Способ определения нуклеотидной последовательности pu(5mc)gpy в заданном положении протяженной днк



Способ определения нуклеотидной последовательности pu(5mc)gpy в заданном положении протяженной днк
Способ определения нуклеотидной последовательности pu(5mc)gpy в заданном положении протяженной днк
Способ определения нуклеотидной последовательности pu(5mc)gpy в заданном положении протяженной днк
Способ определения нуклеотидной последовательности pu(5mc)gpy в заданном положении протяженной днк

 


Владельцы патента RU 2525710:

Общество с ограниченной ответственностью "СибЭнзайм" (RU)

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy. 3 з.п. ф-лы, 4 ил., 5 табл., 5 пр.

 

Изобретение относится к биотехнологии и касается способа определения нуклеотидной последовательности (сайта) 5'-Pu(5mC)GPy-3'/3'-PyG(5mC)Pu-5' (здесь и далее 5mC - 5-метилцитозин) в заданном положении протяженной ДНК.

Метилирование ДНК является одним из основных и наиболее изученных механизмов эпигенетической регуляции активности генов высших эукариот. Метилирование CpG-островков в 5'-регуляторной области блокирует транскрипцию соответствующих генов и в норме имеет место при инактивации Х-хромосомы, а также импринтинге отдельных генов [1]. В свою очередь аберрантное метилирование сайтов PuCGPy (с образованием последовательности Pu(5mC)GPy) ДНК-метилтрансферазами человека DNMT3a и DNMT3b в регуляторных районах связывают с развитием некоторых заболеваний, в частности, онкопатологий [2, 3]. Гиперметилирование CpG-островков в регуляторных областях генов-онкосупрессоров, характерное для опухолевых тканей, сохраняется и в малигнантных клеточных линиях, полученных из этих тканей [4, 5].

Наиболее известным способом определения эпигенетического статуса участков ДНК является использование эндонуклеаз рестрикции, блокируемых метилированнием цитозиновых оснований в сайтах узнавания. Чаще всего используется пара эндонуклеаз HpaII и MspI, которые узнают тетрануклеотидную последовательность CCGG, но блокируются по-разному: MspI не расщепляет последовательность (5mC)CGG, a HpaII - C(5mC)GG [6]. В случае метилирования внутреннего CG-динуклеотида этого сайта он будет расщепляться эндонуклеазой MspI, и амплификация фрагмента ДНК происходить не будет, тогда как HpaII такой сайт не расщепляет и в ходе ПЦР будет происходить наработка фрагмента ДНК.

Недостатком способа является то, что последовательность CCGG в отличие от PuCGPy не является сайтом для аберрантного метилирования de novo, таким образом, диагностическая ценность этого способа ниже. Другие используемые для анализа эндонуклеазы рестрикции (HhaI, BstUI, AciI и т.д.) также не удобны для полноценного анализа наличия метилирования, поскольку их сайты узнавания включают в себя лишь некоторые из возможных точек метилирования ДНК эукариот и, в добавок, не имеют изошизомеров, отличающихся по чувствительности к метилированному основанию в CG-динуклеотиде (что желательно для наличия положительного контроля в экспериментах).

Альтернативой является использование для анализа статуса метилирования ДНК метилзависимых эндонуклеаз, которые специфически фрагментируют только метилированную ДНК. Недавно зарубежными исследователями в этих целях был использован фермент McrBC, который узнает последовательность R(mC)N40-2000R(mC) и расщепляет ее вблизи от одного из двух узнаваемых динуклеотидов [7-9]. В настоящее время такой подход используется только в научно-исследовательских работах и в клинической практике пока не применяется. Использование эндонуклеазы McrBC для анализа наличия метилированой ДНК имеет ряд недостатков. В частности, зависимость от двух метилированных цитозиновых оснований, удаленных на значительное расстояние друг от друга, ограничивает возможность определения наличия метилирования в произвольно выбранной области ДНК.

Применение вместо McrBC метилзависимой сайт-специфической ДНК-эндонуклеазы GlaI, сайт узнавания которой полностью соответствует продукту реакции, образующемуся при метилировании ДНК de novo клеточными метилазами DNMT3a и DNMT3b [10, 11], позволяет избавиться от данного недостатка.

