Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса хунин методом полимеразной цепной реакции в реальном времени



Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса хунин методом полимеразной цепной реакции в реальном времени
Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса хунин методом полимеразной цепной реакции в реальном времени

 


Владельцы патента RU 2525938:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор"" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру:

внешний: 5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄

внутренний: 5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

зонд: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1.

Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

 

Изобретение относится к наборам олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени и может быть использовано в медицинской практике для выявления генетического материала вируса Хунин в клинических или секционных образцах для уточнения диагноза, а также для решения научно-исследовательских задач по изучению свойств вируса Хунин, созданию диагностических, профилактических или лечебных препаратов против вируса Хунин. Использование специфичных праймеров и зондов позволяет выявлять генетический материал вируса Хунин в исследуемых образцах методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Вирус Хунин является представителем рода Arenavirus семейства Arenaviridae (http://www.ictvonline.org/virusTaxonomy.asp?version=2011). Вирусный геном сегментирован (L- и S-сегменты) и представлен одноцепочечной РНК.

Вирус Хунин является возбудителем Аргентинской геморрагической лихорадки - острого инфекционного заболевания, характеризующегося природной очаговостью; аспирационным (воздушно-пылевой путь), фекально-оральным и контактным механизмами передачи возбудителя; тяжелым течением с общеинтоксикационным синдромом, экзантемой, геморрагическим синдромом.

Эндемичными районами для инфекции, общая площадь которых составляет около 150000 км2, являются провинции Аргентины. Ежегодно регистрируются вспышки заболевания с числом заболевших от 100 до 3500 человек. Однако, по приблизительным подсчетам, потенциальный риск на эндемичной территории данная инфекция представляет для 5 млн. человек. Переносчиком вируса Хунин и источником заражения для человека являются грызуны Calomis laucha и Calomis musculinus, которые выделяют вирус со слюной и мочой. Люди инфицируются в результате контактов с инфицированными животными, их экскрементами и мочой, содержащими вирус. Заболевание регистрируется чаще у жителей сельских районов [Маркин В.А., Пантиухов В.Б., Марков В.И., Бондарев В.П. Аргентинская геморрагическая лихорадка //ЖМЭИ. - 2012. - 2. - Стр. 78-87].

Летальность при заболевании аргентинской геморрагической лихорадкой колеблется от 15 до 30 %.

Актуальность своевременной диагностики лихорадки Хунин в странах, не являющихся эндемичными территориями, связана с возможностью завоза этой инфекции из Южной Америки.

Известна тест-система для диагностики Аргентинской геморрагической лихорадки на основе метода ИФА с возможностью определения наличия специфических иммуноглобулинов к вирусу Хунин [ S., H., T. et al. Serological Assays Based on Recombinant Viral Proteins for the Diagnosis of Arenavirus Hemorrhagic Fevers // Viruses. - 2012. - 4(10). - P.2097-114].

Однако иммуноглобулины класса М появляются на 10-20 сут после заражения, что приводит к поздней диагностике заболевания.

Наиболее близким аналогом (прототипом) является ПЦР тест-система для выявления РНК вируса Хунин методом обратной транскрипции в режиме реального времени. [Vieth S., Drosten Ch., Charrel R. et al. Establishment of conventional and fluorescence resonance energy transfer-based real-time PCR assays for detection of pathogenic New World arenaviruses // J. Clin. Virol. - 2005. - 32. - P.229-35]. Полимеразная цепная реакция (ПЦР) является методом ранней диагностики данной инфекции и позволяет обнаруживать РНК вируса Хунин в первые дни появления клинических признаков [Lozano M.E., Enría D., Maiztegui J.I. et al. Rapid diagnosis of Argentine hemorrhagic fever by reverse transcriptase PCR-based assay. // J Clin Microbiol. - 1995. - 33(5). - P.1327-1332].

Однако чувствительность вышеуказанной тест-системы составляла около 50 ТЦД50/реакцию, а аналитическая чувствительность - около 1000 геномных эквивалентов/реакцию.

Техническим результатом заявляемого изобретения является разработка более чувствительного набора специфичных олигонуклеотидных праймеров и зонда для выявления генетического материала вируса Хунин в клинических образцах и биологических жидкостях, образцах внешней среды и других вируссодержащих пробах (культуральная вируссодержащая жидкость и др.) методом ОТ-ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Указанный технический результат достигается тем, что набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру:

внешний:

5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄

внутренний:

5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

зонд:

FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1

Изобретение иллюстрируется следующими графическими материалами. На фиг. 1 и 2 представлены кривые флуоресценции на канале R6G/Yellow (530 nm/555 nm) амплификатора Rotor Gene 6000.

