Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса мачупо методом полимеразной цепной реакции в реальном времени



Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса мачупо методом полимеразной цепной реакции в реальном времени
Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса мачупо методом полимеразной цепной реакции в реальном времени

 


Владельцы патента RU 2525937:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор"" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру:

внешний: 5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄

внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

зонд: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. Охарактеризованное решение может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

 

Изобретение относится к наборам олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени и может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах для уточнения диагноза, а также для решения научно-исследовательских задач по изучению свойств вируса Мачупо, созданию диагностических, профилактических или лечебных препаратов против вируса Мачупо. Использование специфичных праймеров и зондов позволяет выявлять генетический материал вируса Мачупо в исследуемых образцах методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Вирус Мачупо является представителем рода Arenavirus семейства Arenaviridae (http://www.ictvonline.org/virusTaxonomy.asp?version=2011). Вирусный геном сегментирован (L- и S-сегменты) и представлен одноцепочечной РНК.

Вирус Мачупо является возбудителем Боливийской геморрагической лихорадки - острого инфекционного заболевания, характеризующегося природной очаговостью; аспирационным (воздушно-пылевой путь), фекально-оральным и контактным механизмами передачи возбудителя; тяжелым течением с общеинтоксикационным синдромом, экзантемой, геморрагическим синдромом, поражением сердечно-сосудистой и нервной системы.

Эндемичной территорией для вируса Мачупо являются сельскохозяйственные районы на северо-востоке Боливии и севере Парагвая. Вспышки заболевания регистрируются с 1959 года с интервалом в несколько лет. Последняя крупная вспышка (более 200 заболевших) произошла в 2008 году [Aguilar P.V., Camargo W., Vargas J. et al. Reemergence of Bolivian hemorrhagic fever, 2007-2008. // Emerg. Infect. Dis. - 2009. - 15(9). - P.1526-28]. Переносчиком вируса Мачупо и источником заражения для человека являются грызуны Calomys callosus. Люди инфицируются в результате контактов с инфицированными животными, их экскрементами и мочой, содержащими вирус. Заболевание регистрируется чаще у жителей сельских районов. Кроме этого возможна вторичная передача вируса Мачупо от человека человеку [Charrel R.N., Lamballerie X. Arenaviruses other than Lassa virus. // Antiviral Research. - 2003. - 57(1-2). - P.89-100].

Летальность при заболевании боливийской геморрагической лихорадкой составляет примерно 20 % [Bradfute S.B., Stuthman K.S., Shurtleff A.C., Bavari S. A STAT-1 knockout mouse model for Machupo virus pathogenesis. // Virol. J. - 2011. - 8:300. - doi: 10.1186/1743-422X-8-300].

Актуальность своевременной диагностики лихорадки Мачупо в странах, не являющихся эндемичными территориями, связана с возможностью завоза этой инфекции из Южной Америки.

Известна тест-система для раннего выявления заболевания, вызываемого вирусом Мачупо, на основе метода ИФА с возможностью определения наличия специфических иммуноглобулинов класса М [ S., H., T. et al. Serological Assays Based on Recombinant Viral Proteins for the Diagnosis of Arenavirus Hemorrhagic Fevers // Viruses. - 2012. - 4(10). - P.2097-114].

Однако иммуноглобулины класса М появляются на 10-20 сут после заражения, что приводит к поздней диагностики заболевания.

Известны наборы праймеров для флуоресцентной количественной ПЦР-диагностики вируса Мачупо (патент Китая № CN101805802, МПК C12Q1/68; C12Q1/70; G01N21/64, опубл. 2010-08-18). Полимеразная цепная реакция (ПЦР) является методом ранней диагностики аренавирусных инфекций и позволяет обнаруживать РНК вируса Мачупо с первых дней появления клинических признаков.

Наиболее близким аналогом (прототипом) является ПЦР тест-система для выявления РНК вируса Мачупо методом обратной транскрипции в режиме реального времени. [Vieth S., Drosten Ch., Charrel R., et al. Establishment of conventional and fluorescence resonance energy transfer-based real-time PCR assays for detection of pathogenic New World arenaviruses // J. Clin. Virol. - 2005. - 32. - P.229-35].

Однако чувствительность тест-систем выше приведенного аналога и прототипа составляла около 50 ТЦД50/реакцию, а аналитическая чувствительность - около 100 геномных эквивалентов/реакцию.

