Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток



Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток
Рекомбинантная плазмидная днк pest877, детерминирующая экспрессию полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток escherichia coli, и штамм бактерий escherichia coli bl21(de3)plyss/pest877-продуцент полипептида с активностью эстеразы psychrobacter cryohalolentis к5т на поверхности клеток

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2526213:

Федеральное государственное бюджетное учреждение науки Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российский академии наук (ИБХ РАН) (RU)
Федеральное государственное бюджетное учреждение науки Институт Физико-химических и биологических проблем почвоведения РАН (RU)

Изобретение относится к микробиологии и биотехнологии и касается рекомбинантной плазмидной ДНК pEst877, детерминирующей экспрессию полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток, с мол. массой 3,64 Md (5,519 т.п.о.), состоящей из NcoI/XhoI - фрагмента ДНК плазмиды pET20b(+) длиной 3,654 т.п.о., включающего промотор T7lac, терминатор транскрипции бактериофага Т7, ген bla β-лактамазы, определяющий устойчивость трансформированных плазмидой pEst877 клеток к ампициллину, участок ori инициации репликации, сигнальную последовательность pelB пектатлиазы В Erwinia carotovora; и NcoI/XhoI - фрагмента ДНК размером 1,865 т.п.о., содержащего гибридный ген Est877, кодирующий аминокислотные последовательности эстеразы P. cryohalolentis К5Т с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида и аутотранспортера P. cryohalolentis K5T в единой рамке считывания. Изобретение также касается штамма бактерий Е. coli BL21(DE3)pLysS/pEst877 - продуцента полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток. Изобретение позволяет получать высокоактивную эстеразу с широкой субстратной специфичностью. 2 н.п. ф-лы, 3 ил., 7 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии. Может быть использовано для получения клеток, обладающих активностью эстеразы Psychrobacter cryohalolentis K5T (цельноклеточного биокатализатора).

Цельноклеточные биокатализаторы (ЦБК) с активностью липаз и эстераз могут быть использованы для биоремедиации загрязненных территорий за счет деградации органических поллютантов, получения биотоплива на основе растительного сырья и др. [Wu С., Mulchandani A., Chen W. Versatile microbial surface-display for environmental remediation and biofuels production. Trends Microbiol. 2008. V.16. P.181-188]. ЦБК со свойствами эстеразы P. cryohalolentis K5T также может быть использован в тонком химическом синтезе в реакциях переэтерификации и гидролиза [Jaeger К.Е., Eggert Т. Lipases for biotechnology. Curr. Opin. Biotechnol. 2002. V.13. Р.390-397].

Преимуществом использования ЦБК является отсутствие необходимости разрушения клеток и очистки целевого продукта, что удешевляет процесс производства, а также повышенная стабильность препарата по сравнению с изолированным ферментом [Ishige Т., Honda К., Shimizu S. Whole organism biocatalysis. Curr. Op. Chem. Biol. 2005. V.9. P.174-180]. Преимуществом использования ЦБК со свойствами эстеразы Р. cryohalolentis K5T является высокая активность данного фермента при низких температурах [Novototskaya-Vlasova К., Petrovskaya L., Yakimov S., Gilichinsky D. Cloning, purification, and characterization of a cold-adapted esterase produced by Psychrobacter cryohalolentis K5T from Siberian cryopeg. FEMS Microbiol. Ecol. 2012. V.82. P.367-375], что позволяет использовать его для биоремедиации загрязненных территорий Севера, а также сокращение расходов на подогрев реакционных смесей и связанных с этим атмосферных выбросов углекислого газа.

Известен способ получения ЦБК с активностью липазы путем экспрессии в клетках Е. coli гибридного гена, кодирующего в единой рамке считывания с ферментом белок-транспортер. При таком способе происходит секреция рекомбинантной липазы на поверхность клеток, что обеспечивает правильный фолдинг белка, а также устраняет необходимость выделения фермента из биомассы штамма-продуцента. В качестве транспортера может быть использован белок, способствующий формированию кристаллов льда (ice nucleation protein, INP) Pseudomonas syringae [H. Jung, S. Ко, S. Ju, E. Kim, M. Kim, J. Pan. Bacterial cell surface display of lipase and its randomly mutated library facilitates high-throughput screening of mutants showing higher specific activities. Journal of Molecular Catalysis B: Enzymatic. 2003. V.26. P.177-184]. Для получения ЦБК ген липазы TliA P. fluorescens клонируют в 3′-направлении от гена inaK с образованием единой рамки считывания под контролем tac-промотора в плазмиде pKK223-3. Синтез рекомбинантного белка индуцируют добавлением 1 мМ изопропил-β-D-тиогалактопиранозида (ИПТГ). К недостаткам этого способа получения следует отнести большое количество индуктора, необходимое для достижения экспрессии, а также недостаточно строгий контроль репрессии промотора в плазмиде pKK223-3.

Известен способ получения ЦБК с активностью липазы с использованием в качестве транспортера белка FadL Е. coli [S.Н. Lee, J. Choi, S.J. Park, S.Y. Lee, В.C. Park. Display of bacterial lipase on the Escherichia coli cell surface by using FadL as an anchoring motif and use of the enzyme in enantioselective biocatalysis. Appl. Environ. Microbiol. 2004. V.70. P.5074-5080]. В этом случае ген термостабильной липазы Bacillus sp. TG43 клонируют в 3′-направлении от последовательности, кодирующей белок FadL, под контролем trc-промотора в плазмиде pTrc99A. Экспрессию гибридного гена индуцируют добавлением 0,1 мМ ИПТГ. Недостатком этого способа является низкий уровень синтеза рекомбинантного белка.

