Праймеры для диагностики дистрофии роговицы авеллино

Изобретение относится к биотехнологии. Описана пара праймеров и зонды для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино. Изобретение позволяет точно диагностировать присутствие или отсутствие в экзоне 4 гена BIGH3 мутации, которая является ответственной за дистрофию роговицы Авеллино. Также применение пары праймеров и зонда согласно настоящему изобретению может обеспечить диагностику дистрофии роговицы Авеллино более быстрым и точным способом, чем стандартный способ с применением ДНК-чипа или ПЦР. 4 н.п. ф-лы, 2 ил., 2 пр.


Область техники

Настоящее изобретение касается пары праймеров и зонда для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино и, более конкретно, такой пары праймеров и зонда для ПЦР в реальном времени для диагностики дистрофии роговицы Авеллино, которые могут точно диагностировать присутствие или отсутствие в экзоне 4 гена BIGH3 мутации, которая является ответственной за дистрофию роговицы Авеллино.

Уровень техники

Дистрофия роговицы представляет собой аутосомное доминантное наследственное заболевание, которое начинается с появления помутнения в центре роговицы, и постепенно распространяясь, в конце концов, приводит к потере зрения по мере старения пациента. Дистрофия роговицы включает дистрофию роговицы Авеллино, гранулярную (зернистую) дистрофию роговицы, решетчатую дистрофию роговицы типа 1, дистрофию роговицы Рейса-Бюклерса и т.д. и является результатом мутации в гене, кодирующем белок βIG-H3.

У гетерозиготных пациентов, страдающих от дистрофии роговицы Авеллино, проявляется тяжелая потеря зрения по мере их старения, а у гомозиготных пациентов полная потеря зрения проявляется, начиная с шестилетнего возраста. Дистрофия роговицы Авеллино является новым заболеванием, получившим свое название в 1988 году, когда она была выделена в отдельное заболевание из так называемой гранулярной дистрофии роговицы, поскольку было установлено, что она имеет специфические симптомы и другую генетическую природу. Также известно, что она является наиболее распространенной дистрофией роговицы во всем мире, коэффициент распространенности этого заболевания, основанный на генетическом анализе, составляет в Корее от 1/340 до 1/1000 (в случае гетерозигот) и говорит о том, что она представляет собой распространенную дистрофию (Holland, E.J. et al., Ophthalmology, 99:1564, 1992; Kennedy, S.M. et al., Br. J. Ophthalmol., 80:489, 1996; Dolmetsch, A.M. et al., Can. J. Ophthalmol., 31:29, 1996; Afshari, N.A. et al., Arch. Ophthalmol., 119:16, 2001; Stewart, H.S. Hum. Mutat., 14:126, 1999).

Авторы настоящего изобретения обнаружили, что если пациенту, страдающему от гетерозиготной дистрофии роговицы Авеллино, проводили лазерную коррекцию зрения LASIK, то через 2 года у него начинается агрессивное развитие помутнения роговицы, которое обычно приводит к потере зрения (Jun, R. M. et al., Opthalmology, 111:463, 2004). Ранее хирургическое лечение глаз проводилось с надеждой на то, что LASIK или Эксимерная лазерная хирургия позволит избавить пациента, страдающего от дистрофии роговицы, от нечеткости зрения. Даже в Корее было проведено примерно триста тысяч хирургических операций LASIK, что по оценкам привело к тому, что 300 человек потеряло зрение. Это основано на оценке того, что минимум 1/1000 пациентов это пациенты с гетерозиготной дистрофией роговицы Авеллино. Пациенты, которым проводились хирургические операции LASIK, являются, главным образом, 20- и 30-летними активными членами общества; таким образом, потеря ими зрения приводит к серьезным проблемам в социальной сфере и в экономике.

Кроме того, после одобрения в 2000 году в США хирургических операций LASIK было установлено, что афроамериканские пациенты, страдающие от дистрофии роговицы Авеллино и получившие хирургическое лечение LASIK, теряют зрение, что позволяет заключить, что множество подобных случаев может иметь место по всему миру.

Таким образом, хотя правильная диагностика дистрофии роговицы Авеллино является необходимой для предотвращения прогрессирования дистрофии роговицы Авеллино с помощью хирургического лечения LASIK, диагностика дистрофии роговицы Авеллино обычно проводится с помощью микроскопического обследования помутнения роговицы и, следовательно, врачи часто упускают скрытые симптомы у пациентов, которым назначается хирургическое лечение LASIK, что приводит к потере зрения. Таким образом, быстрая и точная диагностика дистрофии роговицы является жизненно необходимой.

