Биологический днк маркер для идентификации гена устойчивости к х вирусу картофеля



Биологический днк маркер для идентификации гена устойчивости к х вирусу картофеля
Биологический днк маркер для идентификации гена устойчивости к х вирусу картофеля
Биологический днк маркер для идентификации гена устойчивости к х вирусу картофеля

 


Владельцы патента RU 2522828:

Федеральное государственное бюджетное учреждение науки Центр "Биоинженерия" Российской академии наук (RU)

Изобретение относится к области биохимии, в частности к биологическому ДНК маркеру, позволяющему идентифицировать ген Rx у культурного картофеля S. tuberosum и его гомологи у родственных дикорастущих видов рода Solanum sect. Petota. Изобретение позволяет эффективно идентифицировать ген Rx у культурного картофеля S. tuberosum и его гомологи у родственных дикорастущих видов рода Solanum sect. Petota. 2 ил., 1 пр.

 

Описание изобретения.

Изобретение относится к генетике и биотехнологии растений, в частности к молекулярно-генетическим исследованиям, и связанно с идентификацией генов устойчивости к Х вирусу картофеля (PVX).

В качестве настоящего изобретения предложен биологический ДНК маркер (пара олигонуклеотидных праймеров), позволяющий идентифицировать Rx гены и их гомологи у широкого круга видов клубнеобразующего картофеля рода Solarium секции Petota, использующихся в качестве доноров устойчивости к вирусу PVX при создании новых сортов картофеля.

Результаты реализации данного изобретения могут быть использованы в селекции, а так же в биотехнологии для получения сортов картофеля, устойчивых к X вирусу. Потери урожая картофеля, наносимые Х вирусом картофеля (PVX), могут в неблагоприятные годы достигать 34%. На сегодняшний день не существует надежных химических средств борьбы с вирусными инфекциями, в том числе и с PVX, что связано с биологией их возбудителей. В этой связи единственным наиболее действенным и актуальным подходом является создание сортов картофеля, несущих гены устойчивости к вирусам.

В настоящее время основным алгоритмом создания сортов картофеля, устойчивых к PVX, является идентификация вариантов генов гомологов Rx, определяющих устойчивость к X вирусу у образцов дикорастущих видов картофеля, и введение этих генов гомологов Rx в геном культурного картофеля S. tuberosum. Идентификация генов гомологов Rx позволит выявлять образцы дикорастущих видов клубнеобразующего картофеля, которые можно использовать в качестве доноров устойчивости к PVX при скрещиваниях и отслеживать их наследуемость в поколениях при создании устойчивых сортов. Идентификация Rx генов устойчивости к PVX у образцов вида S. tuberosum и гомологов Rx генов у широкого круга видов клубнеобразующего картофеля рода Solarium секции Petota посредством предложенного изобретения весьма актуальна, так как в настоящий момент полноразмерная последовательность гена Rx известна только для вида культурного картофеля S. tuberosum и его разновидности S. tuberosum spp. Andigena. Другие гомологи гена Rx у Solarium секции Petota в базах данных не приводятся.

Разработанные праймеры позволяют идентифицировать (амплифицировать, секвенировать) новые гены гомологи Rx у широкого круга видов клубнеобразующего картофеля Solanum секции Petota, для которых первичная последовательность этих генов неизвестна.

В настоящее время известен способ получения растений с повышенной устойчивостью к широкому спектру патогенов (вирусы, грибные инфекции и др.), который включает полипептиды и кодирующие их полинуклеотиды, способные активизировать гиперчувствительный ответ, инициируемый патогенами, в частности PVX. Патент также рассматривает ген устойчивости Rx Solanum tuberosum или его различные гомологи (естественные или синтетические), такие как 111h1; 221h2;AC15; Ac64; K39.hom (Европейский патент - WO 9954490).

Известен способ идентификации R-генов устойчивости к фитофторе (Phytophthora pathotypes) у представителей рода Solanum с использованием эффектор-рецепторного подхода (Европейский патент EP 1950304).

Известен способ конструирования слитых генов для повышения устойчивости к PVX и PVY вирусам картофеля. Метод основан на слиянии СР гена белка оболочки PVX вируса и Nib гена репликазы PVY вируса и конструировании гена RNAiCN с двойной резистентностью. Трансформация картофеля полученной конструкцией повышает устойчивость растений как к PVX, так и к PVY вирусам картофеля (патент Китая CN 101092624).

Известен способ детекции TMV-устойчивых растений с использованием ДНК маркеров или праймеров (Европейский патент - WO 2007097574 (A1)).