Наиболее близким к заявленному является способ получения клеток Е. coli, обладающих активностью эстеразы ApeE Salmonella enterica [Е. Schultheiss, S. Weiss, Е. Winterer, R. Maas, E. Heinzle, J. Jose. Esterase autodisplay: enzyme engineering and whole-cell activity determination in microplates with pH sensors. Applied and Environmental Microbiology. 2008. V.74. P.4782-4791]. Рекомбинантная плазмида pES02 содержит ген гибридного белка, состоящего из эстеразы АреЕ Salmonella enterica и аутотранспортера AIDA-I Е. coli под контролем промотора Т7. Синтез белка осуществляют при добавлении индуктора ИПТГ до конечной концентрации 1 мМ. Рекомбинантный штамм Е. coli BL21(DE3)/pES02 обеспечивает синтез и секрецию белка FP89 на поверхности клеток. В результате получают клетки Е. coli с активностью эстеразы АреЕ по отношению к α-нафтилацетату, составляющей 1 U на 2×107 клеток. К недостаткам описанного способа получения клеток Е. coli, обладающих эстеразной активностью, можно отнести большое количество индуктора, необходимое для достижения экспрессии, а также узкую субстратную специфичность полученного ЦБК.

Технической задачей изобретения является получение штамма-продуцента полипептида с активностью эстеразы Psychrobacter cryohalolentis K5T на поверхности клеток, а также повышение уровня его активности по отношению к различным субстратам. Поставленная задача решается за счет конструирования рекомбинантной плазмидной ДНК pEst877, детерминирующей экспрессию полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток, с мол. массой 3,64 Md (5,519 т.п.о.), состоящей из NcoI/XhoI - фрагмента ДНК плазмиды pET20b(+) длиной 3,654 т.п.о., включающего промотор T7lac, терминатор транскрипции бактериофага Т7, ген bla β-лактамазы, определяющий устойчивость трансформированных плазмидой pEst877 клеток к ампициллину, участок ori инициации репликации, сигнальную последовательность pelB пектатлиазы В Erwinia carotovora; и NcoI/XhoI - фрагмента ДНК размером 1,865 т.п.о., содержащего гибридный ген Est877, кодирующий аминокислотные последовательности эстеразы P. cryohalolentis K5T с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида и аутотранспортера P. cryohalolentis K5T в единой рамке считывания; содержащей уникальные сайты узнавания рестрикционными эндонуклеазами, имеющими следующие координаты: NdeI - 2089, NcoI - 2023, PauI - 1138, XhoI - 158, а также за счет штамма бактерий Е. coli BL21(DE3)pLysS/pEst877 - продуцента полипептида со свойствами эстеразы Р. cryohalolentis К5Т на клеточной поверхности.

Рекомбинантная плазмидная ДНК pEst877 кодирует индуцибельный синтез полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток, а штамм Е. coli BL21(DE3)pLysS/pEst877 обеспечивает синтез и секрецию этого полипептида с уровнем экспрессии не ниже 10% суммарного клеточного белка. Индуцибельный высокий уровень синтеза целевого полипептида обеспечивается тем, что плазмида pEst877 содержит промотор T7lac и усилитель трансляции гена 10 бактериофага Т7, а экспрессия на поверхности клеток - наличием в составе плазмиды кодирующих последовательностей сигнального пептида pelB и С-концевого домена аутотранспортера P. cryohalolentis K5T, а также модификацией 5′-концевой последовательности гена эстеразы P. cryohalolentis K5T.

Особенностью предложенной плазмидной конструкции является наличие в ее составе кодирующей последовательности гибридного белка, состоящего из эстеразы Р. cryohalolentis К5Т с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида и С-концевого домена аутотранспортера Р. cryohalolentis К5Т (SEQ ID NO 5), под контролем сильного регулируемого промотора T7lac, что в сочетании с наличием в плазмиде кодирующей последовательности сигнального пептида pelB, генов РНК-полимеразы бактериофага Т7 и компонентов системы секреции в мембране клеток в хромосоме хозяйского штамма обеспечивает индуцибельный синтез целевого белка (SEQ ID NO 6) на поверхности клеток с высоким выходом, достигаемым при малых концентрациях индуктора. В 5′-концевую последовательность гена эстеразы P. cryohalolentis К5Т добавлен кодон GAT, обеспечивающий наличие остатка аспарагиновой кислоты после сайта отщепления сигнального пептида. Известно, что суммарный отрицательный заряд N-концевой части зрелой последовательности секретируемого белка способствует более эффективной секреции через мембрану [Li P., Beckwith J., Inouye Н. Alteration of the amino terminus of the mature sequence of a periplasmic protein can severely affect protein export in Escherichia coli. Proc. Natl. Acad. Sci. USA. 1988. V.85. P.7685-7689].

Для получения штамма-продуцента полипептида с активностью эстеразы Р. cryohalolentis К5Т на поверхности клеток компетентные клетки Е. coli штамма BL21(DE3)pLysS трансформируют рекомбинантной плазмидой pEst877.

Полученный штамм Е. coli BL21(DE3)pLysS/pEst877 характеризуется следующими признаками.

Морфологические признаки: клетки мелкие, палочковидной формы, грамотрицательные, подвижные, размером 1×3-5 мкм, неспороносные.