Был разработан чип ДНК для диагностики мутации в гене BIGH3, которая является ответственной за дистрофию роговицы Авеллино (Korean Patent Laid-Open Publication No. 10-2007-0076532). Однако, к сожалению, диагностика дистрофии роговицы Авеллино с применением указанного ДНК-чипа требует нескольких стадий, включая стадию амплификации ДНК в образце, стадию гибридизации амплифицированной ДНК с ДНК-чипом, стадию отмывки гибридизованного ДНК-чипа и стадию регистрации положительного ответа.

В соответствии с этим, авторы настоящего изобретения приложили большие усилия для разработки способа, позволяющего более эффективно проводить диагностику дистрофии роговицы Авеллино, и в результате обнаружили, что если диагностика дистрофии роговицы Авеллино проводится с применением пары праймеров, имеющих нуклеотидные последовательности SEQ ID NO:1 и SEQ ID NO:2, и зондов, имеющих нуклеотидные последовательности SEQ ID NO:25 и SEQ ID NO:26, методом ПЦР в режиме реального времени, то дистрофия роговицы Авеллино может быть диагностирована более быстрым и точным способом по сравнению со стандартным способом, что и привело к осуществлению настоящего изобретения.

Раскрытие изобретения

Основным объектом настоящего изобретения является предоставление пары праймеров и зонда для более эффективной и точной диагностики дистрофии роговицы Авеллино с применением метода ПЦР в реальном времени.

Для достижения указанной выше цели настоящее изобретение предоставляет пару праймеров для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, которая представлена нуклеотидными последовательностями, выбираемыми из группы, состоящей из последовательностей SEQ ID NOs:1 и 2, SEQ ID NOs:3 и 4, SEQ ID NOs:5 и 6, SEQ ID NOs:7 и 8, SEQ ID NOs:9 и 10, SEQ ID NOs:11 и 12, SEQ ID NOs:13 и 14, SEQ ID NOs:15 и 16, SEQ ID NOs:17 и 18, SEQ ID NOs:19 и 20, SEQ ID NOs:21 и 22 и SEQ ID NOs:23 и 24.

Настоящее изобретение также предоставляет зонд для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, который представлен нуклеотидной последовательностью, выбираемой из группы, состоящей из последовательностей от SEQ ID NO:25 до SEQ ID NO:42.

Краткое описание фигур

Фигура 1 показывает результаты, полученные с применение разработанных праймеров и зондов для ПЦР в режиме реального времени. На Фигуре 1 «А» показаны результаты ПЦР в режиме реального времени, которая проводилась с применением оптимальных праймеров и зондов, на панелях «В» и «С» показаны результаты ПЦР в режиме реального времени, которая проводилась с применением праймеров, отличающихся от таковых в случае «А».

Фигура 2 показывает результаты ПЦР в режиме реального времени, которая проводилась с применением праймеров для ПЦР в режиме реального времени согласно настоящему изобретению для выявления мутации гена, вызывающей дистрофию роговицы Авеллино.

Наилучший способ осуществления изобретения

В одном аспекте настоящее изобретение направлено на пару праймеров для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, которая представлена нуклеотидными последовательностями, выбираемыми из группы, состоящей из последовательностей SEQ ID NOs:1 и 2, SEQ ID NOs:3 и 4, SEQ ID NOs:5 и 6, SEQ ID NOs:7 и 8, SEQ ID NOs:9 и 10, SEQ ID NOs:11 и 12, SEQ ID NOs:13 и 14, SEQ ID NOs:15 и 16, SEQ ID NOs:17 и 18, SEQ ID NOs:19 и 20, SEQ ID NOs:21 и 22 и SEQ ID NOs:23 и 24.

Дистрофия роговицы Авеллино представляет собой заболевание, вызываемое генетическим нарушением, при котором последовательность CGC в экзоне 4 гена BIGH3 мутирована в САС, в результате чего остаток аргигина в белке BIGH3 заменяется на гистидин (R124H).

При проведении ПЦР в режиме реального времени с применением праймеров настоящего изобретения дистрофия роговицы Авеллино может быть диагностирована более быстрым и точным способом по сравнению с обычным способом с применением ДНК-чипа.

