Синтетические олигонуклеотиды-праймеры, используемые для получения нуклеотидных последовательностей генов рв2, рв1, ра, np, mp, ns низкопатогенных вирусов гриппа птиц.


 


Владельцы патента RU 2522822:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Новосибирский национальный исследовательский государственный университет" (Новосибирский государственный университет, НГУ) (RU)

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам. Разработанные праймеры позволяют получить полную информацию о генах вирусов гриппа птиц, их принадлежности к той или иной генетической линии вируса, наличии нуклеотидных/аминокислотных замен в геноме патогена. Представленное изобретение может быть использовано в диагностических целях идентификации вируса гриппа птиц в вирусологии и ветеринарии, а также для решения научно-исследовательских задач по изучению данного вируса. 1 ил., 2 табл., 4 пр.

 

Изобретение относится к биотехнологии, молекулярной биологии и может быть использовано в диагностических целях идентификации вируса гриппа птиц в вирусологии и ветеринарии, а также для решения научно-исследовательских задач по изучению данного вируса

Вирусы гриппа птиц (вирус гриппа типа А; ВГП) (Orthomyxoviridae, Influenza virus А) имеют широкий круг хозяев среди млекопитающих и птиц, но их основным резервуаром в природе являются дикие птицы околоводного комплекса. Геном вируса состоит из 8-ми сегментов, представленных одноцепочечными (-)РНК, и кодирующих 10 генов и 13 белков (В. W. Jagger, Н. М. Wise, J. С.Kash, К.-А. Walters, N. М. Wills, Y.-L. Xiao, R. L. Dunfee, L. M. Schwartzman, A. Ozinsky, G. L. Bell, R. M. Dalton, A. Lo, S. Efstathiou, J. F. Atkins, A. E. Firth, J. K. Taubenberger, P. Digard. An Overlapping Protein-Coding Region in Influenza A Virus Segment 3 Modulates the Host Response // SCIENCE. - 337. - 199-204). Вирусы гриппа типа А подразделяются на субтипы на основании антигенных свойств их поверхностных гликопротеинов - гемагглютинина (НА) и нейраминидазы (NA). В настоящий момент известно 17 субтипов НА и 10 субтипов NA, все из которых были выделены от диких птиц, кроме субтипа H17N10, выделенного от летучих мышей (Tong S, Li Y, Rivailler P, Conrardy C, Castillo DA, Chen LM, Recuenco S, Ellison JA, Davis CT, York IA, Turmelle AS, Moran D, Rogers S, Shi M, Tao Y, Weil MR, Tang K, Rowe LA, Sammons S, Xu X, Frace M, Lindblade KA, Cox NJ, Anderson LJ, Rupprecht CE, Donis RO A distinct lineage of influenza A virus from bats. Proc Natl Acad Sci U S A. 2012 Mar 13; 109(11):4269-74).

Анализ известных аналогов. За рубежом для получения нуклеотидных последовательностей генов ВГП используется метод ОТ-ПЦР с ген-специфицными праймерами. Впоследствии, полученные в ходе данной реакции продукты используются в сиквенсовой реакции с использованием уже другого набора ген-специфических праймеров (Е. Hoffmann, J. Stech, Y. Guan, R. G. Webster, D. R. Perez. Universal primer set for the full-length amplification of all influenza A viruses // Arch Virol. - 2001. - 146(12). - №2275-2289). Данный метод не только трудоемок, но и в связи с тем, что используемые в данном случае праймеры разработаны с учетом генетическом особенностей ВГП американской линии, не применим для получения нуклеотидных последовательностей вирусов евразийской линии. В связи с этим, для получения первичных последовательностей генов (РВ2, РВ1, PA, NP, MP, NS) ВГП нами были разработаны последовательности олигонуклеотидных праймеров, специфичных для ВГП евразийской линии. Кроме того, на 5'-конце разработанных нами праймеров имеется последовательность фага М13 - M13-F 5'-TGTAAAACGACGGCCAGT-3', M13-R 5'-CAGGAAACAGCTATGACC-3' (Е. Ghedin, N.A. Sengamalay, М. Shumway, J. Zaborsky, Т. Feldblyum, V. Subbu, D. J. Spiro, J. Sitz, H. Koo, P. Bolotov, D. Dernovoy, T. Tatusova, Y. Bao,K. St. George, J. Taylor, D. J. Lipman, С.M. Fraser, J. K. Taubenberger, S. L. Salzberg. Large-scale sequencing of human influenza reveals the dynamic nature of viral genome evolution // Nature. - 2005. - 437. - 1162-1166), что в значительной мере упрощает и ускоряет процесс постановки сиквенсовой реакции, а также исключает недосеквенирования концевых последовательностей генов. Метод с использованием фрагментов генома фага М13 в последовательности праймеров ранее был разработан Е. Ghedin с соавторами и в настоящий момент применяется для получения последовательностей генов высокопатогенных ВГП H5N1 субтипа (http://gsc.jcvi.org/projects/msc/influenza/infl_a_virus/primers.shtml) и вируса гриппа человека рНШ1 (http://www.who.int/influenza/en/).

