аллель; или, при необходимости,

d) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и у которого отсутствуют упомянутые маркерные аллели, идентифицированные на стадии а).

В другом аспекте, изобретение относится к способу введения аллеля в локус количественного признака («QTL»), способствующего устойчивости к трипсу у растения Capsicum annuum, у которого упомянутый аллель отсутствует, включающему:

а) получение первого растения рода Capsicum согласно изобретению и как оно описано выше, в частности растения Capsicum annuum, включающему по меньшей мере один маркерный аллель, характеризуемый с помощью продукта ПЦР амплификации, в частности продукта ПЦР амплификации, получаемого с использованием ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу;

b) скрещивание упомянутого первого растения рода Capsicum, в частности растения Capsicum annuum, со вторым растением Capsicum annuum, где у упомянутого второго растения Capsicum annuum отсутствует упомянутая нуклеиновая кислота; и

c) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к трипсу и включающего по меньшей мере один упомянутый маркерный аллель; или, при необходимости,

d) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и у которого отсутствуют упомянутые маркерные аллели, идентифицированные на стадии а).

В другом аспекте, изобретение относится к способу введения по меньшей мере первого аллеля в локус количественного признака («QTL»), способствующего устойчивости к Bemisia, и по меньшей мере второго аллеля в локус количественного признака («QTL»), способствующего устойчивости к трипсу и/или к Bemisia в растение Capsicum annuum, у которого упомянутые аллели отсутствуют, включающему:

а) получение первого растения рода Capsicum, в частности растения Capsicum annuum, включающему

i) по меньшей мере один маркерный аллель, характеризуемый с помощью продукта ПЦР амплификации, в частности продукта ПЦР амплификации, получаемого с использованием ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia, и

ii) по меньшей мере один маркерный аллель, характеризуемый с помощью продукта ПЦР амплификации, в частности продукта ПЦР амплификации, получаемого с использованием ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу и/или к Bemisia;

b) скрещивание упомянутого первого растения рода Capsicum, в частности растения Capsicum annuum, со вторым растением Capsicum annuum, где у упомянутого второго растения Capsicum annuum отсутствуют упомянутые нуклеиновые кислоты; и

c) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и/или к трипсу и включающего по меньшей мере два упомянутых маркерных аллеля, ко-сегрегированных по упомянутой устойчивости, или, при необходимости,

d) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и/или к трипсу и у которого отсутствуют упомянутые маркерные аллели, идентифицированные на стадии а).

В другом аспекте, изобретение относится к способу введения QTL, способствующего устойчивости к Bemisia, в растение Capsicum annuum, у которого упомянутый аллель отсутствует, включающему:

а) получение первого растения рода Capsicum, в частности растения Capsicum annuum, которое содержит геном, включающий локус количественного признака («QTL»), способствующего устойчивости к Bemisia, где упомянутый QTL характеризуется наличием генетического сцепления с по меньшей мере одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами и еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, но особенно предпочтительно по меньшей мере с пятью и с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, или любым другим маркерным локусом на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia;

b) скрещивание упомянутого первого растения рода Capsicum, в частности растения Capsicum annuum, со вторым растением Capsicum annuum, где у упомянутого второго растения Capsicum annuum отсутствует упомянутая нуклеиновая кислота; и

c) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и включающему упомянутый QTL.

В другом аспекте, изобретение относится к способу введения QTL, способствующего устойчивости к трипсу, в растение Capsicum annuum, у которого упомянутый аллель отсутствует, включающему:

а) получение первого растения рода Capsicum, в частности растения Capsicum annuum, которое содержит геном, включающий локус количественного признака («QTL»), способствующего устойчивости к трипсу, где упомянутый QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами и в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности с шестью маркерными локусами и с семью маркерными локусами, при этом маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим праймером или парой праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу;

b) скрещивание упомянутого первого растения рода Capsicum, в частности растения Capsicum annuum, со вторым растением Capsicum annuum, где у упомянутого второго растения Capsicum annuum отсутствует упомянутая нуклеиновая кислота; и

c) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к трипсу и включающему упомянутый QTL.

В другом аспекте, изобретение относится к способу введения QTL, способствующего устойчивости к Bemisia и устойчивости к трипсу, в растение Capsicum annuum, у которого упомянутый(-ые) аллель(-и) отсутствует(-ют), включающему:

а) получение первого растения рода Capsicum, в частности растения Capsicum annuum, которое содержит геном, включающий локус количественного признака («QTL»), который способствует

i) устойчивости к Bemisia, где упомянутый QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, предпочтительно по меньшей мере с двумя маркерными локусами, более предпочтительно по меньшей мере с тремя маркерными локусами и еще более предпочтительно по меньшей мере с четырьмя маркерными локусами, но особенно предпочтительно по меньшей мере с пятью и с шестью маркерными локусами, при этом маркерные локусы находятся на хромосоме 3, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы с помощью ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6, или любым другим маркерным локусом на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia; и

ii) устойчивости к трипсу, где упомянутый QTL характеризуется наличием генетического сцепления по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами и в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности с шестью маркерными локусами и с семью маркерными локусами, при этом маркерные локусы находятся на хромосоме 5, ко-сегрегированы по признаку устойчивости к трипсу и могут быть идентифицированы с помощью ПЦР олигонуклеотидных праймеров или пары ПЦР олигонуклеотидных праймеров, в частности пар праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO; 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, или любым другим маркерным локусом на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу;

b) скрещивание упомянутого первого растения рода Capsicum, в частности растения Capsicum annuum, со вторым растением Capsicum annuum, где у упомянутого второго растения Capsicum annuum отсутствует(-ют) упомянутая(-ые) нуклеиновая(-ые) кислота(-ы); и

c) идентификацию растения, происходящего от скрещивания, обнаруживающего повышенную устойчивость к Bemisia и к трипсу и включающему упомянутый QTL.

В конкретном воплощении изобретения первое растение Capsicum annuum является растением, которое имеет генетический фон, а особенно генетическую архитектуру в локусе устойчивости к Bemisia и/или к трипсу линии 061М4387, образец семян которой депонирован под номером доступа NCIMB 41428, или его потомства или предка, но особенно растения упомянутой линии 061М4387, его потомства или предка.

В другом конкретном воплощении изобретения, идентификация растения Capsicum, обнаруживающего повышенную устойчивость к Bemisia и/или к трипсу и включающего QTL согласно изобретению на стадии с) любого из описанных выше способов, производится посредством фенотипической оценки, используя шкалу оценок, раскрытую в Примерах 2А и 2В соответственно, или с помощью молекулярного маркера согласно изобретению и как это раскрыто выше, или их комбинацией.

В одном аспекте, изобретение относится к применению аллеля или QTL, получаемого из растения, которое имеет генетический фон, но особенно генетическую архитектуру в локусе устойчивости к Bemisia и/или к трипсу, линии 061М4387, образец семян которой депонирован под номером доступа NCIMB 41428, или его потомства или предка, в частности от растения, которое имеет генетическую архитектуру в QTL, способствующего устойчивости к Bemisia и/или к трипсу линии 061М4387, или потомства или но особенно растения упомянутой линии 061М4387, или его потомства или предка, но особенно от упомянутой линии 061М4387, или ее потомства или предка, для придания устойчивости к Bemisia и/или к трипсу растению Capsicum annuum, у которого отсутствует упомянутый аллель, ассоциированный с устойчивостью к Bemisia и устойчивостью к трипсу соответственно.

Изобретение далее включает культивируемое растение Capsicum annuum, устойчивое, в частности устойчивое в промежуточной степени, к Bemisia, при этом растение получают путем скрещивания Capsicum annuum, подверженного к поражению Bemisia, с растением линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или его потомства или предка, и посредством отбора растения, включающего QTL, которое может быть идентифицировано в ПЦР реакции с помощью пары ПЦР олигонуклеотидных праймеров, состоящей из прямого праймера и обратного праймера, обнаруживающей нуклеотидную последовательность, которая является по меньшей мере на 90%, в частности по меньшей мере на 95%, в частности по меньшей мере на 96%, в частности по меньшей мере на 97%, в частности по меньшей мере на 98%, в частности по меньшей мере на 99% идентичной последовательностям, приведенным в SEQ ID NOs: 1-12, или с помощью любого другого праймера или пары праймеров, которые идентифицируют маркерный локус на хромосоме 3, который статистически коррелирует с признаком устойчивости к Bemisia.

В одном воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, устойчивое, в частности устойчивое в промежуточной степени, к трипсу, при этом растение получают путем скрещивания Capsicum annuum, подверженного к поражению трипсом, с растением линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или его потомства или предка, и посредством отбора растения, включающего QTL, которое может быть идентифицировано в ПЦР реакции с помощью пары ПЦР олигонуклеотидных праймеров, состоящей из прямого праймера и обратного праймера, обнаруживающей нуклеотидную последовательность, которая является по меньшей мере на 90%, в частности по меньшей мере на 95%, в частности по меньшей мере на 96%, в частности по меньшей мере на 97%, в частности по меньшей мере на 98%, в частности по меньшей мере на 99% идентичной последовательностям, приведенным в SEQ ID NOs: 1-12, или с помощью любого другого праймера или пары праймеров, которые идентифицируют маркерный локус на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу.

В другом воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, устойчивое, в частности устойчивое в промежуточной степени, к Bemisia и к трипсу, при этом растение получают путем скрещивания Capsicum annuum, подверженного к поражению Bemisia и/или трипсом, с растением линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или его потомством или предком, и посредством отбора растения, включающего QTL, которое может быть идентифицировано в ПЦР реакции с помощью пары ПЦР олигонуклеотидных праймеров, состоящей из прямого праймера и обратного праймера, обнаруживающей нуклеотидную последовательность, которая является по меньшей мере на 90%, в частности по меньшей мере на 95%, в частности по меньшей мере на 96%, в частности по меньшей мере на 97%, в частности по меньшей мере на 98%, в частности по меньшей мере на 99% идентичной последовательностям, приведенным в SEQ ID NOs: 1-12 и в SEQ ID NOs: 13-26 соответственно, или с помощью любого другого праймера или пары праймеров, которые идентифицируют маркерный локус на хромосоме 3 и на хромосоме 5, который статистически коррелирует с признаком устойчивости к трипсу и к Bemisia соответственно.

В одном аспекте, изобретение относится к способу получения плода перца, включающего:

a) выращивание культивируемого растения Capsicum annuum, устойчивого, в частности устойчивого в промежуточной степени, к Bemisia, согласно изобретению и как оно описано выше;

b) обеспечение возможности упомянутому растению дать плод; и

c) сбор плода с упомянутого растения.

В другом аспекте, изобретение относится к способу получения плода перца, в частности плода перца, который по существу свободен от вреда, вызванного поеданием Bemisia и/или трипсом, включающему:

a) выращивание культивируемого растения Capsicum annuum, устойчивого, в частности устойчивого в промежуточной степени, к трипсу, согласно изобретению и как оно описано выше;

b) обеспечение возможности упомянутому растению дать плод; и

c) сбор плода с упомянутого растения.

В другом аспекте, изобретение относится к способу получения плода перца, в частности плода перца, который по существу свободен от вреда, вызванного поеданием трипсом, включающему:

a) выращивание культивируемого растения Capsicum annuum, устойчивого, в частности устойчивого в промежуточной степени, к Bemisia и к трипсу, согласно изобретению и как оно описано выше;

b) обеспечение возможности упомянутому растению дать плод; и

c) сбор плода с упомянутого растения.

В другом аспекте, изобретение относится к способу получения семени перца, включающему:

a) выращивание культивируемого растения Capsicum annuum, устойчивого, в частности устойчивого в промежуточной степени, к Bemisia, согласно изобретению и как оно описано выше;

b) сбор плода с упомянутого растения; и

с) извлечение семени из упомянутого плода.

В другом аспекте, изобретение относится к способу получения семени перца, включающему:

a) выращивание культивируемого растения Capsicum annuum, устойчивого, в частности устойчивого в промежуточной степени, к Bemisia и к трипсу, согласно изобретению и как оно описано выше;

b) сбор плода с упомянутого растения; и

c) извлечение семени из упомянутого плода.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia, где упомянутое растение включает аллель, ассоциированный с устойчивостью к Bemisia, в локусах количественного признака («QTL»), способствующего устойчивости к Bemisia, расположенных на хромосоме 3, в частности в QTL, происходящем из Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или из его потомства, или предка, содержащего упомянутый QTL, включающему стадии:

a) обеспечение реципиентного растения перца, восприимчивого к Bemisia, или растения, которое не содержит QTL аллель, придающий устойчивость к поражению Bemisia;

b) обеспечение донорного растения перца, обнаруживающего устойчивость к поражению Bemisia благодаря наличию QTL аллеля устойчивости на хромосоме 3;

c) скрещивание реципиентного и донорного растения для получения растений-потомков, сегрегированных по наличию благоприятного QTL аллеля;

d) скрининг генома растений-потомков на рекомбинации в области QTL на хромосоме 3.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia, где упомянутое растение включает аллель, ассоциированный с устойчивостью к Bemisia, в локусах количественного признака («QTL»), способствующего устойчивости к трипсу, расположенных на хромосоме 5, в частности в QTL, происходящем из Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или из его потомства, или предка, содержащего упомянутый QTL, включающему стадии:

a) обеспечение реципиентного растения перца, восприимчивого к Bemisia, или растения, которое не содержит QTL аллель, придающий устойчивость к поражению Bemisia;

b) обеспечение донорного растения перца, обнаруживающего устойчивость к поражению Bemisia благодаря наличию QTL аллеля устойчивости на хромосоме 3 и/или хромосоме 5;

c) скрещивание реципиентного и донорного растения для получения растений-потомков, сегрегированных по наличию благоприятного QTL аллеля;

d) скрининг генома растений-потомков на рекомбинации в области QTL на хромосоме 3 и/или хромосоме 5.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к трипсу, где упомянутое растение включает аллель, ассоциированный с устойчивостью к трипсу, в локусах количественного признака («QTL»), способствующего устойчивости к трипсу, расположенных на хромосоме 5, в частности в QTL, происходящем из Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или из его потомства, или предка, содержащего упомянутый QTL, включающему стадии:

a) обеспечение реципиентного растения перца, восприимчивого к трипсу, или растения, которое не содержит QTL аллель, придающий устойчивость к поражению трипсом;

b) обеспечение донорного растения перца, обнаруживающего устойчивость к поражению трипсом благодаря наличию QTL аллеля устойчивости на хромосоме 5;

c) скрещивание реципиентного и донорного растения для получения растений-потомков, сегрегированных по наличию благоприятного QTL аллеля;

d) скрининг генома растений-потомков на рекомбинации в области QTL на хромосоме 5.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia и трипсу, где упомянутое растение включает аллель, связанный с устойчивостью к Bemisia, в локусах количественного признака («QTL»), способствующего устойчивости к Bemisia, расположенных на хромосоме 3, и аллель, ассоциированный с устойчивостью к трипсу и/или Bemisia, в локусах количественного признака («QTL»), способствующего устойчивости к трипсу и/или Bemisia, расположенных на хромосоме 5, в частности в QTL, расположенных на хромосоме 3 и 5 соответственно, происходящих из Capsicum annuum линии 061М4387, образец семени которого депонирован под номером доступа NCIMB 41428, или из его потомства, или предка, содержащего упомянутый QTL, включающему стадии:

a) обеспечение реципиентного растения перца, восприимчивого к Bemisia, или растения, которое не содержит QTL аллель, придающий устойчивость к поражению Bemisia и/или трипсом;

b) обеспечение донорного растения перца, обнаруживающего устойчивость к поражению Bemisia и/или трипсом благодаря наличию QTL аллеля устойчивости на хромосоме 3 и/или 5 соответственно;

c) скрещивание реципиентного и донорного растения для получения растений-потомков, сегрегированных по наличию благоприятного QTL аллеля;

d) скрининг генома растений-потомков на рекомбинации в области QTL на хромосоме 3 и/или 5.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia и/или трипсу согласно изобретению и как описано выше, где упомянутое растение-потомок является растением сегрегирующей популяции, полученной самоопылением растения F1, получаемого от упомянутого скрещивания на стадии с), или скрещиванием растения F1, получаемого из упомянутого скрещивания в другим растением перца.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia и/или трипсу согласно изобретению и как описано выше, где сегрегирующая популяция, полученная на стадии с), может быть подвергнута стандартному анализу устойчивости, такому, например, как анализ устойчивости, который описан в Примере 2А и 2В соответственно.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia и/или трипсу согласно изобретению и как описано выше, где скрининг растений-потомков на стадии d) является скринингом, основанным на маркерах, который может быть выполнен постановкой анализа устойчивости, такого, например, как анализ устойчивости, который описан в Примере 2А и 2В соответственно.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia и/или трипсу согласно изобретению и как описано выше, где скрининг генома осуществляют, используя молекулярные маркеры, генетически сцепленные с хромосомой 3 и/или 5 соответственно.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia согласно изобретению и как описано выше, где скрининг генома осуществляют, используя молекулярные маркеры, генетически сцепленные по меньшей мере с одним маркером, охарактеризованным с помощью продукта ПЦР-амплификации ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к трипсу согласно изобретению и как описано выше, где скрининг генома осуществляют, используя молекулярные маркеры, генетически сцепленные по меньшей мере с одним маркером, охарактеризованным с помощью продукта ПЦР амплификации ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia согласно изобретению и как описано выше, где идентифицируют и отбирают растения-потомки, которые включают редуцированный геномный сегмент в QTL, все еще придающий устойчивость к Bemisia, где сцеление по меньшей мере с одним маркерным аллелем по меньшей мере в одном маркерном локусе, связанном с QTL в донорном растении, где упомянутый маркерный аллель характеризуется продуктом ПЦР амплификации ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12, разрушено.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia согласно изобретению и как описано выше, где идентифицируют и отбирают растения-потомки, которые включают редуцированный геномный сегмент в QTL, все еще придающий устойчивость к Bemisia, где сцепление со всеми маркерными аллелями, характеризуемыми продуктом ПЦР амплификации ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы пар 1-6 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 1-12, разрушено.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к трипсу согласно изобретению и как описано выше, где идентифицируют и отбирают растения-потомки, которые включают редуцированный геномный сегмент в QTL, все еще придающий устойчивость к трипсу, где сцепление по меньшей мере с одним маркерным аллелем по меньшей мере в одном маркерном локусе, связанном с QTL в донорном растении, где упомянутый маркерный аллель характеризуется продуктом ПЦР амплификации ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26, разрушено.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к трипсу согласно изобретению и как описано выше, где идентифицируют и отбирают растения-потомки, которые включают редуцированный геномный сегмент в QTL, все еще придающий устойчивость к трипсу, где сцепление со всеми маркерными аллелями, характеризуемыми продуктом ПЦР амплификации ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы пар 7-13 праймеров, представленных прямым и обратным праймерами с последовательностями SEQ ID NOs: 13-26, разрушено.