Для метода ПЦР в режиме реального времени очень трудно подобрать температурные условия, поскольку эксперименты с применением праймеров и зондов должны проводиться в одинаковых температурных условиях. В частности, если необходимо определить только одно положение мутации, как в случае дистрофии роговицы Авеллино, праймеры и зонды должны применяться в таких температурных условиях, при которых они могут связываться. Кроме того, зонды могут связываться в очень узком температурном диапазоне от 1°С до 3°С при условии, что зонд для определения нормального гена и зонд для определения мутантного гена различаются только на один нуклеотид.

Вследствие этого важно найти общие температурные условия, в которых зонды и праймеры могут связываться с желаемым геном. В частности, необходимо сконструировать «мутантный» зонд и «нормальный» зонд таким образом, чтобы температуры для них отличались максимально, насколько это возможно, в пределах ограниченного диапазона. Иными словами, температуры для праймеров и зондов должны хорошо соответствовать друг другу, температурные условия для прямого праймера и обратного праймера должны хорошо соответствовать друг другу, и разница между температурами для «мутантного» зонда и «нормального» зонда должна, по возможности, быть максимальной. Фигура 1А показывает результаты применения хорошо сконструированных праймеров и зондов, и Фигуры 1В и 1C показывают результаты применения праймеров, отличающихся от таковых, которые применялись на Фигуре 1А, несмотря на то, что применялись те же самые зонды, что и в случае, показанном на Фигуре 1А. Как можно видеть из Фигур, конструирование праймеров и зондов оказывает значительное влияние на получаемые результаты.

В настоящем изобретении для создания оптимальных праймеров для диагностики дистрофии роговицы Авеллино с применением метода ПЦР в режиме реального времени были сконструированы пары праймеров с последовательностями SEQ ID NOs:1 и 2, SEQ ID NOs:3 и 4, SEQ ID NOs:5 и 6, SEQ ID NOs:7 и 8, SEQ ID NOs:9 и 10, SEQ ID NOs:11 и 12, SEQ ID NOs:13 и 14, SEQ ID NOs:15 и 16, SEQ ID NOs:17 и 18, SEQ ID NOs:19 и 20, SEQ ID NOs:21 и 22 и SEQ ID NOs:23 и 24, и ПЦР в режиме реального времени была проведена с применением каждой из сконструированных пар праймеров. В результате было установлено, что применение пары праймеров с последовательностями SEQ ID NOs:1 и 2 дает оптимальные результаты.

В другом аспекте настоящее изобретение направлено на зонд для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, который представлен нуклеотидной последовательностью, выбираемой из группы, состоящей из последовательностей от SEQ ID NO:25 до SEQ ID NO:42.

В настоящем изобретении для создания оптимальных зондов для диагностики дистрофии роговицы Авеллино с применением метода ПЦР в режиме реального времени были сконструированы зонды с последовательностями SEQ ID NOs: от 25 до 42, и ПЦР в режиме реального времени была проведена с применением каждого из сконструированных зондов. В результате было установлено, что применение зондов с последовательностями SEQ ID NOs:25 и 26 дает оптимальные результаты.


Далее настоящее изобретение будет раскрыто более детально с помощью примеров. Специалисту в данной области техники будет очевидно, что эти примеры приводятся исключительно для иллюстрации и не должны рассматриваться, как ограничивающие объем настоящего изобретения. Таким образом, следующие стадии будут описываться в качестве иллюстративных примеров, которые не ограничивают объем настоящего изобретения.

Пример 1. Конструирование праймеров для ПЦР в режиме реального времени и зондов MGB

Для конструирования праймеров, способных амплифицировать участок, включающий мутацию в экзоне 4 гена BIGH3, были получены пары праймеров с последовательностями SEQ ID NOs:1 и 2, SEQ ID NOs:3 и 4, SEQ ID NOs:5 и 6, SEQ ID NOs:7 и 8, SEQ ID NOs:9 и 10, SEQ ID NOs:11 и 12, SEQ ID NOs:13 и 14, SEQ ID NOs:15 и 16, SEQ ID NOs:17 и 18, SEQ ID NOs:19 и 20, SEQ ID NOs:21 и 22 и SEQ ID NOs:23 и 24 с помощью программного обеспечения Primer Express 3.0 (Applied Biosystems U.S.A).