В приложении приведены олигонуклеотидные последовательности, видоспецифичные РНК вируса Хунин.

Методика получения набора праймеров и зонда. Диагностические праймеры и флуоресцентно-меченый зонд конструировались для участка S-сегмента генома вируса Хунин и оптимизации концентраций компонентов реакционной смеси и условий проведения ПЦР. Для контроля амплификации были получены рекомбинантные плазмиды, несущие вирусспецифический участок ДНК-матрицы.

На начальном этапе был проведен анализ нуклеотидных последовательностей геномов вируса Хунин, имеющихся в базе данных NCBI (http://www.ncbi.nlm.nih.gov/), и определены консервативные участки. В качестве мишени для диагностических праймеров и зонда был выбран находящийся в S-сегменте вирусного генома участок гена N, кодирующего нуклеокапсидный белок.

Анализ свойств олигонуклеотидных праймеров и зондов проводился с использованием программы Vector NTI 9.0.0 (InforMax).

Для идентификации генетического материала вируса Хунин методом ПЦР в реальном времени были подобраны праймеры и зонд, представленные ниже:

F/JUNV TCTTCTTCCCCCYTTTTAGTCTTTCT
R/JUNV CGCACAGTGGATCCTAGGCA
Z/JUNV (FAM)-TGAGTCCATCTAAAGCTTGGNACCTCCTT-(BHQ1)

Пример 1. Проверка аналитической чувствительности набора праймеров и зондов.

Для контроля амплификации были получены положительные контрольные образцы (ПКО), представляющие собой рекомбинантные плазмиды, несущие вирусспецифические вставки, являющиеся матрицей для амплификации вирусспецифических ДНК-фрагментов.

Для проведения ПЦР в режиме реального времени, в качестве анализируемых образцов использовали рекомбинантную плазмидную ДНК, включающую вставку ДНК, соответствующую детектируемому участку генома вируса Хунин.

Условия проведения амплификации оптимизировались по следующим параметрам: концентрация ионов магния в реакционной смеси; концентрация праймеров и зонда в реакционной смеси; температура отжига праймеров.

Для определения аналитической чувствительности из концентрированного раствора плазмидной ДНК были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК осуществляли при помощи флуориметра QUBIT (Invitrogen, США) и наборов реагентов того же производителя. ПЦР в режиме реального времени для детекции генетического материала вируса Хунин проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия), детекцию результатов амплификации (рисунок 1) осуществляли по каналу FAM/Green (470 nm/510 nm).

На фиг. 1 приведены кривые флуоресценции на канале FAM/Green (470 nm/510 nm) амплификатора Rotor Gene 6000 (Corbett Research, Австралия). Обозначение образцов, содержащих разные концентрации ДНК-матрицы, и положительного контрольного образца (ПКО): 1 - 109 ГЭ; 2 - 108 ГЭ; 3 - 107 ГЭ; 4 - 106 ГЭ; 5 - ПКО; 6 - 105 ГЭ; 7 - 104 ГЭ; 8 - 103 ГЭ; 9 - 102 ГЭ в образце.

Минимальное количество ДНК-матриц, детектируемое в ПЦР после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах), составило 102 ГЭ в образце.

Пример 2. Определение РНК вируса Хунин в вируссодержащих образцах.

Инактивацию образцов и выделение РНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3. 2569 -09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I - IV групп патогенности».

Для оценки специфичности использовали несколько образцов культуральной вируссодержащей жидкости, полученные с использованием различных культур клеток - Vero, Vero E6 и гомогенатов мозга сосунков мыши с титром вируса Хунин от 2.6х104 ТЦД50/мл до 8.9х105 ТЦД50/мл.

Процедуру выделения РНК из исследуемого материала проводили с использованием набора реагентов «Рибо-сорб» (ФГУН ЦНИИЭ Роспотребнадзора) в соответствии с инструкцией по применению.

Реакцию обратной транскрипции проводили с использованием набора реагентов «Реверта-L» (ФГУН ЦНИИЭ Роспотребнадзора) в соответствии с инструкцией по применению.

ПЦР в режиме реального времени проводили в реакционной смеси следующего состава (на 1 исследование):

кДНК 5 мкл
10×Taq буфер без Mg2+ 3 мкл
100 mM раствор MgCl2 1 мкл
5 mM раствор dNTP 1 мкл
Смесь праймеров и зондов (по 2 о.е. каждого) по 1 мкл каждого
Smart Taq DNA-Полимераза 5 ед/ мкл 0,3 мкл
Вода для ПЦР До 30 мкл общего объема

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по следующей программе, представленной в таблице 1.