В другом воплощении, изобретение относится к способу получения растения перца, которое обнаруживает устойчивость к Bemisia и/или трипсу согласно изобретению и как описано выше, где растения, включающие геномный сегмент, в частности редуцированный геномный сегмент в QTL, все еще придающий устойчивость к Bemisia и/или трипсу, идентифицируют с помощью основанного на маркерах скрининга или постановки анализа устойчивости, или комбинацией обоих, в частности с помощью основанного на маркерах скрининга, где используют маркеры, расположенные в области QTL и генетически связанные по меньшей мере с одним маркерным локусом, при условии, что упомянутые маркеры сегрегируют в одной и той же популяции.

В другом воплощении, изобретение относится к способу идентификации локуса количественного признака («QTL»), который способствует устойчивости к Bemisia, включающему использование в ПЦР реакции ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6.

В другом воплощении, изобретение относится к способу идентификации локуса количественного признака («QTL»), который способствует устойчивости к Bemisia, включающему использование в ПЦР-реакции ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13.

В другом воплощении, изобретение относится к способу идентификации локуса количественного признака («QTL»), который способствует устойчивости к Bemisia, включающему использование в ПЦР реакции

а) ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6; и

b) ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13.

В другом воплощении, изобретение относится к способу идентификации локуса количественного признака («QTL»), который способствует устойчивости к трипсу, включающему использование в ПЦР реакции ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13.

В другом воплощении, изобретение относится к QTL, идентифицированному способом согласно изобретению и как описано выше, где QTL способствует устойчивости к Bemisia и расположен на хромосоме 3.

В другом воплощении, изобретение относится к QTL, идентифицированному способом согласно изобретению и как описано выше, где QTL способствует устойчивости к Bemisia и расположен на хромосоме 5.

В другом воплощении, изобретение относится к QTL, идентифицированному способом согласно изобретению и как описано выше, где QTL способствует устойчивости к трипсу и расположен на хромосоме 5.

В другом воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, содержащее геном, включающий по меньшей мере один QTL, который способствует устойчивости к Bemisia, причем QTL расположен на хромосоме 3, где упомянутый по меньшей мере один QTL может быть идентифицирован с помощью молекулярного маркера, который находится в неравновесном сцеплении и/или сцеплен с и/или расположен в QTL области, а также маркер, который представляет действительные причинные мутации, лежащие в основе QTL, и поэтому обнаруживает статистическую корреляцию с фенотипическим признаком, при этом маркер может быть получен с использованием олигонуклеотидных праймеров, которые раскрыты в последовательностях SEQ ID NOs: 1-12.

В другом воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, содержащее геном, включающий по меньшей мере два QTL, которые способствуют устойчивости к Bemisia, причем QTL расположены на хромосомах 3 и 5, где упомянутые по меньшей мере два QTL могут быть идентифицированы с помощью молекулярных маркеров, которые находятся в неравновесном сцеплении и/или сцеплены с и/или расположены в QTL области, а также маркеры, которые представляют действительные причинные мутации, лежащие в основе QTL, и поэтому обнаруживает статистическую корреляцию с фенотипическим признаком, при этом маркеры могут быть получены с использованием олигонуклеотидных праймеров, которые раскрыты в последовательностях SEQ ID NOs: 1-12 и SEQ ID NOs: 13-26.

В другом воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, содержащее геном, включающий по меньшей мере один QTL, который способствует устойчивости к трипсу, причем QTL расположен на хромосоме 5, где упомянутый по меньшей мере один QTL может быть идентифицирован с помощью молекулярного маркера, который находится в неравновесном сцеплении и/или сцеплен с и/или расположен в QTL области, а также маркер, который представляет действительные причинные мутации, лежащие в основе QTL, и поэтому обнаруживает статистическую корреляцию с фенотипическим признаком, при этом маркер может быть получен с использованием олигонуклеотидных праймеров, которые раскрыты в последовательностях SEQ ID NOs: 13-26.

В другом воплощении, изобретение обеспечивает культивируемое растение Capsicum annuum, содержащее геном, включающий по меньшей мере два QTL, которые способствуют устойчивости к Bemisia и к трипсу, причем QTL расположены на хромосомах 3 и 5, где упомянутые по меньшей мере два QTL могут быть идентифицированы с помощью молекулярных маркеров, которые находятся в неравновесном сцеплении и/или сцеплены с и/или расположены в QTL области, а также маркеры, которые представляют действительные причинные мутации, лежащие в основе QTL, и поэтому обнаруживает статистическую корреляцию с фенотипическим признаком, при этом маркеры могут быть получены с использованием олигонуклеотидных праймеров, которые раскрыты в последовательностях SEQ ID NOs: 1-12 и SEQ ID NOs: 13-26, соответственно.

Определения

Технические термины и выражения, используемые в объеме данной заявки, как правило, приводятся в значении, обычно применяемом к ним в области селекции и культивирования растений, если далее не указано иначе.

Под «культивируемым растением Capsicum annuum» в объеме настоящего изобретения понимается растение, которое не находится более в природном состоянии, а создано благодаря человеческому уходу и для использования и/или потребления человеком.

Как используется в этом описании и прилагаемой формуле изобретения, форма слова в единственном числе подразумевает и слова во множественном числе, если из контекста ясно не вытекает иное. Поэтому, например, ссылка на «растение» подразумевает одно или более растений, а ссылка на «клетку» подразумевает смеси клеток, тканей и т.п.

Под «аллелем» в объеме изобретения понимаются альтернативные или вариантные формы различных генетических единиц, идентичных или связанных с разными формами гена или любого рода идентифицируемого генетического элемента, которые являются альтернативами в наследовании, поскольку они расположены в том же самом локусе в гомологичных хромосомах. Такие альтернативные или вариантные формы могут являться результатом единичных нуклеотидных полиморфизмов, инсерций, инверсий, транслокаций или делеций либо следствием генной регуляции, вызванной, например, химической или структурной модификацией, транскрипционной регуляции или посттрансляционной модификации/регуляции. В диплоидной клетке или организме два аллеля данного гена или генетического элемента обычно занимают соответственные локусы на паре гомологичных хромосом.

Аллель, связанный с количественным признаком, может включать альтернативные или вариантные формы различных генетических единиц, включая те, которые идентичны или связаны с единичным геном или многочисленными генами или их продуктами, или даже с прерыванием генов, или регулируются генетическим фактором, способствующим фенотипу, представленному упомянутым QTL.

Как он здесь используется, термин «маркерный аллель» относится к альтернативной или вариантной форме генетической единицы, как описано выше, когда она используется в качестве маркера расположения генетических локусов, содержащих аллели на хромосоме, которые способствуют вариабельности фенотипических признаков.

Как он здесь используется, термин «селекция», и его грамматические формы, относится к любому процессу, который создает потомственную особь. Селекция может быть половой или вегетативной, либо любой их комбинацией. Типичные неограничивающие примеры селекции включают скрещивания, самоопыление, создание производных двойных гаплоидов и их комбинации.

Как оно здесь используется, выражение «установившаяся селекционная популяция» относится к совокупности потенциальных селекционных партнеров, получаемых с помощью и/или использованием в качестве родителей в селекционной программе; например коммерческой селекционной программе. Члены установившейся селекционной популяции в типичном случае хорошо охарактеризованы генетически и/или фенотипически. Например, некоторые представляющие интерес фенотипические признаки могли бы быть оценены, напр., в различных условиях окружающей среды, во многих местностях и/или в различное время. Альтернативно или в дополнение к этому, могли бы быть идентифицированы один или более генетических локусов, связанных с экспрессией фенотипических признаков и один или более членов селекционной популяции могли бы быть генотипированы в отношении одного или более генетических локусов, а также в отношении одного или более генетических маркеров, которые связаны с одним или более генетическими локусами.

Как оно здесь используется, выражение «диплоидный индивид» относится к особи, которая имеет два набора хромосом, в типичном случае один из каждого из его двух родителей. Однако понятно, что в некоторых воплощениях диплоидный индивид может получить его «материнский» и «отцовский» наборы хромосом от того же самого единичного организма, когда растение самоопыляется, чтобы произвести следующее поколение растений.

«Гомозиготный» в объеме изобретения понимается как относящийся к похожим аллелям в одном или более соответствующих локусов на гомологичных хромосомах.

«Гетерозиготный» в объеме изобретения понимается как относящийся к непохожим аллелям в одном или более соответствующих локусов на гомологичных хромосомах.

«Обратное скрещивание» в объеме настоящего изобретения понимается как относящееся к процессу, в котором гибридное поколение повторно скрещивается с одним из родителей. В последующих обратных скрещиваниях могут быть использованы разные родительские формы, с которыми скрещивается гибрид.

«Локус» в объеме настоящего изобретения понимается как относящийся к области на хромосоме, которая включает ген или любой генетический элемент или фактор, вносящий вклад в признак.

«Маркерный локус», как используется здесь, относится к области на хромосоме, которая включает нуклеотидную или полинуклеотидную последовательность, которая представляет геном индивида и которая связана с представляющими интерес одним или более локусами, которая может включать ген или любой другой генетический элемент или фактор, вносящий вклад в признак. «Маркерный локус» относится также к области на хромосоме, которая включает полинуклеотидную последовательность, комплементарную геномной последовательности, такую как последовательность нуклеиновой кислоты, используемая в качестве зонда.

«Генетической сцепление» в объеме настоящей заявки понимается как относящееся к наследуемой ассоциации признаков, благодаря близкому расположению генов на той же самой хромосоме, измеряемое процентом рекомбинации между локусами (сантиморган, сМ).

Выражение «количественный признак», как оно используется здесь, относится к фенотипическому признаку, который может быть описан численно (т.е. квантифицирован или выражен в количественной форме). Количественный признак в типичном случае обнаруживает постепенную вариацию между индивидами популяции; то есть различия в числовом значении фенотипического признака небольшие и постепенные от одного индивида к другому. Часто частотное распределение количественного признака в популяции показывает колоколообразная кривая (т.е. показывает нормальное распределение между двумя крайними значениями). В данном случае, количественный признак обнаруживает постепенную вариацию между индивидами популяции в показателе устойчивости к насекомым рода Bemisia и/или другим Thysanoptera, при этом устойчивость подсчитывается с помощью стандартизованного Анализа Устойчивости к Насекомым, использующего шкалу от 1 до 9 для оценки тяжести поражения. В типичном случае, количественный признак является результатом генетического локуса, взаимодействующего с окружающей средой, или множества генетических локусов (QTL), взаимодействующих один с другим и/или в окружающей средой. Примеры количественных признаков включают высоту и урожай растений.

Для целей настоящего изобретения, термин «ко-сегрегация» относится к тому факту, что аллель, ответственный за признак, и аллель(-и), ответственный(-ые) за маркер(ы), имеют тенденцию передаваться совместно, поскольку они физически близко расположены на одной и той же самой хромосоме (частичная рекомбинация между ними вследствие их физической близости), что приводит к неслучайной ассоциации аллелей, как результату их близости на той же самой хромосоме. «Ко-сегрегация» относится также к наличию двух или более признаков в одном растении, для которого известно, что по меньшей мере один признак является генетическим, и который не может быть объяснен случайностью.

Термины «локус количественного признака» (QTL) и «ассоциация маркерного признака», как они используются здесь, относятся к ассоциации между генетическим маркером и областью хромосомы и/или гена, который влияет на фенотип представляющего интерес признака. В типичном случае, это определяется статистически, напр., основываясь на одном или более методах, опубликованных в литературе. QTL может быть областью хромосомы и/или генетическим локусом по меньшей мере с двумя аллелями, которые дифференцированно влияют на фенотипический признак (либо количественный признак, либо качественный признак).

Термин «генетическая архитектура в QTL» относится к геномной области, которая статистически коррелирует с представляющим интерес фенотипическим признаком и представляет лежащий в основе генетический базис представляющего интерес фенотипического признака.

Фразы «половое скрещивание» и «половое размножение», как они используются здесь, в контексте раскрываемого предмета изобретения относятся к слиянию гамет для продуцирования потомства (напр., оплодотворение, такое, чтобы продуцировать семена опылением на растении). «Половое скрещивание» или «кросс-оплодотворение» в некоторых воплощениях изобретения представляет собой оплодотворение одного индивида другим (напр., перекрестное опыление у растений). Термин «самоопыление» в некоторых воплощения относится к продуцированию семени посредством самооплодотворения или самоопыления; т.е. пыльца и яйцеклетка происходят от того же самого растения.

Выражение «генетический маркер», как оно используется здесь, относится к признаку генома индивида (напр., нуклеотидной или полинуклеотидной последовательности, которая присутствует в геноме индивида), который ассоциирован с одним или более представляющих интерес локусами. В некоторых воплощениях, генетический маркер является полиморфным в представляющей интерес популяции или локусе, занимаемым полиморфизмом, в зависимости от контекста. Генетические маркеры включают, например, единичные нуклеотидные полиморфизмы (SNPs), индели (т.е. инсерции/делеции), простые повторы последовательностей (SSRs), полиморфизмы длин рестрикционных фрагментов (RFLPs), случайно амплифицированные полиморфные ДНК (RAPDs), маркеры расщепленных амплифицированных полиморфных последовательностей (CAPS), маркеры Технологии Анализа Разнообразия (DArT) и полиморфизмы длин амплифицированных фрагментов (AFLPs), среди многих других примеров. Генетические маркеры могут быть использованы, например, для определения местоположения генетических локусов, содержащих аллели на хромосоме, которые вносят вклад в изменчивость фенотипических признаков. Выражение «генетический маркер» может также относиться к полинуклеотидной последовательности, комплементарной геномной последовательности, к такой как последовательность нуклеиновой кислоты, используемая в качестве зонда.

Генетический маркер физически может быть локализован в положении на хромосоме, которое находится внутри или снаружи генетического локуса, с которым он ассоциирован (т.е. в интрагенном или экстрагенном соответственно). Если сформулировать иначе, когда генетические маркеры используются в типичном случае, когда локализация на хромосоме гена или функциональной мутации, напр., в пределах регуляторного элемента снаружи гена, который соответствует представляющему интерес локусу не идентифицирован, и имеется ненулевая степень рекомбинации между генетическим маркером и представляющим интерес локусом, раскрываемый здесь предмет изобретения может также использовать генетические маркеры, которые физически расположены в пределах границ генетического локуса (напр., внутри геномной последовательности, которая соответствует гену как таковому, без ограничения полиморфизмом в пределах интрона или экзона гена). В некоторых воплощениях раскрываемого здесь предмета изобретения, один или более генетических маркеров включают от одного до десяти маркеров, а в некоторых воплощениях, один или более генетических маркеров включают более десяти генетических маркеров.

Термин «генотип», как он здесь используется, относится к генетической конституции клетки или организма. «Генотип индивида в отношении совокупности генетических маркеров» включает специфические аллели для одного или более маркерных локусов, присутствующих в гаплотипе индивида. Как известно в данной области техники, генотип может относиться к единственному локусу или ко множеству локусов, родственных или неродственных локусов и/или сцепленных или несцепленных. В некоторых воплощениях, генотип индивида относится к одному или более генам, которые связаны тем, что один или более генов вовлечены в экспрессию представляющего интерес фенотипа (напр., количественного признака, как он определен выше). Таким образом, в некоторых воплощениях генотип включает совокупность одного или более аллелей, присутствующих у индивида в одном или более генетических локусах количественного признака. В некоторых воплощениях, генотип экспрессируется в показателях гаплотипа (определяется ниже).

Термин «зародышевая плазма», как он используется здесь, относится ко всей общности генотипов популяции или другой группы индивидов (напр., к виду). Термин «зародышевая плазма» может также относиться к растительному материалу, например группе растений, которые выступают как репозиторий для разных аллелей. Выражение «адаптированная зародышевая плазма» относится к растительному материалу доказанного генетического превосходства; напр., для данного окружения или географической территории, в то время как фразы «неадаптированная зародышевая плазма», «сырая зародышевая плазма» и «экзотическая зародышевая плазма» относятся к растительному материалу неизвестного или непроверенного генетического значения; напр., для данного окружения или географической территории; как таковое выражение «неадаптированная зародышевая плазма» относится в некоторых воплощениях к растительному материалу, который не является частью установившейся селекционной популяции и который не имеет известного отношения к члену установившейся селекционной популяции.

Термины «гибрид», «гибридное растение» и «гибридное потомство», как они используются здесь, относятся к индивидам, полученным от генетически различных растений (напр., генетически гетерозиготные или в значительной мере гетерозиготные индивиды).

Выражение «гибрид единственного скрещивания F1», как оно используется здесь, относится к F1-гибриду, полученному от скрещивания двух инбредных линий.