ACD Прямой праймер: 5'-TCC ACC ACC ACT CAG CTG ТА (SEQ ID NO:1)

ACD Обратный праймер: 5'-CCA TCT CAG GCC TCA GCT Т (SEQ ID NO:2) (60 п.о.)

AV Прямой праймер: 5'-TGC AGC CCT ACC ACT CTC AA (SEQ ID NO:3)

AV Обратный праймер: 5'-AGG CCT CGT TGC TAG G (SEQ ID NO:4) (150 п.о.)

Real Прямой праймер: 5'-TAG TCT CTT ATT СТА ATA GA (SEQ ID NO:5)

Real Обратный праймер: 5'-GCT GCA GAC TCT GTG TTT AA (SEQ ID NO:6) (860 п.о.)

ACD Прямой праймер 2: 5'-CCA ТСС CTC CTT CTG TCT TCT G (SEQ ID NO:7)

ACD Обратный праймер 2: 5'-CGG GCC CCT CCA TCT С (SEQ ID NO:8) (140 п.о.)

ACD Прямой праймер 3: 5'-CAG AGA AGG GAG GGT GTG GTT (SEQ ID NO:9)

ACD Обратный праймер 3: 5'-GGG CGA AGA TGG TGA AGC Т (SEQ ID NO:10) (190 п.о.)

ACD Прямой праймер 4: 5'-TCC TCG ТСС TCT CCA CCT GTA (SEQ ID NO:11)

ACD Обратный праймер 4: 5'-AGC TGG CAA GGA GGC CC (SEQ ID NO:12)

ACD Прямой праймер 5: 5'-TTT GGG CTT ТСС CAC ATG С (SEQ ID NO:13)

ACD Обратный праймер 5: 5'-GGC AGA CGG AGG TCA TCT CA (SEQ ID NO:14)

ACD Прямой праймер 6: 5'-GTA GTA CCG TGC TCT CTG (SEQ ID NO:15)

ACD Обратный праймер 6: 5'-AGT ТСС CCA TAA GAA ТСС ССС SEQ ID NO:16)

ACD Прямой праймер 7: 5'-GGC TGG ACC ССС AGA GG (SEQ ID NO:17)

ACD Обратный праймер 7: 5'-ACC CCT CGG GGA AGT AAG G (SEQ ID NO:18)

ACD Прямой праймер 8: 5'-AAC CTT TAC GAG ACC CTG GGA (SEQ ID NO:19)

ACD Обратный праймер 8: 5'-GAC ТСС CAT CCA TCA TGC CC (SEQ ID NO:20)

ACD Прямой праймер 9: 5'-AGT CGT TGG АТС CAC CAC CA (SEQ ID NO:21)

ACD Обратный праймер 9: 5'-GAC GTC ATT ТСС TAC TGT TTC AGG (SEQ ID NO:22)

ACD Прямой праймер 10: 5'-CCC ССС AGA AAC AGC CTG (SEQ ID NO:23)

ACD Обратный праймер 10: 5'-TTC TAA GGG GTT AAG GAG AAA GCT Т (SEQ ID NO:24)

Для выявления мутации гуанин-аденин в экзоне 4 гена BIGH3 были сконструированы зонды с последовательностями SEQ ID NOs: от 25 до 42.

Зонд, связывающийся с нормальным фрагментом гена, не содержащим мутацию, был помечен красителем VIC, и зонд, связывающийся с фрагментом гена, содержащим мутацию, был помечен красителем FAM, и агент, обеспечивающий связывание с малой бороздкой ДНК (minor groove binder, MGB) был присоединен к зонду для облегчения связывания с комплементарным фрагментом гена.

«Нормальный» зонд 1: VIC-CAC GGA CCG CAC GGA-NFQ (SEQ ID NO:25) (15 п.о.)

«Мутантный» зонд 1: FAM-CAC GGA CCA CAC GGA-NFQ (SEQ ID NO:26)

«Нормальный» зонд 2: VIC-ACA CGG ACC GCA CG-NPQ (SEQ ID NO:27)

«Мутантный» зонд 2: FAM-ACA CGG ACC АСА CG-NFQ (SEQ ID NO:28) (14 п.о.)

«Нормальный» зонд 3: VIC-TAC ACG GAC CGC A-NFQ (SEQ ID NO:29)

«Мутантный» зонд 3: FAM-TAC ACG GAC CAC A-NFQ (SEQ ID NO:30) (13 п.о.)