Таблица 1. Программа проведения ПЦР

Температура (°С) Время (минуты:секунды) Количество циклов
95 05:00 1
95 00:10 45
54 00:20
72 00:20

Измерение флуоресценции осуществляли при температуре 54 °С на канале FAM/Green.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случае, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию. При этом значение Ct для данного образца было не больше 40 (рисунок 1).

На фиг. 2 приведены кривые флуоресценции образцов, содержащих кДНК вируса Хунин, на канале FAM/Green (470 nm/510 nm) амплификатора Rotor Gene 6000 (Corbett Research, Австралия).

Во всех используемых для анализа образцах в оптимизированных условиях проведения реакции ПЦР используемые праймеры и зонды позволяли выявлять РНК вируса Хунин.

Таким образом, минимальное количество РНК вируса, детектируемое в ПЦР после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах), составило 100 ГЭ в образце, вследствие чего чувствительность заявляемых праймеров значительно выше прототипа.

Приложение

<110> Федеральное бюджетное учреждение науки «Государственный

научный центр вирусологии и биотехнологии "Вектор"» (ФБУН

ГНЦ ВБ "Вектор")

<120> Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени

<210> 1

<223> Последовательности олигонуклеотидов видоспецифические к вирусу Хунин,

<400> 1 для выявления РНК вируса Хунин:

внешний:

5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄

внутренний:

5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

зонд:

FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1

Набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени, включающий последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру:
внешний:
5΄→3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄
внутренний:
5΄→3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄
зонд:
FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1



 

Похожие патенты:

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.
Представленный способ получения бактериофага включает: засев бактериальной культуры штамма-хозяина в титре 108-109 КОЕ/мл в сосуд для культивирования на скошенную плотную питательную среду с толщиной слоя от 10 мм до 25 мм, культивирование в течение 3-3,5 часов при оптимальной температуре для роста культуры штамма-хозяина, затем на полученный газон культуры штамма-хозяина засевают маточный бактериофаг в титре 105-106 БОЕ/мл и культивируют в течение 13-15 часов при оптимальной температуре и толщине слоя воздуха над поверхностью плотной питательной среды от 25 мм до 40 мм.

Изобретение относится к области биотехнологии, вирусологии и медицины. Предложен реассортантный вирус гриппа для производства вакцин.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.
Изобретение относится к области вирусологии и касается штамма вируса гриппа H10N7-cyбтипа. Охарактеризованный штамм вируса гриппа A/pochard/Siberia/249/08-МА H10N7-субтипа выделен из клоакального смыва красноголового нырка и адаптирован к линии BALB/c мышей.
Изобретение относится к области ветеринарной микробиологии, вирусологии и биотехнологии и касается способа получения вакцины против инфекционного ринотрахеита крупного рогатого скота.
Изобретение относится к медицинской вирусологии и микробиологии. Способ оценки активности лечебно-профилактических препаратов против вируса натуральной оспы включает введение в организм модельных животных контрольной и испытуемой групп по заданной схеме суспензии исследуемого противовирусного препарата, интраназальное заражение их штаммом вируса натуральной оспы, инкубацию вируса в организме животных и определение концентрации вируса в легких животных с последующим вычислением оценочных показателей снижения концентрации вируса в легких.

Изобретение относится к области вирусологии и биотехнологии. Штамм вируса иммунодефицита человека I-типа ИВ741 выделен на территории РФ от больного не получавшего АРВ-терапию.

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу B, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им.

Изобретение относится к области биохимии, в частности к полипептидам, которые являются ингибиторами клетки метанопродуцента и биологическими маркерами для детекции фага φmru, а также к полинуклеотидам, которые кодируют эти полипептиды.
Изобретение относится к области медицины. Способ предусматривает отделение подвижных сперматозоидов от спермоплазмы и сопутствующих клеток путем центрифугирования и последующей инкубации в специальных средах с целью забора супернатанта, содержащего «отмытые» сперматозоиды для проведения оплодотворения. Применение способа позволяет удалить ВИЧ из эякулята и свести к минимуму риск инфицирования здоровой супруги. Способ применяется для удаления вируса иммунодефицита человека из спермы мужчины перед проведением вспомогательных репродуктивных технологий. 2 пр.
Наверх