Способы определения восприимчивости пациента к внутрибольничной инфекции и составления прогноза развития септического синдрома



Способы определения восприимчивости пациента к внутрибольничной инфекции и составления прогноза развития септического синдрома
Способы определения восприимчивости пациента к внутрибольничной инфекции и составления прогноза развития септического синдрома
Способы определения восприимчивости пациента к внутрибольничной инфекции и составления прогноза развития септического синдрома

 


Владельцы патента RU 2525707:

БИОМЕРЬЕ (FR)
ОСПИС СИВИЛЬ ДЕ ЛИОН (FR)

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине. Получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента и экстрагируют биологический материал: нуклеиновую кислоту или белок из биологического образца. С использованием специфического реагента в отношении продукта экспрессии гена-мишени S100A9, выбранного из праймера амплификации, зонда гибридизации и/или антитела, определяют экспрессию гена-мишени S100A9. Изобретение позволяет по сверхэкспрессии гена-мишени S100A9 по отношению к определенной пороговой величине определить, что пациент с септическим шоком восприимчив к внутрибольничной инфекции. 2 н. и 9 з.п.ф-лы, 2 ил., 3 табл., 5 пр.

 

Настоящее изобретение относится к способу определения восприимчивости пациента к внутрибольничной инфекции. Объектом настоящего изобретения также является способ составления прогноза развития септического шока у пациента.

Внутрибольничные инфекции представляют собой реальную проблему здравоохранения. Во Франции число пациентов, которые подвергаются каждый год внутрибольничной инфекции, оценивают как составляющее от 500000 до 800000. Появление внутрибольничных инфекций связано с различными факторами такими, как используемые терапевтические методы, однако, также с восприимчивостью пациента к такой внутрибольничной инфекции. Так, пациенты с иммунодефицитной системой, пациенты с гипотрофией, новорожденные, люди пожилого возраста, люди с септическом синдромом, получившие серьезные ожоги, люди в травматическом состоянии могут быть более предрасположены, чем другие, к внутрибольничной инфекции.

Септический синдром, системный ответ на инфекцию, представляет собой одну из первых причин смертности в реанимационных отделениях. Он может проистекать от бактериальной, вирусной, микотической или паразитарной инфекции. Эти септические синдромы могут быть классифицированы в зависимости от их тяжести. В возрастающем порядке тяжести различают SIRS (синдром системного воспалительного ответа), сепсис, тяжелый сепсис и септический шок. Группой экспертов в 2001 г. также предложены критерии определений этих четырех клинических синдромов[1]:

- SIRS представляет собой воспалительный системный ответ, вызываемый многообразием инфекционных или нет причин. Из состояний SIRS, вызываемых неинфекционными причинами, можно назвать травматические состояния, ожоги, панкреатиты, острые респираторные синдромы. Воспалительный системный ответ обнаруживается по меньшей мере по двум из следующих признаков: а) температура выше 38°С или ниже 36°С; b) сердечный ритм выше 90 пульсаций в минуту; с) респираторный ритм выше 20 дыханий в минуту; d) число лейкоцитов выше 12000/мм2 или ниже 4000/мм2;

- сепсис представляет собой синдром воспалительного системного ответа в связи с инфекцией;

- тяжелый сепсис представляет собой сепсис, ассоциированный с артериальной гипотензией и/или гипоперфузией, и/или дисфункцией по меньшей мере одного органа;

- септический шок представляет собой тяжелый сепсис, ассоциированный с устойчивой гипотензией, и может быть квалифицирован по:

- наличию идентифицированного инфекционного участка,

- устойчивой гипотензии несмотря на адекватные меры повышения давления и лечения повышающими кровяное давление лекарственными средствами.

Как правило, признаки сепсиса, тяжелого сепсиса и септического шока являются близкими, и различие между этими тремя состояниями заключается, главным образом, в значительности пертурбации всех витальных функций. Во время септического шока наблюдают, главным образом, снижение артериального давления, тахикардию, полипноэ, мраморировки кожи, гипо- или гипертермию, ознобы. Эти признаки также сопровождаются дисфункцией органов-«мишеней» с ухудшением функции органов на расстоянии от очага инфекции (почки, легкие, центральная нервная система, пищеварительная система и системы коагуляции крови), выражающимся в олигурии (<0,5 мл/кг/ч), почечной недостаточности, гипоксемии, тромбопении, ажитации, дезориентации во времени и пространстве.

Пациенты с септическим синдромом также более или менее восприимчивы к внутрибольничным инфекциям, то есть инфекциям в связи с пребыванием в лечебном учреждении. Эта восприимчивость оказывает большое воздействие на выживание и полное выздоровление этих пациентов.

Развитие септического синдрома, начиная от стадии сепсиса к стадии тяжелого сепсиса, затем септического шока, не является систематическим, так как примерно у 64% пациентов с сепсисом развивается тяжелый сепсис, и у 23% пациентов с тяжелым сепсисом проявляется септический шок. Перед этой последней стадией септического шока пациенту должны быть предписаны лечения с целью прекращения и реверсирования физиопатологического процесса. Также необходимо восстанавливать удовлетворительное гемодинамическое состояние и обеспечивать эффективную вентиляцию. Также необходимо проводить одновременно симптоматическое лечение шока и антибиотическое лечение, адаптированное, насколько возможно, в зависимости от бактериологических данных.

Оказывается, что, если в случае некоторых пациентов развивается септический синдром, и, в особенности, септический шок, они могут быть реанимированы путем принятия стандартных мер таких, как лечение антибиотиком широкого спектра, проводимое до результатов бактериологических анализов, указывающих источник инфекции; в случае других пациентов, у которых развивается намного более тяжелый септический синдром, требуется проведение «тяжелых» терапий, как использование активированного белка С. Сверх очень высокой стоимости, этот вид терапии подвергает пациентов рискам очень значительных нежелательных эффектов (нарушения коагуляции…). Следовательно, очень важным является нацеливание эффективным образом восприимчивых пациентов к получению пользы от такого лечения.

В связи с этим, знание этиологии воспалительного системного ответа и определение восприимчивости пациента с воспалительным системным ответом к внутрибольничной инфекции являются существенными для назначения пациенту адаптированного лечения. Другим важным параметром для пациента является наличие возможности составления по возможности наиболее раннего прогноза развития септического шока.

На сегодняшний день не существует теста, который позволял бы определять восприимчивость пациента к развитию внутрибольничной инфекции, в особенности, пациента с воспалительным системным ответом, связанным или нет с инфекцией. Авторами настоящего изобретения неожиданно выявлено, что анализ экспрессии генов S100A9 и/или S100A8 особенно адаптирован для определения такой восприимчивости и что, к тому же, он применим для составления прогноза развития септического шока.

В соответствии с вышеприведенным и нижеприводимым контекстом, для лучшего понимания изобретения приводятся нижеследующие определения.

Под септическим синдромом понимают системный ответ на инфекцию. Этот септический синдром может быть на стадии SIRS, сепсиса, тяжелого сепсиса или септического шока. Предпочтительно, септическим синдромом является септический шок.

Под внутрибольничной инфекцией понимают любую инфекцию, «приобретаемую» в лечебном учреждении спустя 48 часов после госпитализации и которой не было до попадания пациента в это учреждение.

Под генами-мишенями, геном S100A9 и геном S100A8, понимают, в частности, ген S100A9, обозначенный в банке генов под номером доступа NM_002965.3, и ген S100A8, обозначенный в банке генов под номером доступа NM_002964.3.

Под продуктом экспрессии гена S100A9 и гена S100A8 понимают матричную РНК (мРНК) или фрагмент мРНК, кДНК или фрагмент кДНК, белок или фрагмент белка.

Под биологическим образцом понимают любой материал, происходящий от пациента, который может содержать биологический материал, позволяющий детектировать экспрессию гена. Это может быть, в частности, образец крови, сыворотки, слюны или ткани или циркулирующих клеток пациента. Получают этот биологический образец любым типом отбора, известным специалисту в данной области таким, как, в частности, взятие пробы крови.

Под биологическим материалом понимают любой материал, позволяющий детектировать экспрессию гена, как, в частности, нуклеиновая кислота или белок или его кодирующая последовательность. Нуклеиновой кислотой может быть, в особенности, РНК (рибонуклеиновая кислота), такая как мРНК (матричная РНК). Согласно предпочтительному варианту осуществления данного изобретения, биологическим материалом является нуклеиновая кислота и, еще более предпочтительно, мРНК.

Экстракция биологического материала из биологического образца может быть осуществлена согласно любому из протоколов экстракции нуклеиновых кислот или белков, хорошо известных специалисту в данной области.

Для сведения, экстракция нуклеиновых кислот, в частности, может быть осуществлена за счет:

- стадии лизиса клеток, присутствующих в биологическом образце, в целях высвобождения нуклеиновых кислот, содержащихся в белковых и/или липидных оболочках микроорганизмов (как клеточные дебрисы, которые пертурбируют дальнейшие реакции). В качестве примера, можно использовать способы лизиса такие, как описываемые в заявках на патенты:

- WO-A-00/05338, способ смешанного магнитного и механического лизиса,

- WO-A-99/53304, способ электрического лизиса, и

- WO-A-99/15321, способ механического лизиса.