«Нормальный» зонд 4: VIC-CTG TAC ACG GAC CGC ACG-NFQ (SEQ ID NO:31)

«Мутантный» зонд 4: FAM-CTG TAC ACG GAC CAC ACG-NFQ (SEQ ID NO:32) (18 п.о.)

«Нормальный» зонд 5: VIC-CTG TAC ACG GAC CGC ACG GAG-NFQ (SEQ ID NO:33)

«Мутантный» зонд 5: FAM-CTG TAC ACG GAC CAC ACG GAG-NFQ (SEQ ID NO:34) (21 п.о.)



«Нормальный» зонд 7: VIC-ACC GCA CGG AGA AGC-NFQ (SEQ ID NO:37)

«Мутантный» зонд 7: FAM-ACC АСА CGG AGA AGC-NFQ (SEQ ID NO:38)

«Нормальный» зонд 8: VIC-ACC GCA CGG AGA AGC TGA GGC-NFQ (SEQ ID NO:39)

«Мутантный» зонд 8: FAM-ACC АСА CGG AGA AGC TGA GGC-NFQ (SEQ ID NO:40)

«Нормальный» зонд 8 (9?): VIC-ACC GCA CGG AGA AGC TGA GGC CTG-NFQ (SEQ ID NO:41)

«Мутантный» зонд 8 (9?): FAM-ACC АСА CGG AGA AGC TGA GGC CTG-NFQ (SEQ ID NO:42)

Пример 2. Диагностика дистрофии роговицы Авеллино с применением ПЦР в режиме реального времени

У тестируемых субъектов были взяты образцы крови, корней волос и эпителия ротовой полости и из образцов была выделена ДНК. Выделение и очистку ДНК проводили с использованием частично модифицированного метода фенол/хлороформной экстракции (Miller, SA et al., Nucl. Acids Res. 16:1215, 1988) и выделенную ДНК растворяли в подходящем количестве буфера ТЕ (10 мМ Tris-Cl, 1 мМ ЭДТА, рН 7,4), анализировали с помощью электрофореза в 1% агарозном геле и использовали в качестве матрицы в ПЦР.

Реакции ПЦР проводили с применением праймеров (SEQ ID NOs: от 1 до 24) для амплификации фрагмента, содержащего мутантный участок, и зондов (SEQ ID NOs: от 25 до 42), сконструированных в Примере 1.

Для проведения реакции ПЦР было приготовлено и использовано в реакции 25 мкл смеси мастер-микс, содержащей 10 пмолей каждого праймера и 5 пмолей каждого зонда

Реакцию ПЦР в режиме реального времени проводили в следующих условиях: 36 циклов, каждый из которых состоял из 10 мин при 95°С, 15 сек при 92°С и 1 мин при 60°С, с последующей инкубацией в течение 5 мин при 60°С.

После каждого цикла измерялась флуоресценция. Образец, положительный по красителю VIC, был диагностирован, как содержащий нормальный ген, и образец, положительный по FAM, был диагностирован, как содержащий мутантный ген.

В результате можно видеть, что применение пары праймеров с последовательностями SEQ ID NOs:1 и 2 и зондов с последовательностями SEQ ID NOs:25 и 26 демонстрировало наиболее точные и эффективные результаты (Фигура 2).

Хотя настоящее изобретение было раскрыто в деталях со ссылкой на специфические особенности, специалисту в данной области техники очевидно, что это раскрытие описывает только предпочтительное воплощение и не ограничивает объем настоящего изобретения. Таким образом, основной объем настоящего изобретения будет определен в прилагаемой Формуле изобретения и ее эквивалентах.

Промышленная применимость

Применение пары праймеров и зонда согласно настоящему изобретению может обеспечить диагностику дистрофии роговицы Авеллино более быстрым и точным способом, чем стандартный способ с применением ДНК-чипа или ПЦР.

1. Пара праймеров для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, которая представлена нуклеотидными последовательностями, выбираемыми из группы, состоящей из последовательностей SEQ ID NOs: 1 и 2.

2. Зонд для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, который представлен нуклеотидной последовательностью SEQ ID NO: 25.

3. Зонд для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино, который представлен нуклеотидной последовательностью SEQ ID NO: 26.

4. Способ диагностики дистрофии роговицы Авеллино, включающий ПЦР амплификацию в режиме реального времени с использованием пары праймеров по п.1 и зондов по пп.2 и 3.