Выражение «инбредная линия», как оно используется здесь, относится к генетически гомозиготной или почти гомозиготной популяции. Инбредная линия, например, может происходить, проходя несколько циклов селекции «брат/сестра» или самоопыления, или при получении дигаплоидов. В некоторых воплощениях, инбредные линии выводят ради одного или более представляющих интерес фенотипических признаков. «Инбред», «инбредный индивид» или «инбредное потомство» - это индивидуальные образцы от инбредной линии.

Термин «дигаплоидная линия», как он здесь используется, относится к стабильным инбредным линиям, произведенным из культуры пыльников. Некоторые пыльцевые зерна (гаплоиды), культивируемые на специфической среде и при специфических условиях могут производить ростки, содержащие n хромосом. Эти ростки являются поэтому «двойными» и содержат 2n хромосом. Потомство этих ростков называют «дигаплоидами», и оно является по существу не сегрегированным более (стабильным).

Термин «сцепление», как он здесь используется, и его грамматические формы, относится к тенденции аллелей в разных локусах на той же самой хромосоме сегрегировать совместно более часто, чем ожидалось бы в случае их независимой передачи; в некоторых воплощениях, как следствие их физической близости.

Термин «локус», как он здесь используется, относится к локализации на хромосоме (напр., в гене, генетическом маркере или т.п.).

Выражение «нуклеиновая кислота», как оно здесь используется, относится к любой физической цепочке мономерных единиц, которые могли бы соответствовать цепочке нуклеотидов, включая полимер нуклеотидов (напр., типичный ДНК-, кДНК- или РНК-полимер), модифицированные олигонуклеотиды (напр., олигонуклеотиды, включающие основания, которые не типичны для биологической ДНК или РНК, такие как 2'-O-метилированные олигонуклеотиды), и т.п. В некоторых воплощениях, нуклеиновая кислота может быть одноцепочечной, двуцепочечной, многоцепочечной или их комбинацией. Если не указано иначе, последовательность конкретной нуклеиновой кислоты согласно раскрываемому здесь предмету изобретения, при необходимости, включает или кодирует комплементарные последовательности помимо любой явным образом указанной последовательности.

Выражение «фенотипический признак», как оно здесь используется, относится к внешнему виду или другой характеристике индивида, которая может быть обнаружена, происходящей от взаимодействия его генома, протеома и/или метаболома с окружающей средой.

Выражение «устойчивость», как оно здесь используется, относится к способности растения ограничивать рост и развитие специфических вредителей или патогенов и/или вред, который они причиняют, если сравнивать с восприимчивыми растениями при сходных условиях окружающей среды и вредителях или давлении патогенов. Устойчивые растения могут обнаруживать некоторые симптомы заболевания или вреда при тяжелом давлении вредителя или патогена.

Главным образом, различают два уровня устойчивости. «Высокая или стандартная устойчивость» относится к растениям, которые сильно ограничивают рост и развитие специфического вредителя, или патогенна при нормальном давлении вредителя, или патогенна по сравнению с восприимчивыми аналогами. Эти растения, могут, однако, обнаруживать некоторые симптомы или повреждения при тяжелом давлении вредителя или патогена.

«Умеренная/в промежуточной степени устойчивость» относится к растениям, которые отпугивают насекомых и/или ограничивают рост и развитие специфического вредителя или патогена, или показывают уменьшенное повреждение по сравнению с восприимчивыми аналогами, но могут обнаруживать больший диапазон симптомов или повреждения по сравнению с высоко/стандартно устойчивыми растениями. Умеренно/в промежуточной степени устойчивые растения все же показывают значительно менее сильные симптомы или повреждение, чем восприимчивые растения, если их выращивают при сходных условиях окружающей среды и/или давлении вредителей или патогенов.

Выражение «восприимчивость», как оно используется здесь, относится к неспособности растения адекватно ограничивать рост и развитие специфического вредителя или патогена.

Выражение «устойчивость к Bemisia», или «устойчивость к поражению Bemisia», или «устойчивое к Bemisia растение» относится к способности растений сопротивляться атаке, поражению или заселению насекомым. Уровень устойчивости, обнаруживаемой определенным растением, может подсчитываться, например, посредством стандартизованного Анализа Устойчивости к Насекомым, описанного ниже в Примере 2А, использующего шкалу от 1 до 9 для оценки тяжести поражения.

Растения, оцениваемые баллом 1 в упомянутом Анализе Устойчивости к Насекомым, полностью покрыты куколками и сильно заплесневелы, часто отстают в росте, в то время как растения, оцениваемые баллом 9, совершенно свободны от куколок и, таким образом, являются полностью устойчивыми. Стандартный «восприимчивый сорт» (напр., Vergasa F1 или Bikingo F1), как это понимается для целей настоящего изобретения, относится к растению, чьи баллы в Анализе Устойчивости к Насекомым, описанном в Примере 2А, находятся между 3 и 4, когда растения показывают много куколок (100-400/лист), которые плотно нагромождены на листе и обычно сопровождаются черной плесенью.

«Устойчивое к Bemisia растение», как это понимается для целей настоящего изобретения, относится к растению, чей балл в Анализе Устойчивости к Насекомым, описанном ниже в Примере 2А, находится в диапазоне между 6 и 9, включая 6 и 9.

Умеренная или в промежуточной степени устойчивость к поражению Bemisia начинается с балла 6, когда растение показывает умеренно относительно низкое количество куколок (20-50/лист), которые более равномерно распределены по листьям. При балле 7 присутствует только некоторое количество куколок (5-20/лист), которые неравномерно разбросаны по листу. Растения, имеющие балл 8, показывают лишь очень небольшое количество (1-5/лист) куколок, и их влияние на рост или развитие плода незаметно.

Соответственно, для целей настоящего изобретения, под растением, имеющим «умеренную или в промежуточной степени устойчивость» к поражению Bemisia, понимается растение, которое имеет балл в диапазоне между 6 и 8 по шкале, изменяющейся от 1 до 9, определенный в стандартизованном Анализе Устойчивости к Насекомым, описанном ниже в Примере 2А. Понимается, что растение имеет «высокую устойчивость» к Bemisia, если его балл находится в интервале между 8 и 9, включая 9.

Выражение «устойчивость к трипсу», или «устойчивость к поражению трипсом», или «устойчивое к трипсу растение», как оно здесь используется, относится к способности растений сопротивляться атаке, поражению или заселению насекомым. Уровень устойчивости, обнаруживаемой определенным растением, может подсчитываться, например, посредством стандартизованного Анализа Устойчивости к Насекомым, описанного ниже в Примере 2В, использующего шкалу от 1 до 9 для оценки тяжести поражения, исходя из базиса наблюдаемого повреждения поеданием (посеребрение).

Растения, оцениваемые баллом 1 в упомянутом Анализе Устойчивости к Насекомым, показывают очень сильное посеребрение на большой части поврежденного листа (>40% посеребрения), в то время как растения, оцениваемые баллом 9, не показывают никакого серебристого повреждения (0% посеребрения) и, таким образом, являются полностью устойчивыми. Стандартный «восприимчивый сорт» (напр., Roxy F1 и/или Snooker F1), как это понимается для целей настоящего изобретения, относится к растению, чьи баллы в Анализе Устойчивости к Насекомым, описанном в Примере 2В, находятся между 3(11%-20% посеребрения) и 4 (6%-10% посеребрения), когда растения показывают много больших серебристых пятен, распределенных по всему листу.

«Устойчивое к трипсу растение», как это понимается для целей настоящего изобретения, относится к растению, чей балл в Анализе Устойчивости к Насекомым, описанном ниже в Примере 2В, находится в диапазоне между 5 и 9, включая 9.

Умеренная или в промежуточной степени устойчивость к поражению трипсом начинается с балла 5, когда растение показывает умеренное количество пятен, довольно равномерно распределенных по листьям (3%-5% посеребрения). При балле 7 растения показывают только небольшие пятна, особенно близко к срединной жилке или краю листа (0,1%-1% посеребрения). Растения с баллом 8 показывают лишь крошечные пятна, и их влияние на рост или развитие плода незаметно (<0,1% посеребрения).

Соответственно, для целей настоящего изобретения, под растением, имеющим «умеренную или в промежуточной степени устойчивость» к поражению трипсу, понимается растение, которое имеет балл в диапазоне между 5 и 8, в частности между 6 и 8, по шкале, изменяющейся от 1 до 9, определенный в стандартизованном Анализе Устойчивости к Насекомым, описанном ниже в Примере 2В. Понимается, что растение имеет «высокую устойчивость» к трипсу, если его балл находится в интервале между 8 и 9, включая 9.

Подразумевается, что термины «хромосома 3» и «хромосома 5» включают, и, таким образом, используются здесь синонимически с терминами «группа сцепления 3 и 5» и/или «хромосомный эквивалент группы сцепления 3 и 5» соответственно.

Термин «множество», как он здесь используется, относится к более чем одному. Таким образом, «множество индивидов» относится по меньшей мере к двум индивидам. В некоторых воплощениях, термин «множество» относится к более чем половине целого. Например, в некоторых воплощениях, «множество в популяции» относится более чем к половине членов этой популяции.

Термин «потомство», как он используется здесь, относится к потомку (потомкам) конкретного скрещивания. В типичном случае, потомство происходит от скрещивания двух индивидов, хотя некоторые виды (в частности, некоторые растения и животные-гермафродиты) могут самоопыляться (т.е. то же самое растение выступает в качестве донора и мужской, и женской гамет). Потомком (потомками) могут быть, например, F1, F2 или любое последующее поколение.

Выражение «количественный признак», как оно используется здесь, относится к фенотипическому признаку, который контролируется одним или несколькими генами, которые обнаруживают главные фенотипические следствия. Вследствие этого, количественные признаки, в типичных случаях, просто наследуются. У растений примеры включают, но не ограничиваются ими, цвет цветка, цвет плода и устойчивость к нескольким известным заболеваниям, таким, например, как устойчивость к бактериальной пятнистости.

Как понимается в объеме настоящего изобретения, «основанная на маркерах селекция» относится, напр., к использованию генетических маркеров для обнаружения одной или более нуклеиновых кислот из растения, когда нуклеиновая кислота ассоциирована с желательным признаком, для идентификации растений, которые несут гены, ответственные за желательные (или нежелательные) признаки, чтобы эти растения могли быть использованы (или отбракованы) в программе избирательной селекции.

Как понимается в объеме настоящего изобретения, «микросателлитные или SSRs» (простые повторы последовательностей) относятся к типу генетического маркера, который состоит из многочисленных повторов коротких последовательностей ДНК-оснований, которые находятся в локусах по всему растительному геному и имеют вероятность быть высокополиморфными.

Как понимается в объеме настоящего изобретения, «ПЦР (полимеразная цепная реакция)» относится к способу получения относительно больших количеств специфических областей ДНК или подсистемы(-) генома, дающему возможность проводить различные анализы, которые основаны на этих областях.

Как понимается в объеме настоящего изобретения, «ПЦР-праймер» относится к относительно коротким фрагментам одноцепочечной ДНК, используемой в ПЦР-амплификации специфических областей ДНК.

Как понимается в объеме настоящего изобретения, «фенотип» относится к отличительной(-ым) характеристике(-ам) генетически контролируемого признака.

Как понимается в объеме настоящего изобретения, «полиморфизм» относится к присутствию в популяции двух или более разных форм гена, генетического маркера, или унаследованного признака, или генного продукта, получаемого, например, посредством альтернативного сплайсинга, ДНК-метилирования и т.д.

Как понимается в объеме настоящего изобретения, «избирательная селекция» относится к программе селекции, которая использует растения, которые обладают или обнаруживают желательный признак, в качестве родителей.

Как понимается в объеме настоящего изобретения, «тестерное» растение относится к растению рода Capsicum, используемому для того, чтобы генетически охарактеризовать признак у растения, которое тестируется.

В типичном случае, тестируемое растение скрещивают с «тестерным» растением, и подсчитывают сегрегационное отношение признака в потомстве кросса.

Как здесь используется, «зонд» относится к группе атомов или молекул, которая способна распознавать и связываться со специфической мишеневой молекулой или клеточной структурой и, таким образом, обнаруживать мишеневую молекулу или структуру. В частности, «зонд» относится к меченым ДНК- или РНК-последовательностям, которые можно использовать для обнаружения присутствия и квантификации комплементарной последовательности посредством молекулярной гибридизации.

Термин «гибридизовать(ся)», как он здесь используется, относится к традиционным условиям гибридизации, предпочтительно к гибридизационным условиям, при которых используется раствор 5xSSPE, 1% SDS, IxDenhardts, и/или гибридизационные температуры находятся между 35°С и 70°С, предпочтительно 65°С. После гибридизации предпочтительно выполняется промывка сначала с помощью 2xSSC, 1% SDS и далее с помощью 0,2xSSC при температуре между 35°С и 70°С, предпочтительно между 45°С и 65°С, но особенно при 59°С (относительно определения раствора SSPE, SDS и Denhardts см. Sambrook и др1. в цитируемом месте). Гибридизационные условия высокой строгости, например описанные у Sambrook и др., см. выше, особенно предпочтительны. Особенно предпочтительные строгие гибридизационные условия, например, представлены, когда гибридизация и промывка происходят при 65°С, как указано выше. Нестрогие гибридизационные условия, например, с гибридизацией и промывкой, выполняемыми при 45°С, являются менее предпочтительными, а при 35°С - еще менее предпочтительными.

«Гомология последовательностей» и «идентичность последовательностей» используются здесь взаимозаменяемо. Термины «идентичная» или процент «идентичности» в контексте двух или более нуклеиново-кислотных или протеиновых последовательностей относятся к двум или более последовательностям или подпоследовательностям, которые являются такими же самыми или имеют специфический процентный состав аминокислотных остатков или нуклеотидов, который является таким же самым, если они сравнены и выровнены для максимального соответствия, когда процентный состав измерен с использованием одного из алгоритмов последовательного сравнения или с помощью визуального обследования. Если две последовательности, которые сравниваются одна с другой, различаются длиной, идентичность последовательностей предпочтительно относится к проценту нуклеотидных остатков более короткой последовательности, которые идентичны с нуклеотидными остатками более длинной последовательности. Идентичность последовательностей может быть определена традиционным методом с использованием компьютерных программ, таких как программа Bestfit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit использует алгоритм локальной гомологии Smith и Waterman, Advances in Applied Mathematics 2 (1981), 482-489, чтобы найти сегмент, имеющий самую высокую идентичность между двумя последовательностями. При использовании Bestfit или другой программы выравнивания последовательностей для определения того, имеет ли конкретная последовательность, например, 95% идентичности с последовательностью, на которую имеется ссылка в настоящем изобретении, параметры предпочтительно регулируют таким образом, чтобы процент идентичности вычислялся по всей длине ссылочной последовательности и чтобы допускались гомологичные пропуски до 5% от общего числа нуклеотидов в ссылочной последовательности. Когда используется Bestfit, так называемые опциональные параметры предпочтительно оставлять в их заранее заданных («по умолчанию») значениях. Отклонение, появляющееся при сравнении между данной последовательностью и вышеупомянутыми последовательностями согласно изобретению, может быть вызвано, например, добавлением, делецией, замещением, инсерцией или рекомбинацией. Такое сравнение последовательностей предпочтительно может также выполняться с помощью программы «версия 2.0u66, сентябрь 1998, созданная William R.Pearson и Вирджинским университетом; см. также W.R.Pearson (1990), Methods in Enzimology 183, 63-98, приложенные примеры и http://workbench.sdsc.edu/). С этой целью могут быть использованы установки параметров «по умолчанию».

Другим указанием на то, что две нуклеотидные последовательности существенно идентичны, является то, что две молекулы гибридизуются одна с другой при строгих условиях. Выражение «гибридизующаяся специфично с» относится к связыванию, образованию дуплексов или гибридизации молекулы только со специфической нуклеотидной последовательностью при строгих условиях, если эта последовательность присутствует в сложной смеси (напр., в общей клеточной) ДНК или РНК. «Связываются (связывается) существенно» относится к комплементарной гибридизации между нуклеиновой кислотой зонда и мишеневой нуклеиновой кислотой и охватывает небольшие несоответствия, которые могут быть согласованы посредством уменьшения строгости гибридизационных сред, чтобы достичь желаемого обнаружения мишеневой последовательности нуклеиновой кислоты.

«Строгие условия гибридизации» и «строгие условия гибридизационной промывки» в контексте экспериментов по гибридизации нуклеиновых кислот, таких как Southern- и Northern-гибридизации, зависят от последовательностей и различаются при разных условиях параметров окружающей среды. Более длинные последовательности специфично гибридизуются при более высоких температурах. Обширное руководство по гибридизации нуклеиновых кислот имеется у Tijssen (1993) Laboratiry Techniques in Biochemistry and Molecular Biology-Hybridisation with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York. Обычно, очень строгие условия гибридизации и промывки выбирают равными примерно на 5°С ниже, чем температура точки плавления (Т. пл. посл.) для специфической последовательности при определенных ионной силе и рН. В типичном случае, при «строгих условиях» зонд гибридизуется с его мишеневой последовательностью, но ни с какой другой последовательностью.