Специалист в данной области может использовать другие, хорошо известные, способы лизиса такие, как тепловые или осмотические удары или химические лизисы за счет хаотропных агентов таких, как гуанидиевые соли (заявка на патент США 5234809);

- стадии очистки, позволяющей осуществлять разделение между нуклеиновыми кислотами и другими клеточными компонентами, высаленными на стадии лизиса. Эта стадия обычно позволяет концентрировать нуклеиновые кислоты. В качестве примера, можно использовать магнитные частицы, необязательно покрытые олигонуклеотидами, за счет адсорбции или ковалентной связи (см. на этот предмет заявки на патенты США А-4672040 и А-5750338), и таким образом очищать нуклеиновые кислоты, которые фиксировались на этих магнитных частицах, за счет стадии промывки. Эта стадия очистки нуклеиновых кислот особенно представляет интерес, если в дальнейшем желают амплифицировать вышеуказанные нуклеиновые кислоты. Особенно представляющий интерес способ реализации этих магнитных частиц описывается в Международных заявках на патенты: WO-A-97/45202 и WO-A-99/35500. Другим, представляющим интерес, примером способа очистки нуклеиновых кислот является использование диоксида кремния либо в колоночной форме, либо в форме инертных[2] или магнитных частиц (Merck: MagPrep Silica; Promega: MagneSilTM, парамагнитные частицы). Другие, очень широко распространенные, способы базируются на использовании ионообменных смол в колонке или в особом парамагнитном формате (Whatman: DEAE-Magarose) (Levison P.R. и др., J. Chromatography, 337-344 (1998)). Другим, очень подходящим, но не исключительным, для изобретения способом является способ адсорбции на носителе из оксида металла (фирма Xtrana: матрица Xtra-BindTM). Такая стадия экстракции может быть осуществлена в автоматах. Особенно адаптированным является автомат easyMAG®.

Под специфическим реагентом понимают реагент, который реагирует с биологическим материалом для выявления, прямо или непрямо, экспрессии гена-мишени, которая может быть определена путем анализа мРНК, происходящих от этого гена, или путем анализа кодируемого этим геном белка.

Для сведения, когда желают определить экспрессию гена-мишени путем анализа кодируемого этим геном белка, этот специфический реагент включает по меньшей мере одно антитело, специфичное к белку, кодируемому этим геном-мишенью.

Для сведения, когда желают определить экспрессию гена-мишени путем анализа мРНК-транскриптов, исходя из этого гена, этот специфический реагент включает по меньшей мере один специфический праймер амплификации комплементарной ДНК этой мРНК (тогда речь идет о специфическом праймере амплификации гена-мишени). Комплементарная ДНК матричной РНК может быть получена согласно протоколу, хорошо известному специалисту в данной области. Для сведения, экстрагируют все РНК (включающие рибосомальные РНК, транспортные РНК, мРНК) из биологического образца. Затем проводят реакцию обратной транскрипции с помощью фермента обратная транскриптаза, которая позволяет получать, исходя из фрагмента РНК, комплементарный фрагмент ДНК (кДНК). Осуществление такой стадии хорошо известно специалисту в данной области. Когда желают, более конкретно, получать только комплементарные ДНК матричных РНК, эту ферментативную стадию осуществляют в присутствии нуклеотидных фрагментов, включающих только тиминовые основания (polyT), которые гибридизируются за счет комплементарности с последовательностью polyT различных мРНК с образованием комплекса polyT-polyA, который служит тогда исходной точкой для реакции обратной транскрипции, осуществляемой с помощью фермента обратная транскриптаза. Тогда получают различные комплементарные ДНК различных матричных РНК, первоначально присутствующих в биологическом образце. В дальнейшем контексте обозначением кДНК называют комплементарную ДНК матричной РНК.

Под праймером амплификации понимают нуклеотидный фрагмент, включающий 5-100 нуклеотидных мотивов, предпочтительно, 15-20 нуклеотидных мотивов, и обладающий специфичностью гибридизации в определенных условиях для инициации ферментативной полимеризации, например, в случае ферментативной реакции амплификации.

Под ферментативной реакцией амплификации понимают процесс, генерирующий множественные копии нуклеотидного фрагмента-мишени с помощью специфических праймеров амплификации за счет воздействия по меньшей мере одного фермента. Такие реакции амплификации хорошо известны специалисту в данной области и можно назвать, в частности, следующие способы: ПЦР (полимеразная цепная реакция), LCR (лигазная цепная реакция), RCR (репаративная цепная реакция), 3SR (самоподдерживаемая репликация последовательности), в соответствии с Международной заявкой на патент WO-A-90/06995), NASBA (базирующаяся на полинуклеотидной последовательности амплификация) и ТМА (опосредуемая транскрипцией амплификация), в соответствии с заявкой на патент США А-5399491.

Тогда речь идет о ампликонах для обозначения полинуклеотидов, генерируемых по способу ферментативной амплификации. Предпочтительно, когда ферментативной амплификацией является ПЦР, специфический реагент включает по меньшей мере 2 специфических праймера амплификации, чтобы амплифицировать конкретную область комплементарной ДНК матричной РНК, происходящей от гена-мишени. Когда ферментативной амплификацией является ПЦР, осуществляемая после реакции обратной транскрипции, речь идет о RT-PCR (полимеразная цепная реакция с обратной транскриптазой).

Под зондом гибридизации понимают нуклеотидный фрагмент, включающий 5-100 нуклеотидных мотивов, особенно, 6-35 нуклеотидных мотивов, обладающий специфичностью гибридизации в определенных условиях для образования гибридного комплекса с нуклеотидным фрагментом-мишенью. Согласно настоящему изобретению, нуклеотидным фрагментом-мишенью может быть нуклеотидная последовательность, включенная в матричную РНК, или нуклеотидная последовательность, включенная в комплементарную ДНК, полученную путем обратной транскрипции вышеуказанной матричной РНК.

Под гибридизацией понимают процесс, во время которого, в соответствующих условиях, два нуклеотидных фрагмента таких, как, например, зонд гибридизации и нуклеотидный фрагмент-мишень, имеющие достаточно комплементарные последовательности, способны образовывать двойную нить со стабильными и специфическими водородными связями. Нуклеотидным фрагментом, «способным гибридизироваться» с полинуклеотидом, является фрагмент, который может гибридизироваться с вышеуказанным полинуклеотидом в условиях гибридизации, которые могут быть определены известным образом в каждом случае. Условия гибридизации определяют путем строгого контроля, то есть точного соблюдения рабочих условий. Гибридизация является тем более специфической, когда она осуществляется при более сильном строгом контроле. Строгий контроль определяется, в частности, с точки зрения состава оснований дуплекса зонд/мишень, а также степенью мезоконъюгации между двумя нуклеиновыми кислотами. Строгий контроль также может быть функцией параметров реакции таких, как концентрация и тип ионов, присутствующих в растворе для гибридизации, природа и концентрация денатурирующих агентов и/или температура гибридизации. Строгий контроль в отношении условий, при которых должна быть реализована реакция гибридизации, главным образом зависит от используемых зондов гибридизации. Все эти данные хорошо известны и соответствующие условия могут быть определены специалистом в данной области. Как правило, в зависимости от длины используемых зондов гибридизации, температура реакции гибридизации составляет от примерно 20°С до 70°С, в частности, от 35°С до 65°С, в солевом растворе с концентрацией около 0,5-1 М. Затем осуществляют стадию детекции реакции гибридизации.

Под детекцией понимают либо прямую детекцию физическим методом, либо способ детекции с помощью маркера. Для детекции нуклеиновых кислот существуют многочисленные способы детекции[4,5].

Под маркером понимают меченое вещество, способное давать сигнал. Неисчерпывающий перечень этих меченых веществ включает ферменты, которые продуцируют сигнал, детектируемый, например, путем калориметрии, флуоресценции или люминесценции, как пероксидаза хрена, щелочная фосфатаза, бета-галактозидаза, глюкозо-6-фосфатдегидрогеназа; хромофоры, как флуоресцентные, люминесцентные или окрашивающие соединения; группы с электронной плотностью, детектируемые с помощью электронного микроскопа или за счет их электрических свойств, как удельная проводимость, методами амперометрии или вольтаметрии, или путем измерений импеданса; группы, детектируемые оптическими методами, как дифракция, резонанс поверхностного плазмона, изменение угла контакта, или физическими методами, как спектроскопия атомных сил, туннельный эффект и т.д.; радиоактивные молекулы, как 32Р, 35S или 125I. Так, полинуклеотид может быть маркирован во время стадии ферментативной амплификации, например, используя маркированный нуклеотидтрифосфат для реакции амплификации. Маркированным нуклеотидом является дезоксирибонуклеотид в системах амплификации, генерирующих ДНК, как ПЦР, или рибонуклеотид в способах амплификации, генерирующих РНК, как способы ТМА или NASBA. Полинуклеотид также может быть маркирован после стадии амплификации, например, гибридизируя маркированный зонд по способу гибридизации сэндвич-типа, описанному в документе WO-А-91/19812.

Согласно настоящему изобретению, зондом гибридизации может быть так называемый зонд-ловушка. В этом случае, нуклеотидный фрагмент-мишень может быть предварительно маркирован с помощью маркера. Так называемый зонд-ловушка является имммобилизированным или иммобилизируемым на твердом носителе с помощью любого соответствующего способа, то есть прямо или непрямо, например, за счет ковалентной связи или адсорбции. Тогда осуществляют реакцию гибридизации между вышеуказанным зондом-ловушкой и маркированным нуклеотидным фрагментом-мишенью.

Зондом гибридизации также может быть так называемый зонд детекции. В этом случае, зонд гибридизации может быть маркирован с помощью маркера. Тогда осуществляют реакцию гибридизации между вышеуказанным зондом детекции и нуклеотидным фрагментом-мишенью.

Когда используют так называемый зонд-ловушку или так называемый зонд детекции, реакция гибридизации может быть осуществлена на твердом носителе, который включает все материалы, на которых может быть иммобилизирована нуклеиновая кислота. В качестве твердого носителя могут быть использованы синтетические материалы или природные материалы, необязательно химически модифицированные, в частности полисахариды такие, как материалы на основе целлюлозы такие как, например, бумага, производные целлюлозы такие, как ацетат целлюлозы и нитроцеллюлоза или декстран; полимеры, сополимеры, в частности, на основе мономеров стирольного типа, натуральные волокна такие, как хлопок, и синтетические волокна такие, как нейлон; минеральные материалы, такие, как диоксид кремния, кварц, стекла, керамика; латекс; магнитные частицы; металлические производные, гели и т.д. Твердый носитель может быть в форме титрационного микропланшета, мембраны, как описано в Международной заявке WO-A-94/12670, частицы или биочипа.