Похожие патенты:

Изобретение относится к молекулярной биологии, в частности к коротким интерферирующим РНК (siRNA), и может быть использовано в противоопухолевой терапии. На основе геномного анализа сконструированы последовательности siRNA против гена HIF1A человека с SEQ ID NO:1-2, siRNA против гена HSP8A человека с SEQ ID NO:3-4, siRNA против гена APEX1 человека с SEQ ID NO:5-6 и siRNA против гена CCND3 человека с SEQ ID NO:7-8, ассоциированных с пролиферацией клеток аденокарциномы поджелудочной железы человека.

Изобретение относится к молекулярной биологии, в частности к коротким интерферирующим РНК (siRNA), и может быть использовано в противоопухолевой терапии. На основе геномного анализа сконструированы последовательности siRNA против гена HIF1A человека с SEQ ID NO:1-2, siRNA против гена HSP8A человека с SEQ ID NO:3-4, siRNA против гена APEX1 человека с SEQ ID NO:5-6 и siRNA против гена CCND3 человека с SEQ ID NO:7-8, ассоциированных с пролиферацией клеток аденокарциномы поджелудочной железы человека.
Изобретение относится к биотехнологии и микробиологии и представляет собой способ идентификации кластера генов, кодирующих стафилококковые белки, являющиеся экзотоксинами.

Изобретение относится к области биохимии, в частности к способу уничтожения сорняков, предусматривающему стадию нанесения гербицида РРО-ингибиторного типа на культивируемую часть растения, где указанное растение обладает устойчивостью к указанному гербициду и экспрессирует белок со способностью превращать вышеуказанный гербицид в гербицид с более низкой гербицидной активностью.

Представленные решения касаются способа генерирования заквасочной культуры, заквасочной культуры и способа ферментации с использованием такой заквасочной культуры.

Изобретение относится к биотехнологии. Описан набор праймеров для амплификации фрагментов гена CFTR.

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого.

Изобретение относится к области биотехнологии, конкретно к набору синтетических олигонуклеотидных пар праймеров, и может быть использовано в судебно-медицинской идентификационной экспертизе.

Изобретение относится к биотехнологии и представляет собой способ оценки чувствительности клеток рака легкого к доксорубицину (IC50), а также набор для осуществления данного способа.

Изобретение относится к области генной инженерии и может быть использовано для регулирования проницаемости метан-продуцирующей клетки. Получают полипептид, который способен проникать в метан-продуцирующую клетку и повышать ее проницаемость, характеризующийся аминокислотной последовательностью SEQ ID NO:117, 118 или 119 или по меньшей мере 90% идентичностью к указанной последовательности или по меньшей мере 15 последовательно расположенными аминокислотами указанной последовательности.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра. Молекулы нуклеиновых кислот получены методами генной инженерии. Белок для детекции пероксида водорода имеет аминокислотную последовательность, показанную в SEQ ID NO:2. Также обеспечиваются клетка-хозяин и кассета экспрессии, содержащие указанные молекулы нуклеиновых кислот. Использование изобретений позволяет осуществлять микроскопию в толстых слоях тканей, а также обеспечивает возможность совместной микроскопии нескольких флуоресцентных конструкций. 4 н.п. ф-лы, 7 ил.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Tannerella forsythensis методом полимеразной цепной реакции. Указанный набор включает специфичные к фрагменту гена bspA микроорганизма Tannerella forsythensis праймеры 5′-TGGCACCCTCCGATGCCGAC-3′ и 5′-GCGCAGACCGTTGGGTTTCA-3′, а также зонд (BHQ1)-5′-CCGCGCCCGA(FdT)GCGTCGCTGGC-3′-Р, где BHQ1 означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции, a FdT - флуоресцентный краситель FAM, присоединенный к нуклеотиду Т. Предлагаемое изобретение позволяет достоверно обнаруживать присутствие в биологическом материале микроорганизма Tannerella forsythensis.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложена молекула RNAi для супрессии экспрессии тимидилатсинтазы за счет действия RNAi, содержащая домен двухцепочечной РНК, состоящий из смысловой цепи, состоящей из нуклеотидной последовательности, представленной SEQ ID NO: 1, гибридизованной с антисмысловой цепью, гибридизующейся в жестких условиях со смысловой цепью. Молекула может существенно потенцировать противоопухолевое действие 5-FU-противоопухолевого агента, в связи с чем может быть использована в медицине при противоопухолевой терапии. 5 н. и 10 з.п. ф-лы, 2 ил., 3 пр.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы. Представленные изобретения обеспечивают более доступный и простой метод анализа с высокой специфичностью и низкой стоимостью. 4 н.п. ф-лы, 2 ил., 2 табл., 4 пр.