Задачей заявляемого изобретения является создание специфичного набора праймеров, содержащего пары олигонуклеотидов, обладающих активностью прямого и обратного праймеров (F и R соответственно), позволяющих получать первичные последовательности полных генов вируса гриппа птиц для дальнейшего генетического анализа.

Техническим результатом предлагаемого изобретения является набор праймеров, разработанных для получения первичных последовательностей генов РВ2, РВ1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц, циркулирующего на территории Евразийского континента. Уникальные олигонуклеотиды не дают перекрестных реакций с родственными видами, позволяют, ограничиваясь одноступенчатой процедурой проведения ПЦР. Разработанные праймеры позволяют получить полную информацию о генах вирусов гриппа птиц, их принадлежности к той или иной генетической линии вируса, наличии нуклеотидных/аминокислотных замен в геноме патогена.

К моменту разработки нового заявляемого набора праймеров, опубликованных данных по молекулярно-генетическому изучению вирусов гриппа птиц, циркулирующих на территории Евразийского континента и России, в частности, не известно. Таким образом, заявляемый объект изобретения обладает критериями новизна, изобретательский уровень и промышленная применимость.

Методика конструирования заявляемых олигонуклеотидных праймеров

Разработка структуры олигонуклеотидных праймеров осуществлялась путем сравнения нуклеотидных последовательностей различных штаммов ВГП, выделенных на территории Евразии и Африки, и депонированных в международной базе данных GeneBank. Локализация в геноме позиций сконструированных олигонуклеотидных праймеров соответствует наиболее консервативным районам генов.

Апробация праймеров была осуществлена с использованием большого числа изолятов ВГП, выделенных от различных видов диких птиц на территории Западной Сибири и Дальнего Востока России, а также Монголии. Было показано, что применение данных праймеров для получения первичных последовательностей ВГП обеспечивает синтез фрагментов ДНК рассчитанного размера в условиях ПЦР и секвенирующей реакций. Специфичность продуктов амплификации была подтверждена методом прямого секвенирования.

Характеристика набора праймеров и участков амплифицируемой геномной РНК

Праймеры фланкируют участки генов РВ2, РВ1, PA, NP, MP, NS низкопатогенных ВГП, кДНК каждого из которых не имеет полиндромных повторов нуклеотидов и не образует выраженных вторичных структур, не имеет протяженных G-C участков. Для пар праймеров расчетная температура плавления была близкой и составила Tm=50°С. Специфичность образующегося фрагмента кДНК устанавливали прямым секвенированием полученного фрагмента, что и было выполнено для некоторого количества штаммов и изолятов ВГП, выделенных в Новосибирской, Омской области и Алтайском крае. Изобретение иллюстрируется примерами, структура которых приведена в таблице 1.