Согласно настоящему изобретению, определение экспрессии гена S100A9 и гена S100A8 может быть проанализировано путем экспрессии матричных РНК, которые в данное время являются транскриптами. В этом случае, биологическим материалом является нуклеиновая кислота и специфическим реагентом может быть безразлично праймер амплификации или зонд гибридизации такие, как указанные выше.

Экспрессию гена-мишени можно определять следующим образом:

1) после экстракции всех РНК из биологического образца, осуществляют стадию обратной транскрипции такую, как указанная выше, чтобы получить различные комплементарные ДНК различных матричных РНК, первоначально присутствующих в биологическом образце (или кДНК);

2) специфически амплифицируют кДНК. В этом случае, используемый специфический реагент включает по меньшей мере один специфический праймер амплификации гена-мишени такой, как указанный выше. Эта стадия может быть осуществлена, в частности, путем реакции амплификации типа ПЦР или любым другим способом соответствующей амплификации;

3) определяют экспрессию гена-мишени, определяя количество кДНК. кДНК могут быть количественно определены, в частности, путем использования диапазона квантификации, получаемого путем реакции амплификации, доводимой вплоть до насыщения. Для учета вариабельности ферментативной эффективности, которая может наблюдаться во время различных стадий (обратная транскрипция, ПЦР…), можно нормировать экспрессию гена-мишени различных групп пациентов путем одновременного определения экспрессии так называемого гена «домашнего хозяйства», экспрессия которого является подобной у различных групп пациентов. Реализуя соотношение между экспрессией гена-мишени и экспрессией гена «домашнего хозяйства», таким образом корректируют любую вариабельность между различными экспериментированиями. Специалист в данной области может, в частности, полагаться на следующие публикации[6,7].

Экспрессию гена-мишени также можно определять следующим образом:

1) после экстракции всех РНК из биологического образца, осуществляют стадию обратной транскрипции такую, как указанная выше, чтобы получить различные комплементарные ДНК различных матричных РНК, первоначально присутствующих в биологическом образце (или кДНК);

2) иммобилизируют комплементарные ДНК на мембране;

3) определяют экспрессию гена-мишени, гибридизируя кДНК со специфическими, предварительно маркированными, зондами гибридизации гена-мишени. Такие способы гибридизации хорошо известны специалисту в данной области, и можно назвать, в частности, способ нозерн-блоттинга. Эта реакция гибридизации может быть реализована после стадии специфической амплификации комплементарных ДНК матричных РНК гена-мишени, когда, в частности, ген является слабо экспрессируемым.

Экспрессия гена-мишени также может быть проанализирована путем экспрессии белков, кодируемых геном-мишенью. В этом случае, биологическим материалом является белок, и могут быть использованы несколько способов детекции с лигандом или без него. Масс-спектрометрия может быть использована в качестве способа детекции без лиганда. Специфическим реагентом может быть антитело, специфичное к белку, кодируемому геном мишенью, для системы детекции с лигандом.

Рекомбинантные антитела, специфичные к белку, продуцируемому геном-мишенью, могут быть получены согласно классическим, известным специалисту в данной области, способам исходя из прокариот таких, как бактерии, или исходя из эукариот таких, как дрожжи, клетки млекопитающих, растений, насекомых или животных, или за счет систем внеклеточного продуцирования.

Моноклональные антитела могут быть получены согласно классическим, известным специалисту в данной области, способам таким, как гибридомный способ, основной принцип которого приводится ниже.

Во-первых, с помощью представляющего интерес антигена-мишени иммунизируют животное, обычно мышь (или культивируемые клетки в рамках иммунизаций in vitro), лимфоциты В которого тогда способны продуцировать антитела к вышеуказанному антигену. Эти лимфоциты, продуценты антител, затем гибридизируют с «бессмертными» миеломатозными клетками (в примере, мышиными) с целью образования гибридом. Исходя из гетерогенной смеси таким образом полученных клеток, тогда осуществляют отбор клеток, способных продуцировать конкретное антитело и бесконечно размножаться. Каждая гибридома размножается в форме клона, причем каждый приводит к продуцированию моноклонального антитела, свойства распознавания которого по отношению к представляющему интерес антигену могут быть тестированы, например, при использовании твердофазного иммуноферментного анализа (ELISA), путем иммуноблоттинга по одному или двум параметрам, путем иммунофлуоресценции или с помощью биоловушки. Таким образом, селекционированные моноклональные антитела затем очищают, в частности, согласно способу аффинной хроматографии.

Фрагменты антитела могут быть получены, например, путем протеолиза. Так, они могут быть получены путем ферментативного расщепления, приводящего в результате к фрагментам типа Fab (обработка папаином[8]) или типа F(ab)'2 (обработка пепсином[9]). Они также могут быть получены рекомбинантным путем[10]. Другой фрагмент антитела, который соответствует целям настоящего изобретения, включает фрагмент Fv, который представляет собой димер, образованный нековалентной ассоциацией «легкого» изменяемого домена (VL) и «тяжелого» изменяемого домена (VH) фрагмента Fab, следовательно, ассоциацией двух полипептидных цепей. В целях улучшения стабильности фрагмента Fv, возникающей вследствие диссоциации двух полипептидных цепей, этот фрагмент Fv может быть модифицирован путем генной инженерии за счет введения адаптированной пептидной связи между доменом VL и доменом VH[11]. Тогда речь идет о фрагменте scFv («изменяемый одноцепочечный фрагмент»), так как он образован одной полипептидной цепью. Использование пептидной связи, предпочтительно состоящей из 15-25 аминокислот, позволяет связывать С-конец одного домена с N-концом другого домена с образованием, таким образом, мономерной молекулы, снабженной свойствами связывания, подобными свойствам связывания антитела в его полной форме. Две ориентации доменов VL и VH допускаются (VL-связь-VH и VH-связь-VL), так как они обладают идентичными функциональными свойствами. Разумеется, любой фрагмент, известный специалисту в данной области и обладающий вышеопределенными иммунологическими характеристиками, пригоден в целях изобретения.

Когда биологическим материалом является белок, происходящий из экспрессии гена, экспрессию этого последнего можно определять, детектируя и квантифицируя упомянутый белок путем вестерн-блоттинга или ELISA или любым другим методом, известным специалисту в данной области таким, как метод хемилюминесценции, исходя из биологического материала.

Метод ELISA («твердофазный иммуноферментный анализ») представляет собой иммуноферментативное количественное определение на твердом носителе. Этот анализ входит в более общие рамки EIA («иммуноферментный анализ»), в случае которого количественное определение связано с катализируемой ферментом реакцией. В методе используют одно или два антитела. Антитело для детекции образования иммунных комплексов (антиген/антитело) связано с ферментом и может генерировать эмиссию сигнала за счет хромогенного или флуорогенного субстрата.

Метод вестерн-блоттинга представляет собой тест для детекции специфического белка в образце с помощью специфичного к этому белку антитела, включающий следующие стадии такие, как описанные ниже.

Первая стадия представляет собой электрофорез в геле, который позволяет разделять белки образца по их размеру.

Белки в геле тогда переносят на мембрану (нитроцеллюлоза, PVDF…) под давлением или за счет использования электрического тока, причем белки фиксируются на мембране благодаря гидрофобным и ионным взаимодействиям.

После насыщения сайтов неспецифического взаимодействия, первое антитело, специфичное к исследуемому белку, (первичное антитело) инкубируют с мембраной.

Мембрану затем промывают в целях удаления несвязанных первичных антител, затем инкубируют с так называемыми вторичными антителами, которые связываются с первичными антителами. Это вторичное антитело обычно связано с ферментом, который позволяет осуществлять визуальную идентификацию исследуемого белка на мембране. Добавление меченого субстрата фермента вызывает цветную реакцию, которая видима на мембране.

Анализ экспрессии гена S100A9 и/или гена S100A8 позволяет определять восприимчивость пациента к внутрибольничной инфекции, в особенности пациента с воспалительным системным ответом, и составлять прогноз развития септического синдрома. Можно, например, анализировать экспрессию по меньшей мере одного гена-мишени у пациента, в случае которого не было известно о восприимчивости к внутрибольничной инфекции, и путем сравнения с известными величинами обычной экспрессии гена-мишени у восприимчивых пациентов и известными величинами обычной экспрессии гена-мишени у невосприимчивых пациентов определять, восприимчив ли пациент к внутрибольничной инфекции. Таким же образом можно, например, анализировать экспрессию по меньшей мере одного гена-мишени и путем сравнения с обычными величинами известной экспрессии гена-мишени составлять прогноз развития септического синдрома, включая прогноз в отношении выживания или смерти.

Следовательно, объектом настоящего изобретения является способ определения восприимчивости пациента к внутрибольничной инфекции, согласно которому:

а) получают биологический образец пациента и экстрагируют биологический материал из биологического образца;

b) получают по меньшей мере один специфический реагент в отношении продукта экспрессии по меньшей мере одного гена-мишени, выбираемого среди генов-мишеней S100A9 и S100A8;

c) определяют экспрессию по меньшей мере одного из генов-мишеней S100A9 и S100A8, причем сверхэкспрессия по отношению к определенной пороговой величине является указанием на восприимчивость к внутрибольничной инфекции.

На стадии с) можно определять экспрессию гена-мишени S100A9 и гена-мишени S100A8, причем сверхэкспрессия гена-мишени S100A9 по отношению к определенной пороговой величине и сверхэкспрессия гена-мишени S100A8 по отношению к определенной пороговой величине являются указанием на восприимчивость к внутрибольничной инфекции.

Специалист в данной области обладает различными возможностями для определения пороговой величины. Можно назвать, например, определение показателя Youden.

Показатель Youden соответствует определению общего процента без погрешности. Он изменяется от 0, для теста, не позволяющего осуществлять распознавание двух популяций, до 1, для теста, позволяющего осуществлять полное распознавание двух популяций. Максимум показателя Youden соответствует пороговой величине, для которой количество ложных результатов (отрицательный ложный и положительный ложный) является наиболее незначительным. Чем ближе показатель Youden к 1, тем более хорошими являются диагностические данные[12].