Культуральные признаки: при росте на агаризованной LB-среде преобладают мелкие колонии диаметром 1-3 мм; круглые, гладкие, полупрозрачные, блестящие, серые, край ровный; консистенция пастообразная. Могут встречаться крупные колонии диаметром 4-5 мм; круглые, гладкие, матовые, край волнистый. Рост в жидких средах (LB, минимальная среда с глюкозой) характеризуется равномерным помутнением среды.

Физиолого-биохимические признаки. Клетки штамма продуцента могут расти в диапазоне температур 20-42°С, оптимальная температура роста составляет 37°С. Наиболее благоприятные для роста значения pH находятся в интервале 6,8-7,2. При росте в аэробных условиях, культура может усваивать азот как органических соединений (пептон, триптон, аминокислоты, дрожжевой экстракт), так и аммонийных солей. Углерод усваивается в форме углеводов, многоатомных спиртов (глицерин), аминокислот.

Устойчивость к антибиотикам. Клетки проявляют устойчивость к ампициллину (до 200 мкг/мл), обусловленную наличием в плазмиде гена бета-лактамазы, и к хлорамфениколу (до 34 мкг/мл), обусловленную присутствием в хозяйском штамме плазмиды pLysS.

Способ, условия и состав среды для хранения штамма. LB-бульон с 15% глицерином, при температуре -70°С, в криовиалах.

Технический результат заявленного изобретения заключается в том, что полученный штамм Е. coli BL21(DE3)pLysS/pEst877 позволяет получать полипептид с активностью эстеразы P. cryohalolentis K5T на поверхности клеток в количестве не менее 10% от суммарного клеточного белка при концентрации индуктора 0,1 мМ. В отличие от прототипа в данном штамме достигается в 2 раза более высокая эстеразная активность при использовании в 10 раза меньшего количества индуктора (ИПТГ). Кроме того, в отличие от прототипа полученный штамм проявляет эстеразную активность по отношению к более широкому кругу субстратов - эфиров жирных кислот с длиной углеводородной цепи от С4 до С10. Совокупность перечисленных свойств штамма Е. coli BL21(DE3)pLysS/pEst877 обусловливает большую технологичность процесса получения ЦБК с активностью эстеразы P. cryohalolentis K5T на поверхности клеток.

Изобретение иллюстрируют графические материалы.

Фиг.1. Физическая карта рекомбинантной плазмиды pEst877. Указаны уникальные сайты эндонуклеаз рестрикции. Т7 promoter - промотор бактериофага Т7, Т7 terminator-терминатор транскрипции бактериофага Т7, Ар - ген устойчивости к ампициллину, ori - участок инициации репликации плазмиды, Est877 - рекомбинантный ген Est877, кодирующий аминокислотную последовательность полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток.

Фиг.2. Электрофореграмма лизатов клеток штамма-продуцента Е. coli BL21(DE3)pLysS/pEst877 до (дорожка 1) и после индукции (дорожки 2) и мембранных фракций клеток штамма-продуцента Е. coli BL21(DE3)pLysS/pEst877 до (дорожка 3) и после индукции ИПТГ (дорожка 4) в 13%-ном полиакриламидном геле (М - белковые маркеры молекулярной массы); стрелкой указано положение целевого полипептида.

Фиг.3. Субстратная специфичность полипептида с активностью эстеразы Р. cryohalolentis К5Т на поверхности клеток.

Изобретение иллюстрируют следующие примеры.

Пример 1.

Конструирование рекомбинантной плазмидной ДНК рАТ877.

Культуру P. cryohalolentis К5Т выращивают в течение ночи на чашке с агаризованной средой TSB (Difco, USA) +2% NaCl. 20 мкл полученной биомассы суспендируют в 50 мкл буфера для Taq-полимеразы (75 мМ трис-HCl, pH 8,8, 20 мМ (NH4)2SO4, 0,1% Tween 20) и разрушают в течение 15 мин прогреванием на кипящей водяной бане. После центрифугирования 5 мин при скорости 13000 об/мин 5 мкл полученного супернатанта добавляют в реакционную смесь для ПЦР объемом 50 мкл, содержащую 50 pmol праймера PC877F (SEQ ID NO 3), 50 pmol праймера PC877R (SEQ ID NO 4), 2 мМ каждого из четырех dNTP, 5 мкл 10× буфера для Pfu ДНК-полимеразы (Fermentas), 2,5 е.a. Pfu ДНК-полимеразы и 0,5 е.a. Taq ДНК-полимеразы (Fermentas). Полимеразную цепную реакцию (ПЦР) проводят в следующем режиме: денатурация - 1 мин, 94°С; отжиг - 45 с, 52°С; достройка - 60 с, 72°С; количество циклов - 35. 2 мкг ПЦР-продукта обрабатывают рестриктазами NcoI и XhoI (Fermentas) в условиях, рекомендованных производителем ферментов, фрагмент длиной 1,783 т.п.о. выделяют из 1% агарозного геля. 0,5 мкг полученного фрагмента и 0,2 мкг плазмидного вектора pET20b(+), линеаризированного обработкой рестриктазами NcoI и XhoI, длиной 3,654 п.о. лигируют в течение 4 ч при 12°С в 10 мкл раствора, содержащего 40 мМ трис-HCl (pH 7,8), 10 мМ MgCl2, 10 мМ дитиотреитола, 0,5 мМ аденозинтрифосфата и 3 е.а. Т4 ДНК-лигазы (Fermentas, Литва). 5 мкл лигазной смеси используют для трансформации компетентных клеток Е. coli XL-1 Blue (Stratagene, США). Трансформанты высевают на LB-arap, содержащий 100 мкг/мл ампициллина.

