Способ специфичной детекции малопредставленных фракций рнк в в биологическом образце


 


Владельцы патента RU 2524115:

БАКСТЕР ИНТЕРНЭШНЛ ИНК. (US)
БАКСТЕР ХЕЛТКЭР С.А. (CH)

Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР). Изобретение может быть использовано для тестирования на наличие микоплазм в медицине. 3 н. и 12 з. п. ф-лы, 3 табл., 3 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к способу и набору для детекции малопредставленных фракций РНК в биологическом образце и к способу и набору для определения наличия микоплазменного загрязнения в биологическом образце.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

К числу наиболее широко распространенных и результативных способов детекции и анализа молекул РНК относится так называемый ОТ/ПЦР (обратная транскрипция/полимеразная цепная реакция). В этом способе, РНК молекулы транскрибируют в молекулы кДНК посредством обратной транскриптазы (ОТ) и затем определяют и/или анализируют способами на основе ПЦР.

В более ранних исследованиях в этой области для обратной транскрипции использовали или ОТ вируса миелобластоза птиц или ОТ вируса лейкоза Молони мышей. Однако значительную проблему при использовании РНК в качестве матрицы для синтеза кДНК представляла неспособность этих мезофильных вирусных ОТ синтезировать кДНК в области стабильных вторичных структур РНК. Для разрешения этой проблемы обратную транскрипцию можно выполнять при повышенных температурах, что позволяет разрушать вторичные структуры РНК и дополнительно увеличивать специфичность при удлинении праймера. Это требует применения термостабильных ферментов для обратной транскрипции, таких как ДНК-полимераза Thermus thermophilus (Tth pol), активность которой является оптимальной при температуре 70°C.

Однако применение термостабильных ферментов для обратной транскрипции также создает ряд новых проблем. В частности, при попытке определить и/или анализировать малопредставленные фракции РНК в биологическом образце, термостабильный фермент для обратной транскрипции во время последовательных стадий ОТ/ПЦР может катализировать образование неспецифичных продуктов реакции. Это особенно относится к образцам, которые содержат большое фоновое количество суммарной РНК, что приводит к последовательному повышению нижнего предела детекции представляющей интерес РНК до уровней, намного выше, чем может быть необходимо, например, при контроле качества биофармацевтических препаратов. Для разрешения этой проблемы, все манипуляции и стадии ОТ/ПЦР, следующие за обратной транскрипцией, надлежит осуществлять при повышенных температурах и в условиях “горячего старта”. Это, однако, часто является практически нецелесообразным и невыгодным, особенно при работе в производственном масштабе.

Применение, где чувствительность детекции малопредставленных фракций РНК, часто при наличии большого фонового количества суммарной РНК, является особенно важной, представляет собой детекцию микоплазменного загрязнения в биологическом образце.

Микоплазмы представляют собой бактериальные микроорганизмы с наименьшими размерами геномов, способных к саморепликации. Хотя большинство микоплазм представляют собой природные безопасные симбионты, некоторые из них способны инфицировать своих природных хозяев и вызывать заболевания различной степени тяжести. Микоплазмы, особенно виды семейства Mycoplasma и Acholeplasma, также представляют собой частую причину загрязнения первичных и стабильных клеточных линий и являются серьезной проблемой для исследовательских и производственных лабораторий, включенных в разработку и получение биологических и фармацевтических препаратов, полученных на основе клеток. Таким образом, несмотря на все профилактические меры, которые, как правило, применяются на всем протяжении культивирования клеточных линий и работы с ними, микоплазменное загрязнение остается часто встречающейся проблемой.

Аналитические протоколы, рекомендованные для тестирования клеточных линий и биологических продуктов, полученных на основе клеток, на наличие микоплазм, включают использование культуры бульон/агар и тестирование индикаторных клеточных линий. Способ на основе культуры бульон/агар предназначен для детекции хорошо культивируемых микоплазменных видов, в то время как индикаторную клеточную линию используют для детекции микоплазменных видов, трудно поддающихся культивированию. Хотя комбинация двух этих способов способствует эффективной детекции наличия микоплазм, в целом способы тестирования являются дорогостоящими, трудоемкими и требуют большого количества времени (минимум 28 суток). Кроме того, существует ряд не поддающихся культивированию видов микоплазм, которые не подлежат детекции данным способом.

Недавно разработаны новые способы тестирования на наличие микоплазм, основанные на амплификации нуклеиновых кислот, в частности рибосомальных РНК микоплазменного происхождения. Эти способы имеют некоторые преимущества в отношении денежных затрат, аналитической чувствительности, простоты исполнения и временных затрат. Однако величина уровня нижнего предела детекции у существующих способов все еще выше, чем это необходимо при контроле качества биофармацевтических препаратов, особенно при работе с образцами, в которых представлено большое фоновое количество суммарной РНК или других макромолекул.