Т. пл. посл. - это температура (при определенной ионной силе и рН), при которой 50% мишеневой последовательности гибридизуется с точно подобранным зондом. Очень строгие условия выбираются равными Т. пл.посл. для конкретного зона. Примером строгих гибридизационных условий для гибридизации комплементарных нуклеиновых кислот, которые имеют более 100 комплементарных на фильтре в Southren- или Nothern-блоте, является формамид с 1 мг гепарина при 42°С, при проведении гибридизации в течение ночи. Примером очень строгих условий промывки является 0,1 5М NaCl при 72°С в течение примерно 15 минут. Пример строгих условий промывки - промывка 0,2-кратным SSC при 65°С в течение 15 минут (Sambrook, см. ниже, при описании SSC буфера). Часто промывке высокой строгости предшествует промывка низкой строгости для того, чтобы удалить фоновый сигнал зонда. Примером промывки средней строгости для дуплекса из, напр., более чем 100 нуклеотидов является 1-кратный SSC при 45°С в течение 15 минут. Пример промывки низкой строгости для дуплекса из, напр., более чем 100 нуклеотидов - 4-6-кратный SSC при 40°С в течение 15 минут. Для коротких зондов (напр., от около 10 до 50 нуклеотидов) строгие условия в типичном случае включают солевые концентрации менее чем примерно 1,0М Na иона, обычно от около 0,01 до 1,0М концентрации Na иона (или других солей) при рН 7,0-8,3, а температура обычно составляет по меньшей мере 30°С. Строгие условия могут также достигаться добавлением дестабилизирующих агентов, таких как формамид. В целом, 2-кратное (или выше) отношение сигнала к шуму, чем наблюдаемое для неродственного зонда в конкретном гибридизационном анализе, указывает на обнаружение специфичной гибридизации. Нуклеиновые кислоты, которые не гибридизуются одна с другой при строгих условиях, все же являются существенно идентичными, если протеины, которые ими кодируются, существенно идентичны. Это случается, напр., когда копия нуклеиновой кислоты создается, используя максимальную вырожденность кодонов, допускаемую генетическим кодом.

«Растение» - это любое растение на любой стадии развития, в частности растение с семенем.

«Клетка растения» - это структуно-физиологическая единица растения, включающая протопласт и клеточную стенку. Клетка растения может быть в форме изолированной единичной клетки, или культивированной клетки, или в форме части более высокоорганизованной единицы, такой как, например, ткань растения, орган растения или целое растение.

«Культура клетки растения» означает культуры единиц растения, таких как, например, протопласты, клеточные культуры клетки, клетки растительных тканей, пыльца, пыльцевые трубки, семяпочки, зародышевые сумки, зиготы и зародыши на различных стадиях развития.

«Растительный материал» относится к листьям, стеблям, корням, цветкам или частям цветка, плодам, пыльце, яйцеклеткам, зиготам, семенам, отводкам, клеточным или тканевым культурам, или к любой другой части или продукту растения.

«Орган растения» - это различимая и визуально структурированная или дифференцированная часть растения, такая как корень, стебель, лист, цветочная почка или зародыш.

«Растительная ткань», как она здесь понимается, означает группу клеток растения, организованных в структурно-функциональную единицу. Охватывается любая ткань растения in planta или в культуре. Этот термин включает, но не ограничивается ими, целые растения, органы растения, семена растения, тканевую культуру и любые группы клеток растения, организованные в структурные и/или функциональные единицы. Использование этого термина в соединении или в его отсутствие с любым конкретным типом растительной ткани, из перечисленных выше или иначе охватываемых этим определением, не понимается как исключительная принадлежность к любому другому типу растительной ткани.

Настоящее изобретение относится к новым растениям перца, в частности к растениям Capsicum annuum, устойчивым, в частности устойчивым в промежуточной степени, к насекомым, предпочтительно к насекомым рода Bemisia и/или порядка Thysanoptera, более предпочтительно к Bemisia tabaci (белокрылке) и/или к трипсу, более предпочтительно к Frankliniela occidentalis, а также к семенам и плодам упомянутых растений. Настоящее изобретение относится также к способам получения и использования таких растений и их плодов.

Растения согласно изобретению могут быть получены скрещиванием двух или более родительских генотипов, по меньшей мере один из которых может иметь один или более аллелей, в частности один или более аллелей в соответствующих QTL, способствующих устойчивости к Bemisia и/или трипсу, при этом аллель(-и) отсутствует(-ют) в другом родительском генотипе или дополняет другой генотип, чтобы получить растение согласно изобретению и как описано выше. Если более чем один QTL способствует экспрессии признака устойчивости и два первоначальных родительских генотипа не обеспечивают полный набор аллелей, в селекцию популяции могут быть включены другие источники. Другой родительский генотип может обеспечивать вклад в желаемый признак, включая качество плода, требуемое для продажи, такой как, например, вес в пределах 180 грамм, глыбовидную форму, гладкую кожуру, ярко-красный цвет. Помимо качества плода, другими желаемыми агрономически важными характеристиками являются, такие как, например, хорошее строение растения, высокая продуктивность и базовая устойчивость к заболеваниям, таким как, но без ограничения ими, TMV (вирус табачной мозаики) и TSWV (вирус пятнистого увядания томата).

Эти родительские генотипы могут быть скрещены один с другим, чтобы получить потомственное семя. Родительские генотипы могут быть инбредными линиями, полученными самоопылением выбранных с полей гетерозиготных растений с неконтролируемым или перекрестным опылением и применением рекуррентных селекционных процедур. Лучшие растения самоопыляют и отбирают в последовательных поколениях. В последующих поколениях гетерозиготное состояние дает путь однородным линиям, как результат самоопыления и отбора. В следующих поколениях инбридинга растение становится более и более гомозиготным и единообразным внутри поколения растений. В типичном случае, для получения инбредных линий, которые единообразны в характеристиках растения и семени и которые будут оставаться единообразными при продолжающемся самооплодотворении, могут практиковаться пять-семь или более поколений (F1-F2; F3-F4; F4-F5) самоопыления и отбора по потомству.

Во время инбридинга многие нежелательные аллели в локусах гетерозигот могут быть замещены более благоприятными аллелями, а неблагоприятные или нежелательные аллели устранены из потомства. Кроме того, посредством селекции, опосредованной маркерами, число благоприятных аллелей может быть доведено в нем до максимума, а неблагоприятные аллели идентифицируют и последовательно замещают более благоприятными аллелями.

В одном аспекте, растение согласно изобретению может быть получено введением признака устойчивости к насекомым от растения-предка, в частности дикого растения-предка, в культивируемое растение перца, в частности культивируемое растение Capsicum annuum, более предпочтительно в растение Capsicum annuum, которое является гомозиготным по с-локусу (Blum и др l. (2002) Genome, 45: 702-705), или punl-аллелю (Stewart и др. (2005) The Plant Journal, 42: 675-688), или по обоим локусам.

В одном специфическом воплощении изобретения, дикий предок, от которого может быть получен признак устойчивости к Bemisia и/или трипсу, является диким Capsicum annuum с номером доступа CGN 16975, полученным от Instituut voor de Veredeling van Tuinbouwgewassen (сейчас Centre for Genetic Resources), Wageningen, Нидерланды. Признак устойчивости к насекомым согласно настоящему изобретению, который придает растению свойство экспрессировать этот признак, промежуточный уровень устойчивости к поражению насекомыми рода Bemisia и/или порядка Thysanoptera, более предпочтительно к Bemisia tabaci (белокрыдке) и/или трипсу, более предпочтительно к Franklmiellci occidentalis, альтернативно может быть получен от Capsicum annuum линии 061М4387, образец которого депонирован NCIMB Ltd под номером доступа NCIMB 41428, или от потомка или предка линии 061М4387, включающей признак устойчивости к Bemisia и/или трипсу.

Соответственно, в специфическом воплощении изобретения, родительский генотип, вносящий вклад в признак(-и) устойчивости, является инбредной линией, имеющей релевантные изобретению свойства депонированной линии 061М4387 Capsicum annuum, т.е. существенно такую же самую геномную архитектуру в QTL, связанную с устойчивостью к Bemisia и/или трипсу, образец семян которой депонирован 10 августа 2006 г. NCIMB под номером доступа NCIMB 41428.

В другом специфическом воплощении изобретения, родительский генотип, вносящий признак устойчивости, является гибридом, имеющим релевантные изобретению свойства депонированной линии 061М4387 Capsicum annuum, т.е. существенно такую же самую геномную архитектуру в QTL, связанную с устойчивостью к Bemisia и/или трипсу, образец семян которой депонирован 10 августа 2006 г. NCIMB под номером доступа NCIMB 41428.

Capsicum annuum линии 061М4387 получен от скрещивания дикого растения с номером доступа CGN 16975, полученного от Centre for Genetic Resources, Wageningen, Нидерланды, в качестве донора признака устойчивости с Capsicum annuum инбредной линии. Устойчивое к Bemisia и трипсу потомство от этого скрещивания было скрещено со следующими инбредными линиями разного генетического окружения до получения в итоге линии 061М4387.

Соответственно, Capsicum annuum линии 061М4387 или любой другой линии растения, содержащей признак устойчивости к Bemisia и/или трипсу Capsicum annuum линии 061М4387, может быть использован как исходный материал для введения упомянутого признака устойчивости в любое желаемое генетическое окружение, чтобы получить растение перца с высокой или в промежуточной степени устойчивостью, в частности устойчивое в промежуточной степени, к поражению насекомыми рода Bemisia и/или порядка Thysanoptera, более предпочтительно к Bemisia tabaci (белокрылке) и/или трипсу, более предпочтительно к Frankliniella occidentalis, которое дополнительно может содержать один или более желаемых признаков, таких как признаки качества плода, требуемые рынком, такие как, например, вес в пределах 180 грамм, глыбовидная форма, гладкая кожура, ярко-красный цвет. Помимо качества плода, другими желаемыми агрономически важными характеристиками являются, такие как, например, хорошее строение растения, высокая продуктивность и базовая устойчивость к заболеваниям, таким как, но без ограничения ими, TMV (вирус табачной мозаики) и TSWV (вирус пятнистого увядания томата).

Основываясь на описании настоящего изобретения, специалист, в распоряжении которого имеется Capsicum annuum линии 061М4387, образец которого депонирован NCIMB Ltd под номером доступа NCIMB 41428, или его потомок или предок, содержащий QTL на хромосоме 3, связанный с устойчивостью к Bemisia, и/или QTL на хромосоме 5, связанный с устойчивостью к трипсу и Bemisia соответственно, как описано выше, не будет иметь трудностей передать признак устойчивости к Bemisia и/или признак устойчивости к трипсу по настоящему изобретению в другие растения перца разных типов, используя селекционные методики, хорошо известные в данной области техники. Признак согласно настоящему изобретению может быть передан, например, растениям перца, дающим плоды различных типов или формы, таким как салатные перцы, сладкие перцы, жгучие перцы, большие прямоугольные перцы, конические перцы, включая продолговатые конические перцы или глыбообразные перцы, и различных цветов в зрелом состоянии, таких как зеленый, красный, желтый, оранжевый или кремовый.

Соответственно, в одном воплощении, растение согласно настоящему изобретению является растением С.annuum, способным сопротивляться поражению Bemisia и/или трипсом, при этом растение представляет собой салатный перец или сладкий перец, жгучий перец, большой прямоугольный перец, конический перец или продолговатый конический перец согласно настоящему изобретению. В другом воплощении, растение согласно настоящему изобретению способно производить зеленый, красный, желтый, оранжевый или кремовый плод перца. В следующем воплощении изобретения, растения перца выращиваются на (гибридное) семя или для коммерческого производства перца.

Соответственно, в другом воплощении, настоящее изобретение раскрывает способ передачи признака устойчивости к Bemisia и/или признака устойчивости к трипсу согласно настоящему изобретению растению перца, у которого отсутствует упомянутый признак, при этом способ включает а) получение растения, включающего упомянутый признак; b) скрещивание этого растения с растением, у которого отсутствует упомянутый признак; с) получение растения от скрещивания на стадии b); d) отбор растения, полученного на стадии с), которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению. В другом воплощении, способ дополнительно включает е) обратное скрещивание растения, полученного на стадии d), с растением перца, и f) отбор растения перца, которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению. В другом воплощении, способ дополнительно включает получение инбредного растения перца, которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению, и в одном воплощении, способ далее включает скрещивание упомянутого инбредного растения перца с другим растением перца для получения гибридного растения перца, которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению. В другом воплощении, растение перца отбирают определением балла устойчивости к поражению Bemisia и/или трипсом, как здесь описывается. В другом воплощении, растение со стадии а), включающее упомянутый признак, является Capsicum annuum линии 061М4387, образец которого депонирован NCIMB Ltd под номером доступа NCIMB 41428, или потомок или предок указанного растения.

В некоторых воплощениях изобретения, используют стандартизованный Анализ Устойчивости к Насекомым, такой как описан ниже в Примере 2, для определения уровня устойчивости растений-потомков, получаемых от одного или более скрещиваний, и отбор для дальнейшей селекции тех растений-потомков, которые являются устойчивыми в промежуточной степени к поражению Bemisia и/или трипсом.

В одном воплощении, настоящее изобретение раскрывает растение С.annuum, получаемое любым из приведенных выше способов, где растение способно сопротивляться поражению Bemisia и/или трипсом, как здесь описывается.

В еще одном воплощении, настоящее изобретение раскрывает способ получения растения, включающего признак устойчивости к Bemisia и/или трипсу согласно настоящему изобретению, у растения перца с отсутствующим упомянутым признаком, включающий а) получение растения, включающего упомянутый признак; b) скрещивание этого растения с растением, у которого отсутствует упомянутый признак; с) получение растения от скрещивания на стадии b); d) отбор растения, полученного на стадии с), которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению. В другом воплощении, способ дополнительно включает е) обратное скрещивание растения, полученного на стадии d), с растением перца, и f) отбор растения перца, которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению. В другом воплощении, способ дополнительно включает получение инбредного растения перца, которое способно к поражению Bemisia и/или трипсом согласно настоящему изобретению, и в одном воплощении, способ далее включает скрещивание упомянутого инбредного растения перца с другим растением перца для получения гибридного растения перца, которое способно сопротивляться поражению Bemisia и/или трипсом согласно настоящему изобретению. В другом воплощении, растение перца отбирают определением балла устойчивости к поражению Bemisia и/или трипсом, как здесь описывается. В другом воплощении, растение со стадии а), включающее упомянутый признак, является Capsicum annuum линии 061М4387, образец которого депонирован NCIMB Ltd под номером доступа NCIMB 41428, или потомок или предок указанного растения.

В одном воплощении, настоящее изобретение раскрывает растение С.annuum, получаемое любым из приведенных выше способов, где растение способно сопротивляться поражению Bemisia и/или трипсом, как здесь описывается.

Основываясь на раскрытии настоящего изобретения, специалист может создать программу поиска новых источников признака, в частности признака устойчивости и в частности устойчивости к насекомым рода Bemisia и/или порядка Thysanoptera.

В одном аспекте изобретения, растения, экспрессирующие признак устойчивости к насекомым и обнаруживающие устойчивость, в частности устойчивость промежуточного уровня, к поражению насекомыми рода Bemisia, могут быть идентифицированы и отобраны, используя стандартизованный тест устойчивости к Bemisia, дающий ранг устойчивости, который обычно используется и является признанным в области селекции перца.

В частности, растения получают и культивируют согласно стандартным процедурам и пересаживают в соответствии со специальным проектом.

Растения пересаживают в несколько рядов с фиксированным количеством растений на ряд. В каждом ряду одна сторона используется как распределительный ряд и засаживается восприимчивым входом или восприимчивой родительской линией. Другая часть ряда засаживается входами, которые будут тестироваться на устойчивость к насекомым. Тестовые входы полностью рандомизируют в каждый из нескольких блоков с 1 или более растениями/вход на блок.

Развитие Bemisia наблюдается в распределительном ряду еженедельно или каждые две недели с оценкой фиксированного количества растений распределительного ряда на эквидистантных позициях (например, растение 1, 38, 75, 112, 150) в каждом ряду. Заключительную оценку делают, когда среднее поражение растений распределительного ряда достигает степени устойчивости приблизительно 4, то есть когда куколки плотно располагаются на листе в количестве более 100/лист. Обычно эта стадия достигается во время, когда поспевают первые плоды (3-4 месяца после пересаживания).

Данные анализируют, вычисляя средние на тест вход и сравнивая с восприимчивым входом (напр., восприимчивым распределительным рядом или иначе). Множественное сравнение средних значений (напр., LSD) указывает, отличаются ли друг от друга тестовые входы и от восприимчивого контроля.

Для оценки строгости используют шкалу от 1 до 9 (Таблица 1). Исследуют нижнюю сторону листа и оценивают согласно шкале 1-9 среднее по 5 приблизительно наиболее поврежденным листьям. Все тестовые растения оцениваются этим методом.

В одном аспекте изобретения, растения, экспрессирующие признак устойчивости к насекомым и обнаруживающие устойчивость, в частности устойчивость промежуточного уровня, к поражению насекомыми порядка Thysanoptera, могут быть идентифицированы и отобраны, используя стандартизованный тест устойчивости к трипсу, дающий ранг устойчивости, который обычно используется и является признанным в области селекции перца.

В частности, растения получают и культивируют согласно стандартным процедурам и пересаживают в соответствии со специальным проектом.

Альтернативно, для идентификации этих индивидов может использоваться селекция, связанная с маркерами, где локусы, релевантные изобретению, в частности релевантные изобретению локусы QTL и/или фланкирующие маркерные локусы, или маркерные локусы, генетически связанные с ними, как описано выше, имеют благоприятные генотипы, в частности гомозиготные благоприятные генотипы.

В одном воплощении изобретения, устойчивость к поражению Bemisia и/или трипсом регистрируется фенотипической оценкой.

В другом воплощении, селекция основывается на молекулярных маркерах, которые связаны с представляющими интерес признаками.

В другом воплощении, селекция основывается на комбинации молекулярных маркеров и фенотипической оценке.

Основанная на маркерах селекция может легко использоваться на ранних фазах инбредного развития, часто в комбинации с методами скрининга, которые основаны большей частью на фенотипических характеристиках, которые могут быть определены визуально и связаны с ключевыми рабочими показателями, такими как, например, мощность растения, длина междоузлий, ветвистость, устойчивость к насекомым, такая как устойчивость к поражению Bemisia и/или трипсом, устойчивость к вирусам, таким как TMV (вирус мозаичности табака) и TSWV (вирус пятнистого увядания томата), и т.д., которые релевантны пригодности растения к использованию в коммерческом производстве гибридов. Селекция может также основываться на молекулярных маркерах, которые могут быть или необязательно быть связаны с представляющими интерес признаками.