Таблица 1
Структура олигонуклеотидных праймеров для получения первичных последовательностей генов РВ2, РВ1, PA, NP, MP, NS ВГП в образцах
Структура праймера (5'→3') Локализация в геноме Размер ампликона (п.н.)
1 TGTAAAACGACGGCCAGTGAGCAAAAGCAGGGTAG CAGGAAACAGCTATGACCCTTGCATMAGRGAGCAC NP-2F NP-551R 549
2 TGTAAAACGACGGCCAGTAAGAARACTGGRGGWCC CAGGAAACAGCTATGACCGGCARGCAKGAYTTATG NP-313F NP-875R 562
3 TGTAAAACGACGGCCAGTAATTYCAAACAGCAGCAC NP-730F
CAGGAAACAGCTATGACCCTTTTAGAAACAAGGGTATT NP-1563R 833
4 TGTAAAACGACGGCCAGTAGCAAAAGCAGGGTGAC CAGGAAACAGCTATGACCTTATCATTCCATTCMAGT С NS-1F NS-576R 575
5 TGTAAAACGACGGCCAGTTGGTWCATGCTNATGCC CAGGAAACAGCTATGACCAGTAGAAACAAGGGTGTT NS-327F NS-890R 563
6 TGTAAAACGACGGCCAGTGCAGGTAGATRTGAAAG CAGGAAACAGCTATGACCCCAAAAGCMACTTYCGT M-8F M-459R 451
7 TGTAAAACGACGGCCAGTAARAGRGARATAACATTC CA CAGGAAACAGCTATGACCGATCACTTGAATCGCTG M-334F M-785R 451
8 TGTAAAACGACGGCCAGTATGGTGCAGRCRATGAG CAGGAAACAGCTATGACCAGTAGAAACAAGGTAGTAG M-658F M-1053R 395
9 TGTAAAACGACGGCCAGTAGCRAAAGCAGGTACTG CAGGAAACAGCTATGACCCTCTCYTCATCAAGRGT PA-IF PA-523R 522
10 TGTAAAACGACGGCCAGTAAGATAAARTCHGARAAGAC CAGGAAACAGCTATGACCTGBTKGGCTCYTTCCA PA-432F PA-990R 558
11 TGTAAAACGACGGCCAGTARGGRGARGGKATACC CAGGAAACAGCTATGACCTRGCWGCACARGATGC PA-917F PA-1454R 537
12 TGTAAAACGACGGCCAGTCCDATTGARCAYATTGC CAGGAAACAGCTATGACCTKGAGCYTTCYTCCAC PA-1339F PA-1922R 583
13 TGTAAAACGACGGCCAGTCARCARATTGARAGCATG CAGGAAACAGCTATGACCTTGGACAGTATGGATAGC PA-1796F PA-2212R 416
14 TGTAAAACGACGGCCAGTAGGCAAACCATTTGAATG CAGGAAACAGCTATGACCCCATTGATTCCATYACAT С PB1-11F PB1-549R 538
15 TGTAAAACGACGGCCAGTCARACYTATGAYTGGAC CAGGAAACAGCTATGACCGTTATCATTGCYARAAACAT PB1-404F PB1-974R 570
16 TGTAAAACGACGGCCAGTGSAATGARAARAARGCTA А PB1-848F
CAGGAAACAGCTATGACCCARCTRAARTTGGCTAC PB1-1547R 699
17 TGTAAAACGACGGCCAGTGATGAYTTYGCYCTCAT PB1-1358F
CAGGAAACAGCTATGACCYTGGTACATYTGYTCATC PB1-2078R 720
18 TGTAAAACGACGGCCAGTCAGATGGRGGRCCAAA PB1-1798F
CAGGAAACAGCTATGACCATTTTTTCAYGAAGGACA AG PB1-2328R 530
19 TGTAAAACGACGGCCAGTGTCTCAGGKAGCRAAAG PB2-4F
CAGGAAACAGCTATGACCTCCCARCAGGTYCCTT PB2-761R 757
20 TGTAAAACGACGGCCAGTTTRATGGTKGCWTACATG PB2-628F
CAGGAAACAGCTATGACCCYTATCATRCARTCCTC PB2-1247R 619
21 TGTAAAACGACGGCCAGTAYGARGARTTYACAATGG PB2-1106F
CAGGAAACAGCTATGACCTCCCADTTYCTRATGATC PB2-1678R 572
22 TGTAAAACGACGGCCAGTAGTRGATGARTATTCCAG PB2-1481F
CAGGAAACAGCTATGACCCRCCTGCRTCYTTTCC PB2-2048R 576
23 TGTAAAACGACGGCCAGTTACCATTTGCRGCAGC PB2-1882F
CAGGAAACAGCTATGACCGAAACAAGGTCGTTTTTAAA PB2-2341R 459

Примеры 1-4 иллюстрируют алгоритм апробации сконструированных олигонуклеотидных праймеров на примере штамма A/teal/Chany/7119/2008(H15N4).