Таким образом, в данной области существует необходимость в усовершенствовании существующих способов ОТ/ПЦР, что позволит расширить пределы детекции малопредставленных фракций РНК в биологических образцах.

Решение проблемы, указанной выше, осуществляют посредством вариантов осуществления, представленных в пунктах формулы изобретения.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Задачей по настоящему изобретению является создание усовершенствованного способа детекции малопредставленных фракций РНК в биологическом образце. В частности, настоящее изобретение относится к указанному способу и набору для детекции малопредставленных фракций РНК в биологическом образце. Дополнительно, другой задачей по настоящему изобретению является создание усовершенствованного способа и набора для определения микоплазменного загрязнения в образце.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В одном аспекте, настоящее изобретение относится к способу детекции малопредставленных представляющих интерес фракций РНК в биологическом образце, где способ включает стадии:

(а) обратная транскрипция РНК в кДНК с использованием обратной транскриптазы (ОТ);

(b) инактивация ОТ и

(с) детекция представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Как применяют в настоящем документе, термин “биологический образец” относится к любому образцу, который содержит или предполагают, что он содержит, биологически значимые макромолекулы, такому как, например, образцы, полученные на различных стадиях процесса получения биофармацевтических препаратов, например, вакцин или рекомбинантных белков, образцы супернатантов клеточной культуры, лизатов клеток, экстрактов клеток, проб продуктов питания или окружающей среды, образцы, взятые из организма человека или животного, такие как образцы цельной крови, сыворотки, плазмы, мочи, ликвора или мазки, к любым другим образцам биологического происхождения и любой другой композиции, которая содержит или ожидают, что она содержит РНК.

В предпочтительном варианте осуществления настоящего изобретения, биологический образец содержит большое фоновое количество клеточных компонентов.

Как применяют в настоящем документе, термин “клеточные компоненты” относится к клеточным органеллам, белкам, пептидам, мембранам, липидам, нуклеиновым кислотам, в частности, к фракциям РНК, не являющимся целью исследования по настоящему изобретению, и их комбинациям или фрагментам.

В другом предпочтительном варианте осуществления настоящего изобретения, биологический образец содержит большое фоновое количество суммарной РНК.

Как применяют в настоящем документе, термин “большое фоновое количество суммарной РНК” относится к ситуации, когда количество молекул представляющей интерес РНК представлено менее чем одной молекулой в количестве суммарных молекул РНК, равном 104, предпочтительно менее чем одной молекулой в количестве суммарных молекул РНК, равном 106, более предпочтительно менее чем одной молекулой в количестве суммарных молекул РНК, равном 108, и наиболее предпочтительно как менее чем одной молекулой в количестве суммарных молекул РНК равном 1010.

В предпочтительном варианте осуществления настоящего изобретения представляющая интерес РНК представлена в количестве менее чем 10000 копий на мл образца, предпочтительно менее чем 1000 копий на мл образца, более предпочтительно менее чем 100 копий на мл образца, и наиболее предпочтительно менее чем 10 копий на мл образца.

В предпочтительном варианте осуществления настоящего изобретения, обратную транскрипцию РНК в кДНК с использованием ОТ осуществляют, согласно способу по настоящему изобретению, в условиях “горячего старта”.

Как применяют в настоящем документе, термин “условия “горячего старта”” относится к любым условиям, при которых реакционную смесь, перед добавлением фермента, осуществляющего удлинение праймера, нагревают до температуры плавления или выше температуры плавления комплекса праймер/нуклеиновая кислота, или если фермент, который осуществляет удлинение праймера, неактивен при температуре окружающей среды и активируется стадией активации при высокой температуре, которую проводят при температуре плавления или выше температуры плавления комплекса праймер/нуклеиновая кислота.

В предпочтительном варианте осуществления настоящего изобретения, способ по настоящему изобретению дополнительно содержит, после стадии обратной транскрипции РНК в кДНК с использованием ОТ, стадию амплификации представляющей интерес кДНК с использованием той же ОТ. Эту дополнительную стадию называют “первичная ПЦР” и предпочтительно осуществляют в течение 5-15 циклов в условиях “горячего старта”, более предпочтительно в течение 5-11 циклов в условиях “горячего старта”, и наиболее предпочтительно в течение пяти или в течение десяти циклов в условиях “горячего старта”.

Таким образом, в другом аспекте настоящее изобретение относится к способу детекции малопредставленных фракций РНК в биологическом образце, где способ включает стадии:

(a) обратной транскрипции РНК в кДНК с использованием обратной транскриптазы (ОТ);

(b) амплификации кДНК посредством полимеразной цепной реакции (ПЦР) с использованием ОТ из стадии (a);

(c) инактивацию ОТ и

(d) детекции представляющей интерес кДНК посредством ПЦР.