Из выросших клонов выделяют плазмидную ДНК и обрабатывают рестриктазами NcoI и XhoI с последующим электрофоретическим анализом длин рестрикционных фрагментов в 1% агарозном геле. Структуру клонированного гена в отобранных клонах подтверждают определением нуклеотидной последовательности. В результате получают плазмидную ДНК рАТ877, содержащую кодирующую последовательность аутотранспортера P. cryohalolentis K5T (SEQ ID NO 1).

Пример 2.

Конструирование рекомбинантной плазмидной ДНК pEst877.

Для амплификации гена эстеразы P. cryohalolentis K5T с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида проводят полимеразную цепную реакцию (ПЦР) на матрице плазмидной ДНК pET32a(+)/EstPc [Novototskaya-Vlasova К., Petrovskaya L., Yakimov S., Gilichinsky D. Cloning, purification, and characterization of a cold-adapted esterase produced by Psychrobacter cryohalolentis K5T from Siberian cryopeg. FEMS Microbiol. Ecol. 2012. V.82. P.367-375] в смеси объемом 50 мкл следующего состава: 50 pmol праймера 23NcoF (SEQ ID NO 7), 50 pmol праймера 23R (SEQ ID NO 8), 2 мМ каждого из четырех dNTP, 5 мкл 10× буфера для Pfu ДНК-полимеразы (Fermentas), 2,5 е.а. Pfu ДНК-полимеразы (Fermentas). Реакцию проводят в следующем режиме: денатурация - 40 с, 94°С; отжиг - 40 с, 52°С; достройка - 60 с, 72°С; количество циклов - 25. 2 мкг ПЦР-продукта обрабатывают рестриктазами NcoI и PauI (Fermentas) в условиях, рекомендованных производителем ферментов, фрагмент длиной 0,885 т.п.о., содержащий ген эстеразы P. cryohalolentis К5Т с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида, выделяют из 1% агарозного геля. 0,5 мкг полученного фрагмента и 0,2 мкг плазмидного вектора рАТ877, линеаризированного обработкой рестриктазами NcoI и PauI, длиной 4,634 п.о. лигируют в течение 4 ч при 12°С в 10 мкл раствора, содержащего 40 мМ трис-HCl (pH 7,8), 10 мМ MgCl2, 10 мМ дитиотреитола, 0,5 мМ аденозинтрифосфата и 3 е.а. Т4 ДНК-лигазы (Fermentas, Литва). 5 мкл лигазной смеси используют для трансформации компетентных клеток Е. coli XL-1 Blue (Stratagene, США). Трансформанты высевают на LB-arap, содержащий 100 мкг/мл ампициллина.

Из выросших клонов выделяют плазмидную ДНК и обрабатывают рестриктазами NcoI и PauI с последующим электрофоретическим анализом длин рестрикционных фрагментов в 1% агарозном геле. Структуру клонированного гена в отобранных клонах подтверждают определением нуклеотидной последовательности. В результате получают плазмидную ДНК pEst877 (фиг.1), содержащую кодирующую последовательность гибридного полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток (SEQ ID NO 5).

Пример 3.

Получение штамма-продуцента полипептида с активностью эстеразы Р. cryohalolentis К5Т на поверхности клеток.

Рекомбинантной плазмидной ДНК pEst877 трансформируют компетентные клетки Е. coli BL21(DE3)pLysS (Novagen) и после выращивания рекомбинантных клонов на LB-агаре с ампициллином (100 мкг/мл) и хлорамфениколом (34 мкг/мл) при 37°С получают штамм-продуцент полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток.

Пример 4.

Определение продуктивности штамма-продуцента полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток.

Для определения продуктивности клетки E.coli BL21(DE3)pLysS/pEst877 выращивают при 37°С в 5 мл жидкой среды LB, содержащей 100 мкг/мл ампициллина, в течение 16 ч на качалке при 250 об/мин. Полученную ночную культуру в объеме 200 мкл переносят в 5 мл жидкой среды LB (разбавление до оптической плотности 0,15-0,20 при длине волны 560 нм), содержащей 100 мкг/мл ампициллина, и выращивают до оптической плотности 0,8 (длина волны 560 нм) при 37°С и перемешивании 250 об/мин. Добавляют ИПТГ до конечной концентрации 0,1 мМ, после чего клетки выращивают в течение 3 ч при 27°С и перемешивании 200 об/мин. Отбирают пробу культуры в количестве 1 оптическая единица (длина волны 560 нм) и центрифугируют 5 мин при скорости 7000 об/мин. Осажденные клетки суспендируют в 100 мкл буфера, содержащего 125 мМ трис-HCl, pH 6,8, 20% глицерин, 3% додецилсульфат натрия, 3% меркаптоэтанол, 0,005% бромфеноловый синий, инкубируют 10 мин в кипящей водяной бане, образцы объемом 10 мкл анализируют электрофорезом в 13% полиакриламидном геле с додецилсульфатом натрия. По окончании электрофореза гель прокрашивают при помощи кумасси R-250. После отмывки красителя гель сканируют и проводят математическую обработку результатов с помощью программы Scion Image (Scion Corp., США). По данным сканирования содержание гибридного белка, состоящего из эстеразы и С-концевого домена аутотранспортера P. cryohalolentis К5Т, составляет 20% от общего клеточного белка. На фиг.2 представлена электрофореграмма лизатов клеток штамма-продуцента Е. coli BL21(DE3)pLysS/pEst877 (дорожки 1 и 2) в 13%-ном полиакриламидном геле до (дорожка 1) и после индукции ИПТГ (дорожки 2) (М - белковые маркеры молекулярной массы; стрелкой указано положение целевого полипептида).