Наиболее близким к заявленному способу-прототипом, является способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК, включающий предварительный гидролиз исследуемой ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI и последующую амплификацию в реальном времени с ПЦР-хелперами [12]. Использование хелперов, представляющих собой сложные олигонуклеотидные структуры, 3' половина которых комплементарна исследуемой ДНК до места предполагаемого гидролиза, а 5' конец кодирует последовательность для праймера, позволяет точно отметить место гидролиза GlaI, таким образом, наличие ПЦР сигнала однозначно говорит о наличии последовательности Pu(5mC)GPy.

Недостатками известного способа являются длительность, дороговизна и ограниченные функциональные возможности. Так, каждый раунд амплификации содержит две стадии отжига и элонгации: на первой гибридизуется хелпер и затем с него достраивается последовательность ДНК, являющаяся комплементарной к праймеру, а далее, после денатурации, гибридизуется праймер и происходит дальнейшая наработка ампликона. Так как хелпер и праймер имеют схожие структуры, то между ними происходит сильная конкуренция, для уменьшения которой необходимо тщательно подбирать соотношение праймер/хелпер и использовать в структуре хелпера единичные замены нуклеотидов на инозин. Кроме того, подобная система отличается низкой эффективностью ПЦР, длительностью времени реакции (для получения данных необходимо провести до 85 раундов ПЦР), высокой вероятностью преждевременного разложения компонентов реакционной смеси и необходимостью синтеза уникального хелпера для каждой исследуемой последовательности.

Задачей изобретения является упрощение известного способа и расширение его функциональных возможностей.

Поставленная задача достигается предлагаемым способом, заключающимся в получении образцов высокоочищенной ДНК, предварительной фрагментации выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, в частности TaqI; гидролизом фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигировании универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 5' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составлением заключения по появлению флуоресцентного сигнала в случае наличия последовательности 5'-Pu(5mC)GPy-3'/3'-PyG(5mC)Pu-5'.

Высокоочищенную ДНК выделяют, как описано ранее в [13]. Предварительную фрагментацию ДНК проводят в реакционной смеси, содержащей ДНК и эндонуклеазу рестрикции TaqI (или ее изошизомера) в течение 2 часов при 65°C в буфере: 33 мМ трис-ацетат, pH 7,9; 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ дитиотреитол. Затем фрагментированную ДНК расщепляют путем добавления 1-2 е.а. метилзависимой сайт-специфической ДНК-эндонуклеазы GlaI (или ее изошизомера), в реакционном буфере (20 мМ Tris-SO4, pH 8.0, 4 мМ MgCl2, 1 мМ β-меркаптоэтанол, 100 нг/мкл BSA) в течение 1 часа при 30°C с последующей инактивацией при 65°C в течение 20 минут. Далее, в реакционную смесь вносят АТФ до конечной концентрации 0,5-1,0 мМ, ПЭГ до 1-2%, β-меркаптоэтанол до 6,8-8,0 мМ, универсальный адаптер (5'-CTCCCGCCTGCTCTTTCATCG-3'/3'-ACGAGAAAGTAGC-5') до конечной концентрации 500-1000 нМ и 500-1000 е.а. высокоактивной Т4 ДНК-лигазы. Реакцию лигирования адаптера проводят в течение 15 минут при 25°C, затем лигазу термоинактивируют при 65°C в течение 20 минут. Для проведения реакции ПЦР к смеси добавляют до достижения итоговых концентраций: 50 мМ Tris-SO4, pH 9.0, 30 мМ KCl, 10 мМ сульфата аммония, 3 мМ MgCl2, 0,2 мМ, смеси дезоксирибонуклеозидтрифосфатов, 0,01% Tween-20, смесь праймеров и зонда по 0,4-0,8 мкМ каждого и 0,04-0,1 е.а./мкл Hot Start ДНК-полимеразы. Появление флуоресцентного сигнала в ходе ПЦР однозначно говорит о наличии последовательности Pu(5mC)GPy в заданном положении протяженной ДНК.