Известен способ скрининга генофонда томатов на устойчивость к патогенам и экстремальным факторам среды, а также определения нуклеотидных последовательностей генов устойчивости, локализованных в хромосоме 6 (Mi, MEu-1), обеспечивающих устойчивость этой культуры к нематодам и тлям (Европейский патент KR 20000029896).

Известен способ получения трансгенных сортов картофеля и томата, устойчивых к фитофторозу, который основан на введении в растение ДНК, которая кодирует продукт, способный обеспечивать растение семейства Solanaceae и его потомство устойчивостью к поражению оомицетным грибом Phytophthora infestans (Российский патент №2361920).

Проведенный анализ патентных источников показывает, что, несмотря на возрастающий поток информации о путях достижения устойчивости растений к болезням, имеется острая потребность в идентификации генов и кодируемых ими белков, которые могут в дальнейшем использоваться для селекции сортов сельскохозяйственных растений, обладающих пролонгированной системой резистентности к заболеваниям широкого спектра действия.

Недостатком перечисленных способов является специфичность использования подходов и маркеров только для определенных видов растений и генов. При этом не существует способа, позволяющего идентифицировать последовательности гена Rx, определяющего устойчивость к вирусу PVX у сортов картофеля Solanum tuberosum, а также у представителей рода Solanuum секции Petota, наиболее часто используемых в скрещиваниях при создании новых сортов картофеля.

Задачей предлагаемого изобретения является идентификация Rx генов устойчивости к X вирусу и их гомологов у широкого круга сортов и видов картофеля использованием биологического ДНК маркера, представленного парой специфических олигонуклеотидных праймеров, позволяющих амплифицировать последовательность гена Rx и его гомологов у родственных клубнеобразующих видов Solanum секции Petota, использующихся в скрещиваниях при селекции новых устойчивых сортов.

Таким образом, изобретение - биологический ДНК маркер:

а) должен быть представлен олигонуклеотидными праймерами следующего состава:

RXUF 5′ GGTCTCTGCTTTTGTCTACATGATG 3′

RXUR 5′ GCCACTGGATTTAGCCTTTGCG 3′,

позволяющими амплифицировать ДНК последовательность длиной около 3600 п.н.у дикорастущих клубнеобразующих видов Solanum секции Petota с высокой нуклеотидной гомологией (более 80%) к Rx гену картофеля Solanum tuberosum.

б) должен быть специфичен для гена картофеля Rx, определяющего устойчивость к вирусу PVX, то есть быть пригодным для специфической амплификации именно последовательностей данного гена и его гомологов у клубнеобразующих видов Solanum секции Petota.

в) должен быть применим как для культурного картофеля Solanum tuberosum, так и для родственных дикорастущих видов клубнеобразующего картофеля рода Solanum секции Petota

Вышеуказанный результат достигается тем, что использование биологического ДНК маркера после полимеразной реакции амплификации позволяет получить Rx ген и его гомологи у сортов картофеля Solanum tuberosum и родственных дикорастущих видов клубнеобразующего картофеля рода Solanum секции Petota.

В результате использования биологического ДНК маркера для идентификации гена устойчивости к X вирусу картофеля появляется возможность для поиска новых источников устойчивости к X вирусу среди дикорастущих видов картофеля, а также для повышения эффективности генетико-селекционных мероприятиях, связанных с выведением новых сортов картофеля, устойчивых к X вирусу.

Методика использования изобретения.

Для идентификации функционального гена устойчивости к Х вирусу картофеля собирают живой растительный материал исследуемых образцов или сортов (от 5-10 растений сорта).

Наилучшим материалом для последующего выделения суммарной ДНК являются молодые ткани листьев. При наличии клубневого материала клубни предварительно проращивают до появления из глазковых почек 1-2 листков.

Выделение ДНК.

Выделение тотальной ДНК проводили по следующей методике.

1. Лизис клеток.

К листовой высечке (~0.05 мг) в пробирке типа Eppendorf объемом 1,5 мл добавляют 400 мкл лизирующего буфера (200 мМ трис - HCl, pH=7,5; 250 мМ NaCl; 25 мМ EDTA; 0,5% SDS). Растительный материал в буфере при комнатной температуре гомогенизируют с помощью специальных пестиков. Смесь инкубируют в термостате или водяной бане в течение 20 минут при 65°C.

2. Депротеинизация ДНК.