Ферменты, которые обладают активностью как ОТ (т.е. РНК-зависимая ДНК-полимераза), так и ДНК-полимеразы (т.е. ДНК-зависимая ДНК-полимераза), хорошо известны в данной области и включают, например, ДНК-полимеразу Thermus thermophilus (Tth pol). Условия, при которых конкретный фермент демонстрирует конкретную активность, также являются хорошо известными в данной области. В случае Tth pol, его активность в качестве обратной транскриптазы обеспечивается ионами Mn2+, а активность в качестве ДНК-полимеразы обеспечивается ионами Mg2+.

В предпочтительном варианте осуществления настоящего изобретения, ОТ, используемая в способе по настоящему изобретению, представляет собой ДНК-полимеразу Thermus thermophilus (Tth pol). В дополнительном предпочтительном варианте осуществления Tth pol получена рекомбинантным способом (rTth-pol).

В другом предпочтительном варианте осуществления настоящего изобретения, в способе по настоящему изобретению ОТ инактивируют, предпочтительно способом, выбранным из группы, состоящей из термической обработки, обработки фенолом, обработки протеиназой K и обработки хаотропным средством.

Термическая обработка по настоящему изобретению включает нагревание реакционной смеси, содержащей ОТ, до 80-100°C, предпочтительно до 90-100°C, более предпочтительно до 95°C. Продолжительность термической обработки составляет от 15 до 90 минут, предпочтительно от 30 до 75 минут, более предпочтительно 60 минут. В особенно предпочтительном варианте осуществления, термическая обработка включает нагревание реакционной смеси, содержащей ОТ, до 95°C в течение 60 минут.

По настоящему изобретению обработка протеиназой К включает добавление от 1 до 10 единиц протеиназы К в реакционную смесь, более предпочтительно от 2 до 5 единиц протеиназы K или наиболее предпочтительно 5 единиц протеиназы K. Продолжительность обработки протеиназой К составляет от 30 до 90 минут, предпочтительно от 45 до 75 минут или наиболее предпочтительно 60 минут. В особенно предпочтительном варианте осуществления, обработка протеиназой К включает добавление 5 единиц протеиназы К и продолжительность обработки составляет 60 минут.

В предпочтительном варианте осуществления настоящего изобретения, в способе по настоящему изобретению ОТ инактивируют обработкой хаотропным средством. Обработка хаотропным средством по настоящему изобретению включает добавление хаотропного средства в реакционную смесь, содержащую ОТ, в количестве и в течение времени, достаточном для инактивации ОТ. Добавляемое количество и время обработки хорошо известны в данной области для конкретного хаотропного средства. В более предпочтительном варианте осуществления настоящего изобретения, хаотропное средство выбирают из группы, состоящей из мочевины, перхлората лития и соли гуанидиния. В наиболее предпочтительном варианте осуществления, хаотропное средство представляет собой соль гуанидиния.

В дополнительном предпочтительном варианте осуществления настоящего изобретения, способ по настоящему изобретению дополнительно содержит, после инактивации ОТ с использованием хаотропного средства, стадию удаления хаотропного средства из реакционной смеси. Способы удаления хаотропного средства из реакционной смеси хорошо известны в данной области и включают, например, очистку нуклеиновых кислот, содержащихся в реакционной смеси, с использованием связывающих ДНК центрифужных колонок.

Детекция представляющей интерес кДНК посредством ПЦР также называют ““буст” ПЦР”. В предпочтительном варианте осуществления настоящего изобретения, полимеразная цепная реакция (ПЦР) в способе по настоящему изобретению представляет собой ПЦР в реальном времени.

Как применяют в настоящем документе, термин “ПЦР в реальном времени” относится к любому способу, основанному на полимеразной цепной реакции (ПЦР) и который позволяет амплифицировать и одновременно определять количество представляющей интерес ДНК молекулы.

В предпочтительном варианте осуществления настоящего изобретения представляющая интерес РНК получена из микоплазмы. Как применяют в настоящем документе, термин “микоплазма” относится к любому семейству класса молликутов, которое включает вид Mycoplasma, Ureaplasma, Mesoplasma, Entomoplasma, Spiroplasma, Acholeplasma, Asteroleplasma и Thermoplasma. В более предпочтительном варианте осуществления настоящего изобретения, микоплазму выбирают из группы, состоящей из Acholeplasma laidlawii, Mycoplasma gallisepticum, Mycoplasma hyorhinis, Mycoplasma hominis, Mycoplasma fermentans, Mycoplasma synoviae и Mycoplasma orale.

В дополнительном предпочтительном варианте осуществления настоящего изобретения представляющая интерес РНК представляет собой рибосомальную РНК 16S (рРНК 16S).