Определяющими отличительными признаками предлагаемого способа по сравнению с прототипом являются:

1. Предварительную фрагментацию ДНК осуществляют эндонуклеазой рестрикции TaqI или другой, не имеющей сайта узнавания в изучаемом регионе, что позволяет провести более полное расщепление исходной ДНК;

2. К гидролизованной ДНК лигируют универсальный олигонуклеотидный адаптер 5'-CTCCCGCCTGCTCTTTCATCG-3'/3'-CGATGAAAGAGCA-5', что позволяет упростить способ и расширить его функциональные возможности за счет того, что в процессе лигирования гидролизованной ДНК с универсальным адаптером маркируются все последовательности Pu(5mC)GPy, что позволяет анализировать любую последовательность Pu(5mC)GPy на протяженной ДНК, в том числе и несколько последовательностей одновременно (мультиплекс);

3. Амплификацию проводят с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее трем нуклеотидам 3' конца ДНК от заданного места гидролиза метилзависимой сайт-специфической ДНК-эндонуклеазой, а оставшаяся часть комплементарна адаптерной последовательности, что позволяет повысить специфичность гибридизации к исследуемому району ДНК.

Изобретение иллюстрируется следующими примерами конкретного выполнения.

Пример 1. Определение последовательности Pu(5mC)GPy в плазмиде pHspAI2.

Плазмида pHspAI2 несет в себе ген метилазы M.HspAI, которая узнает последовательность 5'-GCGC-3'/3'-CGCG-5' и метилирует внутренний цитозин с образованием последовательности 5'-G(5mC)GC-3'/3'-CG(5mC)G-5'. Данная последовательность является частным случаем сайта узнавания метилзависимой ДНК-эндонуклеазы GlaI.

Предварительную фрагментацию ДНК плазмиды pHspAI2 проводили в 50 мкл реакционной смеси, включающей 5 мкг ДНК и 20 единиц эндонуклеазы рестрикции GsaI в течение 2 часов при 65°C в буфере: 33 мМ трис-ацетат, pH 7,9; 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ дитиотреитол. В качестве контрольной ДНК использовали неметилированную плазмиду pBR322, которую подвергали предварительному гидролизу аналогичным образом ДНК-эндонуклеазой HindIII в течение 2 часов при 37°C в буфере: 10 мM трис-хлорид, pH 8,5; 10 мМ хлорид магния, 100 мМ хлорид натрия, 1 мМ дитиотреитол. Затем гидролизаты ДНК очищали фенол-хлороформной экстракцией и высаживали 96% этанолом по общепринятой методике [13], после чего осадки ДНК высушивали при комнатной температуре и растворяли в 40 мкл буфера ТЕ (10 мМ трис-HCl, pH 8,0; 1 мМ ЭДТА). Концентрацию фрагментированной ДНК измеряли при помощи спектрофотометра и доводили до концентрации 1500 копий/мкл раствором буфера ТЕ, содержащего 5 нг/мкл ДНК фага λ. В эксперимент брали 6 различных пробирок (табл.1), в каждую вносили по 15 мкл соответствующей ДНК. Пробирка 1 - эксперимент, 2-4 - использованы в качестве контроля соответствующих стадий, 5 - отрицательный контроль. Затем фрагментированную ДНК расщепляли путем добавления 1 е.а. метилзависимой сайт-специфической ДНК-эндонуклеазы GlaI, в реакционном буфере (20 мМ Tris-SO4, pH 8.0, 4 мМ MgCl2, 1 мМ β-меркаптоэтанол, 100 нг/мкл BSA) в течение 1 часа при 30°C с последующей инактивацией при 65°C в течение 20 минут. Далее, в реакционную смесь вносили АТФ до концентрации 0,5 мМ, ПЭГ до 1%, β-меркаптоэтанол до 6,8 мМ, универсальный адаптер до 500 нМ и 1000 е.а. высокоактивной Т4 ДНК-лигазы. Лигировали 15 минут при 25°C, затем термоинактивировали при 65°C в течение 20 минут. Для проведения реакции ПЦР к смеси добавляли до достижения итоговых концентраций: 50 мМ Tris-SO4, pH 9.0, 30 мМ KCl, 10 мМ сульфата аммония, 3 мМ MgCl2, 0,2 мМ смеси дезоксирибонуклеозидтрифосфатов, 0,01% Tween-20, смесь праймеров и зонда по 0,4 мкМ каждого и 0,04 е.а./мкл Hot Start ДНК-полимеразы. Структура праймеров и зонда следующая: прямой - 5'-GACACATGCAGCTCCCGGAGA-3', гибридный - 5'-CCTGCTCTTTCATCGGCCCT-3' (подчеркнута часть праймера, комплементарная исследуемой ДНК), зонд - 5'-FAM-TCTGCTCCCGGC ATCCGCTTAC AGAC-BHQ1-3'. Полученную смесь разделяли на 3 части и амплифицировали на амплификаторах ДТ-322 (ДНК-технология) либо CFX-96 (Bio-Rad) по программе: 95°C 3 мин, далее 5 циклов без детекции: 95°C 10 сек, 61°C 30 сек, 72°C 10 сек; затем 45 циклов с детекцией (канал FAM) на стадии отжига: 95°C 10 сек, 61°C 30 сек, 72°C 10 сек.