Пример 1. Выделение РНК ВГП из образцов вируссодержащей аллантоисной жидкости куриных эмбрионов.

Для оценки эффективности использования нашего изобретения было исследовано 20 образцов вируссодержащей аллантоисной жидкости куриных эмбрионов. О наличии в исследуемом материале ВГП судили на основании результатов метода ПЦР в режиме реального времени с использованием зонда (5'-FAM-TCAGGCCCCCTCAAAGCCGA-BHQ,-3') и пар праймеров на М ген (5'-TCGA AACGT ACGTTCTCTCTATC-3'), (5'-TGTCTTCAGCCАТТССATGAG-3'), длина фрагмента составляет 103 н.п. Постановка реакции осуществлялась согласно следующему протоколу:

0.5 pmol dNTPs

0.5 pmol смеси праймеров

0.5 pmol зонда

10 мкл 10х буфера (100mM TrisHCl (рН=8.9), 160 тМ (NH4)2SO4, 0.5% Tween20, 25 mM MgCl2)

0,5 о.е. Taq-ДНК полимераза (СибЭнзим, Россия)

Суммарный объем реакции доводили до 25 мкл водой (nuclease free).

ПЦР программа (52 цикла) включала следующие стадии:

1.Т=95°С,3 минуты,

2. Т=95°С, 40 секунд,

Т=58°С*, 30 секунд

Т=72°С, 30 секунд

Детектирование флуоресценции производилось на стадии отжига.

Для отслеживания наличия внутрилабораторной контаминации постановка реакции осуществлялась в присутствии отрицательного контроля. ПЦР проводили на амплификаторе IQCycler (BioRad, США).

В качестве положительного контроля был использован вирус A/gadwall/Altai/1202/2007(H5N2) (номера штамма в GenBank CY049753-CY049760).

Выделение РНК ВГП из вируссодержащей аллантоисной жидкости куриных эмбрионов производили с использованием коммерческого набора Promega SV Total RNA Isolation Kit (Promega, США) согласно инструкции производителя.

Пример 2. Получение кДНК методом обратной транскрипции.

Постановка реакции обратной транскрипции производилась коммерческим набором M-MuLV Reverse Transcriptase (BioLabs Inc., США) согласно инструкции производителя и с использованием Random праймера (Fermentas, Литва).

Пример 3. Проведение полимеразной цепной реакции.

Постановка ПЦР осуществлялась с использованием коммерческого набора PyroStart Fast PCR Master Mix (2x) (Fermentas, Литва) и разработанных праймеров, специфичных на соответствующие гены. Использовали следующие параметры ПЦР: 96°С 30 с, затем 95°С 10 с, 50°С 30 с, 68°С 30 сек 35 циклов. Завершающий синтез проводили 10 мин 68°С. Полученные продукты реакции очищались с помощью гель-электрофореза в 1,5% агарозном геле и 1х ТАЕ буфере. ДНК визуализировали после окраски бромистым этидием (Sigma, США) при освещении УФ-светом. Длина фрагментов продуктов реакции определялась в сравнении с используемым ДНК- маркером (Gene Ruler 100bp DNA Ladder Plus, Fermentas, Литва). Выделение фрагментов ДНК осуществлялось коммерческим набором QIAquick Gel Extraction Kit (Quagen, Германия) согласно инструкции производителя.

Пример 4. Определение нуклеотидной последовательности:

Определение нуклеотидной последовательности выделенного ПЦР фрагмента проводили на 3130×1 Genetic Analyzer (Applied Biosystem, США) по методу Sanger et al., согласно инструкции к BigDye Terminator 3.1v Cycler (Applied Biosystem, США) с использованием универсальных праймеров М13 (M13-F 5'-TGTAAAACGACGGCCAGT-3', M13-R 5'-CAGGAAACAGCTATGACC-3'). Температура отжига праймеров составляет 50°С. Чистка секвенирующей реакции производилась коммерческим набором BigDye XTerminator Purification Kit (Applied Biosystem, США) согласно инструкции производителя. Нуклеотидные последовательности были проанализированы с использованием программы ContigExpress (Invitrogene Inc., США) и базы данных Influenza virus Recourse (NCBI, США).