В другом аспекте настоящее изобретение относится к способу детекции микоплазменного загрязнения в биологическом образце, где способ включает стадии:

(a) выделение суммарной РНК из образца;

(b) обратная транскрипция РНК в кДНК с использованием обратной транскриптазы (ОТ);

(с) амплификация кДНК, полученной на основе рибосомальной РНК 16S (рРНК 16S) микоплазмы посредством полимеразной цепной реакции (ПЦР) с использованием ОТ из стадии (b);

(d) инактивация ОТ посредством добавления хаотропного средства;

(e) удаление хаотропного средства из реакционной смеси и

(f) детекция кДНК, полученной на основе рРНК 16S из микоплазмы посредством полимеразной цепной реакции (ПЦР).

Способы выделения суммарной РНК из образца хорошо известны в данной области и включают выделение с фенолом/хлороформом и осаждение изопропанолом.

В предпочтительном варианте осуществления настоящего изобретения, микоплазменное загрязнение, подлежащее детекции, представляет собой загрязнение, составляющее не более чем приблизительно 10 КОЕ/мл микоплазм в образце.

Хорошо известны в данной области праймеры для обратной транскрипции рРНК 16S из микоплазмы, а также праймеры для амплификации посредством ПЦР кДНК, полученной на основе рРНК 16S из микоплазмы.

В предпочтительном варианте осуществления настоящего изобретения, обратную транскрипцию РНК в кДНК с использованием ОТ из способа детекции микоплазменного загрязнения в образце выполняют в условиях “горячего старта”.

В другом предпочтительном варианте осуществления настоящего изобретения, ОТ, которую используют в способе детекции микоплазменного загрязнения в образце, представляет собой ДНК-полимеразу Thermus thermophilus (Tth pol). В дополнительном предпочтительном варианте осуществления Tth pol получена рекомбинантным способом (rTth-pol).

В дополнительном предпочтительном варианте осуществления настоящего изобретения, хаотропное средство, которое используют в способе детекции микоплазменного загрязнения в образце, выбирают из группы, состоящей из мочевины, перхлората лития и соли гуанидиния. В наиболее предпочтительном варианте осуществления, хаотропное средство представляет собой соль гуанидиния.

В одном дополнительном предпочтительном варианте осуществления настоящего изобретения, ПЦР в способе детекции микоплазменного загрязнения в образце представляет собой ПЦР в реальном времени.

В другом аспекте настоящее изобретение относится к набору для детекции малопредставленных представляющих интерес фракций РНК в биологическом образце, содержащем, по меньшей мере, ОТ и средства для инактивации ОТ. Средства для инактивации ОТ могут представлять собой протеиназу К или хаотропное средство. Набор может дополнительно содержать, например, праймеры для обратной транскрипции, праймеры для детекции специфических кДНК, РНК-носитель, калибровочную РНК, калибровочную ДНК, подходящие ферменты, буферы, реагенты, емкости для реакции и расходные материалы.

В дополнительном аспекте, настоящее изобретение относится к набору для детекции микоплазменного загрязнения в биологическом образце, содержащем, по меньшей мере, рекомбинантную ДНК-полимеразу Thermus thermophilus (rTth-pol), подходящие праймеры для обратной транскрипции рРНК 16S микоплазмы, подходящие праймеры для амплификации кДНК, полученной из рРНК 16S микоплазмы, хаотропное средство для инактивации rTth-pol, средства для удаления хаотропного средства из реакционной смеси и праймеры для детекции кДНК, полученной на основе рРНК 16S микоплазмы посредством ПЦР, например, ПЦР в реальном времени. Средства для удаления хаотропного средства могут представлять собой связывающие ДНК центрифужные колонки. Набор может дополнительно содержать, например, средства для выделения суммарной РНК из образца, РНК-носитель, калибровочную РНК, калибровочную ДНК, подходящие ферменты, буферы, реагенты, емкости для реакции и/или расходные материалы. Средства для выделения суммарной РНК могут представлять собой фенол, хлороформ и изопропанол или буферы, содержащие т.п.

Настоящее изобретение будет дополнительно проиллюстрировано в следующих примерах, которые не являются ограничивающими.

ПРИМЕРЫ

Общий способ:

Выполнение способа начинают с центрифугирования представляющего интерес биологического образца, с последующим выделением суммарной РНК из осадка в образце. РНК затем подвергают обратной транскрипции в кДНК, используя рекомбинантную ДНК-полимеразу Thermus thermophilus (rTth-pol) в присутствии Mn2+ в условиях “горячего старта”. После хелатирования Mn2+ и добавления Mg2+, rTth-pol осуществляет амплификацию посредством ПЦР в течение 5 циклов или в течение 10 циклов в условиях “горячего старта” (первичная ПЦР). Реакционную смесь ПЦР затем переносят в буфер, содержащей гуанидин, для инактивации rTth-pol. Очистка посредством набора, основанного на использовании центрифужной колонки, дает в результате очищенные ПЦР-продукты первичной ПЦР, которые затем амплифицируют совместно со стандартной ДНК (калибровочная ДНК) в дуплексной ПЦР в реальном времени (“буст” ПЦР). Альтернативно, РНК-стандарт (калибровочную РНК) можно добавлять на начальных стадиях процесса выделения РНК для нормирования и контроля процесса на начальных стадиях.