В особенности, биологический образец берут у пациента с воспалительным системным ответом, ассоциированным или нет с инфекцией. Биологическим образцом может быть образец крови и экстрагированным биологическим материалом может быть, кроме того, нуклеиновая кислота. Предпочтительно, из биологического образца экстрагируют все РНК, и определение экспрессии гена-мишени осуществляют путем анализа экспрессии мРНК.

Согласно предпочтительному варианту осуществления способа в соответствии с данным изобретением, специфический реагент включает по меньшей мере один праймер амплификации или по меньшей мере один специфический зонд гибридизации в отношении продукта экспрессии гена-мишени S100A9 и/или гена-мишени S100A8; или по меньшей мере одно антитело, специфичное к продукту экспрессии гена-мишени S100A9 и/или гена-мишени S100A8.

Способ, в частности, применим для определения восприимчивости к внутрибольничной инфекции пациента с септическим синдромом, то есть с воспалительным системным ответом на инфекцию как, например SIRS, сепсис, тяжелый сепсис и септический шок.

Специфический реагент в отношении продукта экспрессии гена S100A9 и/или гена S100A8, следовательно, используют для определения восприимчивости пациента к внутрибольничной инфекции, в особенности пациента с воспалительным системным ответом, ассоциированным или нет с инфекцией. Реагент может включать по меньшей мере один специфический зонд гибридизации в отношении гена-мишени S100A9 по меньшей мере один специфический зонд гибридизации в отношении гена-мишени S100A8 по меньшей мере один специфический праймер амплификации гена-мишени S100A9 по меньшей мере один специфический праймер амплификации гена-мишени S100A8 по меньшей мере одно антитело, специфичное к молекуле S100A9, или по меньшей мере одно антитело, специфичное к молекуле S100A8.

Анализ экспрессии гена S100A9 и/или S100A8 также позволяет составлять прогноз развития септического синдрома (прогноз, включающий выживание или смерть).

Объектом настоящего изобретения также является способ составления прогноза развития септического синдрома у пациента, согласно которому:

а) получают биологический образец пациента и экстрагируют биологический материал из биологического образца;

b) получают по меньшей мере один специфический реагент в отношении продукта экспрессии по меньшей мере одного гена-мишени, выбираемого среди генов-мишеней S100A9 и S100A8;

c) определяют экспрессию по меньшей мере одного из генов-мишеней S100A9 и S100A8, причем субэкспрессия по отношению к определенной пороговой величине является указанием на хороший прогноз в отношении развития септического синдрома, и сверхэкспрессия по отношению к определенной пороговой величине является указанием на плохой прогноз в отношении развития септического синдрома.

На стадии с) можно определять экспрессию гена-мишени S100A9 и гена-мишени S100A8, причем субэкспрессия гена-мишени S100A9 по отношению к определенной пороговой величине и субэкспрессия гена-мишени S100A8 по отношению к определенной пороговой величине являются указанием на хороший прогноз в отношении развития септического синдрома;

сверхэкспрессия гена-мишени S100A9 по отношению к определенной пороговой величине и сверхэкспрессия гена-мишени S100A8 по отношению к определенной пороговой величине являются указанием на плохой прогноз в отношении развития септического синдрома.

Определение пороговой величины является доступным пониманию специалиста в данной области. Можно назвать, например, определение показателя Youden. Показатель Youden соответствует определению общего процента без погрешности. Он варьирует от 0, для теста, не позволяющего осуществлять распознавание двух популяций, до 1, для теста, позволяющего осуществлять полное распознавание двух популяций. Максимум показателя Youden соответствует пороговой величине, для которой количество ложных результатов (отрицательный ложный и положительный ложный) является наиболее незначительным. Чем ближе показатель Youden к 1, тем более хорошими являются диагностические данные[12].

Биологическим образцом может быть образец крови, и экстрагированным биологическим материалом может быть, кроме того, нуклеиновая кислота. Предпочтительно, из биологического образца экстрагируют все РНК, и определение экспрессии гена-мишени осуществляют путем анализа экспрессии мРНК.

Согласно предпочтительному варианту осуществления способа в соответствии с изобретением, специфический реагент включает по меньшей мере один праймер амплификации или по меньшей мере один специфический зонд гибридизации в отношении продукта экспрессии гена-мишени S100A9 и/или гена-мишени S100A8; или по меньшей мере одно антитело, специфичное к продукту экспрессии гена-мишени S100A9 и/или гена-мишени S100A8.

Специфический реагент в отношении продукта экспрессии гена S100A9 и/или гена S100A8, следовательно, используют для составления прогноза развития септического синдрома у пациента (включая прогноз выживания или смерти). Реагент может включать по меньшей мере один специфический зонд гибридизации в отношении гена-мишени S100A9, по меньшей мере один специфический зонд гибридизации в отношении гена-мишени S100A8, по меньшей мере один специфический праймер амплификации гена-мишени S100A9, по меньшей мере один специфический праймер амплификации гена-мишени S100A8, по меньшей мере одно антитело, специфичное к молекуле S100A9, или по меньшей мере одно антитело, специфичное к молекуле S100A8.

Фигуры

Фиг.1 представляет собой корреляцию экспрессии гена S100A9 и гена S100A8 (n=86). На ней представлена сильная корреляция, которая существует между генными экспрессиями молекул S100A9 и S100A8 с коэффициентом Spearman >0,90 (r=0,9134). Генные экспрессии молекул S100A9 и S100A8 обладают похожей способностью к распознаванию пациентов, восприимчивых к внутрибольничной инфекции, и составлению прогноза развития септического синдрома.

Фиг.2 иллюстрирует значительное различие экспрессии гена S100A8 (р=0,0461) между выжившими и невыжившими пациентами в случае взятия проб, осуществляемых между днем 7 и днем 10 после начала септического шока. Пояснительный список условных обозначений: HV = здоровые волонтеры; S = выжившие пациенты; NS = невыжившие пациенты.

Примеры

Пример 1

Исследование экспрессии гена S100A9

Образцы

Использовали группу из 44 здоровых волонтеров (S) и группу из 148 пациентов, пораженных септическим синдромом (SEP) и пробы для анализа у которых брали в день 1, день 2 и день 3 после септического шока (Н0 означает инъекцию повышающего кровяное давление средства), в целях сравнения экспрессии гена S100A9 в периферической крови. Тогда четко различали группу из 44 здоровых пациентов (S) и группу из 148 пациентов с развивающимся септическим шоком (SEP).

Экстракция РНК и синтез кДНК

В случае каждого пациента, биологический образец представлял собой пробу крови, регулярно отбираемую в течение первых 10 дней, следующих за началом септического синдрома, развивающегося у SEP-пациентов. Взятие пробы также осуществляли, согласно тому же самому протоколу, у здоровых пациентов (S). Эти пробы собирали прямо в пробирки PAXgeneTM Blood RNA (PreAnalytiX, Frankin Lakes, США).

После стадии взятия пробы крови и для достижения полного лизиса клеток, пробирки выдерживали при комнатной температуре в течение 4 часов, после чего хранили при температуре -20°С вплоть до экстракции биологического материала. Более конкретно, согласно этому протоколу, все РНК экстрагировали с помощью наборов PAXgene Blood RNA® (PreAnalytiX), соблюдая рекомендации изготовителя. Вкратце, пробирки центрифугировали (10 минут, ускорение 3000 g) для получения осадка нуклеиновых кислот. Этот осадок промывали и вновь помещали в буфер, содержащий протеиназу К, необходимую для расщепления белков (10 минут, при температуре 55°С). Осуществляли новое центрифугирование (5 минут, ускорение 19000 g) для удаления клеточных дебрисов и добавляли этанол для оптимизации условий фиксации нуклеиновых кислот. Все РНК специфически фиксировали в колонках PAXgene RNA spin column и, перед их элюированием, осуществляли расщепление загрязняющей ДНК с помощью набора RNAse free DNAse setTM (Qiagen Ltd, Crawley, UK).

Для каждой экстракции контролировали качество всех РНК путем капиллярного электрофореза, используя набор RNA 6000 Nano ChipTM (Agilent Technologies). Используемым инструментом является биоанализатор 2100. Реакцию обратной транскрипции (RT) осуществляли в конечном объеме 20 мкл. Полную РНК (0,5 мкг) смешивали с 1 мкл 50 мкМ polyT и 1 мкл буфера для гибридизации, затем инкубировали в течение 5 минут при температуре 65°С. После охлаждения на льду раствор смешивали с 10 мкл 2х первого фермента цепной реакции Mix и 2 мкл SuperScript III/RNaseTM без фермента Mix RT (15 Ед/мкл), причем все эти продукты происходили из системы для ПЦР с обратной транскриптазой SuperScript First Strand Synthesis Super MixTM RT-PCR (Invitrogen). Обратную транскрипцию осуществляли в течение 50 минут при температуре 50°С, затем прекращали путем инкубации в течение 5 минут при температуре 85°С. В завершение, каждый раствор кДНК разводили в 1/10 в DEPC-воде.

Получение эталонных наборов для количественного определения

Исходя из пула кДНК, происходящего от здоровых субъектов, осуществляли амплификацию области 153-179 гена-мишени S100A9 (банк генов, № NM_002965.3) путем ПЦР (полимеразная цепная реакция), проводимой вплоть до насыщения, используя следующую пару праймеров:

смысловой праймер: 5'-TCAAAGAGCTGGTGCGAAAA-3' (идентифицированная последовательность № 1)

антисмысловой праймер: 5'-AACTCCTCGAAGCTCAGCTG-3' (идентифицированная последовательность № 2)

Анализ экспрессии мРНК путем ПЦР в реальном режиме времени

Ретранскриптные мРНК гена-мишени S100A9, в виде кДНК, как описано выше, количественно определяли путем количественной ПЦР в режиме реального времени, используя LightCyclerTM (Roche). Реакции ПЦР осуществляли с помощью набора для ПЦР в режиме реального времени Fast-StartTM DNA Master SYBR Green I (Roche Molecular Biochemicals). Каждую ПЦР осуществляли в конечном объеме 20 мкл, содержащем 3,6 мкл воды, 2,4 мкл MgCl2, 2 мкл SYBR Green mix (Fast start DNA master SYBR green + Taq ДНК-полимераза) и 1 мкл каждого праймера (10 мкМ) и 10 мкл раствора кДНК. Используемыми праймерами являются вышеуказанные праймеры.