В таблице 1 представлены результаты качественного анализа наличия последовательности Pu(5mC)GPy в протяженной бактериальной ДНК.

Таблица 1.
Пробирка № 1 2 3 4 5
Плазмидная ДНК pHspAI2 pHspAI2 pHspAI2 pHspAI2 pBR322
Добавление GlaI + - + - +
Добавление лигазы + + - - +
Наличие последовательности Pu(5mC)GPy (3 повтора) + - - - -
+ - - - -
+ - - - -

На фиг.1 показана кривая накопления продукта с модифицированной ДНК с течением времени. При этом видно, что реакция ПЦР происходит только тогда, когда к изучаемой ДНК после предварительного гидролиза GlaI лигируется адаптер, тем самым создавая условия для правильного отжига гибридного праймера (табл.1, пробирка 1). Если хотя бы одна из стадий пропущена, то наработка продукта невозможна (табл.1, пробирки 2-4), равно как и наличие неспецифической ДНК не дает ложноположительных результатов (табл.1, пробирка 5).

Пример 2. Определение последовательности Pu(5mC)GPy в первом экзоне гена-онкосупрессора CST6.

Для анализа наличия последовательности Pu(5mC)GPy была выбрана ДНК из клеток Raji (лимфома Беркитта), в которой исследуемый район гена CST6 гиперметилирован, в качестве неметилированного отрицательного контроля ДНК мыши линии А/Не.

Предварительную фрагментацию и очистку ДНК проводили аналогично примеру 1, но в качестве эндонуклеазы рестрикции, не имеющей сайта узнавания в исследуемом районе, применяли TaqI в буфере: 33 мМ трис-ацетат, pH 7,9; 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ дитиотреитол. Для анализа использовали ДНК в концентрации 1500 копий/мкл без дополнительного добавления ДНК фага λ. Последующее расщепление и дотирование полученных фрагментов также проводили в условиях, описанных в примере 1, но с увеличенными концентрациями реактивов при лигировании. Конечные концентрации составили: АТФ 1 мМ, ПЭГ 2%, β-меркаптоэтанол 8 мМ, универсальный адаптер 1000 нМ и использовали 1000 е.а. высокоактивной Т4 ДНК-лигазы в реакцию. ПЦР осуществляли, как описано в примере 1, за исключением того, что использовали ДНК-праймеры: прямой - 5'-GC ATGGTCGGAGAACTCC-3', гибридный - 5'-CTGCTCTTTCATCGGCCGC-3' (подчеркнута часть праймера, комплементарная исследуемой ДНК) и зонд - 5'-FAM-CTTCTGC ACCTGCGGGTCGT-BHQ1-3'.

В таблице 2 представлены результаты анализа наличия последовательности Pu(5mC)GPy в первом экзоне гена-онкосупрессора CST6.