Экспериментальные способы:

Выделение РНК. Все стадии проводили в реакционных пробирках объемом 2 мл. 2 мл образца центрифугировали при 4°C в течение 10 мин при 1000 об/мин. Осадок ресуспендировали в 1 мл РНК-Bee™ (Tel-Test Inc., TX), добавляли 5 мкл 1 мг/мл дрожжевой тРНК и образец инкубировали в течение 20 мин в центрифуге при 70°C и 1000 об/мин. Затем, добавляли 110 мкл хлороформа и проводили разделение фаз посредством центрифугирования в течение 5 мин при 13000 об/мин. Проводили осаждение РНК посредством добавления 500 мкл изопропанола к полученной в результате верхней фазе и образцы в течение 5 мин оставляли на сухом льду. Осадок РНК собирали посредством центрифугирования в течение 15 мин при 13000 об/мин, промывали 500 мкл 70% EtOH и образец центрифугировали в течение 10 мин при 13000 об/мин, супернатант удаляли и осадок РНК растворяли в 250 мкл дважды дистиллированной H2O (bdH2O).

Обратная транскрипция. 6 мкл смеси для ОТ (1 мкл 10-кратного буфера для обратной транскрипции (Applied Biosystems, Austria), 1 мкл 10 мМ MnCl2, 0,5 мкл 10 мкМ обратного праймера, 0,8 мкл 2,5 мМ dNTP каждого, 2,2 мкл (5,5 Ед) rTth-pol и 0,5 мкл bdH2O) добавляли к 4 мкл выделенной РНК. Обратную транскрипцию проводили в течение 2 мин при 80°C, 5 мин при 62°C, 10 мин при 70°C и 2 мин при 80°C.

Первичная ПЦР. 40 мкл смеси для ПЦР (4 мкл 10-кратного хелатирующего буфера (Applied Biosystems, Austria), 5 мкл 25 мМ MgCl2, 2,5 мкл 10 мкМ прямого праймера, 2 мкл 10 мкМ обратного праймера и 26,5 мкл bdH2O), которую предварительно прогревали до 85°C±5°C, добавляли к реакционной смеси, полученной на этапе обратной транскрипции. ПЦР проводили по следующему протоколу: 2 мин при 80°C, 2 мин при 95°C, 5x(10 с при 95°C, 30 с при 62°C, 30 с при 72°C).

Инактивация ОТ. После первичной ПЦР, 50 мкл все еще горячей реакционной смеси добавляли к 253 мкл буфера для инактивации (3 мкл РНК-носителя (1 мкг/мкл дрожжевой тРНК), 250 мкл буфера PBI (Qiaquick PCR Purification Kit; Qiagen, Germany)) и перемешивали. Образцы помещали в центрифужные колонки Qiaquick mini (Qiagen, Germany) в 2 мл пробирку для сбора образцов и центрифугировали в течение 1 мин при 13000 об/мин. Пробирку для сбора образцов удаляли, центрифужную колонку помещали в новую пробирку для сбора образцов, добавляли 750 мкл буфера PE (Qiaquick PCR Purification Kit; Qiagen, Germany) и образец центрифугировали в течение 1 мин при 13000 об/мин. Пробирку для сбора образцов вновь удаляли и центрифужную колонку центрифугировали в новой пробирке для сбора образца в течение 1 мин при 13000 об/мин. Центрифужную колонку затем помещали в новую реакционную пробирку объемом 1,5 мл, 50 мкл 10 мМ Tris (pH 8,0) добавляли и проводили элюцию ДНК посредством центрифугирования в течение 1 мин при 13000 об/мин.

“Буст” ПЦР. 10 мкл элюированной ДНК помещали в оптическую пробирку и добавляли 5 мкл калибровочной ДНК в качестве контроля и 35 мкл смеси TMPCR (1xTaqMan Буфер A (Applied Biosystems, Austria), 5 мМ MgCl2, 200 нМ каждого праймера, 100 нМ каждой пробы, 200 мкМ каждого dNTP, 9% глицерина (масс./об.), 0,05% желатин (масс./об.), 0,01% Tween 20 (масс./об.), 2,5 Ед полимеразы AmpliTaq Gold (Applied Biosystems, Austria)). ПЦР в реальном времени проводили по следующему протоколу: 10 мин при 95°C, 40x(15 с при 95°C, 1 мин при 62°C).