В частности, основанная на маркерах селекция может применяться в комбинации с или с последующей фенотипической селекцией для идентификации тех индивидов, у которых все релевантные изобретению локусы, описанные выше, имеют гомозиготные благоприятные фенотипы.

Имеется несколько типов молекулярных маркеров, которые могут быть использованы в основанной на маркерах селекции, включая, но не ограничиваясь ими, полиморфизм длины рестрикционных фрагментов (RFLP), случайная амплификация полиморфных ДНК (RAPD), полиморфизм длины амплифицированных рестрикционных фрагментов (AFLP), единичные повторы последовательностей (SSR) и сингулярные нуклеотидные полиморфизмы SNPs.

RFLP включает использование ферментов рестрикции для разрезания хромосомной ДНК на короткие специфические рестрикционные сайты, при этом полиморфизмы происходят от дупликаций или делеций между сайтами или мутаций в рестрикционных сайтах.

RAPD использует полимеразную цепную реакцию (ПЦР) амплификации низкой строгости с единичными праймерами исследуемой последовательности для получения цепочечно-специфичных совокупностей неизвестных фрагментов ДНК. Способ требует только крошечных образцов ДНК и анализирует большое число полиморфных локусов.

AFLP требует расщепления клеточной ДНК рестрикционным(-и) ферментом(-ами) перед использованием ПЦР и избирательных нуклеотидов в праймерах для амплификации специфичных фрагментов. С помощью этого метода, используя методики электрофореза для визуализации полученных фрагментов, можно измерить до 100 полиморфных локусов на праймерную комбинацию, и только один маленький образец ДНК требуется для каждого теста.

SSR-анализ основывается на последовательностях микросателлитных (коротко-повторяющихся) ДНК, которые широко рассеяны по геному эукариот и которые избирательно амплифицируются с искомыми вариациями в простых повторах последовательностей. Для SSR-анализа требуются лишь крошечные образцы ДНК. SNPs использует анализы ПЦР-расширения, которые эффективно указывают точечные мутации. Эта процедура требует небольшого образца ДНК. В типичной программе основанной на маркерах селекции может быть использован один или два из вышеописанных методов.

В наиболее предпочтительном методе достижения амплификации нуклеотидных фрагментов, которые обеспечивают полиморфную область растительного генома, применяется полимеразная цепная реакция («ПЦР») (Mullis и др. Cold Spring Harbor Symp.Quant. Biol. 51:263 273 (1986)), использующая пары праймеров, включающих прямой праймер и обратный праймер, которые способны гибридизоваться с близкими последовательностями, которые определяют полиморфизм в его двухцепочечной форме.

Для амплификации фрагментов могут использоваться альтернативные способы, такие как «лигазная цепная реакция» ("LCR") (Barany, Proc. Natl. Acad. Sci. (U.S.A.) 88:189 193 (1991)), в которой используются две пары олигонуклеотидных зондов, чтобы экспоненциально амплифицировать специфическую мишень. Последовательности каждой пары олигонуклетидов выбираются так, чтобы позволить паре гибридизоваться с прилегающими последовательностями той же самой цепочки мишени. Такая гибридизация образует субстрат для зависимой от матрицы лигазы. В ПЦР получающиеся продукты, таким образом, служат в качестве матрицы в последующих циклах, и получается экспоненциальная амплификация желаемой последовательности.

LCR может быть выполнена с помощью олигонуклеотидов, имеющих проксимальные или дистальные последовательности той же самой цепочки полиморфного сайта. В одном воплощении, конструируют какой-либо олигонуклеотид, включающий действительный полиморфным сайт полиморфизма. В таком воплощении, условия реакции выбирают так, чтобы олигонуклеотиды могли лигироваться друг с другом, только если мишеневая молекула либо содержит, либо не содержит специфический нуклеотид, который комплементарен полиморфному сайту, имеющемуся на олигонуклеотиде. Альтернативно, олигонуклеотиды могут быть подобраны так, что они не включают полиморфный сайт (см., Segev, заявка РСТ WO 90/01069).

Другой метод, который может быть применен в «анализе олигонуклеотидного лигирования» ("OLA") (Landegren и др.. Science 241:1077 1080 (1988)). Протокол OLA использует два олиголигонуклеотида, которые конструируются так, чтобы они были способны гибридизоваться с ближайшими последовательностями одной цепочки мишени. OLA, подобно LCR, особенно пригоден для обнаружения точечных мутаций. В отличие от LCR, однако, OLA приводит скорее к «линеаризации», нежели к экспоненциальной амплификации мишеневой последовательности.

Еще один метод, который может альтернативно применяться, - это «Анализ Захватчика», в котором используется структурно-специфичная клапанная эндонуклеаза (FEN) для расщепления трехмерных комплексов, образованных гибридизацией аллельспецифичных олигонуклеотидов с мишеневой ДНК, содержащей сайт сингулярного нуклеотидного полиморфизма (SNP). Отжиг олигонуклеотида, комплементарного SNP-аллелю в мишеневой молекуле, запускает расщепление олигонуклеотида кливазой, термостабильной FEN. Расщепление можно обнаружить с помощью нескольких подходов. Наиболее обычно, продукт расщепления запускает вторичную реакцию расщепления на кассете для резонансного переноса энергии флуоресценции (FRET) для выдачи флуоресцентного сигнала. Альтернативно, расщепление может быть обнаружено с помощью зондов флуоресцентной поляризации (FP) или посредством масс-спектрометрии. Расширяющаяся реакция расщепления является высокоспецифичной, имеет низкую степень неудачи и может обнаружить зептомольные количества мешеневой ДНК. Хотя этот анализ традиционно используется для проверки одного SNP в одном образце на реакцию, проверяются новые, основанные на чипах и шариках подходы, чтобы повысить эффективность и точность анализа, адаптированного к мультиплексному и высокопроизводительному SNP генотипированию.

Nickerson et al. описывают анализ обнаружения нуклеиновых кислот, который сочетает качества ПЦР и OLA (Nickerson et al., Proc. Natl. Acad. Sci. (U.S.A.) 87:8923 8927 (1990)). В этом методе ПЦР используется для достижения экспоненциальной амплификации мишеневой ДНК, которая затем обнаруживается с помощью OLA.

Схемы, основанные на лигировании двух (или более) олигонуклеотидов в присутствии нуклеиновой кислоты, имеющей последовательность, происходящую из «ди-олигонуклеотида», где амплифицируется ди-олигонуклеотид, также известны (Wu et al., Genomics 4:560 569 (1989)) и могут быть легко адаптированы для целей настоящего изобретения.

В одном воплощении, молекулярным маркером является фрагмент ДНК, амплифицированный с помощью ПЦР, например SSR-маркер или RAPD-маркер. В другом воплощении, наличие или отсутствие амплифицированного фрагмента ДНК является указанием наличия или отсутствия самого признака или конкретного аллеля признака. В другом воплощении, различие в длине амплифицированного фрагмента ДНК является указанием наличия или отсутствия аллеля признака, что дает возможность различить разные аллели признака.

В конкретном воплощении изобретения, маркеры простых повторов последовательностей используют для идентификации релевантных изобретению аллелей в родительских растениях и/или их предках, а также в растениях-потомках, происходящих от скрещивания упомянутых родительских растений. Простые повторы последовательностей являются короткими, повторяющимися ДНК последовательностями, присутствуют в геномах всех эукариот и состоят из нескольких до свыше сотни повторов данного нуклеотидного мотива. Поскольку число повторов, имеющихся в конкретном месте генома часто различается среди растений, для определения отсутствия или наличия специфических аллелей могут использоваться SSRs.

В другом воплощении изобретения, для идентификации релевантных изобретению аллелей в родительских растениях и/или их предках, а также в растениях-потомках, происходящих от скрещивания упомянутых родительских растений, используют SNP-маркеры.

В одном аспекте, изобретение относится к маркеру или набору из двух или более маркеров, вплоть до 6 маркеров, включающему пару ПЦР олиголинуклеотидных праймеров, состоящих из прямого праймера и обратного праймера, выбранную из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, при этом праймеры приводят к получению амплификационного продукта в реакции ПЦР, обнаруживающей молекулярный вес или нуклеотидную последовательность, которая существенно идентична или может рассматриваться как ее аллель в соответствующем продукте ПЦР амплификации, полученном из Capsicum annuum линии 061М4387 в реакции ПЦР с идентичной(ыми) парой(ами) праймеров.

Любая другая комбинация прямого и обратного праймеров, выбранных из группы праймерных последовательностей, приведенных в SEQ ID NOs: 1-12, также может использоваться в реакции ПЦР.

В одном аспекте, изобретение относится к маркеру или набору из двух или более маркеров, вплоть до 7 маркеров, включающему пару ПЦР олигонуклеотидных праймеров, состоящую из прямого и обратного праймеров, выбранную из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO; 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, при этом праймеры приводят к получению амплификационного продукта в реакции ПЦР, обнаруживающей молекулярный вес или нуклеотидную последовательность, которая существенно идентична или может рассматриваться как ее аллель в соответствующем продукте ПЦР амплификации, полученном из Capsicum annuum линии 061М4387 в реакции ПЦР с идентичной(ыми) парой(ами) праймеров.

Любая другая комбинация прямого и обратного праймеров, выбранных из группы праймерных последовательностей, приведенных в SEQ ID NOs: 13-26, также может использоваться в реакции ПЦР.

В одном аспекте, изобретение относится к маркеру или набору из двух или более маркеров, вплоть до 13 маркеров, включающему пару ПЦР олиголинуклеотидных праймеров, состоящих из прямого праймера и обратного праймера, выбранную из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, при этом праймеры приводят к получению амплификационного продукта в реакции ПЦР, обнаруживающей молекулярный вес или нуклеотидную последовательность, которая существенно идентична или может рассматриваться как ее аллель в соответствующем продукте ПЦР амплификации, полученном из Capsicum annuum линии 061М4387 в реакции ПЦР с идентичной(ыми) парой(ами) праймеров.

Любая другая комбинация прямого и обратного праймеров, выбранных из группы праймерных последовательностей, приведенных в SEQ ID NOs: 1-26, также может использоваться в реакции ПЦР.

В другом воплощении изобретения, могут использоваться молекулярные маркеры, которые находятся в неравновесном сцеплении, и/или связаны с, и/или расположены в области QTL на хромосоме 3 и хромосоме 5, соответственно включающие вклад QTL в устойчивость к Bemisia и трипсу согласно изобретению, а также маркеры, которые представляют действительные причинные мутации, лежащие в основе QTL, и поэтому обнаруживают статистическую корреляцию с фенотипическим признаком, при этом маркеры можно сконструировать, используя олигонуклеотидные праймеры, которые раскрыты в последовательностях SEQ ID NOs: 1-12 и SEQ ID NOs: 13-26 соответственно.

На первом этапе образцы ДНК и кДНК получают из подходящего растительного материала, такого как ткань листа, экстракцией ДНК или РНК, используя известные методики. Праймеры, которые фланкируют область, содержащую SSRs в релевантном изобретению QTL, раскрытому выше, или в связанной с ней области, затем используют для амплификации образца ДНК, применяя метод полимеразной цепной реакции (ПЦР), хорошо известный специалистам в данной области техники.

В основном, метод ПЦР амплификации включает использование праймера или пары праймеров, включающих две короткие олигонуклеотидные праймерные последовательности, фланкирующие сегмент ДНК, который должен быть амплифицирован или адаптирован к последовательности, лигированной с упомянутым сегментом ДНК. За повторными циклами нагревания и денатурации ДНК следует отжиг праймеров с их комплементарными последовательностями при низких температурах и расширение отожженных праймеров ДНК-полимеразой. Праймеры гибридизуются с расположенными напротив цепочками ДНК мишеневых последовательностей. Гибридизация относится к отжигу комплементарных цепочек ДНК, где комплементарность относится к последовательности нуклеотидов так, что нуклеотиды одной цепочки могут связываться с нуклеотидами расположенной напротив цепочки с образованием двухцепочечных структур. Праймеры ориентируют так, чтобы синтез ДНК с помощью полимеры происходил межу праймерами через нуклеотидную последовательность двунаправлено. Эта процедура эффективно удваивает количество этого сегмента ДНК в цикле. Поскольку ПЦР продукты являются комплементарными и способы связываться с праймерами, каждый последующий цикл удваивает количество ДНК, синтезированной в предыдущем цикле. Результатом этой процедуры является экспоненциальное накопление специфичного мишеневого фрагмента, то есть приблизительно 2<n>, где n - это число циклов.

Посредством ПЦР амплификации создаются миллионы копий ДНК сегментов, фланкированных праймерами. Различия в числе повторяющихся последовательностей, или инсерций, или делеций в области, фланкирующей упомянутые повторы, которые располагаются между фланкирующими праймерами в разных аллелях, отражаются на длине вариаций амплифицированных ДНК фрагментов. Эти вариации могут быть обнаружены, например, с помощью электрофоретического разделения амплифицированных ДНК фрагментов на гелях или с помощью капиллярного секвенатора. Анализируя гель или профиль, можно определить, содержит ли растение желательный аллель в гомозиготном или гетерозиготном состоянии или же отсутствует ли желательный или нежелательный аллель в геноме растения.

Маркерный анализ можно выполнить на ранней стадии развития растения, используя образцы ДНК, экстрагированные из ткани листа очень молодого растения или из его семени. Это позволяет идентифицировать растения с желательной генетической основой на раннем этапе селекционного цикла и отбраковать растения, которые не содержат желательных релевантных изобретению аллелей, до опыления, уменьшая таким образом размер селекционной популяции и уменьшая требования по фенотипированию.

Кроме того, используя молекулярные маркеры, можно выявить отличия между гомозиготными растениями, которые несут две копии желательного релевантного изобретению алллеля в релевантных изобретению локусах QTL, и гетерозиготными растениями, которые несут только одну копию, и растениями, которые не содержат копии благоприятного(ых) аллеля(ей).

В одном воплощении изобретения, маркерные локусы можно идентифицировать с помощью пары ПЦР олигонуклеотидных праймеров, состоящих из прямого праймера и обратного праймера, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, включая олигонуклеотидные праймеры, состоящие из прямого праймера и обратного праймера, обнаруживающие нуклеотидные последовательности, которые имеют идентичность последовательности между 90% и 99%, в частности между 95% и 98% с нуклеотидными последовательностями, приведенными в SEQ ID NO: 1-12.

В другом воплощении изобретения, маркерные локусы можно идентифицировать с помощью пары ПЦР олигонуклеотидных праймеров, состоящих из прямого праймера и обратного праймера, выбранной из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13, включая олигонуклеотидные праймеры, состоящие из прямого праймера и обратного праймера, обнаруживающие нуклеотидные последовательности, которые имеют идентичность последовательности между 90% и 99%, в частности между 95% и 98% с нуклеотидными последовательностями, приведенными в SEQ ID NO: 13-26.

Кроме того, в объеме настоящего изобретения можно использовать такие олигонуклеотидные молекулы, как праймеры или зонды, в частности праймеры, состоящие из прямого праймера и обратного праймера, обнаруживающие нуклеотидные последовательности, которые гибридизуются с нуклеотидными последовательностями прямого и обратного праймера, приведенными в SEQ ID NO: 1-12, показанными в Таблице 10, и в SEQ ID NO: 13-26, показанными в Таблице 11, или с нуклеотидными последовательностями, которые гибридизуются с последовательностью, которая может быть получена с использованием последовательностей прямого и обратного праймеров, приведенных в SEQ ID NO: 1-12 и SEQ ID NO: 13-26 соответственно, в среде, в частности в среде с условиями до высокой строгости, в частности в условиях высокой строгости.

В частности, реакция гибридизации проводится в условиях высокой строгости, при которых в качестве раствора используется раствор 5xSSPE, 1% SDS, 1xDenhardts и/или гибридизационные температуры находятся между 35°С и 70°С вплоть до 72°С, предпочтительно 65°С. После гибридизации выполняется частичная промывка сначала с помощью 2xSSC, 1% SDS и затем 0,2xSSC при температурах между 35°С и 70°С вплоть до 72°С, предпочтительно 65°С (относительно определения раствора SSPE, SSC и Denhardts см Sambrook и др., в цитируемом месте).

В одном аспекте изобретения, могут быть сконструированы и использованы маркеры, которые не в точности такие, как раскрытые здесь, или даже маркеры, которые еще следует идентифицировать. Основываясь на информации, обеспечиваемой в этом изобретении, для специалиста возможно идентифицировать или сконструировать маркеры, которые не в точности такие, как раскрытые здесь, но связанные с QTL или связанные с раскрытыми маркерами. Специалист знает, что другие маркеры могут обеспечить по меньшей мере равную полезность в селекции, связанной с маркерами.

Таким образом, изобретение относится к молекулярным маркерам, которые находятся в неравновесном сцеплении и/или расположены в области QTL на хромосоме 3 и хромосоме 5 соответственно, включающие QTL, способствующие устойчивости к Bemisia и трипсу согласно изобретению, а также маркеры, которые представляют действительные причинные мутации, лежащие в основе QTL, и поэтому обнаруживают статистическую корреляцию с фенотипическим признаком, при этом маркеры можно сконструировать, используя олигонуклеотидные праймеры, раскрытые в последовательностях SEQ ID NO: 1-12 и SEQ ID NO: 13-26 соответственно.

Соседние геномные маркеры, которые указывают положение QTL в геноме, в принципе являются произвольными и не ограничиваются. В целом, на положение QTL указывают соседние нити маркеров, которые обнаруживают статистическую корреляцию с фенотипическим признаком. Следовательно, возможно указать расположение QTL и наличие или отсутствие QTL (что касается и фенотипа) с помощью других маркеров, локализованных в пределах области QTL. Число потенциально полезных маркеров ограничено, но может быть очень большим, и специалист может легко идентифицировать маркеры в дополнение к тем, которые раскрыты в заявке. Любой маркер, который связан с устойчивостью, как раскрыто в заявке, может быть использован в селекции, связанной с маркерами.