Изобретение относится к области биохимии, в частности к биологическому ДНК маркеру для обнаружения геномной ДНК картофеля S. tuberosum и родственных дикорастущих видов рода Solanum sect. Petota в растительном материале и пищевых продуктах, представляющий собой олигонуклеотидные праймеры - затравки полимеразной реакции SEQ ID №1 - 5′-CAAAAACAAACTGAACGAACATGCATTC-3′ SEQ ID №2 - 5′GCGTTGACGTTCACACGGATG-3′, позволяющие амплифицировать ген Sus4 у культурного картофеля S. tuberosum и родственных дикорастущих видов рода Solanum sect. Petota, а также в продуктах переработки картофеля, и таким образом идентифицировать ДНК картофеля. Изобретение позволяет эффективно обнаруживать геномную ДНК картофеля S. tuberosum и родственных дикорастущих видов рода Solanum sect. Petota в растительном материале и пищевых продуктах. 4 ил., 1 прим.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита. Изобретение позволяет повысить чувствительность и точность детектирования единичных молекул. 4 н. и 19 з.п. ф-лы, 6 ил., 4 пр.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием. TD-зонд гибридизуется с нуклеиновокислотной последовательностью-мишенью как через 5'-концевой второй участок гибридизации, так и 3'-концевой первый участок гибридизации. Когда TD-зонд гибридизуется с нуклеиновокислотной последовательностью, не являющейся мишенью, тогда и 5'-концевой второй участок гибридизации, и разделительный участок оба не гибридизуются с нуклеиновокислотной последовательностью, не являющейся мишенью, так что оба участка образуют одиночную цепь вследствие низкой величины своей Тпл. Представленные изобретения позволяют повысить специфичность гибридизации и могут быть использованы в области клинической диагностики и генетических исследований. 7 н. и 32 з.п. ф-лы, 14 ил., 9 пр.

Группа изобретений относится к области биотехнологии и медицины. Введение субъекту молекулы нуклеиновой кислоты при лечении волчаночного нефрита, которая способна связываться с MCP-1 и является антагонистом МСР-1, где молекула нуклеиновой кислоты содержит последовательность нуклеиновой кислоты SEQ ID NO:37 совместно с иммуносупрессивным средством, позволяет снизить дозу вводимого иммуносупрессивного средства. Введение субъекту молекулы нуклеиновой кислоты, где молекула нуклеиновой кислоты содержит последовательность нуклеиновой кислоты SEQ ID NO:37, также оказывает терапевтический эффект при лечении легочной гипертензии и хроническом обструктивном заболевании легких. 6 н. и 24 з.п. ф-лы, 54 ил., 1 табл., 12 пр.

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин. ПЦР продукты анализируют в агарозном геле, размер полученного фрагмента определяют с помощью ДНК-маркера, выделяют целевые фрагменты из ПЦР-смеси или агарозного геля и секвенируют их с целью обнаружения соответствующих полиморфизмов. Предложенное изобретение позволяет точно и быстро проводить генотипирование микобактерий в режиме ПЦР и может быть использовано для идентификации клинически значимых штаммов M. tuberculosis, в том числе с множественной и широкой лекарственной устойчивостью, а также с измененной вирулентностью при работе с пациентами. 1 ил., 3 табл., 5 пр.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела. Охарактеризованное изобретение специфично и высокоафинно связывается с аутоантителами, характерными для рассеянного склероза и может быть использовано для диагностики рассеянного склероза. 3 ил., 2 пр.

Изобретение относится к биотехнологии. Описана пара праймеров и зонды для ПЦР в режиме реального времени для диагностики дистрофии роговицы Авеллино. Изобретение позволяет точно диагностировать присутствие или отсутствие в экзоне 4 гена BIGH3 мутации, которая является ответственной за дистрофию роговицы Авеллино. Также применение пары праймеров и зонда согласно настоящему изобретению может обеспечить диагностику дистрофии роговицы Авеллино более быстрым и точным способом, чем стандартный способ с применением ДНК-чипа или ПЦР. 4 н.п. ф-лы, 2 ил., 2 пр.