Пример 1: Детекция Mycoplasma synoviae в образцах, полученных в процессе производства вакцины

В образцы, полученные в процессе производства вакцины, вносили различные количества Mycoplasma synoviae и анализировали согласно описанным выше экспериментальным способам. Для того чтобы продемонстрировать положительное воздействие инактивации ОТ (образцы 1-6), включали контрольные образцы, в которых ОТ не инактивировали (образцы 7-12) или в которые совсем не добавляли ОТ (образцы 13-18). После выделения РНК, обратной транскрипции, первичной ПЦР и инактивации ОТ, образцы анализировали на наличие кДНК посредством ПЦР в реальном времени. Перед этой “буст” ПЦР, заданное количество калибровочной ДНК добавляли к реакционной смеси. Данную калибровочную ДНК амплифицировали вместе с представляющими интерес нуклеиновыми кислотами с использованием различных наборов праймеров. Сигналы от калибровочной и представляющей интерес ДНК дифференцировали, используя различные меченые зонды. Праймеры для первичной и “буст” ПЦР являлись специфичными для рРНК 16S микоплазмы. Результаты, просуммированные в таблице 1, демонстрируют значения Ct, полученные при ПЦР в реальном времени, т.е. количество циклов, необходимое для детекции специфического продукта ПЦР. Низкие значения Ct подразумевают более быструю детекцию, в то время как значения Ct, равное 40, показывают, что на протяжении всего времени проведения ПЦР в реальном времени продукта обнаружено не было.

Таблица 1
Детекция Mycoplasma synoviae в образцах,
полученных в процессе производства вакцины
Образец № M.synoviae КОЕ/мл ОТ присут-ствует ОТ инакти-вирована Ct (калибро-вочная) Ct (представ-ляющая интерес)
1 100 + + 29,88 30,82
2 100 + + 29,67 30,71
3 10 + + 29,68 33,16
4 10 + + 29,71 35,42
5 - + + 29,85 40,00
6 - + + 29,95 40,00
7 100 + - 39,30 40,00
8 100 + - 34,41 40,00
9 10 + - 34,64 40,00
10 10 + - 35,12 40,00
11 - + - 34,42 40,00
12 - + - 36,11 40,00
13 100 - - 29,56 40,00
14 100 - - 29,43 40,00
15 10 - - 29,39 40,00
16 10 - - 29,40 40,00
17 - - - 29,31 40,00
18 - - - 29,37 40,00

Результаты, представленные в таблице 1, убедительно показывают, что наличие активной ОТ (образцы 7-12) не позволяет определить даже 100 КОЕ/мл Mycoplasma synoviae, а инактивация ОТ позволяет определить даже всего 10 КОЕ/мл. Увеличение определяемых значений Ct для калибровочной ДНК в образцах, в которых не инактивировали ОТ, показывает, что без инактивации ОТ является способной катализировать реакции, приводящие к образованию неспецифических продуктов реакции, которые препятствуют образованию специфических продуктов калибровочной и представляющей интерес ДНК в течение проведения “буст” ПЦР. Объяснение основано на факте того, что в образцах, к которым совсем не добавили ОТ (образцы 13-18), значения Ct для калибровочной ДНК представлены на том же уровне, что и в образцах, в которых ОТ инактивирована (образцы 1-6).

Пример 2: Детекция Mycoplasma fermentans в образцах, полученных в процессе производства вакцины

В образцы, аналогичные образцам в примере 1, вносили различные количества Mycoplasma fermentans и анализировали согласно описанным выше экспериментальным способам. Для того чтобы показать положительное воздействие инактивации ОТ (образцы 1-6), включали контрольные образцы, в которых не инактивировали ОТ (образцы 7-12). После выделения РНК, обратной транскрипции, первичной ПЦР и инактивации ОТ, образцы анализировали на наличие кДНК посредством ПЦР в реальном времени. Перед “буст” ПЦР, заданное количество калибровочной ДНК добавляли в реакционную смесь. Праймеры для первичной и “буст” ПЦР и в этом примере представляли собой праймеры, специфичные к рРНК 16S микоплазмы. Результаты, просуммированные в таблице 2, демонстрируют значения Ct, полученные в результате ПЦР в реальном времени.

Таблица 2
Детекция Mycoplasma fermentans в образцах, полученных в процессе производства вакцины
Образец № M.synoviae КОЕ/мл ОТ присут-ствует ОТ инакти-вирована Ct (калибро-вочная) Ct (представ-ляющая интерес)
1 100 + + 29,31 29,57
2 100 + + 29,46 30,44
3 10 + + 29,30 33,46
4 10 + + 29,47 34,72
5 - + + 29,67 40,00
6 - + + 29,27 40,00
7 100 + - 40,00 40,00
8 100 + - 40,00 40,00
9 10 + - 40,00 40,00
10 10 + - 40,00 40,00
11 - + - 40,00 40,00
12 - + - 40,00 40,00

Результаты в таблице 2 подтверждают, что в то время как наличие активной ОТ (образцы 7-12) не позволяет определять даже 100 КОЕ/мл Mycoplasma fermentans, инактивация ОТ позволяет определить даже всего 10 КОЕ/мл. Увеличение определяемых значений Ct для калибровочной ДНК в образцах, в которых не инактивировали ОТ, показывает, что без инактивации ОТ является способной катализировать реакции, приводящие к образованию неспецифических продуктов реакции, которые препятствуют образованию специфических продуктов калибровочной и представляющей интерес ДНК в течение проведения “буст” ПЦР.