Таким образом, методами, известными специалисту, могут быть сконструированы и использованы альтернативные маркеры для идентификации и отбора растений с аллелем или набором аллелей локуса или локусов количественного признака, согласно настоящему изобретению и как описано выше.

Например, используя пары праймеров, указанные в Таблице 10 и Таблице 11 соответственно, имеющие нуклеотидную последовательность, приведенную в SEQ ID NO: 1-12 и SEQ ID NO: 13-26, специалистами в данной области техники могут быть получены нуклеотидная последовательность амплифицированного продукта, полученного в ПЦР амплификации, и новые праймеры или пары праймеров, основанные на вновь определенной нуклеотидной последовательности продукта ПЦР амплификации. Кроме того, маркеры, согласно изобретению и раскрытые выше, могли бы быть позиционированы на генетической карте перца или других растений, в частности видов Solanaceae, a известные маркеры, картированные в тех же самых, или гомологичной, или ортологичной области(ях), могли бы быть использованы в качестве стартовой точки для конструирования новых маркеров.

Нуклеотидные последовательности амплифицированных продуктов, полученных в ПЦР амплификации с использованием пар праймеров, указанных в Таблице 10 и Таблице 11 соответственно, имеющих нуклеотидную последовательность, приведенную в SEQ ID NO: 1-12 и SEQ ID NO: 13-26, или их часть могут быть также использованы в качестве гибридизационных зондов, например, для скрининга в ВАС библиотеке, чтобы идентифицировать дополнительные связанные нуклеотидные последовательности.

Соответственно, маркеры, конкретно раскрытые в настоящем изобретении, могут также быть использованы в идентификации и/или конструировании новых или дополнительных маркеров, связанных с представляющим интерес QTL, которые в свою очередь затем могут быть использованы в связанной с маркерами селекции и/или поиске рекомбинантов, фланкирующих QTL, и/или точного картирования, и/или клонирования QTL.

Имеется несколько методов или доступных подходов, известных специалистам в данной области, которые могут быть использованы для идентификации и/или конструирования маркеров в неравновесном сцеплении и/или связанных с, и/или расположенных в области QTL, а также маркеров, которые представляют собой действительные каузальные мутации, лежащие в основе QTL. Без исчерпывающей полноты некоторые подходы, известные специалистам, включают:

- использование раскрытых последовательностей/маркеров в гибридизационных подходах для идентификации другой последовательности в области интереса: праймерные последовательности, раскрытые здесь, и/или маркерные/генные последовательности (или их часть), которые можно определить, используя раскрытые здесь праймерные последовательности, могут быть использованы в качестве (гибридизационных) зондов при выделении последовательностей нуклеиновых кислот/генов, фланкирующих маркеры и/или связанных с, и/или ассоциированных с, и/или специфичных для области QTL, из образца геномной нуклеиновой кислоты и/или образца РНК или кДНК, или пула образцов (например, скрининг геномных источников подобно скринингу ВАС библиотек или библиотеки гДНК или кДНК);

- использование раскрытых последовательностей/маркеров в ПЦР подходах для идентификации другой последовательности в области интереса: праймерные последовательности, раскрытые здесь, и/или маркерные/(кандидатов в) генные последовательности (или их часть), которые можно определить, используя раскрытые здесь праймерные последовательности, могут быть использованы в качестве (ПЦР) амплификационных праймеров для амплификации последовательностей нуклеиновых кислот/генов, фланкирующих и/или связанных с, и/или ассоциированных с, и/или специфичных для области QTL, из образца геномной нуклеиновой кислоты и/или образца РНК или кДНК, или пула образцов, выделенных или не выделенных из специфичной растительной ткани и/или после специфической обработки растения и из однолетнего перца или в принципе любого другого организма с достаточной гомологией;

- использование раскрытых последовательностей/маркеров в ПЦР подходах для идентификации другой последовательности в области интереса: нуклеотидные последовательности/гены одного или более маркеров могут быть определены после внутренних праймеров, чтобы упомянутые маркерные последовательности можно было сконструировать и использовать для последующего определения дополнительных фланкирующих последовательностей/генов в пределах области QTL и/или генетически связанных с, и/или ассоциированных с признаком;

- использование раскрытых последовательностей/маркеров в картировании и/или в подходах по сравнительному картированию для идентификации маркеров в той(тех) же самой(ых) области(ях) (позиционирование QTL на других картах): основываясь на информации, связанной с положением, и/или информации о маркерах, как здесь раскрыто, маркеры любого типа могут быть идентифицированы с помощью подходов генетического картирования, а в итоге (если уже требуется) с помощью позиционирования раскрытых маркеров (генетическим картированием или экстраполяцией по карте, основанной на общих маркерах) на генетической(их) карте(ах) (высокой плотности), и/или интегрированной(ых) генетической или консенсусной карте(ах). Уже известные и/или новые маркеры, генетически связанные с и/или позиционированные в окрестности раскрытых маркеров и/или областей QTL, могут быть идентифицированы и/или получены и, в конечном счете, использованы в (точном) картировании QTL, и/или клонирования QTL, и/или в селекционных приложениях MAS;

- использование раскрытых последовательностей/маркеров в «in-silico» подходах для идентификации дополнительных последовательностей/маркеров/(кандидатов) генов в области(ях) QTL: раскрытые здесь праймерные последовательности и/или маркерные/(кандидатов в) генные последовательности (или их часть), которые можно определить, используя раскрытые здесь праймерные последовательности или, основываясь на связанных маркерах, можно использовать в «in-silico» методах для поиска последовательности или протеиновых баз данных (напр., BLAST) для (дополнительных) фланкирующих и/или гомологичных последовательностей/генов, и/или аллельного разнообразия (как геномных и/или кДНК-последовательностей или даже протеинов, так и происходящих из однолетнего перца и/или любого другого организма), генетически связанного и/или ассоциированного с признаками, как описано здесь, и/или локализованных в области QTL;

- использование раскрытых последовательностей/маркеров в картировании и/или в подходах по физическому картированию, позиционирование QTL на физической карте или в геномной последовательности: раскрытые здесь праймерные последовательности и/или маркерные/генные последовательности (или их часть), которые можно определить, используя раскрытые здесь праймерные последовательности или используя другие маркеры, генетически связанные с раскрытыми здесь маркерами и/или локализованные в области QTL, могут быть позиционированы на физической карте и/или (полной) геномной последовательности, по сути, любого организма с достаточной гомологией, чтобы идентифицировать (кандидатов в) последовательности/маркеры/гены, применимые при (точном) картировании QTL, и/или клонировании QTL, и/или в селекционных приложениях MAS;

- использование раскрытых последовательностей/маркеров для позиционирования QTL на других (физических) картах или в геномах (по виду… для перца и других Solanaceae, таких как томат или картофель, конечно, представляют наибольший интерес, но может быть использована модель вида, подобная Arabidopsis): раскрытые здесь праймерные последовательности и/или маркерные/генные последовательности (или их часть), которые можно определить, используя раскрытые здесь праймерные последовательности, могут быть использованы в подходах по сравнительному картированию генома или групп сцепления для идентификации гомологичной области и гомологичной и/или ортологичной последовательностей/(кандидатов) генов, генетически связанных и/или позиционированных в области QTL, и применимы при (точном) картировании QTL, и/или клонировании QTL, и/или в селекционных приложениях MAS;

- использование раскрытых последовательностей/маркеров для отбора подходящих индивидов, позволяющее идентифицировать маркеры в области интереса с помощью генетических подходов: раскрытые здесь праймерные последовательности и/или маркеры можно использовать для отбора индивидов с разными/различающимися QTL аллелями, которые можно использовать, например, в подходах по генетической ассоциации и/или валовом анализе расщепления (BSA, Michelmore и др.1., 1991) для идентификации маркеров/генов в конкретной области интереса (области QTL) и/или ассоциированной или генетический связанной с описываемыми признаками;

- использование раскрытой информации для поиска (позиционных) кандидатов генов: раскрытая информация может быть использована для позиционных и/или функциональных кандидатов генов, которые могут быть ассоциированы с описанными признаками и/или генетически связаны.

В одном воплощении, изобретение, следовательно, относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере один QTL, который способствует устойчивости к Bemisia, при этом QTL расположен на хромосоме 3, где упомянутый по меньшей мере один QTL может быть идентифицирован с помощью молекулярного маркера, который обнаруживает статистическую корреляцию с фенотипическим признаком, причем маркер может быть получен из сегмента ДНК, содержащего упомянутый QTL, с помощью методов, известных в данной области техники, а сегмент получен от растения, которое имеет генетическое окружение линии 061М4387, в частности от растения, которое имеет генетическое окружение или архитектуру в QTL линии 061М4387, и особенно от растения линии 061М4387, образец семени которого депонирован в NCIMB под номером доступа NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, и определяется по меньшей мере одним маркерным локусом, предпочтительно по меньшей мере двумя маркерными локусами, более предпочтительно по меньшей мере тремя маркерными локусами и еще более предпочтительно по меньшей мере четырьмя маркерными локусами, но особенно предпочтительно по меньшей мере пятью и шестью маркерными локусами, при этом маркерные локусы расположены на хромосоме 3, ко-сегрегированы по признаку устойчивости к Bemisia и могут быть идентифицированы ПЦР олигонуклеотидными праймерами или парой ПЦР олигонуклеотидных праймеров, выбранной из группы: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6.

В другом воплощении, изобретение, таким образом, относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере два QTL, которые способствуют устойчивости к Bemisia, при этом QTL расположены на хромосоме 3 и 5, где упомянутые по меньшей мере два QTL могут быть идентифицированы с помощью молекулярного маркера, который обнаруживает статистическую корреляцию с фенотипическим признаком, причем маркер может быть получен из сегмента ДНК, содержащего упомянутые QTL, с помощью методов, известных в данной области техники, а сегмент получен от растения, которое имеет генетическое окружение линии 061М4387, в частности от растения, которое имеет генетическое окружение или архитектуру в QTL линии 061М4387, и особенно от растения линии 061М4387, образец семени которого депонирован в NCIMB под номером доступа NCIMB 41428, или от его потомства или предка, включающего упомянутые QTL, где первый QTL расположен на хромосоме 3 в донорном растении и генетически связан по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами и в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами, при этом маркерные локусы расположены на хромосоме 3, и ко-сегрегированы по признаку устойчивости к Bemisia, и могут быть идентифицированы парой 1-6 ПЦР олигонуклеотидных праймеров, приведенных в последовательностях SEQ ID NOs: 1-12, и где второй QTL расположен на хромосоме 5 в донорном растении и генетически связан по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами и в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью и семью маркерными локусами, при этом маркерные локусы расположены на хромосоме 5, и ко-сегрегированы по признаку устойчивости к Bemisia, и могут быть идентифицированы парой ПЦР олигонуклеотидных праймеров, выбранных из группы праймерных пар 7-13, приведенных в последовательностях SEQ ID NOs: 13-26.

В другом воплощении, изобретение относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере один QTL, который способствует устойчивости к трипсу, при этом QTL расположен на хромосоме 5, где упомянутый по меньшей мере один QTL может быть идентифицирован с помощью молекулярного маркера, который обнаруживает статистическую корреляцию с фенотипическим признаком, причем маркер может быть получен из сегмента ДНК, содержащего упомянутый QTL, с помощью методов, известных в данной области техники, а сегмент получен от растения, которое имеет генетическое окружение линии 061М4387, в частности от растения, которое имеет генетическое окружение или архитектуру в QTL линии 061М4387, и особенно от растения линии 061М4387, образец семени которого депонирован в NCIMB под номером доступа NCIMB 41428, или от его потомства или предка, включающего упомянутый QTL, и определяется по меньшей мере одним маркерным локусом, предпочтительно по меньшей мере двумя маркерными локусами, более предпочтительно по меньшей мере тремя маркерными локусами и еще более предпочтительно по меньшей мере четырьмя маркерными локусами, но особенно предпочтительно по меньшей мере пятью и шестью маркерными локусами, при этом маркерные локусы расположены на хромосоме 3, и ко-сегрегированы по признаку устойчивости к Bemisia, и могут быть идентифицированы ПЦР олигонуклеотидным праймером или парой ПЦР олигонуклеотидных праймеров, выбранных из группы: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13.

В другом воплощении, изобретение, таким образом, относится к культивируемому растению Capsicum annuum, содержащему геном, включающий по меньшей мере два QTL, которые способствуют устойчивости к Bemisia и трипсу, при этом QTL расположены на хромосоме 3 и 5, где упомянутые по меньшей мере два QTL могут быть идентифицированы с помощью молекулярного маркера, который обнаруживает статистическую корреляцию с фенотипическим признаком, причем маркер может быть получен из сегмента ДНК, содержащего упомянутые QTL, с помощью методов, известных в данной области техники, а сегмент получен от растения, которое имеет генетическое окружение линии 061М4387, в частности от растения, которое имеет генетическое окружение или архитектуру в QTL линии 061М4387, и особенно от растения линии 061М4387, образец семени которого депонирован в NCIMB под номером доступа NCIMB 41428, или от его потомства или предка, включающего упомянутые QTL, где первый QTL расположен на хромосоме 3 в донорном растении и генетически связан по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами и в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью маркерными локусами, при этом маркерные локусы расположены на хромосоме 3, и ко-сегрегированы по признаку устойчивости к Bemisia, и могут быть идентифицированы парой 1-6 ПЦР олигонуклеотидных праймеров, приведенных в последовательностях SEQ ID NOs: 1-12, а второй QTL расположен на хромосоме 5 в донорном растении и генетически связан по меньшей мере с одним маркерным локусом, в частности по меньшей мере с двумя маркерными локусами, в частности по меньшей мере с тремя маркерными локусами и в частности по меньшей мере с четырьмя маркерными локусами, в частности по меньшей мере с пятью маркерными локусами, в частности по меньшей мере с шестью и семью маркерными локусами, при этом маркерные локусы расположены на хромосоме 5, и ко-сегрегированы по признаку устойчивости к Bemisia и/или трипсу, и могут быть идентифицированы парой ПЦР олигонуклеотидных праймеров, выбранных из группы праймерных пар 7-13, приведенных в последовательностях SEQ ID NOs: 13-26.

Маркеры согласно настоящему изобретению могут быть использованы в основанной на маркерах селекции и/или в других методах, где отслеживаются растения, имеющие или не имеющие QTL. Маркеры могут быть либо транс-, либо цис-маркерами. Транс-маркер указывает полиморфизм, происходящий от интрогрессии эндогенной (донорной) ДНК в реципиентный растительный геном, при этом полиморфизм связывается в цис-положении с реципиентным геномом, т.е. связывается с расположенным напротив аллелем. Таким образом, цис-маркеры связываются с представляющим интерес аллелем (благоприятным QTL аллелем от донора), в то время как транс-маркеры связываются с расположенным напротив аллелем (от реципиента).

Для определения полезности инбредной линии и ее потенциала обеспечивать генетический вклад в гибридное потомство, проводят тест-скрещивания с другой инбредной линией, и получающееся потомство оценивают фенотипически. Признаки, которые можно регистрировать, обычно включают признаки, которые относятся к форме плода и таким характеристикам плода, как остроконечный или не остроконечный плод, жгучий или не жгучий, красный, желтый или оранжевый. Также принимаются во внимание характеристики растения, такие как длина междоузлий, мощность растения и ветвистость, наряду со специфической устойчивостью к вирусам, таким как TMV (вирус мозаичности табака) и TSWV (вирус пятнистого увядания томата).

Для генотипирования, QTL картирования или ассоциативного картирования ДНК извлекают из подходящего растительного материала, такого, например, как ткань листа. В частности, собирают массу листьев множества растений. Образцы ДНК генотипируют, используя множество полиморфных SSR's, SNP или любого другого подходящего типа маркера, покрывающего полный геном перца.

Совместный анализ генотипических и фенотипических данных можно провести, используя стандартные программы, такие как, например, программа QTLCartographer и PlabQTL. Интродукции растений и зародышевая плазма могут быть скринированы на аллели в соответствующих QTLs, раскрытых в Таблице 10 и Таблице 11 соответственно, на основании нуклеотидной(ых) последовательности(ей) маркера(ов) в маркерном(ых) локусе(ах), связанном(ых) с упомянутыми QTL, или любого другого маркера, для которого известна локализация на хромосоме 3 и хромосоме 5 соответственно, и молекулярного веса аллеля(ей), используя одну или более методик, раскрытых здесь или известных специалистам в данной области техники.

Нуклеотидная последовательность раскрытых маркеров, связанных маркеров или QTL согласно настоящему изобретению может быть определена известными специалистам методами. Например, нуклеотидная последовательность, включающая упомянутый QTL или его придающая устойчивость часть, может быть выделена из устойчивого к Bemisia/трипсу донорного растения посредством фрагментирования генома упомянутого растения и отбора тех фрагментов, которые содержат один или более маркеров, указывающих на QTL. В дальнейшем или альтернативно, маркерные последовательности (или их части), указывающие на QTL, могут быть использованы в качестве (ПЦР) амплификационных праймеров, чтобы амплифицировать последовательности) нуклеиновых кислот, включающих упомянутый QTL, из образца нуклеиновой кислоты или геномного фрагмента, полученного из упомянутого растения. Нуклеотидная последовательность QTL и/или любого включенного в него дополнительного маркера может быть получена с помощью стандартных методов секвенирования.