В пробирку со смесью, содержащей лизированные клетки и ядра, добавляют 200 мкл предварительно охлажденного 5 М ацетата калия, перемешивают и инкубируют на ледяной бане 20 мин. После инкубации смесь центрифугируют 15 мин при 16000 g.

Полученный надосадочный супернатант (около 450 мкл) переносят в новую пробирку и подвергают двукратной очистке равным объемом смеси фенол (содержит 0.1% антиоксидантов 8-оксихинолина и 0.2% меркаптоэтанола)/хлороформ (смесь хлороформа и изоамилового спирта (24:1)). Супернатант и смесь фенол/хлороформ плавно перемешивают до образования эмульсии, а затем центрифугируют 5 минут при 16000 g. После чего верхнюю фазу с растворенной ДНК отбирают пипеткой в чистую пробирку. Фенолхлороформная депротеинизация повторяется 2-3 раза до полной очистки раствора ДНК от белков.

3. Осаждение ДНК.

Осаждение ДНК производят путем добавления к очищенному супернатанту 0.6 V изопропанола; смесь перемешивают и центрифугируют в течение 15 мин при 16000 g. Спирт сливают и осадок промывают 70% этанолом не менее 3 раз, просушивают и растворяют в 20-25 мкл бидистиллированной стерильной воды.

Оценка качества и количества экстрагированной ДНК.

Оценку качества и количества экстрагированной ДНК производят путем измерения оптической плотности раствора ДНК на анализаторе типа Биофотометр (Bio Photometer, Eppendorf) либо путем проведения аналитического электрофореза.

После определения концентрации и чистоты ДНК (на спектрофотометре/или в геле) концентрации ДНК в пробах стандартизируют путем разведения в стерильной бидистиллированной воде до 100 мкг/мкл.

Полимеразная цепная реакция (ПЦР).

1. Проведение ПЦР

Выделенную ДНК используют в качестве матрицы в реакции амплификации.

Амплификацию ДНК проводят в реакционной смеси объемом 15 мкл, содержащей 10х буфер для соответствующей полимеразы, 0,16 мМ каждого dNTP, 1.2 мМ MgCl2, 0.6 мкМ биологического ДНК маркера, 0.3 ед DreamTaq полимеразы (Fermentas, Литва) и 100 нг геномной ДНК в термоциклере «Applied Biosystems 2700» (США) в режиме: денатурация - 30 сек - 94°C; отжиг - 45 сек - 60°C; синтез ДНК - 3 мин 20 сек- 72°C (35 циклов) с предварительной денатурацией - 5 мин (94°C) и заключительной элонгацией PCR-фрагментов 10 мин - 72°C.

2. Электрофоретическое разделение и визуализация ПНР-продуктов.

Продукты амплификации подвергают аналитическому электрофорезу в 0.8% агарозном геле толщиной 5-7 мм, содержащем бромистый этидий в 1х ТВЕ буфере. В качестве маркеров молекулярного веса используется Gene RuleTM DNA Ladder Mix (″Fermentas″, Литва). Вхождение фрагментов в гель осуществляют при 50 V в течение 10-20 минут, а разделение фрагментов - в течение 1-2 часов при 75-90 V.

Визуализацию осуществляют путем окрашивания гелей бромистым этидием согласно инструкции производителя, с последующим фотодокументированием.

Положительным результатом считается получение уникального фрагмента ДНК размером около 3600 п.н. Размер амплифицируемых продуктов определяют с помощью маркера молекулярных масс GeneRuleTM DNA Ladder mix (″Fermentas″, Литва).

Соответствие полученных фрагментов искомым последовательностям генов Rx проверяется по следующей методике:

1. Клонирование полученных фрагментов в вектор.

Полученные продукты ПЦР реакции клонируют с использованием системы Qiagen cloning plus kit (Qiagen, Нидерланды). Лигирование с вектором проводят в 10 мкл реакционной смеси, которая включала 1 мкл вектора (pDrive Cloning Vector (50 нг/мкл)), 3 мкл ПЦР продукта, 5 мкл Ligation Master Mix и очищенную воду.

Для трансформации используют QIAGEN EZ Competent Cells (из соответствующего набора). К 1 мл раствора, содержащего компетентные клетки, добавляют 2 мкл лигазной смеси и инкубируют на льду в течение 5 минут. Затем смесь нагревают на водяной бане при 42°C в течение 30 секунд, с последующим охлаждением на льду в течение 2 минут. К охлажденным клеткам добавляют 250 мкл среды SOC (из соответствующего набора). Полученную смесь разносят по чашкам Петри со средой LBA (Luria-Bertani - бакто-триптон, бакто-дрожжевой экстракт, NaCI, агар), содержащей ампицилин (100 мг/мл), XGal (40 мг/мл) и IPTG (100 мМ) по 100 мкл на чашку.