После стадии денатурации в течение 10 минут при температуре 95°С осуществляли амплификацию с помощью 40 циклов согласно протоколу «touch-down» ПЦР (10 секунд при температуре 95°С, 10 секунд гибридизации при температуре 68-58°С с последующим выдерживанием в течение 16 секунд при температуре 72°С). В конце каждого цикла измеряли эмиттируемую SYBR Green флуоресценцию.

Для подтверждения специфичности амплификации продукты ПЦР систематически анализировали в соответствии с кривой гибридизации (LightCyclerTM - Roche). Для этого, продукты ПЦР подвергали обработке возрастающей от 58°С до 98°С температурой с повышением 0,1°С/с. Для каждого продукта ПЦР получали один пик во время анализа кривой, характерный для температуры специфической гибридизации.

Комбинацию праймеров, необходимых для количественного определения гена «домашнего хозяйства» СРВ, получали от фирмы Search-LC (Гейдельберг, Германия; индекс 488116).

Количество мРНК-мишени по отношению к количеству мРНК гена «домашнего хозяйства» циклофилина В анализировали по способу относительной квантификации при использовании программного обеспечения LightCycler Relative Quantification SoftwareTM (Roche Molecular Biochemicals). «Second Derivative Maximum Method» программного обеспечения LightCyclerTM (Roche) использовали для определения автоматически «области гибридизации» (Ср) для каждого образца. Значение Ср определяли как количество циклов, для которого флуоресценция была значительно отличающейся от шумового фона.

Пять последовательных разведений в 1/10 осуществляли в четырех повторениях в случае каждого стандарта, чтобы построить калибровочную кривую, выражающую Ср в зависимости от логарифма числа копий. Разведения стандарта оптимизировали для того, чтобы калибровочная кривая перекрывала уровень экспрессии, ожидаемый для каждого гена-мишени и гена «домашнего хозяйства». Были построены относительные стандартные кривые, описывающие эффективность ПЦР для гена-мишени и гена «домашнего хозяйства», и использованы для осуществления квантификации с помощью программного обеспечения LightCycler Relative Quantification Software (Roche Molecular Biochemicals).

Полученные результаты

Полученные результаты представлены в нижеприводимой таблице 1.

Таблица 1
Пациенты Количество Медиана Нижний квартиль Верхний квартиль
S 44 1,46 1,065 1,87
SEP 148 16,62 11,87 25,835

р_Значение теста Mann-Whitney между здоровыми людьми и пациентами, пораженными септическим шоком, составляет <0,0001.

Экспрессия маркера S100A9 в первые 3 дня септического шока была значительно более сильно выражена по отношению к здоровым донорам.

Пример 2

Исследование экспрессии гена S100A8

Образцы

Использовали группу из 32 здоровых волонтеров (S) и группу из 86 пациентов, пораженных септическим синдромом (SEP) и пробы для анализа у которых брали между днем 7 и днем 10 после септического шока (Н0 означает инъекцию повышающего кровяное давление средства), в целях сравнения экспрессии гена S100A8 в периферической крови. Тогда четко различали группу из 32 здоровых пациентов (S) и группу из 86 пациентов с развивающимся септическим шоком (SEP).

Экстракция РНК и синтез кДНК

В случае каждого пациента, биологический образец представляет собой пробу крови, регулярно отбираемую в течение первых 10 дней, следующих за началом септического синдрома, развивающегося у SEP-пациентов. Взятие пробы также осуществляли, согласно тому же самому протоколу, у здоровых пациентов (S). Эти пробы собирали прямо в пробирки PAXgeneTM Blood RNA (PreAnalytiX, Frankin Lakes, США).

После стадии взятия пробы крови и для достижения полного лизиса клеток, пробирки выдерживали при комнатной температуре в течение 4 часов, после чего хранили при температуре -20°С вплоть до экстракции биологического материала. Более конкретно, согласно этому протоколу, все РНК экстрагировали с помощью наборов PAXgene Blood RNA® (PreAnalytiX), соблюдая рекомендации изготовителя. Вкратце, пробирки центрифугировали (10 минут, ускорение 3000 g) для получения осадка нуклеиновых кислот. Этот осадок промывали и вновь помещали в буфер, содержащий протеиназу К, необходимую для расщепления белков (10 минут, при температуре 55°С). Осуществляли новое центрифугирование (5 минут, ускорение 19000 g) для удаления клеточных дебрисов и добавляли этанол для оптимизации условий фиксации нуклеиновых кислот. Все РНК специфически фиксировали в колонках PAXgene RNA spin column и, перед их элюированием, осуществляли расщепление загрязняющей ДНК с помощью набора RNAse free DNAse setTM (Qiagen Ltd, Crawley, UK).

Для каждой экстракции контролировали качество всех РНК путем капиллярного электрофореза, используя набор RNA 6000 Nano ChipTM (Agilent Technologies). Используемым инструментом является биоанализатор 2100. Реакцию обратной транскрипции (RT) осуществляли в конечном объеме 20 мкл. Полную РНК (0,5 мкг) смешивали с 1 мкл 50 мкМ polyT и 1 мкл буфера для гибридизации, затем инкубировали в течение 5 минут при температуре 65оС. После охлаждения на льду раствор смешивали с 10 мкл 2х первого фермента цепной реакции Mix и 2 мкл SuperScript III/RNaseTM без фермента Mix RT (15 Ед/мкл), причем все эти продукты происходили из системы для ПЦР с обратной транскриптазой SuperScript First Strand Synthesis Super MixTM RT-PCR (Invitrogen). Обратную транскрипцию осуществляли в течение 50 минут при температуре 50°С, затем прекращали путем инкубации в течение 5 минут при температуре 85°С. В завершение, каждый раствор кДНК разводили в 1/10 в DEPC-воде.

Получение эталонных наборов для количественного определения

Исходя из пула кДНК, происходящего от здоровых субъектов, осуществляли амплификацию области 129-280 гена-мишени S100A8 (банк генов, № NM_002964.3) путем ПЦР (полимеразная цепная реакция), проводимой вплоть до насыщения, используя следующую пару праймеров:

смысловой праймер: 5'-ATTTCCATGCCGTCTACAGG-3' (идентифицированная последовательность № 3)

антисмысловой праймер: 5'-CACCAGAATGAGGAACTCCT-3' (идентифицированная последовательность № 4)

Анализ экспрессии мРНК путем ПЦР в реальном режиме времени

Ретранскриптные мРНК гена-мишени S100A8, в виде кДНК, как описано выше, количественно определяли путем количественной ПЦР в режиме реального времени, используя LightCyclerTM (Roche). Реакции ПЦР осуществляли с помощью набора для ПЦР в режиме реального времени Fast-StartTM DNA Master SYBR Green I (Roche Molecular Biochemicals). Каждую ПЦР осуществляли в конечном объеме 20 мкл, содержащем 3,6 мкл воды, 2,4 мкл MgCl2, 2 мкл SYBR Green mix (Fast start DNA master SYBR green + Taq ДНК полимераза) и 1 мкл каждого праймера (10 мкМ) и 10 мкл раствора кДНК. Используемыми праймерами являются вышеуказанные праймеры.

После стадии денатурации в течение 10 минут при температуре 95°С осуществляли амплификацию с помощью 40 циклов согласно протоколу «touch-down» ПЦР (10 секунд при температуре 95°С, 10 секунд гибридизации при температуре 68-58°С с последующим выдерживанием в течение 16 секунд при температуре 72°С). В конце каждого цикла измеряли эмиттируемую SYBR Green флуоресценцию.

Для подтверждения специфичности амплификации, продукты ПЦР систематически анализировали в соответствии с кривой гибридизации (LightCyclerTM - Roche). Для этого, продукты ПЦР подвергали обработке возрастающей от 58°С до 98°С температурой с повышением 0,1°С/с. Для каждого продукта ПЦР получали один пик во время анализа кривой, характерный для температуры специфической гибридизации.

Комбинацию праймеров, необходимых для количественного определения гена «домашнего хозяйства» СРВ, получали от фирмы Search-LC (Гейдельберг, Германия; индекс 488116).

Количество мРНК-мишени по отношению к количеству мРНК гена «домашнего хозяйства» циклофилина В анализировали по способу относительной квантификации при использовании программного обеспечения LightCycler Relative Quantification SoftwareTM (Roche Molecular Biochemicals). «Second Derivative Maximum Method» программного обеспечения LightCyclerTM (Roche) использовали для определения автоматически «области гибридизации» (Ср) для каждого образца. Значение Ср определяли как количество циклов, для которого флуоресценция была значительно отличающейся от шумового фона.

Пять последовательных разведений в 1/10 осуществляли в четырех повторениях в случае каждого стандарта, чтобы построить калибровочную кривую, выражающую Ср в зависимости от логарифма числа копий. Разведения стандарта оптимизировали для того, чтобы калибровочная кривая перекрывала уровень экспрессии, ожидаемый для каждого гена-мишени и гена «домашнего хозяйства». Были построены относительные стандартные кривые, описывающие эффективность ПЦР для гена-мишени и гена «домашнего хозяйства», и использованы для осуществления квантификации с помощью программного обеспечения LightCycler Relative Quantification Software (Roche Molecular Biochemicals).

Полученные результаты

Полученные результаты представлены в нижеприводимой таблице 2.

Таблица 2
Пациенты Количество Медиана Нижний квартиль Верхний квартиль
S 32 12,9 8,5 20,4
SEP 86 183,5 96,6 438,5

р_Значение теста Mann-Whitney между здоровыми людьми и пациентами, пораженными септическим шоком, составляет <0,0001.

Экспрессия маркера S100A8 в дни от 7 до 10 после септического шока была значительно более сильно выражена по отношению к здоровым донорам.