Таким образом, настоящее изобретение также относится к последовательности выделенной нуклеиновой кислоты (предпочтительно ДНК, но необязательно ДНК), которая включает QTL согласно настоящему изобретению или его часть, придающей устойчивость к Bemisia/трипсу. Таким образом, раскрытые маркеры могут быть использованы для идентификации и выделения одного или более маркеров или генов из перца или других овощных культур, в частности культур Solanaceous, которые связаны или кодируют устойчивость к Bemisia/трипсу.

Нуклеотидную последовательность дополнительных связанных маркеров или QTL согласно настоящему изобретению можно также, например, получить посредством определения нуклеотидной последовательности одного или более маркеров, ассоциированных с QTL, и конструирования праймеров для упомянутых маркерных последовательностей, которые затем могут быть использованы для последующего определения последовательности за пределами упомянутой маркерной последовательности. Например, нуклеотидная последовательность раскрытых здесь SSR маркеров или любых других маркеров, предсказанных в области QTL и/или связанных с QTL, может быть получена посредством секвенирования амплифицированного ПЦР продукта упомянутых маркеров, хорошо известных в данной области. Или альтернативно, используя маркерные последовательности в ПЦР или в качестве гибридизационных зондов для идентификации связанных нуклеотидных последовательностей с помощью, например, но не ограничиваясь им, ВАС скрининга.

ПРИМЕРЫ

Следующие примеры обеспечивают показательные воплощения изобретения. В свете настоящего раскрытия и общего уровня знания в данной области специалисты поймут, что приведенные примеры даны единственно для иллюстрации и что многочисленные изменения, модификации и варианты можно применить без выхода за пределы объема заявленного здесь предмета изобретения.

Пример 1: История выведения перца селекционной линии 061М4387

Используя количественный биоанализ, как описано ниже в Примере 2, в сочетании с соответствующими условиями выращивания был идентифицирован образец дикого Capsicum annuum, как источника устойчивости к поражению Bemisia и трипсом. Семена этого дикого образца с номером доступа CGN 16975 и наименованием АС 1979 были получены от Instituut voor de Veredeling van Tuinbouwgewassen (теперь Centre for Genetic Resources), Вагенинген, Нидерланды. Популяция, сегрегирующая по устойчивости Bemisia и трипсу, была создана путем скрещивания этого донорного растения перца с восприимчивым реципиентным растением перца. Сегрегирующая популяция, состоящая из общего количества 333 DH линий, была создана для идентификации одного или более QTL, способствующих устойчивости к Bemisia и трипсу.

Начальный источник устойчивости, дикий образец CGN 16975 был скрещен с голландским инбредом от Syngenta, выведенным в Вестланде (Нидерланды). F3 поколение этого кросса было идентифицировано как устойчивое, в частности устойчивое в промежуточной степени, к белокрылке (визуальное наблюдение) в Альмерии (Испания).

Затем было произведено (ВС1) скрещивание между F3, упомянутым в предыдущем абзаце, и линией Syngenta, произведенной в Альмерии. Потомство этого скрещивания было идентифицировано как устойчивое, в частности устойчивое в промежуточной степени, к белокрылке и трипсу (в Агадире-Марокко; трипс - визуальное наблюдение) и использовано для следующего кросса (ВС2).

ВС2 был создан с помощью дигаплоидной линии Syngenta, произведенной в Альмерии (Испания). От растительных семейств в F2 этого кросса было получено некоторое количество (=333) дигаплоидов для характеризации наследования признака устойчивости к белокрылке и трипсу. Среди них - линия 061М4387, депонированная NCIMB под номером доступа NCIMB 41428. Было показано, что NCIMB 41428 является устойчивым в промежуточной степени к поражению Bemisia tabaci и трипсом.

Пример 2: Анализ устойчивости

2А Устойчивость к Bemisia - Протоков тестирования

2А.1 Выращивание растений

Растения высевали и выращивали в соответствии со стандартными процедурами. В частности, растения высевали в, напр., 77 многоярусных лотках (блоки горшочков 4,2×4,2×5,9 см), заполненных хорошо дренированной рыхлой почвой с рН между 6,5 и 7,5 и выращивали приблизительно в течение одного месяца в теплице туннельного типа. Растения удобряли N 4,0-6,0, Р 0,35-1,0, К 4,0-6,0 ЕС2.

Растения пересаживали по специальному проекту (см. ниже) и культивировали в соответствии со стандартными процедурами. Во время культивирования растения часто нуждались в защите от паразитов, иных нежели Bemisia. Химическая обработка проводилась пестицидами, которые причиняют лишь небольшой вред на развитие популяции Bemisia.

2А.2 Культура насекомого и инокуляция

Чтобы гарантировать стабильное и единообразное развитие популяции Bemisia и получить более строгие условия тестирования, проводилась ранняя инокуляция растений посредством Bemisia. Для этого была использована отдельная маленькая теплица из полимерной пленки, в которой культуру перца выращивали в строгих условиях. Для инокуляции тестируемого материала использовали присутствующую в природе популяцию Bemisia.

Для инокуляции можно использовать два метода:

1. Использование тыквы в качестве растения-ловушки: сеянцы тыквы 2-3-недельного возраста помещали в маленькую теплицу из полимерной пленки с культурой Bemisia на 4-6 часов. Поскольку взрослые особи Bemisia имеют большое предпочтение к тыкве, они будут быстро лететь к сеянцам тыквы. Затем тыквенные растения с взрослыми особями Bemisia аккуратно упаковывали в пластиковые мешки и переносили в экспериментальную туннельную теплицу, где равномерно освобождали мешки над растениями. Инокуляция начинается приблизительно на 10-й день после пересадки и может продолжаться, если потребуется, в течение 1-2 недель.

2. Молодые сеянцы перца, взошедшие в лотках, помещали за 4-5 дней до пересадки в маленькую теплицу из полимерной пленки с культурой Bemisia, давая возможность взрослым Bemisia отложить яйца на молодые растения. После этого растения можно пересаживать в сдвоенный туннель большего размера.

2А.3 Схема эксперимента

Большой сдвоенный туннель в Агадире использовали с 8 рядами из приблизительно 2×150 растений в каждом. В каждом ряду одна сторона использовалась как распределительный ряд, засаживалась восприимчивым входом (существующее F1, напр., Bikingo F1 или Vergasa F1, или восприимчивая родительская линия). Другая часть ряда засаживалась тестируемыми входами. Тестируемые входы были полностью рандомизированы в каждом по меньшей мере из 7 блоков с 1 или более растениями/вход на блок.

2А.4 Сбор данных

Развитие Bemisia отслеживалось в распределительном ряду еженедельно или раз в две недели посредством выставления оценки 5 растениям распределительного ряда в эквидистантных положениях (растение 1, 38, 75, 112, 150) в каждом ряду. Окончательные оценки делались, когда среднее поражение отслеженных растений распределительного ряда было приблизительно 4 (Таблица 1) обычно во время, когда поспевают первые плоды (3-4 месяца после пересадки).

Для оценки тяжести поражения использовали шкалу от 1 до 9 баллов (Таблица 1). Исследовали нижнюю поверхность листьев растений и оценивали среднее из 5 приблизительно наиболее поврежденных листьев согласно шкале 1-9. Этим способом обсчитывались все тестируемые растения.

Таблица 1
Оценочная шкала WF-устойчивости
Балл Описание WF ## куколок1
9 Нет куколок 0
8 Очень мало куколок 1-5
7 Некоторое число куколок, неравномерно разбросанных по листу 5-20
6 20-50
5 Умеренное число куколок, более равномерно распределенных по листьям 50-100
Балл Описание WF ## куколок1
4 100-200
3 Много куколок, густо расположенных на листе (присутствует черная плесень) 200-400
2 400-700
1 Растение полностью покрыто куколками и сильно заплесневевшее, часто останавливающееся в росте 700-1000
1: оценка ## куколок на лист: случаи пустых куколок и зрелых куколок

2А.5 Анализ данных

Данные анализировали подсчитывая значения по тестируемому входу и сравнивая с восприимчивым входу (напр., восприимчивым распределительным рядом или иначе), множественное сравнение значений (напр., LSD) указывает, отличаются ли тестируемые друг от друга и от восприимчивого контроля.

2А. 6 Результаты

2А.6.1 Тестирование устойчивости

В Таблице 2 показаны некоторые результаты скрининга Bemisia's в Агадире (Марокко) депонированной линии 061М4387 (содержащей QTL1 (упоминаемый здесь как QTL на хромосоме 3) и QTL2 (упоминаемый здесь как QTL на хромосоме 5), см. пример 3), двух его предков и устойчивого донора. История выведения объяснена в примере 1. Депонированная линия 061М4387 оказалась значительно лучше при изменении давления насекомых, сезонов и условий по сравнению со стандартными восприимчивыми сортами и линиями.

Таблица 2
Результаты тестов депонированной линии 061М4387 и некоторых из его предков
Вход Устойчивая линия Восприим. контроль1 Тест Замечание
CGN 16975 (донор) Очень устойчивая* Очень воспр.* Весна 2002 *Подсчитано визуально в селекционной пробе
BC1F3 Очень устойчивая*
Значение n Значение LSD2
CGN16975 (донор) 8.8 20 6.6 0.4 Дек.2002 Давление насекомых относительно низкое
BC1F4 8.5 20
Депонированная линия Значение n Значение LSD
Вход Устойчивая линия Восприим. контроль Тест Замечание
061М4387 8.0 7 4.2 1.2 Авг.2005 Умеренно-высокое давление насекомых
061М4387 6.4 7 3.0 1.5 Нояб. 2005 Очень высокое давл. насекомых
061М4387 6.7 20 3.8 0.6 Июнь 2006 Высокое давление насекомых
061М4387 8.0 10 5.2 1.4 Февр. 2007 Умеренное давление насекомых
1В упомянутых выше пробах Vergasa F1, Bikingo F1 или родительские линии (все восприимчивые) использовали как в качестве восприимчивого контроля, так и в качестве распределительного ряда
2LSD интервалы (Р0.05) основаны на сравнении значений многих входов включенных в пробу (не показано).

2А.6.2 Идентификация QTL, ассоциированных с устойчивостью

В таблице 3 показаны результаты скрининга набора из 333 DH линий, созданных из BC2F2 с целью идентификации QTL, ассоциированных с устойчивостью (см. примеры 1 и 3). Два теста были поставлены на DH линиях: в тесте 1 посадка была проведена весной 2005 и подсчет производился в августе, во втором тесте посадку проводили в сентябре 2005 и подсчет делали в ноябре (Таблица 3). В ноябрьской пробе некоторые места в теплице имели очень высокое давление насекомых с тем последствием, что никаких заслуживающих доверия фенотипов не могло быть получено. Поэтому эти места были исключены из анализа.

Было идентифицировано два QTL (см. пример 3). QTL (QTL1) на хромосоме 3 имел самое большое LOD-значение (до 50), QTL (QTL2) на хромосоме 5 имел меньшее LOD-значение (до 5).

На основании фланкирующих маркеров 69 DH-линий были идентифицированы как не имеющие QTLs, 57 DH-линий имели только QTL1, 38 DH-линий имели только QTL2 и 63 DH-линии имели вместе и QTL1, и QTL2.

Влияние QTL1 было в обеих пробах значительным и оценено в августовской пробе в 1,3 единицы шкалы, а в ноябрьской пробе в 1,9 единицы шкалы (Таблица 3). Благодаря более низкой пораженности в августе, многие линии имели 7-8 баллов, достигая потолка, возможно, с минимизацией разницы между линиями. В ноябрьской пробе разница между линиями была больше вследствие более высокого уровня поражения.

Таблица 3
Результаты скринирования набора из 333 DH линий, выведенных из BC2F2 с целью идентификации QTLs, связанных с устойчивостью
без QTL QTL1 QTL2 QTL1&2
Авг. 5.9а* 7.2с 6.5b 7.6d
Нояб. 4.1а 6.0b 4.За 6.1b
Авг. 5.0 6.6 5.4 6.8
*: сходные буквы не показывают статистической разницы (LSD, Р<0.05) в пределах периода наблюдения

2А.6.3 Тестирование влияния QTL1 в 5 семействах ВС3

Для оценки влияния QTL1 в разных известных семействах было сделано пять ВС3 с 5 разными ВС-родителями и производной устойчивой линией, содержащей QTL1. 556 DH-линий, произошедших из этих ВС3, были генотипированы по QTL1 и протестированы в Агадире (Февраль 2007, Таблица 4) в таких же самых условиях, что и описанные ранее. Влияние QTL1 было оценено в 1,8-2,3 единиц шкалы для разных семейств (Таблица 4), подтверждая значительное влияние QTL1 (двумерный ANOVA, средний квадрат QTL1=521,3, F=698,7, Р=<0,001, никакого взаимодействия между семейством и наличием QTL1.

Таблица 4
Влияние QTL1 на поражение Bemisia в 5 семействах ВС3, тестированных в Агадире в Феврале 2007
Семейство QTL1-наличие значение Кол-во Различие
1 без QTL 5.2 51 1.8
QTL1 7.0 46
2 без QTL 4.7 47 2.0
QTL1 6.8 38
3 без QTL 5.2 60 2.1
QTL1 7.3 145
4 без QTL 4.9 37 2.2
QTL1 7.2 57
5 без QTL 4.9 42 2.3
QTL1 7.3 33
Всего 556

2А.6.4 Тестирование влияния QTLs 1 и 2 на повреждение Bemisia в наборе из 60 DH линий, произведенных от скрещивания донора CGN16975 и двух элитных линий перца

Начальный источник устойчивости дикий образец CGN16975 был скрещен с двумя элитными линиями (А и В). Из них было получено два F1 в общем количестве 60 дигаплоидных линий (34 от линии А и 26 от линии В). 58 из этих линий были протестированы, главным образом дважды (между Декабрем 2003 г. и Декабрем 2004 г.) на устойчивость к Bemisia.

Таблица 5
Оцененное влияние QTL 1 и 2 на устойчивость к Bemisia в небольшой DH популяции, произведенной от F1 между диким образцом CGN16975 и 2 элитными линиями перца. Данные являются средними по двум тестам
без QTL QTL1 QTL2 QTL1&2
n=11 n=17 n=17 n=13
среднее 4.0а* 5.9.0b 5.1ab 5.9b
* сходные буквы не показывают статистической разницы (ANOVA с последующим сравнением значений с помощью критерия наименьшей значимой разности по методу Фишера LSD, Р<0.05). ** значительно отличается от без QTL при Р=0.06.

Влияние QTL1 оценивалось по приблизительно 1,9 единиц шкалы, а влияние QTL2 оценивалось по 1,1 единиц шкалы в этих популяциях.

2В. Устойчивость к трипсу - протокол тестирования

2В. 1 Выращивание растений

Растения высевали в стандартную торфяную почву и пересаживали спустя 14 дней в горшочки 7×7×8 см. Растения выращивали в теплице при 20°С/18°С и 16 ч/8 ч день/ночь. Примерно 1 месяц после посева растения переносили в клеть размером 1×1×1 м, покрытую нейлоновым ситом (0,07×0,27 мм), предотвращающим покидание трипсом клетки. В каждой клети было выпущено 400-500 трипсов. Это повторили 1 неделю спустя, чтобы гарантировать высокое давление насекомых. Через три-четыре недели после первой инокуляции было произведено наблюдение.

2В. 2 Культура насекомого и инокуляция

Живую культуру трипса поддерживали и использовали для экспериментов по устойчивости. Из культуры собирали 400-500 трипсов (включая как взрослые, так и молодые особи) в склянку с помощью стандартного всасывающего устройства. Затем склянку с трипсами постепенно освобождали в тестовой клети. После инокуляции температуру постепенно поднимали до 24°С (день/ночь).

2В. 3 Схема эксперимента

В каждой клети размещали один или более устойчивых контролей (предпочтительно CGN 16975) и один или более восприимчивых контролей (напр., Roxy F1 и/или Snooker F1). Всего в единичной клети было размещено 57 растений. Для каждой клети растения (включая контрольные растения) были рандомизированы. DH линии, тестированные на Bemisia (см. Пример 1 выше), этим способом протестировали на устойчивость к трипсу. Было поставлено семь последовательных экспериментов, чтобы протестировать все 333 DH линии с (макс.) 12 растениями на линию.

2В.4 Сбор данных

Окончательную оценку производили, когда средняя пораженность восприимчивых контрольных растений составляла 3-4 (Таблица 6). Обычно это достигалось 3-4 недели после инокуляции.

Для оценки повреждения посеребрением использовали шкалу от 1 до 9 (Таблица 6). Исследовали нижнюю поверхность листьев растений и оценивали среднее из 2-3 приблизительно наиболее поврежденных листьев согласно шкале 1-9. Этим способом обсчитывались все тестируемые растения.

Таблица 6
Оценочная шкала для повреждения посеребрением, вызванным Frankliniella occidentalis
Балл Описание повреждения, вызванного трипсом % посеребрения1
9 Нет повреждения посеребрением 0
8 Крошечные пятна <0.1
7 Некоторое количество маленьких пятен особенно вблизи срединной жилки или края листа 0.1-1
6 1-2
Балл Описание повреждения, вызванного трипсом % посеребрения1
5 Умеренное число пятен, более равномерно распределенных по листьям 3-5
4 6-10
3 Присутствует много больших пятен посеребрения, распределенных по всему листу 11-20
2 21-40
1 Очень сильное посеребрение, большая часть листа повреждена >40
1: оценка % посеребрения 2-3 наиболее поврежденных листьев

2В.4 Анализ данных

Данные анализировали, вычисляя значения на тестовый вход и сравнивая с восприимчивым входом (напр., Roxy F1 и/или Snooker F1). Множественное сравнение значений (напр., LSD указывали, отличались ли тестовые входы друг от друга и от восприимчивого контроля.