Отбор колоний на наличие вставки проводился при помощи метода бело-голубой селекции. Чашки Петри выдерживали при температуре 37°C в течение 12 часов, затем отбирали белые колонии. Белые колонии используют в качестве матрицы в реакции амплификации.

2. Амплификация клонированных генов устойчивости к X вирусу.

Амплификацию ДНК проводят в реакционной смеси объемом 15 мкл, содержащей 10х буфер для соответствующей полимеразы, 0,16 мМ каждого dNTP, 1.2 мМ MgCl2, 0.3 мкМ биологического ДНК маркера, представленного последовательностями RXUF и RXUR, 0.3 ед DreamTaq полимеразы (Fermentas, Литва) и клетки бактериальной колонии (~0.3 мкл) в термоциклере «Applied Biosystems 2700» (США) в режиме: денатурация - 30 сек - 94°C; отжиг праймера - 45 сек - 60°C; синтез ДНК - 3 мин 20 сек- 72°C (35 циклов) с предварительной денатурацией - 5 мин (94°C) и заключительной элонгацией PCR-фрагментов 10 мин - 72°C.

Применение праймерной пары должно приводить к образованию фрагмента ДНК длиной ~3600 п.н.

Продукты амплификации подвергают аналитическому электрофорезу в 0.8% агарозном геле толщиной 5-7 мм, содержащем бромистый этидий в 1х ТВЕ буфере. В качестве маркеров молекулярного веса используется Gene RuleTM DNA Ladder Mix (″Fermentas″, Литва). Вхождение фрагментов в гель осуществляют при 50 V в течение 10-20 минут, а разделение фрагментов - в течение 1-2 часов при 75-90 V.

Первичные последовательности ДНК полученных ПЦР продуктов определяют при помощи метода Сэнгера на автоматическом анализаторе ДНК ABI3730 (Applied Biosystems, США).

Установленные последовательности ДНК анализируют при помощи программы BLAST (Altschul et al., 1990) на соответствие известным последовательностям функциональных генов устойчивости к X вирусу картофеля.

Пример выполнения предлагаемого способа.

Способ идентификации гена устойчивости к Х вирусу у образцов дикорастущих видов картофеля.

Из растительного материала образцов 3 видов клубнеобразующего картофеля S. megistacrolobum, S. acaule, S. berthaultii получают ДНК с использованием вышеописанного метода. ДНК, выделенную из каждого образца, используют в качестве матрицы для проведения полимеразной цепной реакции при описанных выше условиях с использованием биологического ДНК маркера, представленного последовательностями RXUF и RXUR. Полученные продукты амплификации визуализируют путем электрофореза в геле и клонируют в бактериальном векторе способом описанным выше. Последовательности клонированных ДНК фрагментов амплифицируют с использованием биологического ДНК маркера, представленного последовательностями RXUF и RXUR. Размер полученных фрагментов должен составлять ~ 3600 п.н. (фиг.1).

Первичные последовательности генов устойчивости к X вирусу определяют на автоматическом анализаторе ДНК ABI3730 (Applied Biosystems, США). Соответствие полученных последовательностей гену устойчивости к X вирусу картофеля проверяется с использованием программы BLAST [Altschul et al., 1990] или MEGA 5 [Tamura et al., 2011] (фиг.2). Уровень нуклеотидной гомологии с последовательностью Rx гена картофеля Solanum tuberosum должен составлять более 80%.

Аналогично возможно получить соответствующие последовательности для любого другого образца видов рода Solanum sect. Petota.

Таким образом, использование биологического ДНК маркера приводит к идентификации гена Rx и его гомологов у культурного картофеля Solanum tuberosum и родственных дикорастущих видов клубнеобразующего картофеля рода Solanum секции Petota.

Литература

1. Altschul, S; Gish, W; Miller, W; Myers, E; Lipman, D (October 1990). ″Basic local alignment search tool″. Journal of Molecular Biology 215 (3): 403-410.