Результат исследований: У полученных ПЦР-продуктов были определены нуклеотидные последовательности и выведены аминокислотные последовательности.

Специфичность набора праймеров была подтверждена при исследовании заведомо положительных образцов, прямым секвенированием полученного ПЦР-фрагмента. В таблице 2 приведены данные о происхождении образцов материала, для которых были определены нуклеотидные и выведены аминокослотные последовательности. На рисунке 1 приведена электрофореграмма, на которой изображены продукты ПЦР, полученные с использованием разработанных праймеров и их специфичности.

Таблица 2
Данные об образцах материала, в которых была обнаружена, выделена РНК ВГП и определена нуклеотидная последовательность генов вируса
№ п/п Название штамма Номера последова тельностей Ген Длина Вид животного
гена
(GenBank) (п.н.)
1. A/teal/Chany/7119/2008(H 15N4) CY098537 PB2 2280 Чирок свистунок (Anas crecca)
2. A/teal/Chany/7119/2008(H15N4) CY098538 PB1 2274 Чирок свистунок (Anas crecca)
3. A/teal/Chany/7119/2008(H15N4) CY098539 PA 2151 Чирок свистунок (Anas crecca)
4. A/teal/Chany/7119/2008(H15N4) CY098541 NP 1497 Чирок свистунок (Anas crecca)
5. A/teal/Chany/7119/2008(H15N4) CY098543 MP 982 Чирок свистунок (Anas crecca)
6. A/teal/Chany/7119/2008(H15N4) CY098544 NS 844 Чирок свистунок (Anas crecca)
7. A/teal/Chany/444/2009(H8N8) CY098521 PB2 2295 Чирок свистунок (Anas crecca)
8. A/teal/Chany/444/2009(H8N8) CY098522 PB1 2274 Чирок свистунок (Anas crecca)
9. A/teal/Chany/444/2009(H8N8) CY098523 PA 2151 Чирок свистунок (Anas crecca)
10. A/teal/Chany/444/2009(H8N8) CY098525 NP 1497 Чирок свистунок (Anas crecca)
11. A/teal/Chany/444/2009(H8N8) CY098527 MP 992 Чирок свистунок (Anas crecca)
12. A/teal/Chany/444/2009(H8N8) CY098528 NS 870 Чирок свистунок (Anas crecca)

На рисунке 1 приведена электрофореграмма ПЦР продуктов, полученных при использовании разработанных пар праймеров на гены РВ2, РВ1, PA, NP, MP, NS. Дорожки 1-23 соответствуют ПЦР продуктам, полученным с кДНК вируса A/teal/Chany/7119/2008(H15N4), и соответствуют нумерации фрагментов, указанных в таблице 1. Дорожка L - ДНК маркер (Gene Ruler 100bp DNA Ladder Plus).

При исследовании отрицательных контрольных образцов положительных результатов получено не было.

Разработка заявленного набора праймеров позволила получить данные о некоторых генетических характеристиках ВГП, циркулирующих на территории Западной Сибири, Дальнего Востока России и Монголии среди диких птиц.

Синтетические олигонуклеотиды-праймеры, используемые для получения нуклеотидных последовательностей генов (PB2, PB1, PA, NP, MP, NS) низкопатогенных вирусов гриппа птиц, имеющие следующую структуру (5'→3'):