2В. 6 Результаты

2В.6.1 Анализ устойчивости

В Таблице 7 в качестве примера показаны результаты CGN 16975, двух восприимчивых контролей (Roxy F1 и Snooker F1) и депонированной линии, содержащей QTL1 и QTL2. Приведены средние данные 3 независимых тестов, в каждом приблизительно 12 растений/вход. Депонированная линия показала значительно меньшее посеребрение по сравнению с двумя восприимчивыми контрольными линиями Snooker F1 и Roxy F1, но большее посеребрение по сравнению с донором CGN 16975. Это указывает, что депонированная линия имеет повышенный уровень устойчивости по сравнению со стандартными сортами.

Таблица 7
Фенотипические результаты депонированной линии 061М4387. CGN 16975 и двух восприимчивых сортов (Roxy F1 и Snooker F1)
Вход Кол-во Посеребрение*
Snooker F1 36 3.5а
Roxy F1 36 3.8а
061М4387 31 5.8b
CGN16975 36 7.3 с
* сходные буквы не показывают статистической разницы (ANOVA с последующим сравнением значений с помощью критерия наименьшей значимой разности по методу Фишера LSD, Р<0.05).

2B.6.2 Идентификация QTL, ассоциированного с устойчивостью к трипсу

QTL-анализ (см. пример 3) по 333 DH линиям (см. пример 1) показывает наличие QTL на хромосоме 5 с LOD значением до 12. Этот QTL расположен в той же самой обрасти, что и QTL2, идентифицированный в QTL картировании Bemisia (см. пример 2А.6). QTL для Bemisia на хромосоме 5 и QTL для трипса расположены в той же самой области хромосомы. Это мог бы быть единичный локус с воздействием как против Bemisia, так и против трипса, QTLs или два связанных QTLs.

2В.6.3 Тестирование влияния QTL2 на повреждение трипсом в наборе из 333 DH линий, выведенных из BC2F2

Влияние QTL на трипс оценивали аналогично тому, как это было сделано для Bemisia. QTL показал значительное влияние в приблизительно 0,8 единицы шкалы (Таблица 8).

Таблица 8
Оцененное влияние QTL2 на повреждение трипсом (посеребрение) в большой BC2F2 популяции из 333 DH линий (возможные рекомбинанты были исключены)
без QTL QTL2
n=122 n=91
Посеребрение 4.5 5.3*
•значительная разница (t - тест, t=-8.29, P<0.001).

2В.6.3 Тестирование влияния QTL2 на повреждение трипсом в наборе из 333 DH линий, происходящих от скрещивания с донором CGN16975 и двумя элитными линиями перца

53 DH линии из того же самого набора из 60 DH линий, произошедших от образца CGN16975, скрещенные с двумя элитными линиями (А и В, см. раздел 2А.6.4), дважды были подвергнуты тесту на трипс и проверены на наличие QTL2.

QTL2 показал значительное влияние в 1,0 единиц шкалы (Таблица 9), которое имеет сравнимый уровень с таковым в большом 333 DH наборе, описанном в 2В6.3 (Таблица 8).

Таблица 9
Оцененное влияние QTL2 на повреждение трипсом (посеребрение) в небольшой DH популяции, произошедшей от F1 между диким образцом CGN 16975 и 2 элитными линиями перца
без QTL QTL2
n=26 n=27
Посеребрение 4.3 5.3*
•значительная разница (t- тест, t=-3.86, P<0.001).

Пример 3: QTL картирование

3.1 QTL картирование для устойчивости к Bemisia

Источник устойчивости к Bemisia был идентифицирован, используя количественный биоанализ, описанный выше в Примере 2А, в сочетании с подходящими условиями выращивания. Популяция, сегрегирующая по устойчивости к Bemisia, была создана путем скрещивания этого донорного растения перца с восприимчивым реципиентным растением перца. Сегрегирующая популяция, состоящая из общего количества 333 DH линий, была создана для идентификации QTL, способствующего устойчивости к Bemisia. ДНК экстрагировали из пула листьев 8 индивидуальных растений каждой DH линии и родительских растений популяции, следуя стандартным протоколам. Родителей популяции скринировали, используя несколько сотен SSRs, чтобы идентифицировать SSRs, которые являются полиморфными среди родителей. DH популяцию последовательно генотипировали, используя идентифицированные полиморфные SSR маркеры. На основании полученных таким образом данных, используя обычно применяемые программы Mapmaker и Joinmap, была подготовлена карта молекулярных маркеров. Маркеры представляют геномные области, полиморфные между родителями популяции.

QTL картирование, т.е. совместный анализ генотипических и фенотипических данных подготовили, используя программу QTL Cartographer. Идентифицировали QTL, которые расположены на разных хромосомах, включая QTL на хромосоме 3, как было продемонстрировано, ассоциирован с устойчивостью к Bemisia. QTL характеризуется посредством маркеров, позиционированных на генетической карте, и маркерные аллели маркеров, для которых известно, что они расположены в области QTL. Тем самым устанавливается(ются) ДНК последовательность(-и), придающая(-ие) одиночную/множественную устойчивость. Детали QTL, ассоциированных с устойчивостью к Bemisia, т.е. фланкирующие маркеры и маркеры, расположенные в области QTL, представлены в таблице 10.

3.2 QTL картирование для устойчивости к трипсу

Подход, идентичный тому, который был описан выше в Примере 3.1, был принят и для картирования QTL, ассоциированного с устойчивостью к трипсу.

QTL, для которого была продемонстрирована ассоциированность с устойчивостью к трипсу, был идентифицирован на хромосоме 5. QTL характеризуется посредством маркеров, позиционированных на генетической карте, и маркерных аллелей маркеров, для которых известно, что они расположены в области QTL. Тем самым устанавливается(ются) ДНК последовательность(-и), придающая(-ие) одиночную/множественную устойчивость. Детали QTL, ассоциированных с устойчивостью к трипсу, т.е. фланкирующие маркеры и маркеры, расположенные в области QTL, представлены в таблице 11.

Заявители осуществили депонирование с действительной датой 10 августа 2006 г. по меньшей мере 2500 семян Capsicum annuum линии 061М4387 в NCIMB Ltd, Ferguson Duilding, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Шотландия под номером доступа NCIMD 41428.

Раскрытое выше изобретение описано в деталях посредством иллюстрации и примера в целях ясности и понятности. Однако будет очевидным, что определенные изменения и модификации, такие как единичные генные модификации и мутации, сомаклональные варианты, варианты индивидов, выбранных из больших популяций растений стабильного инбреда и т.п., могут быть осуществлены в пределах объема изобретения, насколько он ограничен исключительно объемом прилагаемых пунктов притязаний. Таким образом, хотя раскрытое выше изобретение описано в данном документе с некоторыми подробностями, будет очевидным, что изменения и модификация могут быть осуществлены в пределах объема изобретения, насколько он ограничен исключительно объемом прилагаемых пунктов притязаний.

Все цитированные здесь источники включены в данную заявку во всей их полноте.

1. Применение QTL аллеля, ассоциированного с устойчивостью к Bemisia, полученного из линии 061М4387, представленной семенем, которое депонировано под регистрационным номером NCIMB 41428, для придания устойчивости к Bemisia растению Capsicum annuum, у которого отсутствует благоприятный аллель, где указанный аллель QTL может быть выявлен в ПЦР-реакции с парой олигонуклеотидных праймеров, выбранных из SEQ ID NO: 1-12 или SEQ ID NO: 13-26.

2. Способ идентификации в гибридном растении Capsicum annuum локуса количественного признака («QTL»), который способствует устойчивости к Bemisia, включающий использование в ПЦР-реакции:
a) ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранных из группы пар: пара 1 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 1 и обратным праймером с последовательностью SEQ ID NO: 2, идентифицирующая маркерный локус 1; пара 2 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 3 и обратным праймером с последовательностью SEQ ID NO: 4, идентифицирующая маркерный локус 2; пара 3 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 5 и обратным праймером с последовательностью SEQ ID NO: 6, идентифицирующая маркерный локус 3; пара 4 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 7 и обратным праймером с последовательностью SEQ ID NO: 8, идентифицирующая маркерный локус 4; пара 5 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 9 и обратным праймером с последовательностью SEQ ID NO: 10, идентифицирующая маркерный локус 5; и пара 6 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 11 и обратным праймером с последовательностью SEQ ID NO: 12, идентифицирующая маркерный локус 6; и/или
b) ПЦР олигонуклеотидного праймера или пары ПЦР олигонуклеотидных праймеров, выбранных из группы пар: пара 7 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 13 и обратным праймером с последовательностью SEQ ID NO: 14, идентифицирующая маркерный локус 7; пара 8 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 15 и обратным праймером с последовательностью SEQ ID NO: 16, идентифицирующая маркерный локус 8; пара 9 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 17 и обратным праймером с последовательностью SEQ ID NO: 18, идентифицирующая маркерный локус 9; пара 10 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 19 и обратным праймером с последовательностью SEQ ID NO: 20, идентифицирующая маркерный локус 10; пара 11 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 21 и обратным праймером с последовательностью SEQ ID NO: 22, идентифицирующая маркерный локус 11; пара 12 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 23 и обратным праймером с последовательностью SEQ ID NO: 24, идентифицирующая маркерный локус 12, и пара 13 праймеров, представленная прямым праймером с последовательностью SEQ ID NO: 25 и обратным праймером с последовательностью SEQ ID NO: 26, идентифицирующая маркерный локус 13.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы).

Изобретение относится к области микробиологии и паразитологии микроорганизмов. Способ предусматривает рестрикционный анализ бактериальной ДНК бластоцист с использованием комбинации эндонуклеаз рестрикции - Нае III, Pst I и Hind III, позволяющих идентифицировать простейших с различной степенью вирулентности.

Изобретение относится к биотехнологии и представляет собой способ оценки воспаления и/или резистентности к инсулину у животного путем количественного определения присутствия анализируемого вещества в сыворотке или плазме.

Предложенная группа изобретений относится к области медицины и ветеринарии. Предложен биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, содержащий носитель, по меньшей мере одну нуклеиновую кислоту, содержащую гены, кодирующие VEGF и/или SDF-1, и клетки, обеспечивающие репаративную регенерацию.

Предложенная группа изобретений относится к области ветеринарии. Предложена иммуногенная композиция для собак, содержащая эффективное количество вирионов парвовируса с белком типа VP-2, содержащим нуклеиновую кислоту, выбранную из группы, состоящей из SEQ ID NO:2 и SEQ ID NO:4.

Изобретение относится к области молекулярной биологии, биохимии и медицины. Предложена L-нуклеиновая кислота - антагонист MCP-1 и способ её детектирования.

Изобретение относится к области биохимии, в частности к способу идентификации возбудителя чумы и оценки количества микробных клеток, идентифицируемых в качестве возбудителя чумы в исследуемых пробах посредством ПЦР с учетом результатов в режиме реального времени, включающий следующие стадии: выделение ДНК микроорганизма из исследуемых проб, подготовка калибровочной панели, исследование выделенной ДНК в ПЦР с использованием специфических праймеров и зондов с флуоресцентной меткой, идентификация исследуемой ДНК как ДНК микробного или немикробного штамма по наличию нарастания флуоресцентного свечения или его отсутствию соответственно, определение по калибровочной панели концентрации ДНК в пробе.

Изобретение относится к биотехнологии и представляет собой способ определения генотипа человека по полиморфизму в гене коллагена II типа COL2A1 С>А (rs1635529). Данный способ может быть использован при диагностике заболеваний пародонта в ротовой полости.

Изобретение относится к области биотехнологии и пищевой промышленности. Представлено растение ячменя, которое дает зерно и является гомозиготным, по меньшей мере, в двух локусах для введенных генетических вариаций, которые представляют собой: a) аллель, в которой удалена большая часть или все гены, кодирующие В-гордеин в локусе Hor2, и b) мутантную аллель в локусе Lys3 ячменя, так что зерно не содержит ни В-, ни С- гордеинов, и указанные генетические вариации присутствуют в ячмене линий Riso 56 и Riso 1508 соответственно, при этом отсутствие В-гордеинов является обнаружимым по отсутствию амплифицированной ДНК с использованием праймеров: 5'B1hor: 5'-CAACAATGAAGACCTTCCTC-3', 3'B1hor: 5'-TCGCAGGATCCTGTACAACG-3', а отсутствие С-гордеинов является обнаружимым по отсутствию 70 кДа полосы при исследовании спирторастворимого экстракта зерна посредством ДСН-ПААГ.

Изобретение относится к области ветеринарной вирусологии и касается тест-системы и способа для обнаружения РНК вируса болезни Шмалленберг. Предложенная тест-система включает праймер Schm U, имеющий нуклеотидную последовательность 5'-САА ССА GAA GAA GGC САА GA-3', праймер Schm L, имеющий нуклеотидную последовательность 5'-TCT GGC АСА GGA TTT GAG AC-3' и зонд Schm Z, имеющий последовательность 5'-[Hex] CCC CAC САА AAG TAA GAT CGA CAC [BHQ2]-3'.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта. Способ включает определение отношения экспрессии гена парного бокса 2 к экспрессии гена бета-дефензина-1 (PAX2-к-DEFB1) в клетках, полученных из молочной железы субъекта, при этом отношение экспрессии PAX2-к-DEFB1 коррелирует с состояниями молочной железы. Также предложен набор для мониторинга рака молочной железы. Изобретение может быть использовано в медицине при лечении и мониторинге рака. 3 н. и 7 з. п. ф-лы, 40 ил., 8 табл., 17 пр.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека. Разработан набор для количественного определения мРНК МСР1, включающий комбинации олигонуклеотидных праймеров и флюоресцентных зондов для ОТ-ПЦР в реальном времени, для определения количества кДНК гена МСР1 и нормировочных генов RPL32, АСТВ, PII. Использование группы изобретений позволяет уменьшить ошибки вычисления, вносимые при использовании одного нормировочного гена без увеличения числа амплификаций, а также уменьшить ошибки вычислений, возникающие при упрощенном предположении о равенстве эффективности реакций амплификации кДНК MCP1 и нормировачного гена, имеющего место в методе ∆∆Ct. 2 н.п. ф-лы, 2 ил., 3 табл., 1 пр.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам. Разработанные праймеры позволяют получить полную информацию о генах вирусов гриппа птиц, их принадлежности к той или иной генетической линии вируса, наличии нуклеотидных/аминокислотных замен в геноме патогена. Представленное изобретение может быть использовано в диагностических целях идентификации вируса гриппа птиц в вирусологии и ветеринарии, а также для решения научно-исследовательских задач по изучению данного вируса. 1 ил., 2 табл., 4 пр.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны. В качестве биологической мембраны используют клетки сочных мешочков спелой пульпы плода медового помело из рода Citrus. В качестве переносчика РНК используют олеиновую кислоту, содержащуюся в препарате Виталанг-2 в количестве 10,8% и составляющую комплекс с РНК. Для сравнения используют препарат Виталанг-1, содержащий чистую РНК. Клетки помело заливают раздельно водными растворами препаратов Виталанг-1, Виталанг-2 и дистиллированной водой в количестве по 4,8 мл в каждом флакончике. Инкубируют в течение 22 ч при комнатной температуре. С помощью спектрофотометра измеряют оптическую плотность растворов против дистиллированной воды, определяя содержание РНК в клетках помело и окружающем растворе. В результате сравнения полученных значений оптической плотности растворов делают вывод о том, что Виталанг-2 проникает через биологические мембраны в 4,7-4,9 раза эффективнее Виталанга-1. Устанавливают, что спектры поглощения извлеченной из сочных мешочков РНК идентичны таковым для исходных соединений. Изобретение позволяет оценить эффективность олеиновой кислоты, используемой в качестве переносчика РНК через биологические мембраны. 1 пр.

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе. Представленный способ включает предоставление исследуемого образца, реагентов для осуществления амплификации посредством полимеразной цепной реакции (ПЦР) и, по меньшей мере, четырех двояко-меченных зондов. Каждый из зондов является специфическим к своей нуклеотидной последовательности, подлежащей детекции, несет флуоресцентную метку и соответствующий тушитель флуоресценции, причем два зонда несут одинаковую метку и зонды, которые несут одинаковую метку, различаются по температуре плавления (Тпл., Tm). Далее проводят амплификацию нуклеотидных последовательностей и анализ кривой плавления при помощи двояко-меченных зондов в реакционной смеси. Охарактеризованное решение может быть использовано в мультиплексном ПЦР-анализе в реальном времени при диагностике биоагентов. 2 н. и 7 з.п. ф-лы, 9 ил., 21 табл., 2 пр.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР). Изобретение может быть использовано для тестирования на наличие микоплазм в медицине. 3 н. и 12 з. п. ф-лы, 3 табл., 3 пр.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов. Предложен способ идентификации пациента, который нуждается в ранней и/или агрессивной или профилактической терапии сердечно-сосудистого заболевания и способ лечения такого пациента. Предложенная группа изобретений обеспечивает эффективные способы и наборы для определения риска обладания сердечно-сосудистым заболеванием, что позволяет идентифицировать пациента, который нуждается в терапии сердечно-сосудистого заболевания. 4 н. и 6 з.п. ф-лы, 4 ил., 18 табл., 1 пр.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′. Изобретение может быть использовано в медицине, ветеринарии, клинической лабораторной диагностике для выявления ДНК бактерии Coxiella burnetii в пробах, а также для решения научно-исследовательских задач по изучению данного микроорганизма. 2 табл., 2 пр.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине. Получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента и экстрагируют биологический материал: нуклеиновую кислоту или белок из биологического образца. С использованием специфического реагента в отношении продукта экспрессии гена-мишени S100A9, выбранного из праймера амплификации, зонда гибридизации и/или антитела, определяют экспрессию гена-мишени S100A9. Изобретение позволяет по сверхэкспрессии гена-мишени S100A9 по отношению к определенной пороговой величине определить, что пациент с септическим шоком восприимчив к внутрибольничной инфекции. 2 н. и 9 з.п.ф-лы, 2 ил., 3 табл., 5 пр.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy. 3 з.п. ф-лы, 4 ил., 5 табл., 5 пр.
Наверх