2. Tamura К, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731-2739.

Биологический ДНК маркер, представляющий собой пару олигонуклеотидных последовательностей: SEQ ID №1-5′ GGTCTCTGCTTTTGTCTACATGATG 3′ и SEQ ID №2-5′ GCCACTGGATTTAGCCTTTGCG, позволяющий идентифицировать ген Rx у культурного картофеля S. tuberosum и его гомологи у родственных дикорастущих видов рода Solanum sect. Petota.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к способу увеличения биомассы или улучшения пролиферации клеток, развития листа и/или репродуктивного развития растения, содержащему увеличение в растении экспрессии нуклеиновой кислоты, кодирующей Убиквитин-Специфичную Протеазу, а также к растению, части растения и семени растения, биомасса которых увеличена или пролиферация клеток, развитие листа и/или репродуктивное развитие которых улучшены указанным способом.

Изобретение относится к области биохимии, в частности к генам устойчивости Rpi для повышения устойчивости к фитофторозу пасленовых у растений семейства пасленовых, а также к белкам, способным опосредовать ответ против Р.infestans.

Изобретение относится к области биохимии. .

Изобретение относится к образующему кочан растению салата латука вида Lactuca sativa, имеющему красные листья по всему кочану, включая центральную часть кочана. .

Изобретение относится к области биотехнологии и может быть использовано в сельском хозяйстве. .

Изобретение относится к области биотехнологии, к защитным генам растений, кодирующим биологически активные пептиды с антифунгальной активностью. .

Изобретение относится к области генной инженерии, конкретно к получению вариантов аллергена группы I из Роасеае (зубровка душистая), и может быть использовано для специфической иммунотерапии (гипосенсибилизации) пациентов, имеющих аллергии на пыльцу растений, или для профилактической иммунотерапии аллергий на пыльцу.

Изобретение относится к рекомбинантной экспрессии дефенсинов насекомых в клетке мицелиальных грибов рода Aspergillus. .

Изобретение относится к биотехнологии и представляет собой выделенную полинуклеотидную молекулу с функцией rEVE, рекомбинантный вектор экспрессии, экспрессионный шаттл-вектор, клетку-хозяина, а также способы с использованием вышеуказанной выделенной полинуклеотидной молекулы.

Изобретение относится к области биохимии, в частности к способу специфического отбора высокоаффинных молекул ДНК (ДНК-аптамеров) к рекомбинантному белку-мишени. Указанный способ включает синтез единой полипептидной цепи рекомбинантного белка, содержащего в своем составе фрагмент глютатион-S-трансферазы, целевой белок-мишень, пептидную последовательность, расщепляемую летальным фактором B.

Изобретение относится к области генной инженерии, конкретно к анализу нарушений, связанных с раком яичников, и может быть использовано в медицине. Способ включает определение геномного статуса метилирования CpG-динуклеотидов в каждой последовательности из группы последовательностей SEQ ID NO:1-10 с использованием набора зондов, специфичных для указанных последовательностей и способных гибридизоваться с последовательностью по всей длине.

Изобретение относится к области биотехнологии и касается набора, включающего олигодезоксирибонуклеотидные праймеры и флуоресцентно меченный зонд для идентификации ДНК аденовируса серотипов 3, 4, 7, 14, 21 методом гибридизационно-флуоресцентной полимеразной цепной реакции в режиме реального времени.
Изобретение относится к молекулярной биологии и генетике клетки. Предложен способ, включающий этапы предварительной экстракции геномной ДНК, выделения специфической фракции однонитевых G-оверхенгов теломерной ДНК и последующей амплификации их минусовой цепи с дуплекс-специфическим анализом, причем этапы амплификации включают модификацию 3'-концов теломерных оверхенгов с помощью терминальной дезоксинуклеотидилтрансферазы и осуществляются с использованием набора праймеров SEQ ID NO: 1-5.

Изобретение относится к области молекулярной биологии. Предложен одноцепочечный модифицированный олигонуклеотид, способный ингибировать экспрессию рецептора фактора роста фибробластов 4 FGFR4, а также соответствующие композиция и способы лечения диабета, ожирения, метаболического синдрома, ингибирования экспрессии FGFR4, снижения уровня глюкозы и снижения массы тела.
Изобретение относится к области биохимии и молекулярной биологии, а именно к способу очистки синтетических олигодезоксирибонуклеотидов. Основной задачей настоящего изобретения является разработка эффективного способа очистки олигодезоксирибонуклеотидов с высоким выходом и высокой степенью очистки от производных кремниевой кислоты, пригодного для крупномасштабного синтеза.

Группа изобретений относится к области биохимии. Предложен сосуд из пластика для сорбирования нуклеиновых кислот из жидкой среды.
Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии, конкретно к экспрессионным конструкциям, и может быть использовано для экспрессии иммуноглобулина. .

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT. Изобретение позволяет эффективно анализировать структуру внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. 1ил.
Наверх