Пример 5.

Анализ локализации полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток.

Проводят индукцию биосинтеза целевого белка в клетках штамма-продуцента Е. coli BL21(DE3)pLysS/pEst877 ИПТГ (конечная концентрация 0,1 мМ) в течение 3 ч при 27°С. Клетки центрифугируют 15 мин при 7000 об/мин. 1 г влажной биомассы индуцированных клеток ресуспендируют в 10 мл буфера (50 мМ Трис-HCl, 200 мМ NaCl, pH 8,0, после чего разрушают клетки обработкой в ультразвуковом дезинтеграторе Branson Sonifier 450, не допуская нагрева выше 10°С. Полученную суспензию центрифугируют 30 мин при 6000 об/мин. Полученный супернатант повторно центрифугируют 1 час при 100000 g. Осадок суспендируют в 1 мл буфера 50 мМ Трис-HCl pH 8,0; 5 мкл полученной суспензии смешивают с 5 мкл буфера, содержащего 125 мМ трис-HCl, pH 6,8, 20% глицерин, 3% додецилсульфат натрия, 3% меркаптоэтанол, 0,005% бромфеноловый синий, инкубируют 10 мин в кипящей водяной бане, образцы объемом 10 мкл анализируют электрофорезом в 13% полиакриламидном геле с додецилсульфатом натрия. По окончании электрофореза гель прокрашивают при помощи кумасси R-250. Гибридный белок, состоящий из эстеразы P. cryohalolentis K5T с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида и С-концевого домена аутотранспортера P. cryohalolentis K5T, обнаруживается в мембранной фракции клеток штамма-продуцента. На фиг.2 представлена электрофореграмма мембранных фракций клеток штамма-продуцента Е. coli BL21(DE3)pLysS/pEst877 в 13%-ном полиакриламидном геле до (дорожка 3) и после индукции ИПТГ (дорожка 4) (стрелкой указано положение полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток).

Пример 6.

Определение активности полипептида со свойствами эстеразы P. cryohalolentis K5T на поверхности клеток.

Проводят индукцию биосинтеза гибридного полипептида со свойствами эстеразы P. cryohalolentis К5Т на поверхности клеток, кодируемого плазмидой pEst877, в клетках штамма-продуцента Е. coli BL21(DE3)pLysS/pEst877 ИПТГ (конечная концентрация 0,1 мМ) в течение 3 ч при 27°С. В качестве контроля используют культуру клеток Е. coli BL21(DE3)pLysS, трансформированную плазмидным вектором pET20b(+) и индуцированную в тех же условиях. Отбирают пробы обеих культур в количестве 1 оптической единицы (длина волны 560 нм) и центрифугируют 5 мин при скорости 7000 об/мин. Осадки промывают 200 мкл буфера PBS и центрифугируют в тех же условиях. Осадки суспендируют в 50 мкл буфера 50 мМ Трис-HCl (рН 8,0), 100 мМ NaCl. Активность эстеразы на поверхности клеток определяют, используя паранитрофенилбутират (Sigma) в качестве субстрата. К реакционной смеси объемом 1 мл, содержащей 50 мМ Трис-HCl (pH 8,0), 100 мМ NaCl, 0,25 мМ паранитрофенилбутирата (Sigma) добавляют 50 мкл клеточной суспензии, смесь инкубируют 15 мин при 30°С. По 200 мкл реакционной смеси после центрифугирования при 13000 об/мин в течение 5 мин раскапывают в лунки 96-луночного планшета (Costar). Измеряют величину абсорбции при 415 нм на ридере Model680 (BioRad). Измерения проводят в трех повторностях, затем вычисляют среднее значение. За единицу эстеразной активности принимают количество фермента, необходимое для высвобождения 1 мкмоль паранитрофенола за 1 мин. Общая эстеразная активность ЦБК со свойствами эстеразы Р. cryohalolentis К5Т составляет 1 U на 107 клеток, что в 2 раза больше, чем активность прототипа.

Пример 7.

Определение субстратной специфичности полипептида с активностью эстеразы Р. cryohalolentis K5T на поверхности клеток.

Субстратную специфичность полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток определяют в реакциях с добавлением p-нитрофенильных производных эфирных субстратов с различной длиной углеводородной цепи (С2-С16). К реакционной смеси объемом 1 мл, содержащей 50 мМ Трис-HCl (pH 8,0), 100 мМ NaCl, 50 мкл клеточной суспензии добавляют по 0,25 мМ одного из субстратов (Sigma) - паранитрофенилацетата (С2), паранитрофенилбутирата (С4), паранитрофенилоктаноата (С8), паранитрофенилдеканоата (С10) паранитрофенилдодеканоата (С12), паранитрофенилмиристата (С14), паранитрофенилпальмитата (С16), смесь инкубируют 15 мин при 30°С. По 200 мкл реакционной смеси после центрифугирования при 13000 об/мин в течение 5 мин раскапывают в лунки 96-луночного планшета (Costar). Измеряют величину абсорбции при 415 нм на ридере Model680 (BioRad). Вычисляют активность по отношению к различным субстратам, принимая за 100% максимальное значение активности. На фиг.3 представлена диаграмма субстратной специфичности полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток. Максимальная активность наблюдается при использовании паранитрофенилбутирата (С4) в качестве субстрата, активность в отношении паранитрофенилоктаноата (С8) и паранитрофенилдеканоата (С10) составляет около 37% от максимальной.