Техническим результатом изобретения является разработка более чувствительного набора специфичных олигонуклеотидных праймеров и зонда для выявления генетического материала вируса Мачупо в клинических образцах и биологических жидкостях, образцах внешней среды и других вируссодержащих пробах (культуральная вируссодержащая жидкость и др.) методом ОТ-ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Указанный технический результат достигается тем, что набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру:

внешний:

5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄

внутренний:

5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

зонд:

R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1

Изобретение иллюстрируется следующими графическими материалами. На фиг.1 и 2 представлены кривые флуоресценции на канале R6G/Yellow (530 nm/555 nm) амплификатора Rotor Gene 6000.

В приложении приведены олигонуклеотидные последовательности, видоспецифичные РНК вируса Мачупо.

Методика получения набора праймеров и зонда. Диагностические праймеры и флуоресцентно-меченый зонд конструировались для участка S-сегмента генома вируса Мачупо и оптимизации концентраций компонентов реакционной смеси и условий проведения ПЦР. Для контроля амплификации были получены рекомбинантные плазмиды, несущие вирусспецифический участок ДНК-матрицы.

На начальном этапе был проведен анализ нуклеотидных последовательностей геномов вируса Мачупо, имеющихся в базе данных NCBI (http://www.ncbi.nlm.nih.gov/), и определены консервативные участки. В качестве мишени для диагностических праймеров и зонда был выбран находящийся в S-сегменте вирусного генома участок гена N, кодирующего нуклеокапсидный белок.

Анализ свойств олигонуклеотидных праймеров и зондов проводился с использованием программы Vector NTI 9.0.0 (InforMax).

Для идентификации генетического материала вируса Мачупо методом ПЦР в реальном времени были подобраны праймеры и зонд, представленные ниже:

F/MACHV TCCTCYTCACCCCTTTTGTTCTTTCT
R/MACHV CGCACAGTGGATCCTAGGCA
Z/MACHV (R6G)-TGAGTCCACCGRAAGCTGGGRATYTCYTT-(BHQ1)

Пример 1. Проверка аналитической чувствительности набора праймеров и зондов.

Для контроля амплификации были получены положительные контрольные образцы (ПКО), представляющие собой рекомбинантные плазмиды, несущие вирусспецифические вставки, являющиеся матрицей для амплификации вирусспецефических ДНК-фрагментов.

Для проведения ПЦР в режиме реального времени, в качестве анализируемых образцов использовали рекомбинантную плазмидную ДНК, включающую вставку ДНК, соответствующую детектируемому участку генома вируса Мачупо.

Условия проведения амплификации оптимизировались по следующим параметрам: концентрация ионов магния в реакционной смеси; концентрация праймеров и зонда в реакционной смеси; температура отжига праймеров.

Для определения аналитической чувствительности из концентрированного раствора плазмидной ДНК были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК осуществляли при помощи флуориметра QUBIT (Invitrogen, США) и наборов реагентов того же производителя.

ПЦР в режиме реального времени для детекции генетического материала вируса Мачупо проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия), детекцию результатов амплификации (рисунок 1) осуществляли по каналу R6G/Yellow (530 nm/555 nm).

Минимальное количество ДНК-матриц, детектируемое в ПЦР после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах), составило 10 ГЭ в образце.

На фиг.1 представлены кривые флуоресценции на канале R6G/Yellow (530 nm/555 nm) амплификатора Rotor Gene 6000 (Corbett Research, Австралия). Стрелкой обозначена кривая флуоресценции, соответствующая ПКО. Обозанчение образцов, содержащих разные концентрации ДНК-матрицы: 1 - 1010 ГЭ; 2 - 109 ГЭ; 3 - 108 ГЭ; 4 - 107 ГЭ; 5 - 106 ГЭ; 6 - 105 ГЭ; 7 - 104 ГЭ; 8 - 103 ГЭ; 9 - 102 ГЭ; 10 - 10 ГЭ в образце.

Пример 2. Определение РНК вируса Мачупо в вируссодержащих образцах.

Для проверки специфичности использовали культуральную вируссодержащую жидкость (КВЖ) с титром вируса Мачупо 4,2 × 105 БОЕ/мл. Для проведения реакции использовали 20 мкл КВЖ.

Инактивацию образцов и выделение РНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3. 2569 -09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I - IV групп патогенности».

Процедуру выделения РНК из исследуемого материала проводили с использованием набора реагентов «Рибо-сорб» (ФГУН ЦНИИЭ Роспотребнадзора) в соответствии с инструкцией по применению.

Реакцию обратной транскрипции проводили с использованием набора реагентов «Реверта-L» (ФГУН ЦНИИЭ Роспотребнадзора) в соответствии с инструкцией по применению.