NP-2F TGTAAAACGACGGCCAGTGAGCAAAAGCAGGGTAG
NP-551R CAGGAAACAGCTATGACCCTTGCATMAGRGAGCAC
NP-313F TGTAAAACGACGGCCAGTAAGAARACTGGRGGWCC
NP-875R CAGGAAACAGCTATGACCGGCARGCAKGAYTTATG
NP-730F TGTAAAACGACGGCCAGTAATTYCAAACAGCAGCAC
NP-1563R CAGGAAACAGCTATGACCCTTTTAGAAACAAGGGTATT
NS-1F TGTAAAACGACGGCCAGTAGCAAAAGCAGGGTGAC
NS-576R CAGGAAACAGCTATGACCTTATCATTCCATTCMAGT С
NS-327F TGTAAAACGACGGCCAGTTGGTWCATGCTNATGCC
NS-890R CAGGAAACAGCTATGACCAGTAGAAACAAGGGTGTT
M-8F TGTAAAACGACGGCCAGTGCAGGTAGATRTGAAAG
M-459R CAGGAAACAGCTATGACCCCAAAAGCMACTTYCGT
M-334F TGTAAAACGACGGCCAGTAARAGRGARATAACATTC CA
M-785R CAGGAAACAGCTATGACCGATCACTTGAATCGCTG
M-658F TGTAAAACGACGGCCAGTATGGTGCAGRCRATGAG
M-1053R CAGGAAACAGCTATGACCAGTAGAAACAAGGTAGTAG
PA-1F TGTAAAACGACGGCCAGTAGCRAAAGCAGGTACTG
PA-523R CAGGAAACAGCTATGACCCTCTCYTCATCAAGRGT
PA-432F TGTAAAACGACGGCCAGTAAGATAAARTCHGARAAGAC
PA-990R CAGGAAACAGCTATGACCTGBTKGGCTCYTTCCA
PA-917F TGTAAAACGACGGCCAGTARGGRGARGGKATACC
PA-1454R CAGGAAACAGCTATGACCTRGCWGCACARGATGC
PA-1339F TGTAAAACGACGGCCAGTCCDATTGARCAYATTGC
PA-1922R CAGGAAACAGCTATGACCTKGAGCYTTCYTCCAC
PA-1796F TGTAAAACGACGGCCAGTCARCARATTGARAGCATG
PA-2212R CAGGAAACAGCTATGACCTTGGACAGTATGGATAGC
PB1-11F TGTAAAACGACGGCCAGTAGGCAAACCATTTGAATG
PB1-549R CAGGAAACAGCTATGACCCCATTGATTCCATYACAT С
PB1-404F TGTAAAACGACGGCCAGTCARACYTATGAYTGGAC
PB1-974R CAGGAAACAGCTATGACCGTTATCATTGCYARAAACAT

PB1-848F TGTAAAACGACGGCCAGTGSAATGARAARAARGCTA A
PB1-1547R CAGGAAACAGCTATGACCCARCTRAARTTGGCTAC
PB1-1358F TGTAAAACGACGGCCAGTGATGAYTTYGCYCTCAT
PB1-2078R CAGGAAACAGCTATGACCYTGGTACATYTGYTCATC
PB1-1798F TGTAAAACGACGGCCAGTCAGATGGRGGRCCAAA
PB1-2328R CAGGAAACAGCTATGACCATTTTTTCAYGAAGGACA AG
PB2-4F TGTAAAACGACGGCCAGTGTCTCAGGKAGCRAAAG
PB2-761R CAGGAAACAGCTATGACCTCCCARCAGGTYCCTT
PB2-628F TGTAAAACGACGGCCAGTTTRATGGTKGCWTACATG
PB2-1247R CAGGAAACAGCTATGACCCYTATCATRCARTCCTC
PB2-1106F TGTAAAACGACGGCCAGTAYGARGARTTYACAATGG
PB2-1678R CAGGAAACAGCTATGACCTCCCADTTYCTRATGATC
PB2-1481F TGTAAAACGACGGCCAGTAGTRGATGARTATTCCAG
PB2-2048R CAGGAAACAGCTATGACCCRCCTGCRTCYTTTCC
PB2-1882F TGTAAAACGACGGCCAGTTACCATTTGCRGCAGC
PB2-2341R CAGGAAACAGCTATGACCGAAACAAGGTCGTTTTTAAA



 

Похожие патенты:

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы).

Изобретение относится к области микробиологии и паразитологии микроорганизмов. Способ предусматривает рестрикционный анализ бактериальной ДНК бластоцист с использованием комбинации эндонуклеаз рестрикции - Нае III, Pst I и Hind III, позволяющих идентифицировать простейших с различной степенью вирулентности.

Изобретение относится к биотехнологии и представляет собой способ оценки воспаления и/или резистентности к инсулину у животного путем количественного определения присутствия анализируемого вещества в сыворотке или плазме.

Предложенная группа изобретений относится к области медицины и ветеринарии. Предложен биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, содержащий носитель, по меньшей мере одну нуклеиновую кислоту, содержащую гены, кодирующие VEGF и/или SDF-1, и клетки, обеспечивающие репаративную регенерацию.