Таблица 2.
Пробирка № 1 2 3 4 5 6 7 8
ДНК Raji Мышь
Добавление GlaI + - - + + - -
Добавление лигазы + - + - + - + -
Наличие последовательности Pu(5mC)GPy (3 повтора) + - - - - - - -
+ - - - - - - -
+ - - - - - - -

На фиг.2 показана кривая накопления продукта с модифицированной ДНК Raji с течением времени. Аналогично примеру 1, реакция ПЦР происходит только тогда, когда к изучаемой ДНК после предварительного гидролиза GlaI лигируется адаптер, тем самым создавая условия для правильного отжига гибридного праймера (табл.2, пробирка 1). В случае с геномной ДНК человека пропуск одной или нескольких стадий также препятствует наработке продукта (табл.2, пробирки 2-4). Неметилированная ДНК эукариотическая ДНК не дает ложноположительных результатов независимо от пропущенных стадий (табл.2, пробирки 5-8).

Пример 3. Определение последовательности Pu(5mC)GPy в первом экзоне гена-онкосупрессора RARB.

Для анализа наличия последовательности Pu(5mC)GPy была выбрана ДНК из клеток Raji (лимфома Беркитта), в которой гиперметилирована исследуемая область гена RARB, в качестве отрицательного контроля неспецифической ДНК была выбрана ДНК мыши линии А/Не и плазмида pHspAI2.

Предварительную фрагментацию и очистку ДНК проводили аналогично примеру 1, но в качестве эндонуклеазы рестрикции, не имеющей сайта узнавания в исследуемом районе, применяли TaqI в буфере: 33 мМ трис-ацетат, pH 7,9; 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ дитиотреитол. Для анализа использовали ДНК в концентрации 1500 копий/мкл. Последующее расщепление и лигирование полученных фрагментов также проводили в условиях, описанных в примере 1, но с отличиями: в случае с ДНК человека и мыши не добавляли ДНК фага λ, а в реакцию брали 2 е.а. эндонуклеазы рестрикции GlaI.

ПЦР осуществляли, как описано в примере 1, за исключением того, что использовали следующие ДНК-праймеры: прямой - 5'-ТТС AGAGGC AGGAGGGTCTATTC-3', гибридный - 5'-CCTGCTCTTTCATCGGTTCTCG-3' (подчеркнута часть праймера, комплементарная исследуемой ДНК) и зонд - 5'-FAM-TCCCAGTCCTCAAACAGCTCGCATGG-BHQ1-3'. Также были повышены концентрации праймеров и зонда до 0,8 мкМ каждого и Hot Start ДНК-полимеразы до 0,1 е.а./мкл

В таблице 3 представлены результаты анализа наличия последовательности Pu(5mC)GPy в первом экзоне гена-онкосупрессора RARB.

Таблица 3.
Пробирка № 1 2 3 4 5 6 7 8 9 10 11 12
ДНК Raji Мышь pHspAI2
Добавление GlaI + + - - + + - - + + - -
Добавление лигазы + - + - + - + - + - + -
Наличие последовательности Pu(5mC)GPy (3 повтора) + - - - - - - - - - - -
+ - - - - - - - - - - -
+ - - - - - - - - - - -

На фиг.3 показана кривая накопления продукта с модифицированной ДНК Raji с течением времени. Аналогично примеру 1, реакция ПЦР происходит только тогда, когда к изучаемой ДНК после предварительного гидролиза GlaI лигируется адаптер, тем самым создавая условия для правильного отжига гибридного праймера (табл.3, пробирка 1). В случае с геномной ДНК человека пропуск одной или нескольких стадий также препятствует наработке продукта (табл.3, пробирки 2-4). Неспецифическая эукариотическая и бактериальная ДНК не дает ложноположительных результатов независимо от пропущенных стадий (табл.3, пробирки 5-12).

Пример 4. Применение изошизомера GlaI для определения последовательности Pu(5mC)GPy в первом экзоне гена-онкосупрессора RARB.

Для анализа наличия последовательности Pu(5mC)GPy была выбрана ДНК из клеток Raji (лимфома Беркитта), в которой гиперметилирована исследуемая область гена RARB и в качестве отрицательного контроля неспецифической ДНК была выбрана ДНК мыши линии А/Не.