Перечень последовательностей, представленных в описании изобретения

SEQ ID NO 1.

Нуклеотидная последовательность гена аутотранспортера P. cryohalolentis К5Т в плазмиде рАТ877.

SEQ ID NO 2.

Аминокислотная последовательность аутотранспортера P. cryohalolentis К5Т, кодируемого рекомбинантной плазмидой рАТ877.

SEQ ID NO 3.

PC877F CATATCCATGGAGCTTTATAGCAGCGTGAC

Нуклеотидная последовательность праймера, использованного для амплификации гена аутотранспортера P. cryohalolentis K5T.

SEQ ID NO 4.

PC877R ACATCTCGAGGTAAGTGCTGCTAAGACCGA

Нуклеотидная последовательность праймера, использованного для амплификации гена аутотранспортера P. cryohalolentis K5T.

SEQ ID NO 5.

Нуклеотидная последовательность гена гибридного полипептида с активностью эстеразы P. cryohalolentis К5Т на поверхности клеток, в плазмиде pEst877.

SEQ ID NO 6.

Аминокислотная последовательность полипептида с активностью эстеразы Р. cryohalolentis К5Т на поверхности клеток, кодируемого рекомбинантной плазмидой pEst877.

SEQ ID NO 7.

23NcoF CATATCCATGGATATAAATACCACCCAAAAGATTATTC

Нуклеотидная последовательность праймера, использованного для амплификации гена эстеразы P. cryohalolentis K5T.

SEQ ID NO 8.

23R AGTATGCGCGCGTCCGCTGTCGACGTTCTTTAACCCTTCACGAAAC Нуклеотидная последовательность праймера, использованного для амплификации гена эстеразы P. cryohalolentis К5Т.

1. Рекомбинантная плазмидная ДНК pEst877, детерминирующая экспрессию полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток, с мол. массой 3,64 Md (5,519 т.п.о.), состоящая из NcoI/XhoI - фрагмента ДНК плазмиды pET20b(+) длиной 3,654 т.п.о., включающего промотор T7lac, терминатор транскрипции бактериофага Т7, ген bla β-лактамазы, определяющий устойчивость трансформированных плазмидой pEst877 клеток к ампициллину, участок ori инициации репликации, сигнальную последовательность pelB пектатлиазы В Erwinia carotovora; и NcoI/XhoI - фрагмента ДНК размером 1,865 т.п.о., содержащего гибридный ген Est877, кодирующий аминокислотные последовательности эстеразы P. cryohalolentis K5T с дополнительным аминокислотным остатком аспарагиновой кислоты после сайта отщепления сигнального пептида и аутотранспортера P. cryohalolentis K5T в единой рамке считывания.

2. Штамм бактерий Е. coli BL21(DE3)pLysS/pEst877 - продуцент полипептида с активностью эстеразы P. cryohalolentis K5T на поверхности клеток.



 

Похожие патенты:

Изобретение относится к области биохимии и представляет собой плазмиду 40NaGal, определяющую синтез α-N-ацетилгалактозаминидазы α-AlNaGal, включающую NcoI/SalI-фрагмент плазмиды pET-40b(+) (Novagen) и фрагмент ДНК размером 1299 пар оснований, содержащий химерный ген, состоящий из структурной части гена α-AlNaGal, адаптированной по N-концу для экспрессии в клетках E.coli, и нуклеотиды, кодирующие специфическую последовательность для протеазы TEV.
Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и онкологии, и может быть использовано для диагностики терминальных мутаций в гене RET, ассоциированных с наследственной предрасположенностью к раку щитовидной железы (РЩЖ).

Изобретение относится к микробиологии и генной инженерии и представляет собой рекомбинантную плазмидную ДНК pMind-vapB, представляющую собой плазмиду pMind, в которую клонирована последовательность, представленная на рис.2.

Изобретение относится к микробиологии и генной инженерии и представляет собой рекомбинантную плазмидную ДНК pMind-vapC, представляющую собой плазмиду pMind, в которую клонирована последовательность, представленная на фиг.2.

Изобретение относится к биотехнологии. Заявлены экспрессионные векторы, предназначенные для экспрессии человеческого дарбэпоэтина.

Изобретение относится к области биотехнологии и может быть использовано для получения наноструктурированного материала на основе рекомбинантных жгутиков архей H.

Изобретение относится к области генетической инженерии, молекулярной биологии и медицины. Предложен носитель для направленной доставки нуклеиновых кислот в клетки, экспрессирующие рецептор CXCR4, состоящий из последовательности-лиганда к рецептору CXCR4 с последовательностью аминокислот KPVSLSYRSPSRFFESH, линкерного участка из двух молекул ε-аминогексановой кислоты, соединяющей последовательность-лиганд с последовательностью для компактизации нуклеиновых кислот, последовательности, обеспечивающей компактизацию нуклеиновых кислот и выход комплекса из эндосом CHRRRRRRHC.

Изобретение относится к биохимии и биотехнологии и представляет собой рекомбинантную плазмиду pESAT6-DBD, состоящую из искусственного бактериального оперона химерного белка, включающего промоторную область раннего промотора бактериофага Т5, гена химерного белка, состоящего из последовательности белкового антигена ESAT6 из Mycobacterium tuberculosis, слитого с последовательностью декстрансвязывающего домена (DBD) декстрансукразы Leuconostoc citreum KM20 и терминатора транскрипции; бактериального оперона бета-лактамазы и бактериального участка инициации репликации типа ColEl.