Предложенная группа изобретений относится к области ветеринарии. Предложена иммуногенная композиция для собак, содержащая эффективное количество вирионов парвовируса с белком типа VP-2, содержащим нуклеиновую кислоту, выбранную из группы, состоящей из SEQ ID NO:2 и SEQ ID NO:4.

Изобретение относится к области молекулярной биологии, биохимии и медицины. Предложена L-нуклеиновая кислота - антагонист MCP-1 и способ её детектирования.

Изобретение относится к области биохимии, в частности к способу идентификации возбудителя чумы и оценки количества микробных клеток, идентифицируемых в качестве возбудителя чумы в исследуемых пробах посредством ПЦР с учетом результатов в режиме реального времени, включающий следующие стадии: выделение ДНК микроорганизма из исследуемых проб, подготовка калибровочной панели, исследование выделенной ДНК в ПЦР с использованием специфических праймеров и зондов с флуоресцентной меткой, идентификация исследуемой ДНК как ДНК микробного или немикробного штамма по наличию нарастания флуоресцентного свечения или его отсутствию соответственно, определение по калибровочной панели концентрации ДНК в пробе.
Изобретение относится к области вирусологии и касается штамма вируса гриппа H10N7-cyбтипа. Охарактеризованный штамм вируса гриппа A/pochard/Siberia/249/08-МА H10N7-субтипа выделен из клоакального смыва красноголового нырка и адаптирован к линии BALB/c мышей.
Изобретение относится к области ветеринарной микробиологии, вирусологии и биотехнологии и касается способа получения вакцины против инфекционного ринотрахеита крупного рогатого скота.
Изобретение относится к медицинской вирусологии и микробиологии. Способ оценки активности лечебно-профилактических препаратов против вируса натуральной оспы включает введение в организм модельных животных контрольной и испытуемой групп по заданной схеме суспензии исследуемого противовирусного препарата, интраназальное заражение их штаммом вируса натуральной оспы, инкубацию вируса в организме животных и определение концентрации вируса в легких животных с последующим вычислением оценочных показателей снижения концентрации вируса в легких.

Изобретение относится к области вирусологии и биотехнологии. Штамм вируса иммунодефицита человека I-типа ИВ741 выделен на территории РФ от больного не получавшего АРВ-терапию.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу B, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.

Изобретение относится к области биохимии, в частности к полипептидам, которые являются ингибиторами клетки метанопродуцента и биологическими маркерами для детекции фага φmru, а также к полинуклеотидам, которые кодируют эти полипептиды.
Изобретение относится к области биотехнологии и может быть использовано при производстве медико-биологических препаратов. Фармацевтическая композиция содержит бактериофаги, полученные путем культивирования на питательной среде, содержащей глюкозу, натрий хлористый, натрий двузамещенный фосфорнокислый, дрожжевой автолизат жидкий и очищенную воду в заданном соотношении, и высушенные с наполнителем без лиофилизации, в виде таблеток с желудочно-резистентным покрытием.

Изобретение относится к области биотехнологии и вирусологии. Представлены выделенные штаммы вируса гриппа, которые способны инфицировать собачьих и вызывать респираторное заболевание в собачьих.
Изобретение относится к области пищевой промышленности, биотехнологии и касается композиции антибактериальной и штамма бактериофага Escherichia coli, используемого для получения такой композиции.
Изобретение относится к области ветеринарной биотехнологии и вирусологии и касается штамма диплоидных клеток легкого плода крупного рогатого скота. Охарактеризованный штамм выделен из легкого плода коровы и депонирован в Специализированной Коллекции перевиваемых соматических клеточных культур сельскохозяйственных и промысловых животных РККК(П) (СХЖ РАСХН) при Всероссийском научно-исследовательском институте экспериментальной ветеринарии им.

Изобретения относятся к области биотехнологии и касаются рекомбинантной плазмидной ДНК pQE30/Derf2L и штамма бактерий Escherichia coli M15/pQE30/Derf2L. Охарактеризованная рекомбинантная плазмидная ДНК кодирует белок Der f 2L клеща Dermatophagoides farinae и состоит из BamHI/HindIII - фрагмента ДНК плазмиды pQE30 и последовательности ДНК, кодирующей BamHI/HindIII фрагмент, включающий ген Der f2L Dermatophagoides farinae.
Наверх