ПЦР в режиме реального времени проводили в реакционной смеси следующего состава (на 1 исследование):

кДНК 5 мкл
10×Taq буфер без Mg2+ 3 мкл
100 mM раствор MgCl2 1 мкл
5 mM раствор dNTP 1 мкл
Смесь праймеров и зондов (по 2 о.е. каждого) по 1 мкл каждого
Smart Taq DNA-Полимераза 5 ед/ мкл 0,3 мкл
Вода для ПЦР до 30 мкл общего объема

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по следующей программе, представленной в таблице 1.

Таблица 1. Программа проведения ПЦР

Температура (оС) Время (минуты:секунды) Количество циклов
95 05:00 1
95 00:10 45
54 00:20
72 00:20

Измерение флуоресценции осуществляли при температуре 54 С на канале R6G/Yellow.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов.

На фиг 2 приведены кривые флуоресценции образцов, содержащих вирус Мачупо, на канале R6G/Yellow (530 nm/555 nm) амплификатора Rotor Gene 6000 (Corbett Research, Австралия), из которых видно, что используемые праймеры и зонд выявляли РНК вируса Мачупо в образце, кривая накопления флуоресценции имела характерную «сигмовидную» форму и пересекала пороговую линию при значение Ct не больше 10.

Таким образом, минимальное количество РНК вируса, детектируемое в ПЦР после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах), составило 10 ГЭ в образце, вследствие чего чувствительность заявляемых праймеров значительно выше прототипа.

Приложение

<110> Федеральное бюджетное учреждение науки «Государственный

научный центр вирусологии и биотехнологии "Вектор"» (ФБУН

ГНЦ ВБ "Вектор")

<120> Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени

<210> 1

<223> Последовательности олигонуклеотидов видоспецифические к вирусу Мачупо,

<400> 1 для выявленя РНК вируса Мачупо:

внешний:

5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄ (26 н)

внутренний:

5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ (20 н)

зонд:

R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1 (29 н)

Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени, включающий последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру:
внешний:
5΄→3΄ 5΄ TCCTCYTCACCCCTTTTGTTCTTTCT 3΄
внутренний:
5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄
зонд:
R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1



 

Похожие патенты:

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.
Представленный способ получения бактериофага включает: засев бактериальной культуры штамма-хозяина в титре 108-109 КОЕ/мл в сосуд для культивирования на скошенную плотную питательную среду с толщиной слоя от 10 мм до 25 мм, культивирование в течение 3-3,5 часов при оптимальной температуре для роста культуры штамма-хозяина, затем на полученный газон культуры штамма-хозяина засевают маточный бактериофаг в титре 105-106 БОЕ/мл и культивируют в течение 13-15 часов при оптимальной температуре и толщине слоя воздуха над поверхностью плотной питательной среды от 25 мм до 40 мм.

Изобретение относится к области биотехнологии, вирусологии и медицины. Предложен реассортантный вирус гриппа для производства вакцин.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.
Изобретение относится к области вирусологии и касается штамма вируса гриппа H10N7-cyбтипа. Охарактеризованный штамм вируса гриппа A/pochard/Siberia/249/08-МА H10N7-субтипа выделен из клоакального смыва красноголового нырка и адаптирован к линии BALB/c мышей.
Изобретение относится к области ветеринарной микробиологии, вирусологии и биотехнологии и касается способа получения вакцины против инфекционного ринотрахеита крупного рогатого скота.
Изобретение относится к медицинской вирусологии и микробиологии. Способ оценки активности лечебно-профилактических препаратов против вируса натуральной оспы включает введение в организм модельных животных контрольной и испытуемой групп по заданной схеме суспензии исследуемого противовирусного препарата, интраназальное заражение их штаммом вируса натуральной оспы, инкубацию вируса в организме животных и определение концентрации вируса в легких животных с последующим вычислением оценочных показателей снижения концентрации вируса в легких.

Изобретение относится к области вирусологии и биотехнологии. Штамм вируса иммунодефицита человека I-типа ИВ741 выделен на территории РФ от больного не получавшего АРВ-терапию.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу B, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.

Изобретение относится к области биохимии, в частности к полипептидам, которые являются ингибиторами клетки метанопродуцента и биологическими маркерами для детекции фага φmru, а также к полинуклеотидам, которые кодируют эти полипептиды.
Изобретение относится к области биотехнологии и может быть использовано при производстве медико-биологических препаратов. Фармацевтическая композиция содержит бактериофаги, полученные путем культивирования на питательной среде, содержащей глюкозу, натрий хлористый, натрий двузамещенный фосфорнокислый, дрожжевой автолизат жидкий и очищенную воду в заданном соотношении, и высушенные с наполнителем без лиофилизации, в виде таблеток с желудочно-резистентным покрытием.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру: внешний: 5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄ внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄ зонд: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1. Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.
Наверх