Пример 3: Детекция Mycoplasma fermentans в образцах, полученных в процессе производства рекомбинантного белка

В образцы, полученные в процессе производства рекомбинантного белка, вносили различное количество Mycoplasma fermentans и анализировали согласно описанным выше экспериментальным способам. Положительное воздействие инактивации ОТ представлено в таблице 3, образцы 1-6. Что касается образцов, полученных при производственном получении вакцины, способ также позволяет детекцию всего 10 КОЕ/мл Mycoplasma fermentans, внесенных в суспензию клеток, используемых для получения рекомбинантного белка.

Таблица 3
Детекция Mycoplasma fermentans в образцах, полученных в процессе производства рекомбинантного белка
Образец № M.synoviae КОЕ/мл ОТ присут-ствует ОТ инакти-вирована Ct (калибро-вочная) Ct (представ-ляющая интерес)
1 100 + + 28,33 27,34
2 100 + + 28,56 27,15
3 10 + + 28,57 30,12
4 10 + + 28,50 30,72
5 - + + 28,66 40,00
6 - + + 28,38 40,00

1. Способ детекции малопредставленных представляющих интерес фракций РНК в биологическом образце, включающий стадии:
(a) обратной транскрипции РНК в кДНК с использованием обратной транскриптазы (ОТ), стадию (a) осуществляют в условиях "горячего старта";
(b) инактивации ОТ обработкой хаотропным средством и
(с) детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР),
где биологический образец содержит большое фоновое количество клеточных компонентов и большое фоновое количество суммарной РНК, и где ОТ представляет собой рекомбинантную ДНК-полимеразу Thermus thermophilus (rTth-pol).

2. Способ по п.1, дополнительно включающий, после стадии (а), стадию амплификации представляющей интерес кДНК с использованием ОТ из стадии (а).

3. Способ по п.1, дополнительно включающий, после стадии (b), стадию удаления хаотропного средства из реакционной смеси.

4. Способ по п.1, где хаотропное средство выбрано из группы, состоящей из мочевины, перхлората лития и соли гуанидиния.

5. Способ по п.4, где хаотропное средство представляет собой соль гуанидиния.

6. Способ по п.1, где полимеразная цепная реакция (ПЦР) на стадии (c) представляет собой ПЦР в реальном времени.

7. Способ по п.1, где представляющая интерес РНК происходит из микоплазмы.

8. Способ по п.7, где микоплазму выбирают из группы, состоящей из Acholeplasma laidlawii, Mycoplasma gallisepticum, Mycoplasma hyorhinis, Mycoplasma hominis, Mycoplasma fermentans, Mycoplasma synoviae и Mycoplasma orale.

9. Способ по п.7, где представляющая интерес РНК представляет собой рибосомальную РНК 16S.

10. Способ детектирования микоплазменного загрязнения в биологическом образце, где способ включает стадии:
(a) выделения суммарной РНК из биологического образца;
(b) обратной транскрипции РНК в кДНК с использованием обратной транскриптазы (ОТ), где ОТ представляет собой рекомбинантную ДНК-полимеразу Thermus thermophilus (rTth-pol);
(с) амплификации кДНК, полученной на основе рибосомальной РНК 16S (рРНК 16S) микоплазмы посредством полимеразной цепной реакции (ПЦР) с использованием ОТ из стадии (b);
(d) инактивации ОТ посредством добавления хаотропного средства;
(e) удаления хаотропного средства из реакционной смеси; и
(f) детекции кДНК, полученной на основе рРНК 16S микоплазмы посредством полимеразной цепной реакции (ПЦР).

11. Способ по п.10, где стадию (b) осуществляют в условиях “горячего старта”.

12. Способ по п.10, где хаотропное средство выбрано из группы, состоящей из мочевины, перхлората лития и соли гуанидиния.

13. Способ по п.12, где хаотропное средство представляет собой соль гуанидиния.

14. Способ по п.10, где полимеразная цепная реакция (ПЦР) из стадии (f) представляет собой ПЦР в реальном времени.