Пример 3

Исследование прогностического значения выживания S100A8 у пациентов с септическим шоком

Образцы

Исследование проводили при использовании группы из 86 пациентов с развитым септическим шоком и принятых в хирургическое или терапевтическое реанимационное отделение больничного центра Lyon-Sud. У этих пациентов брали пробы для анализа в день 7, день 8, день 9 или день 10 после септического шока (Н0 означает начало введения повышающего кровяное давление средства).

Экстракция РНК и синтез кДНК

В случае каждого пациента, биологический образец представляет собой пробу крови, которую ежедневно отбирали в течение первых 10 дней, следующих за началом септического синдрома (SEP-пациенты). Эти пробы собирали прямо в пробирки PAXgeneTM Blood RNA (PreAnalytiX, Frankin Lakes, США).

После стадии взятия пробы крови и для достижения полного лизиса клеток, пробирки выдерживали при комнатной температуре в течение 4 часов, после чего хранили при температуре -20°С вплоть до экстракции биологического материала. Более конкретно, согласно этому протоколу, все РНК экстрагировали с помощью наборов PAXgene Blood RNA® (PreAnalytiX), соблюдая рекомендации изготовителя. Вкратце, пробирки центрифугировали (10 минут, ускорение 3000 g) для получения осадка нуклеиновых кислот. Этот осадок промывали и вновь помещали в буфер, содержащий протеиназу К, необходимую для расщепления белков (10 минут, при температуре 55°С). Осуществляли новое центрифугирование (5 минут, ускорение 19000 g) для удаления клеточных дебрисов и добавляли этанол для оптимизации условий фиксации нуклеиновых кислот. Все РНК специфически фиксировали в колонках PAXgene RNA spin column и, перед их элюированием, осуществляли расщепление загрязняющей ДНК с помощью набора RNAse free DNAse setTM (Qiagen Ltd, Crawley, UK).

Для каждой экстракции контролировали качество всех РНК путем капиллярного электрофореза, используя набор RNA 6000 Nano ChipTM (Agilent Technologies). Используемым инструментом является биоанализатор 2100ТМ. Реакцию обратной транскрипции (RT) осуществляли в конечном объеме 20 мкл. Полную РНК (0,5 мкг) смешивали с 1 мкл 50 мкМ oligo(dT) и 1 мкл буфера для гибридизации, затем инкубировали в течение 5 минут при температуре 65°С. После охлаждения на льду, раствор смешивали с 10 мкл 2х первого фермента цепной реакции Mix и 2 мкл SuperScript III/RNase без фермента Mix RT (15 Ед/мкл), причем все эти продукты происходили из системы SuperScript First Strand Synthesis Super MixTM RT-PCR (Invitrogen). Обратную транскрипцию осуществляли в течение 50 минут при температуре 50°С, затем прекращали путем инкубации в течение 5 минут при температуре 85°С. В завершение, каждый раствор кДНК разводили в 1/10 в DEPC-воде.

Получение эталонных наборов для количественного определения

Исходя из пула кДНК, происходящего от здоровых субъектов, осуществляли амплификацию области 129-280 гена-мишени S100A8 (банк генов, № NM_002964.3) путем ПЦР (полимеразная цепная реакция), проводимой вплоть до насыщения, используя следующую пару праймеров:

смысловой праймер: 5'-ATTTCCATGCCGTCTACAGG-3' (идентифицированная последовательность № 3)

антисмысловой праймер: 5'-CACCAGAATGAGGAACTCCT-3' (идентифицированная последовательность № 4)

Анализ экспрессии мРНК путем количественной ПЦР в реальном режиме времени

Ретранскриптные мРНК гена-мишени S100A9, в виде кДНК, как описано выше, количественно определяли путем количественной ПЦР в режиме реального времени, используя LightCyclerTM (Roche). Реакции ПЦР осуществляли с помощью набора для ПЦР в режиме реального времени Fast-StartTM DNA Master SYBR Green I (Roche Molecular Biochemicals). Каждую ПЦР осуществляли в конечном объеме 20 мкл, содержащем 3,6 мкл воды, 2,4 мкл MgCl2, 2 мкл SYBR Green mix (Fast start DNA master SYBR green + Taq ДНК-полимераза) и 1 мкл каждого праймера (10 мкМ) и 10 мкл раствора кДНК. Используемыми праймерами являются вышеуказанные праймеры.

После стадии денатурации в течение 10 минут при температуре 95°С, осуществляли амплификацию с помощью 40 циклов согласно протоколу «touch-down» ПЦР (10 секунд при температуре 95°С, 10 секунд гибридизации при температуре 68-58°С (0,5оС/цикл), с последующим выдерживанием в течение 16 секунд при температуре 72°С). В конце каждого цикла измеряли эмиттируемую SYBR Green флуоресценцию.

Для подтверждения специфичности амплификации продукты ПЦР систематически анализировали в соответствии с кривой гибридизации (LightCyclerTM 2.0 - Roche). Для этого, продукты ПЦР подвергали обработке возрастающей от 58°С до 98°С температурой с повышением 0,1°С/с. Для каждого продукта ПЦР получали один пик во время анализа кривой, характерный для температуры специфической гибридизации.

Комбинацию праймеров, необходимых для количественного определения гена «домашнего хозяйства» СРВ, получали от фирмы Search-LC (Гейдельберг, Германия; индекс 488116).

Количество мРНК-мишени по отношению к количеству мРНК гена «домашнего хозяйства» циклофилина В анализировали по способу относительной квантификации при использовании программного обеспечения LightCycler Relative Quantification SoftwareTM (Roche Molecular Biochemicals). «Second Derivative Maximum Method» программного обеспечения LightCyclerTM (Roche) использовали для определения автоматически «области гибридизации» (Ср) для каждого образца. Значение Ср определяли как количество циклов, для которого флуоресценция была значительно отличающейся от шумового фона.

Пять последовательных разведений в 1/10 осуществляли в четырех повторениях в случае каждого стандарта, чтобы построить калибровочную кривую, выражающую Ср в зависимости от логарифма числа копий. Разведения стандарта оптимизировали для того, чтобы калибровочная кривая перекрывала уровень экспрессии, ожидаемый для гена-мишени и гена «домашнего хозяйства». Были построены относительные стандартные кривые, описывающие эффективность ПЦР для гена-мишени и гена «домашнего хозяйства», и использованы для осуществления квантификации с помощью программного обеспечения LightCycler Relative Quantification Software (Roche Molecular Biochemicals).

Анализ результатов

Для определения, коррелирует ли экспрессия гена S100A8 с выживанием пациента, осуществляли тест Mann-Whitney. На фиг.2 проиллюстрировано значительное различие экспрессии гена S100A8 (р=0,0461) между выжившими пациентами и невыжившими пациентами при использовании образцов проб крови, отбираемых между днем 7 и днем 10 после начала септического шока.

Пример 4

Исследование экспрессии гена S100A9 для определения восприимчивости пациентов к внутрибольничной инфекции

Образцы

Исследование проводили при использовании группы из 93 пациентов с проявляемым септическим шоком и принятых в хирургическое или терапевтическое реанимационное отделение больничного центра Lyon-Sud. У этих пациентов брали пробы для анализа в день 7, день 8, день 9 или день 10 после септического шока (Н0 означает начало введения повышающего кровяное давление средства).

Среди этих пациентов с проявляемым септическим шоком 27 пациентов вторично подверглись шоку за счет внутрибольничной инфекции и 66 пациентов не подверглись внутрибольничной инфекции в течение 53 дней наблюдения этой группы.

Экстракция РНК и синтез кДНК

В случае каждого пациента, биологический образец представляет собой пробу крови, которую регулярно отбирали в течение первых 10 дней, следующих за началом септического синдрома (SEP-пациенты). Взятие проб также осуществляли, согласно тому же самому протоколу, у здоровых субъектов (S). Эти пробы собирали прямо в пробирки PAXgeneTM Blood RNA (PreAnalytiX, Frankin Lakes, США).

После стадии взятия пробы крови и для достижения полного лизиса клеток, пробирки выдерживали при комнатной температуре в течение 4 часов, после чего хранили при температуре -20°С вплоть до экстракции биологического материала. Более конкретно, согласно этому протоколу, все РНК экстрагировали с помощью наборов PAXgene Blood RNA® (PreAnalytiX), соблюдая рекомендации изготовителя. Вкратце, пробирки центрифугировали (10 минут, ускорение 3000 g) для получения осадка нуклеиновых кислот. Этот осадок промывали и вновь помещали в буфер, содержащий протеиназу К, необходимую для расщепления белков (10 минут, при температуре 55°С). Осуществляли новое центрифугирование (5 минут, ускорение 19000 g) для удаления клеточных дебрисов и добавляли этанол для оптимизации условий фиксации нуклеиновых кислот. Все РНК специфически фиксировали в колонках PAXgene RNA spin columnTM и, перед их элюированием, осуществляли расщепление загрязняющей ДНК с помощью набора RNAse free DNAse setTM (Qiagen Ltd, Crawley, UK).

В случае каждой экстракции, контролировали качество всех РНК путем капиллярного электрофореза, используя набор RNA 6000 Nano ChipTM (Agilent Technologies). Используемым инструментом является биоанализатор 2100ТМ. Реакцию обратной транскрипции (RT) осуществляли в конечном объеме 20 мкл. Полную РНК (0,5 мкг) смешивали с 1 мкл 50 мкМ polyT и 1 мкл 50 мкМ oligo(dT) и 1 мкл буфера для гибридизации, затем инкубировали в течение 5 минут при температуре 65°С. После охлаждения на льду раствор смешивали с 10 мкл 2х первого фермента цепной реакции Mix и 2 мкл SuperScript III/RNase без фермента Mix RT (15 Ед/мкл), причем все эти продукты происходили из системы SuperScript First Strand Synthesis Super MixTM RT-PCR (Invitrogen). Обратную транскрипцию осуществляли в течение 50 минут при температуре 50°С, затем прекращали путем инкубации в течение 5 минут при температуре 85°С. В завершение, каждый раствор кДНК разводили в 1/10 в DEPC-воде.