Группа изобретений относится к области биотехнологии. Способ модульного конструирования ДНК аптамеров, способных специфически и высокоаффинно связывать тромбин, имеющих стабилизированную основную субструктуру, предусматривает сборку их структуры моделированием из комбинации трех структурных модулей, содержащих квадруплексный модуль нуклеиновой кислоты, дуплексный модуль нуклеиновой кислоты и соединяющий их модуль нуклеиновой кислоты, имеющий неканоническую структуру, путем определения третичной структуры его спектральным методом кругового дихроизма с подтверждением факта образования более стабильного G-квадруплекса, отличного от квадруплексной структуры исходного структурного квадруплексного модуля.

Изобретение относится к области биотехнологии. Способ лечения или профилактики заражения PCV2 или снижения клинических симптомов, вызываемых или ассоциированных с заражением PCV2, у животных, которые имеют антитела к PCV2, предусматривает однократное введение эффективного количества антигена PCV2 животным, нуждающимся в таком лечении или профилактическом лечении.

Изобретение относится к области молекулярной биологии и медицины. Предложена генетическая конструкция на основе векторной плазмиды pEGFP-N1 с геном устойчивости к неомицину, содержащая под контролем терморегулируемого промотора гена белка теплового шока hsp70 Drosophila melanogaster ген человеческого нейротрофического фактора GDNF с элементами теплового шока HSE 4-8 и ген зеленого флуоресцентного белка GFP. Изобретение может быть использовано при терапии нейродегенеративных заболеваний, травматических нарушениях иннервации, а также при ишемическом инсульте головного мозга млекопитающих (в том числе и человека), поскольку понижение температурного порога активации (от 39 до 42 градусов цельсия) экспрессии терапевтического гена GDNF позволяет снизить негативное воздействие высоких температур на человеческий организм при применении для лечения нейродегенеративных заболеваний конструкции, включающей терапевтический ген GDNF, что достигается использованием hsp 70 Drosophilla melanogaster. Таким образом достигается температурорегулируемая временная активация GDNF для стимуляции нейральной дифференцировки нейральных предшественников, а также предотвращает негативные последствия от гиперэкспрессии трансгенного фактора. 26 ил., 7 пр.

Изобретение относится к биотехнологии и представляет собой рекомбинантные плазмидные ДНК, кодирующие гибридные полипептиды со свойствами красного флуоресцентного белка mCherry. Рекомбинантная плазмидная ДНК pChFN3 кодирует гибридный белок ChFN3, который имеет свойства красного флуоресцентного белка mCherry и 10 домена фибронектина человека III типа, и рекомбинантная плазмидная ДНК pChTNF кодирует гибридный белок ChTNF, который имеет свойства красного флуоресцентного белка mCherry и TNF. Настоящее изобретение обеспечивает эффективную продукцию гибридных белков pChFN3 и ChTNF со свойствами красного флуоресцентного белка mCherry в штамме E.coli BL21(DE3). Изобретение позволяет получить целевой белок с высоким выходом при добавлении меньшего количества индуктора. 2 н.п. ф-лы, 3 ил., 8 пр.

Изобретение относится к области биотехнологии, в частности к молекулярной медицине, и может быть использовано в медицинской практике для лечения патологий, связанных с избыточным ангиогенезом, включая рост злокачественных опухолей, ревматоидный артрит, псориаз и диабетическую ретинопатию. Способ включает введение в область избыточного ангиогенеза эффективного количества протеолитически неактивных рекомбинантных форм активатора плазминогена урокиназного типа (урокиназы) в сочетании с рекомбинантным крингл-доменом активатора плазминогена урокиназного типа, конкурентно подавляющих протеолитическое действие нативного активатора плазминогена урокиназного типа и пространственно разобщающих рецепторные белки, опосредующие регуляторные эффекты системы урокиназы. Способ позволяет локально подавлять рост кровеносных сосудов. 3 н. и 1 з.п. ф-лы, 9 ил., 5 пр.

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого. Полученные аптамеры обладают высокой чувствительностью к продуктам распада опухоли и циркулирующим раковым клеткам в периферической крови больных раком легкого, что позволяет повысить эффективность диагностики рака легкого человека. 2 з.п. ф-лы, 2 ил., 1 пр.

Изобретение относится к области молекулярной биологии, биохимии и генной инженерии. Предложены нуклеиновая кислота, характеризующаяся нуклеотидной последовательностью, кодирующей белок, который состоит из аминокислотной последовательности с делецией, заменой или добавлением одной или более аминокислот в аминокислотной последовательности SEQ ID NO: 2 или SEQ ID NO: 7 и обладает активностью фосфатазы фосфатидной кислоты, соответствующий белок, рекомбинантный вектор, клетка для экспрессии белка и способ получения композиции жирной кислоты. Изобретение может быть использовано для получения полиненасыщенных жирных кислот в пищевой промышленности. 8 н. и 1 з.п. ф-лы, 6 табл., 7 ил., 8 пр.