Предварительную фрагментацию и очистку ДНК проводили аналогично примеру 1, но в качестве эндонуклеазы рестрикции, не имеющей сайта узнавания в исследуемом районе, применяли TaqI в буфере: 33 мМ трис-ацетат, pH 7,9; 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ дитиотреитол. Для анализа использовали ДНК в концентрации 1500 копий/мкл без дополнительного добавления ДНК фага λ. Последующее расщепление и лигирование полученных фрагментов также проводили в условиях, описанных в примере 1, но для специфического гидролиза метилированной ДНК использовали изошизомер GlaI метилзависимую ДНК-эндонуклеазу MoxI. ПЦР осуществляли, как описано в примере 1, с праймерами и зондом из примера 3.

В таблице 4 представлены результаты анализа наличия последовательности Pu(5mC)GPy в первом экзоне гена-онкосупрессора RARB.

Таблица 4.
Пробирка № 1 2 3 4 5 6 7 8
ДНК Raji Мышь
Добавление GlaI + - - + + - -
Добавление лигазы + - + - + - + -
Наличие последовательности Pu(5mC)GPy (3 повтора) + - - - - - - -
+ - - - - - - -
+ - - - - - -

На фиг.4 показана кривая накопления продукта с модифицированной ДНК Raji с течением времени. Аналогично примеру 1, реакция ПЦР происходит только тогда, когда к изучаемой ДНК после предварительного гидролиза MoxI лигируется адаптер, тем самым создавая условия для правильного отжига гибридного праймера (табл.4, пробирка 1). В случае с геномной ДНК человека пропуск одной или нескольких стадий также препятствует наработке продукта (табл.4, пробирки 2-4). Неспецифическая мышиная ДНК не дает ложноположительных результатов независимо от пропущенных стадий (табл.4, пробирки 5-8).

Пример 5. Определение минимального количества детектируемых последовательностей Pu(5mC)GPy в геномной ДНК Raji.

Предварительную фрагментацию и очистку ДНК проводили аналогично примеру 1, но в качестве эндонуклеазы рестрикции, не имеющей сайта узнавания в исследуемом районе, применяли TaqI в буфере: 33 мМ трис-ацетат, pH 7,9; 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ дитиотреитол. Для анализа использовали ДНК в концентрациях 1500, 750, 300, 100, 50, 25, 10, 5, 2,5; 1,6; 0,8; 0,4; и 0,2 копий/мкл (табл.5, пробирки 1-13). Для создания нуклеотидной нагрузки добавляли к образцам ДНК фага X до концентрации 10 нг/мкл. Последующее расщепление и лигирование полученных фрагментов проводили в условиях, описанных в примере 1. ПЦР осуществляли, как описано в примере 1, с праймерами и зондом из примера 3.

В таблице 5 представлены результаты анализа наличия последовательности Pu(5mC)GPy в протяженной геномной ДНК человека при различных концентрациях.

Таблица 5.
Пробирка № 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Концентрация исходной ДНК Raji (копий/мкл)
1500 750 300 100 50 25 10 5 2,5 1,6 0,8 0,4 0,2 0
Количество последовательностей Pu(5mC)GPy на 1 лунку ПЦР
7500 3750 1500 500 250 125 50 25 12,5 8 4 2 1 0
Детекция последовательности Pu(5mC)GPy (3 повтора)
+ + + + + + + + + + + + - -
+ + + + + + + + - - + - + -
+ + + + + + + + + - - - -

Из таблицы 5 видно, что предлагаемый способ обладает высокой специфичностью и позволяет выявлять до единичных количеств последовательностей Pu(5mC)GPy в изучаемом препарате.

Использование заявляемого способа позволит более полно и чувствительно определять последовательность Pu(5mC)GPy в образцах ДНК, а также сократить время анализа, удешевить способ за счет применения универсального адаптера для всех последовательностей Pu(5mC)GPy в протяженной ДНК, и расширить его функциональные возможности за счет анализа любой последовательности Pu(5mC)GPy, в том числе и нескольких последовательностей одновременно (мультиплекс).