Получение эталонных наборов для количественного определения

Исходя из пула кДНК, происходящего от здоровых субъектов, осуществляли амплификацию области 153-179 гена-мишени S100A9 (банк генов, № NM_002965.3) путем ПЦР (полимеразная цепная реакция), проводимой вплоть до насыщения, используя следующую пару праймеров:

смысловой праймер: 5'-TCAAAGAGCTGGTGCGAAAA-3' (идентифицированная последовательность № 1)

антисмысловой праймер: 5'-AACTCCTCGAAGCTCAGCTG-3' (идентифицированная последовательность № 2)

Анализ экспрессии мРНК путем ПЦР в реальном режиме времени

Ретранскриптные мРНК гена-мишени S100A9, в виде кДНК, как описано выше, количественно определяли путем количественной ПЦР в режиме реального времени, используя LightCyclerTM (Roche). Реакции ПЦР осуществляли с помощью набора для ПЦР в режиме реального времени Fast-StartTM DNA Master SYBR Green I (Roche Molecular Biochemicals). Каждую ПЦР осуществляли в конечном объеме 20 мкл, содержащем 3,6 мкл воды, 2,4 мкл MgCl2, 2 мкл SYBR Green mix (Fast start DNA master SYBR green + Taq ДНК-полимераза) и 1 мкл каждого праймера (10 мкМ) и 10 мкл раствора кДНК. Используемыми праймерами являются вышеуказанные праймеры.

После стадии денатурации в течение 10 минут при температуре 95°С осуществляли амплификацию с помощью 40 циклов согласно протоколу «touch-down» ПЦР (10 секунд при температуре 95°С, 10 секунд гибридизации при температуре 68-58°С, с последующим выдерживанием в течение 16 секунд при температуре 72°С). В конце каждого цикла измеряли эмиттируемую SYBR Green флуоресценцию.

Для подтверждения специфичности амплификации продукты ПЦР систематически анализировали в соответствии с кривой гибридизации (LightCyclerTM - Roche). Для этого, продукты ПЦР подвергали обработке возрастающей от 58°С до 98°С температурой с повышением 0,1°С/с. Для каждого продукта ПЦР получали один пик во время анализа кривой, характерный для температуры специфической гибридизации.

Комбинацию праймеров, необходимых для количественного определения гена «домашнего хозяйства» СРВ, получали от фирмы Search-LC (Гейдельберг, Германия; индекс 488116).

Количество мРНК-мишени по отношению к количеству мРНК гена «домашнего хозяйства» циклофилина В анализировали по способу относительной квантификации при использовании программного обеспечения LightCycler Relative Quantification SoftwareTM (Roche Molecular Biochemicals). «Second Derivative Maximum Method» программного обеспечения LightCyclerTM (Roche) использовали для определения автоматически «области гибридизации» (Ср) для каждого образца. Значение Ср определяли как количество циклов, для которого флуоресценция была значительно отличающейся от шумового фона.

Пять последовательных разведений в 1/10 осуществляли в четырех повторениях в случае каждого стандарта, чтобы построить калибровочную кривую, выражающую Ср в зависимости от логарифма числа копий. Разведения стандарта оптимизировали для того, чтобы калибровочная кривая перекрывала уровень экспрессии, ожидаемый для гена-мишени и гена «домашнего хозяйства». Были построены относительные стандартные кривые, описывающие эффективность ПЦР для гена-мишени и гена «домашнего хозяйства», и использованы для осуществления квантификации с помощью программного обеспечения LightCycler Relative Quantification Software (Roche Molecular Biochemicals).

Результаты моноварьируемого и мультиварьируемого анализов

Для определения переменных, влияющих на неожиданное появление внутрибольничной инфекции, осуществляли моноварьируемый анализ, затем мультиварьируемый анализ. Моноварьируемый анализ реализовали, осуществляя логистическую регрессию достигаемого или не достигаемого статуса внутрибольничной инфекции в зависимости от различных переменных и в отношении маркера S100A9 в случае мРНК в дни от 7 до 10 после начала септического шока. Затем реализовали мультиварьируемую логистическую регрессию в отношении переменных, представляющих уровень значимости (р)<0,15 при моноварьируемом анализе. Метод «обратной» селекции (вначале все переменные принимали во внимание на модели, затем их извлекали по одной) использовали с порогом значимости 0,05. Результаты представлены в нижеприводимой таблице 3. Для каждого результата указаны коэффициент нечетности (O.R.) и его доверительный интервал 95%.

Таблица 3
Моноварьируемый анализ (N=93) Мультиварьируемый анализ (N=93)
OR 95% CI P OR 95% CI P
Пол Мужской 1 - -
Женский 1,6 0,641-3,997 0,3143
Возраст (лет) >65 1 - - - - -
≤ 65 2,04 0,814-5,115 0,1285 - - 0,1186
SAPS II с допущением >51 1 - -
≤51 1,107 0,450-2,723 0,8246
SOFA с допущением <10 1 - - - - -
≥10 3,036 1,132-8,144 0,0274- - - 0,1384
Созаболеваемости 0 1 - -
≥1 1,021 0,414-2,514 0,9645
Тип инфекции Внутрибольничная 1 - -
Общая 1,144 0,467-2,803 0,7682
Область инфекции Легочная 1 - -
Абдоминальная 1,735 0,644-4,672 0,3268
Другие 1,172 0,299-4,597 0,8540
S100A9 (МРНК) <6,1 1 - - 1 - -
≥6,1 6,27 1,718-22,891 0,0055 6,242 1,662-23,447 0,0067
OR: коэффициент нечетности.
CI: доверительный интервал.
Р: порог значимости.

Как это следует из таблицы 3, мультиварьируемый анализ показывает, что экспрессия маркера S100A9≥6,1 в дни 7-10 после начала септического шока значительно повышает вероятность неожиданного появления внутрибольничной инфекции (коэффициент нечетности составляет 6,2).

Пример 5

Исследование корреляции экспрессии гена S100A9 и экспрессии гена S100A8

Образцы

Исследование проводили при использовании группы из 86 пациентов с проявляемым септическим шоком и принятых в хирургическое или терапевтическое реанимационное отделение больничного центра Lyon-Sud. У этих пациентов брали пробы для анализа в день 7, день 8, день 9 или день 10 после септического шока (Н0 означает начало введения повышающего кровяное давление средства).

Экстракция РНК и синтез кДНК

В случае каждого пациента, биологический образец представляет собой пробу крови, которую ежедневно отбирали в течение первых 10 дней, следующих за началом септического синдрома (SEP-пациенты). Эти пробы собирали прямо в пробирки PAXgeneTM Blood RNA (PreAnalytiX, Frankin Lakes, США).

После стадии взятия пробы крови и для достижения полного лизиса клеток пробирки выдерживали при комнатной температуре в течение 4 часов, после чего хранили при температуре -20оС вплоть до экстракции биологического материала. Более конкретно, согласно этому протоколу, все РНК экстрагировали с помощью наборов PAXgene Blood RNA® (PreAnalytiX), соблюдая рекомендации изготовителя. Вкратце, пробирки центрифугировали (10 минут, ускорение 3000 g) для получения осадка нуклеиновых кислот. Этот осадок промывали и вновь помещали в буфер, содержащий протеиназу К, необходимую для расщепления белков (10 минут, при температуре 55оС). Осуществляли новое центрифугирование (5 минут, ускорение 19000 g) для удаления клеточных дебрисов и добавляли этанол для оптимизации условий фиксации нуклеиновых кислот. Все РНК специфически фиксировали в колонках PAXgene RNA spin columnTM и перед их элюированием осуществляли расщепление загрязняющей ДНК с помощью набора RNAse free DNAse setTM (Qiagen Ltd, Crawley, UK).

В случае каждой экстракции, контролировали качество всех РНК путем капиллярного электрофореза, используя набор RNA 6000 Nano ChipTM (Agilent Technologies). Используемым инструментом является биоанализатор 2100ТМ. Реакцию обратной транскрипции (RT) осуществляли в конечном объеме 20 мкл. Полную РНК (0,5 мкг) смешивали с 1 мкл 50 мкМ oligo(dT) и 1 мкл буфера для гибридизации, затем инкубировали в течение 5 минут при температуре 65оС. После охлаждения на льду раствор смешивали с 10 мкл 2х первого фермента цепной реакции Mix и 2 мкл SuperScript III/RNase без фермента Mix RT (15 Ед/мкл), причем все эти продукты происходили из системы для ПЦР с обратной транскриптазой SuperScript First Strand Synthesis Super MixTM RT-PCR (Invitrogen). Обратную транскрипцию осуществляли в течение 50 минут при температуре 50°С, затем прекращали путем инкубации в течение 5 минут при температуре 85°С. В завершение, каждый раствор кДНК разводили в 1/10 в DEPC-воде.

Получение эталонных наборов для количественного определения

Исходя из пула кДНК, происходящего от здоровых субъектов, осуществляли амплификацию области 153-179 гена-мишени S100A9 (банк генов, № NM_002965.3) путем ПЦР (полимеразная цепная реакция), проводимой вплоть до насыщения, используя следующую пару праймеров:

смысловой праймер: 5'-TCAAAGAGCTGGTGCGAAAA-3' (идентифицированная последовательность № 1)

антисмысловой праймер: 5'-AACTCCTCGAAGCTCAGCTG-3' (идентифицированная последовательность № 2)

Исходя из пула кДНК, происходящего от здоровых субъектов, осуществляли амплификацию области 129-280 гена-мишени S100A8 (банк генов, № NM_002964.3) путем ПЦР (полимеразная цепная реакция), проводимой вплоть до насыщения, используя следующую пару праймеров:

смысловой праймер: 5'-ATTTCCATGCCGTCTACAGG-3' (идентифицированная последовательность № 3)

антисмысловой праймер: 5'-CACCAGAATGAGGAACTCCT-3' (идентифицированная последовательность № 4)

Анализ экспрессии мРНК путем количественной ПЦР в реальном режиме времени

Ретранскриптные мРНК генов-мишеней S100A9 и S100A8, в виде кДНК, как описано выше, количественно определяли путем количественной ПЦР в режиме реального времени, используя LightCyclerTM 2.0 (Roche). Реакции ПЦР осуществляли с помощью набора для ПЦР в режиме реального времени Fast-StartTM DNA Master SYBR Green I (Roche Molecular Biochemicals). Каждую ПЦР осуществляли в конечном объеме 20 мкл, содержащем 3,6 мкл воды, 2,4 мкл MgCl2, 2 мкл SYBR Green mix (Fast start DNA master SYBR green + Taq ДНК-полимераза) и 1 мкл каждого праймера (10 мкМ) и 10 мкл раствора кДНК. Используемыми праймерами являются вышеуказанные праймеры.