Изобретение относится к области биоинженерии, молекулярной биологии и биотехнологии. Предложена дрожжевая клетка, предназначенная для детекции взаимодействия между белками и их доменами, котрансформированная двумя плазмидами, модифицированными для экспрессии в клетках дрожжей двух белков, где нуклеотидная последовательность, кодирующая первый белок, клонирована в одну плазмиду, а нуклеотидная последовательность, кодирующая второй белок, - в другую плазмиду, где нуклеотидные последовательности, кодирующие белки, слиты с нуклеотидными последовательностями, кодирующими активационный и ДНК-связывающий домены белка GAL4, при этом нуклеотидные последовательности, кодирующие исследуемые белки, отделены от нуклеотидных последовательностей, кодирующих активационный или ДНК-связывающий домен белка GAL4, при помощи нуклеотидной последовательности, кодирующей пептид, представляющий собой последовательность GluLeuGluAlaAlaAlaLysGluAlaAlaAlaLysGluAlaAlaAlaLysGluAlaAlaAla, который экспрессируется в виде белкового мостика между исследуемым белком и доменами белка GAL4. Изобретение позволяет свести к минимуму взаимовлияние доменов тестируемых белков и ДНК-связывающего/активационного доменов вектора и может быть использовано для детекции взаимодействия между белковыми молекулами в медицинских и исследовательских целях. 4 ил., 2 пр.

Изобретение относится к биотехнологии и представляет собой рекомбинантный штамм бактерий Escherichia coli N41 (pBpuN4/MR), который получен путем трансформации штамма Escherichia coli ER2267 плазмидой pBpuN4/MR N41, полученной на основе плазмиды pUC19 и содержащей ген, кодирующий ДНК-метилтрансферазу M.BpuN4I, метилирующую один из цитозинов в положении С5 в последовательности 5'-GGNNCC-3', и ген рестриктазы BpuN4I. Настоящий рекомбинантный штамм бактерий Escherichia coli N41 (pBpuN4/MR) является продуцентом сайт-специфической эндонуклеазы рестрикции BpuN4I, узнающей последовательность ДНК 5'-G^GNNCC-3'/3'-CCNNG^G-5' и расщепляющей обе её цепи после первого гуанина с образованием 5'-выступающих четырёхнуклеотидных липких концов. Настоящее изобретение позволяет получить рестриктазу заданной специфичности с высоким выходом. 3 ил., 4 пр.

Изобретение относится к биотехнологии и представляет собой рекомбинантную плазмидную ДНК pET3.54, кодирующую полипептид FN3.54, взаимодействующий с фактором некроза опухолей человека. Настоящее изобретение раскрывает также рекомбинантный штамм бактерий Escherichia coli BL21(DE3)/pET3.54 - продуцент полипептида FN3.54, взаимодействующего с фактором некроза опухолей человека. Настоящее изобретение позволяет получить целевой белок с высоким выходом при использовании меньшего количества индуктора и уровнем экспрессии более 15% суммарного клеточного белка. 2 н.п. ф-лы, 4 ил., 6 пр.
Изобретение относится к биотехнологии и микробиологии и представляет собой способ идентификации кластера генов, кодирующих стафилококковые белки, являющиеся экзотоксинами. Для осуществления настоящего способа проводят мультипраймерную полимеразную цепную реакцию в один прием в двух реакционных смесях, первая из которых содержит праймеры к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, а вторая - к генам set1, set2, set3, set4, set5, кодирующим экзотоксины. Затем проводят анализ путем сравнения амплицированных фрагментов генов, полученных в двух аликвотах образца, с положительным контрольным образцом в соответствии с идентификационной таблицей. Настоящее изобретение также раскрывает тест-систему для осуществления указанного способа, которая содержит компоненты для выделения ДНК, компоненты для проведения ПЦР и компоненты для анализа результатов. При этом компоненты для проведения ПЦР содержат 10-кратный буферный раствор, рН 8,4, деионизированную стерильную воду, один положительный контрольный образец, фермент Taq-полимеразу, смесь четырёх дНТФ, смесь праймеров №1, содержащую epi-F, epi-R, aur-F, aur-R, hae-F, hae-R, lug-F, lug-R, sap-F, sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, и смесь прамеров №2, содержащую set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R в соотношении 1:1:1:1:1:1:1:1:1:1. Настоящее изобретение позволяет выявить кластер генов, кодирующих стафилококковые белки, молекулярная масса которых составляет от 25 до 35 кДа, состоящих почти из 200 аминокислотных остатков и имеющих третичную структуру, высокогомологичную с некоторыми суперантигенами стафилококка (энтеротоксины, TSST-1 токсин) и с пирогенным стрептококковым экзотоксином C. 2 н.п. ф-лы, 3 табл., 1 пр.

Изобретение относится к молекулярной биологии, в частности к коротким интерферирующим РНК (siRNA), и может быть использовано в противоопухолевой терапии. На основе геномного анализа сконструированы последовательности siRNA против гена HIF1A человека с SEQ ID NO:1-2, siRNA против гена HSP8A человека с SEQ ID NO:3-4, siRNA против гена APEX1 человека с SEQ ID NO:5-6 и siRNA против гена CCND3 человека с SEQ ID NO:7-8, ассоциированных с пролиферацией клеток аденокарциномы поджелудочной железы человека. Использование полученных siRNA, в том числе в составе лентивирусного вектора, приводит к подавлению пролиферации клеток аденокарциномы поджелудочной железы человека и гибели опухоли. Изобретение позволяет добиться уровня подавления пролиферации до 65% при использовании siRNA к генам HIF1A и HSP8A, ассоциированным со стрессом и отвечающим за основные пролиферативные (CCND3) и репаративные (АРЕХ-1) пути деления клеток. 3 н.п. ф-лы, 10 ил., 2 пр.
Наверх