Источники информации

1. Deaton A.M., Bird A. CpG islands and the regulation of transcription // Genes Dev. - 2011. - Vol.25. - P.1010-1022.

2. Handa V., Jeltsch A. Profound sequence preference of Dnmt3a and Dnmt3b mammalian DNA methytransferases shape the human epigenome // J. Mol. Biol. - 2005. - Vol.348. P.1103-1112.

3. Estecio M., Issa J.P. Dissecting DNA hypermethylation in cancer // FEBS Letters. - 2011. - Vol.585. - P.2078-2086.

4. Киселева Н.П., Лихтенштейн A.B. Эпигенетические изменения в опухолевых клетках. Роль метилирования ДНК в канцерогенезе. Канцерогенез. / Под ред. Д.Г. Заридзе. - М.: Медицина, 2004. - С.191-203.

5. de Caseres I.I., Cairus P. Methylated DNA sequences for early cancer detection, molecular classification and chemotherapy response prediction // Clin. Transl. Oncol. - 2007. - Vol.9. - P.429-437.

6. Zilberman D., Henikoff S. Genome-wide analysis of DNA methylation patterns. Development. 2007. 134:3959-3965.

7. Yamada Y., Watanabe H., Miura F., Soejima H., Uchiyama M., Iwasaka Т., Mukai Т., Sakaki Y., Ito T. A comprehensive analysis of allelic methylation status of CpG islands on human chromosome 21q. Genome Res. 2004. 14:247-266.

8. Oakes C.C., La Salle S., Robaire В., Trasler J.M. Evaluation of a quantitative DNA methylation analysis technique using methylation-sensitive/dependent restriction enzymes and real-time PCR. Epigenetics. 2006. 1:146-152.

9. Hublarova P., Hrstka R., Rotterova P., Rotter L., Coupkova M., Badal V., Nenutil R., Vojtesek B. 2009. Prediction of human papilomavirus 16 Е6 gene expression and cervical intraepithelial neoplasia progression by methylation status. Int. J. Gyn. Cancer, 19, 321-325.

10. Чернухин B.A., Наякшина Т.Н., Абдурашитов М.А., Томилова Ю.Э., Мезенцева Н.В., Дедков B.C., Михненкова Н.А., Гончар Д.А., Дегтярев С.Х. Новая эндонуклеаза рестрикции GlaI узнает метилированную последовательность 5'-G(5mC)^GC-3'. Биотехнология, 2006, 4: 31-35.

11. Tarasova G.V., Nayakshina T.N., Degtyarev S.Kh. Substrate specificity of new methyl-directed DNA endonuclease GlaI. BMC Molecular Biology, 2008, 9:7.

12. Rand KN, Young GP, Ho T, Molloy PL. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes. Nucleic Acids Res. 2013 January; 41(1): e15.

13. Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.

1. Способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК, включающий выделение высокоочищенной ДНК, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI с последующей амплификацией в реальном времени и составлением заключения о наличии последовательности Pu(5mC)GPy по появлению флуоресцентного сигнала, отличающийся тем, что выделенную ДНК предварительно фрагментируют ДНК-эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, а к гидролизованной ДНК лигируют универсальный олигонуклеотидный адаптер 5'-CTCCCGCCTGCTCTTTCATCG-3'/3'-CGATGAAAGAGCA-5' с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее трем нуклеотидам 3' конца ДНК от заданного места гидролиза метилзависимой сайт-специфической ДНК-эндонуклеазой, а оставшаяся часть комплементарна адаптерной последовательности.

2. Способ по п.1, отличающийся тем, что фрагментацию выделенной ДНК проводят эндонуклеазой рестрикции TaqI, GsaI, НаеIII, либо любой другой, не имеющей сайта узнавания в амплифицируемом районе.

3. Способ по п.1, отличающийся тем, что гидролиз фрагментированной ДНК - осуществляют метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером.

4. Способ по п.1, отличающийся тем, что адаптер используют в концентрации 500-1000 нМ.