15. Набор для детекции микоплазменного загрязнения в биологическом образце, содержащий, по меньшей мере, рекомбинантную ДНК-полимеразу Thermus thermophilus (rTth-pol), подходящие праймеры для обратной транскрипции рРНК 16S микоплазмы, подходящие праймеры для амплификации кДНК, полученной из рибосомальной РНК 16S (рРНК 16S) микоплазмы, хаотропное средство для инактивации rTth-pol, средства для удаления хаотропного средства из реакционной смеси и праймеры для детекции кДНК, полученной из рРНК 16S микоплазмы посредством ПЦР в реальном времени.



 

Похожие патенты:

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы).

Изобретение относится к области микробиологии и паразитологии микроорганизмов. Способ предусматривает рестрикционный анализ бактериальной ДНК бластоцист с использованием комбинации эндонуклеаз рестрикции - Нае III, Pst I и Hind III, позволяющих идентифицировать простейших с различной степенью вирулентности.

Изобретение относится к биотехнологии и представляет собой способ оценки воспаления и/или резистентности к инсулину у животного путем количественного определения присутствия анализируемого вещества в сыворотке или плазме.

Предложенная группа изобретений относится к области медицины и ветеринарии. Предложен биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, содержащий носитель, по меньшей мере одну нуклеиновую кислоту, содержащую гены, кодирующие VEGF и/или SDF-1, и клетки, обеспечивающие репаративную регенерацию.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов. Предложен способ идентификации пациента, который нуждается в ранней и/или агрессивной или профилактической терапии сердечно-сосудистого заболевания и способ лечения такого пациента. Предложенная группа изобретений обеспечивает эффективные способы и наборы для определения риска обладания сердечно-сосудистым заболеванием, что позволяет идентифицировать пациента, который нуждается в терапии сердечно-сосудистого заболевания. 4 н. и 6 з.п. ф-лы, 4 ил., 18 табл., 1 пр.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′. Изобретение может быть использовано в медицине, ветеринарии, клинической лабораторной диагностике для выявления ДНК бактерии Coxiella burnetii в пробах, а также для решения научно-исследовательских задач по изучению данного микроорганизма. 2 табл., 2 пр.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине. Получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента и экстрагируют биологический материал: нуклеиновую кислоту или белок из биологического образца. С использованием специфического реагента в отношении продукта экспрессии гена-мишени S100A9, выбранного из праймера амплификации, зонда гибридизации и/или антитела, определяют экспрессию гена-мишени S100A9. Изобретение позволяет по сверхэкспрессии гена-мишени S100A9 по отношению к определенной пороговой величине определить, что пациент с септическим шоком восприимчив к внутрибольничной инфекции. 2 н. и 9 з.п.ф-лы, 2 ил., 3 табл., 5 пр.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy. 3 з.п. ф-лы, 4 ил., 5 табл., 5 пр.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе. Способ предусматривает следующее. Гранулу биокатализатора с заключенными в ней клетками одного или нескольких видов родококков помещают в лунку 96-луночного планшета, добавляют краситель иодонитротетразолий (INT). После появления специфического фиолетового окрашивания формазана измеряют оптическую плотность гранулы с помощью планшетного фотометра. В случае окрашенного субстрата или предварительного нахождения иммобилизованного биокатализатора в почве проводят экстракцию формазана 96% этанолом и измеряют оптическую плотность экстракта. Число жизнеспособных родококков в грануле геля определяют с помощью калибровочного графика зависимости оптической плотности от числа живых клеток в суспензии, определенного традиционным методом высева на плотную питательную среду. Затем из окрашенной красителем гранулы биокатализатора или из гранулы после экстракции красителя выделяют ДНК и проводят ПЦР с использованием наборов видоспецифических праймеров. Определяют видовое положение иммобилизованных родококков. Изобретение позволяет сократить время дифференциации родококков и повысить точность способа. 1 з.п. ф-лы, 3 табл., 4 ил., 4 пр.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. Охарактеризованное решение может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1. Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле. При осуществлении мультиплексной ПЦР используют четыре пары праймеров, комплементарных к участкам гена внеклеточной термонуклеазы (nuc), гена лейкоцидина Пантона-Валлентайна (pvl), гена белка токсического шока (tst) и гена устойчивости к метициллину (mecA). Генотипы золотистого стафилококка определяют по наличию или отсутствию генов вирулентности pvl и tst и гена устойчивости к метициллину mecA или их сочетаний. Изобретение позволяет определять отдельные генотипы золотистого стафилококка одновременно в одной мультиплексной реакции, а также исключить предварительный этап идентификации микроорганизма. 1 ил., 2 табл., 2 пр.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3', обратный праймер - 5'-GGCCTCGCААССАССACTTGTC-3', разрушаемый зонд - (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемый штамм относят к определенной группе, виду или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов лактобацилл в микробиоте человека, продуктах питания, а также для определения исследуемого штамма в клинических пробах или молекулярного отслеживания в коммерческих препаратах. 3 табл., 3 пр.
Наверх