После стадии денатурации в течение 10 минут при температуре 95°С осуществляли амплификацию с помощью 40 циклов согласно протоколу «touch-down» ПЦР (10 секунд при температуре 95°С, 10 секунд гибридизации при температуре 68-58°С (0,5°С/цикл), с последующим выдерживанием в течение 16 секунд при температуре 72°С). В конце каждого цикла измеряли эмиттируемую SYBR Green флуоресценцию.

Для подтверждения специфичности амплификации продукты ПЦР систематически анализировали в соответствии с кривой гибридизации (LightCyclerTM 2.0 - Roche). Для этого, продукты ПЦР подвергали обработке возрастающей от 58°С до 98°С температурой с повышением 0,1°С/с. Для каждого продукта ПЦР получали один пик во время анализа кривой, характерный для температуры специфической гибридизации.

Комбинацию праймеров, необходимых для количественного определения гена «домашнего хозяйства» СРВ, получали от фирмы Search-LC (Гейдельберг, Германия; индекс 488116).

Количество мРНК-мишеней по отношению к количеству мРНК гена «домашнего хозяйства» циклофилина В анализировали по способу относительной квантификации при использовании программного обеспечения LightCycler Relative Quantification SoftwareTM (Roche Molecular Biochemicals). «Second Derivative Maximum Method» программного обеспечения LightCyclerTM (Roche) использовали для определения автоматически «области гибридизации» (Ср) для каждого образца. Значение Ср определяли как количество циклов, для которого флуоресценция была значительно отличающейся от шумового фона.

Пять последовательных разведений в 1/10 осуществляли в четырех повторениях в случае каждого стандарта, чтобы построить калибровочную кривую, выражающую Ср в зависимости от логарифма числа копий. Разведения стандарта оптимизировали для того, чтобы калибровочная кривая перекрывала уровень экспрессии, ожидаемый для генов-мишеней и гена «домашнего хозяйства». Были построены относительные стандартные кривые, описывающие эффективность ПЦР для гена-мишени и гена «домашнего хозяйства», и использованы для осуществления квантификации с помощью программного обеспечения LightCycler Relative Quantification Software (Roche Molecular Biochemicals).

Анализ результатов

Для определения, коррелирует ли экспрессия гена S100A9 с экспрессией гена S100A8, осуществляли корреляционный анализ. Результаты, представленные на фиг.1, показывают, что существует сильная корреляция между генными экспрессиями этих двух молекул с коэффициентом Spearman >0,90. Генные экспрессии молекул S100A9 и S100A8, следовательно, обладают подобной способностью к распознаванию пациентов, восприимчивых к внутрибольничной инфекции, и к составлению прогноза развития септического синдрома.

Библиографические ссылки

[I] M.M. Levy, M.P. Fink, J.C. Marshall, E. Abraham, D. Angus, D. Cook, J. Cohen, S.M. Opal, J.L. Vincent and G. Ramsay, 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions
Conference, Crit. Care Med. 31 (2003), pp.1250-1256.

[2] Boom R. et al., J. Clin. Microbiol., 1990, n° 28 (3), pp.495-503.

[4] Kricka et al., Clinical Chemistry, 1999, n° 45(4), pp.453-458.

[5] Keller G.H. et al., DNA Probes, 2nd Ed., Stockton Press, 1993, sections 5 et 6, pp.173-249.

[6] Bustin S.A. Journal of molecular endocrinology, 2002, 29:23-39.

[7] Giulietti A. Methods, 2001, 25:386-401.

[8] Porter R.R, 1959, Biochem. J., 73:119-126.

[9] Nisonoff A. et al., 1960, Science, 132:1770-1771.

[10] Skerra A., 1993, Curr. Opin. Immunol., 5:256-262.

[II] Huston P. et al., 1988, Proc. Natl. Acad. Sci. USA, 85:5879-5883.

[12] Fluss R., Faraggi D., Reiser B. (2005), "Estimation of the Youden index and its associated cutoff point". Biometrical Journal, 47:458-72.

1. Способ определения восприимчивости пациента с септическим шоком к внутрибольничной инфекции, согласно которому:
a) получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента и экстрагируют биологический материал из биологического образца, причем указанный биологический материал представляет собой нуклеиновую кислоту или белок;
b) получают по меньшей мере один специфический реагент, выбранный из праймера амплификации, зонда гибридизации, антитела, в отношении продукта экспрессии по меньшей мере одного гена-мишени, представляющего собой ген-мишень S100A9;
c) определяют, исходя из биологического материала, экстрагированного из биологического образца, экспрессию гена-мишени S100A9, причем сверхэкспрессия по отношению к определенной пороговой величине является указанием на восприимчивость к внутрибольничной инфекции.

2. Способ по п.1, в котором на стадии с) определяют, кроме того, экспрессию гена-мишени S100A8, причем сверхэкспрессия гена-мишени S100A8 по отношению к определенной пороговой величине является указанием на восприимчивость к внутрибольничной инфекции.

3. Способ по п.1, в котором биологическим образцом является образец крови.

4. Способ по п.1, в котором биологическим материалом является нуклеиновая кислота или белок.

5. Способ по п.1, в котором специфический реагент в отношении продукта экспрессии гена S100A9 включает по меньшей мере один специфический праймер амплификации гена-мишени S100A9.

6. Способ по п.1, в котором специфический реагент в отношении продукта экспрессии гена S100A9 включает по меньшей мере один специфический зонд гибридизации гена-мишени S100A9.

7. Способ по п.1, в котором специфический реагент в отношении продукта экспрессии гена S100A9 включает по меньшей мере одно антитело, специфичное к молекуле S100A9.

8. Применение по меньшей мере одного специфического реагента, выбранного из праймера амплификации, зонда гибридизации, антитела, в отношении продукта экспрессии гена S100A9 для определения восприимчивости пациента с септическим шоком к внутрибольничной инфекции.

9. Применение по п.8, в котором специфический реагент в отношении продукта экспрессии гена S100A9 включает по меньшей мере один специфический зонд гибридизации гена-мишени S100A9.

10. Применение по п.8, в котором специфический реагент в отношении продукта экспрессии гена S100A9 включает по меньшей мере один специфический праймер амплификации гена-мишени S100A9.

11. Применение по п.8, в котором специфический реагент в отношении продукта экспрессии гена S100A9 включает по меньшей мере одно антитело, специфичное к молекуле S100A9.



 

Похожие патенты:

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы).

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy. 3 з.п. ф-лы, 4 ил., 5 табл., 5 пр.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе. Способ предусматривает следующее. Гранулу биокатализатора с заключенными в ней клетками одного или нескольких видов родококков помещают в лунку 96-луночного планшета, добавляют краситель иодонитротетразолий (INT). После появления специфического фиолетового окрашивания формазана измеряют оптическую плотность гранулы с помощью планшетного фотометра. В случае окрашенного субстрата или предварительного нахождения иммобилизованного биокатализатора в почве проводят экстракцию формазана 96% этанолом и измеряют оптическую плотность экстракта. Число жизнеспособных родококков в грануле геля определяют с помощью калибровочного графика зависимости оптической плотности от числа живых клеток в суспензии, определенного традиционным методом высева на плотную питательную среду. Затем из окрашенной красителем гранулы биокатализатора или из гранулы после экстракции красителя выделяют ДНК и проводят ПЦР с использованием наборов видоспецифических праймеров. Определяют видовое положение иммобилизованных родококков. Изобретение позволяет сократить время дифференциации родококков и повысить точность способа. 1 з.п. ф-лы, 3 табл., 4 ил., 4 пр.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. Охарактеризованное решение может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1. Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле. При осуществлении мультиплексной ПЦР используют четыре пары праймеров, комплементарных к участкам гена внеклеточной термонуклеазы (nuc), гена лейкоцидина Пантона-Валлентайна (pvl), гена белка токсического шока (tst) и гена устойчивости к метициллину (mecA). Генотипы золотистого стафилококка определяют по наличию или отсутствию генов вирулентности pvl и tst и гена устойчивости к метициллину mecA или их сочетаний. Изобретение позволяет определять отдельные генотипы золотистого стафилококка одновременно в одной мультиплексной реакции, а также исключить предварительный этап идентификации микроорганизма. 1 ил., 2 табл., 2 пр.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3', обратный праймер - 5'-GGCCTCGCААССАССACTTGTC-3', разрушаемый зонд - (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемый штамм относят к определенной группе, виду или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов лактобацилл в микробиоте человека, продуктах питания, а также для определения исследуемого штамма в клинических пробах или молекулярного отслеживания в коммерческих препаратах. 3 табл., 3 пр.

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα). Описаны варианты способа идентификации пациентов для получения MEDI-545 по обнаружению таких профилей экспрессии ИФНα-индуцируемых ФД маркеров. Использование изобретения обеспечивает распознавание тех пациентов, для которых лечение нейтрализующим антителом MEDI-545 может быть действительно эффективным, что может найти применение в медицине. 7 н. и 3 з.п. ф.-лы, 90 ил., 33 табл., 22 пр.

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемые штаммы относят к определенному виду и/или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов бифидобактерий, определения исследуемых штаммов в клинических пробах или их молекулярного отслеживания в коммерческих препаратах. 3 табл.

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения. Предложенный способ включает проведение ПЦР с синтетическими олигонуклеотидными праймерами на район гена hyaD Pasteurella multocida, перенос продукта амплификации на гель и оценку проведения реакции. Для постановки ПЦР используют ДНК, выделенную из патологического материала или бактериальных культур. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 218 п.н. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл.
Наверх