 

Похожие патенты:

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе. Способ предусматривает следующее. Гранулу биокатализатора с заключенными в ней клетками одного или нескольких видов родококков помещают в лунку 96-луночного планшета, добавляют краситель иодонитротетразолий (INT). После появления специфического фиолетового окрашивания формазана измеряют оптическую плотность гранулы с помощью планшетного фотометра. В случае окрашенного субстрата или предварительного нахождения иммобилизованного биокатализатора в почве проводят экстракцию формазана 96% этанолом и измеряют оптическую плотность экстракта. Число жизнеспособных родококков в грануле геля определяют с помощью калибровочного графика зависимости оптической плотности от числа живых клеток в суспензии, определенного традиционным методом высева на плотную питательную среду. Затем из окрашенной красителем гранулы биокатализатора или из гранулы после экстракции красителя выделяют ДНК и проводят ПЦР с использованием наборов видоспецифических праймеров. Определяют видовое положение иммобилизованных родококков. Изобретение позволяет сократить время дифференциации родококков и повысить точность способа. 1 з.п. ф-лы, 3 табл., 4 ил., 4 пр.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. Охарактеризованное решение может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1. Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле. При осуществлении мультиплексной ПЦР используют четыре пары праймеров, комплементарных к участкам гена внеклеточной термонуклеазы (nuc), гена лейкоцидина Пантона-Валлентайна (pvl), гена белка токсического шока (tst) и гена устойчивости к метициллину (mecA). Генотипы золотистого стафилококка определяют по наличию или отсутствию генов вирулентности pvl и tst и гена устойчивости к метициллину mecA или их сочетаний. Изобретение позволяет определять отдельные генотипы золотистого стафилококка одновременно в одной мультиплексной реакции, а также исключить предварительный этап идентификации микроорганизма. 1 ил., 2 табл., 2 пр.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3', обратный праймер - 5'-GGCCTCGCААССАССACTTGTC-3', разрушаемый зонд - (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемый штамм относят к определенной группе, виду или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов лактобацилл в микробиоте человека, продуктах питания, а также для определения исследуемого штамма в клинических пробах или молекулярного отслеживания в коммерческих препаратах. 3 табл., 3 пр.

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα). Описаны варианты способа идентификации пациентов для получения MEDI-545 по обнаружению таких профилей экспрессии ИФНα-индуцируемых ФД маркеров. Использование изобретения обеспечивает распознавание тех пациентов, для которых лечение нейтрализующим антителом MEDI-545 может быть действительно эффективным, что может найти применение в медицине. 7 н. и 3 з.п. ф.-лы, 90 ил., 33 табл., 22 пр.

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемые штаммы относят к определенному виду и/или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов бифидобактерий, определения исследуемых штаммов в клинических пробах или их молекулярного отслеживания в коммерческих препаратах. 3 табл.

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения. Предложенный способ включает проведение ПЦР с синтетическими олигонуклеотидными праймерами на район гена hyaD Pasteurella multocida, перенос продукта амплификации на гель и оценку проведения реакции. Для постановки ПЦР используют ДНК, выделенную из патологического материала или бактериальных культур. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 218 п.н. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл.

Группа изобретений относится к области микробиологии и биотехнологии. Способ детекции живых клеток микроорганизма в тестируемом образце путем отличия живых клеток от мертвых клеток или поврежденных клеток предусматривает добавление в тестируемый образец средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм; облучение тестируемого образца; амплификацию мишеневой области ДНК или РНК микроорганизма, содержащегося в тестируемом образце, способом амплификации нуклеиновых кислот в присутствии средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот, соли магния, соли органической кислоты или соли фосфорной кислоты, без выделения нуклеиновых кислот из клеток и анализа продукта амплификации. Способ может быть осуществлен посредством применения набора, состоящего из средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм, средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот и праймеров для амплификации мишеневой области. При помощи данных изобретений можно с высокой чувствительностью и точностью детектировать живые клетки микроорганизмов в различных биологических образцах. 2 н. и 25 з.п. ф-лы, 17 ил., 12 табл., 9 пр.
Наверх