Модуляция экспрессии фактора 11



Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11
Модуляция экспрессии фактора 11

 


Владельцы патента RU 2535964:

АйЭсАйЭс ФАРМАСЬЮТИКАЛЗ, ИНК. (US)

Изобретение относится к области биотехнологии. Описаны антисмысловые соединения, способы снижения уровня фактора 11 и способы лечения или предупреждения тромбоэмболических осложнений у индивидуума, нуждающегося в этом. Примерами патологических состояний, которые могут быть подвергнуты лечению путем введения антисмысловых соединений, нацеленных на фактор 11, являются тромбоз, эмболия и тромбоэмболия, такие как тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт. Антисмысловые соединения, нацеленные на фактор 11, могут быть также использованы в качестве профилактических средств для устранения риска развития у индивидуумов тромбоза и эмболии. 5 н. и 52 з.п. ф-лы, 169 табл., 47 пр.

 

Перекрестная ссылка на родственные заявки

В соответствии со статьей 35 Кодекса законов США, в настоящей заявке испрашивается приоритет предварительной заявки № 61/105772, поданной 15 октября 2008, и предварительной заявки № 61/174461, поданной 30 апреля 2009. Каждая из вышеуказанных заявок во всей своей полноте вводится в настоящее описание посредством ссылки.

Список последовательностей

Настоящая заявка подана вместе со списком последовательностей в электронном формате. Список последовательностей представлен в виде файла, озаглавленного 20091015_BIOL0107WOSEQ.txt, который был создан 15 октября 2009 и имеет размер 92 Kb. Информация о списке последовательностей в электронном формате во всей своей полноте вводится в настоящее описание посредством ссылки.

Область техники, к которой относится изобретение

В некоторых своих вариантах, настоящее изобретение относится к способам, соединениям и композициям, применяемым для снижения уровня экспрессии мРНК и белка фактора 11 у животного. Такие способы, соединения и композиции могут быть применены для лечения, предупреждения или ослабления тромбоэмболических осложнений.

Предшествующий уровень техники

Для функционирования системы кровообращения необходимы механизмы, которые предупреждают потерю крови, а также механизмы, которые предотвращают нежелательную закупорку кровеносных сосудов. Вообще говоря, свертывание крови включает каскад реакций и, в конечном счете, приводит к превращению растворимого фибриногена в нерастворимый фибриновый гель. Стадии этого каскада реакций включают превращение неактивного зимогена в активированный фермент. Затем, активный фермент катализирует следующую стадию этого каскада реакций.

Каскад реакций свертывания крови

Каскад реакций свертывания крови может быть инициирован двумя путями, такими как путь тканевого фактора (также называемого «внешним путем»), который представляет собой первичный путь, и путь контактной активации (также называемый «внутренним путем»).

Путь тканевого фактора инициируется тканевым фактором, который представляет собой рецептор клеточной поверхности (TF, также называемый фактором III), и который конститутивно экспрессируется экстраваскулярными клетками (перицитами, кардимиоцитами, клетками гладких мышц и кератиноцитами), а также васкулярными моноцитами и эндотелиальными клетками после их индуцирования воспалительными цитокинами или эндотоксином. (Drake et al., Am J Pathol. 1989, 134:1087-1097). TF представляет собой высокоаффинный клеточный рецептор для фактора свертывания крови VIIa, то есть сериновая протеаза. В отсутствие TF фактор VIIa обладает очень низкой каталитической активностью, и связывание с TF необходимо для сообщения фактору VIIa функциональных свойств благодаря аллостерическому механизму. (Drake et al., Am. J. Pathol. 1989, 134:1087-1097). Комплекс TF-VIIa активирует превращение фактора X в фактор Xa. Xa, в свою очередь, ассоциируется с его кофактором, фактором Va, и образует протромбиназный комплекс, который, в свою очередь, активирует превращение протромбина (также называемого фактором II или фактором 2а) в тромбин (также называемый фактором IIa или фактором 2а). Тромбин активирует тромбоциты, превращает фибриноген в фибрин и стимулирует перекрестное связывание фибрина благодаря активации фактора XIII, что приводит к образованию устойчивого сгустка на тех участках экстраваскулярных клеток, на которых присутствует TF. Кроме того, тромбин усиливает ответ в виде каскада реакций свертывания крови благодаря активации факторов V и VIII.

Путь контактной активации запускается в результате активации фактора XII в XIIa. Фактор XIIa превращает XI в XIa, а XIa превращает IX в IXa. IXa ассоциируется с его кофактором VIIIa с последующим превращением X в Xa. Два пути сходятся в этой точке, поскольку фактор Xa ассоциируется с фактором Va, что приводит к активации протромбина (фактора II) в тромбин (фактор IIa).

Ингибирование свертывания крови

Контроль за прохождением каскада реакций свертывания крови осуществляется по меньшей мере по трем механизмам, а именно, под действием активированного белка C, антитромбина и ингибитора пути тканевого фактора. Активированный белок C представляет собой сериновую протеазу, которая разлагает кофакторы Va и VIIIa. Белок C активируется тромбином посредством тромбомодулина, а для его функционирования необходим кофермент белок S. Антитромбин представляет собой ингибитор сериновой протеазы (серпин), который ингибирует сериновые протеазы: тромбин, Xa, XIIa, XIa и IXa. Ингибитор пути тканевого фактора ингибирует действие Xa и комплекса TF-VIIa. (Schwartz A.L. et al., Trends Cardiovasc Med. 1997; 7:234-239.)

Заболевание

Тромбоз представляет собой патологическое образование сгустков крови, а эмболия возникает в том случае, когда сгустки крови мигрируют в другую часть организма и препятствуют нормальному функционированию органов. Тромбоэмболия может вызывать такие состояния, как тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт. В основном тромбоэмболия является главной причиной возникновения тяжелых заболеваний, и в Америке каждый год регистрируется 2 миллиона новых случаев развития такого заболевания (Adcock et al. American Journal of Clinical Pathology. 1997; 108:434-49). Хотя в большинстве случаев тромбоз вызывается приобретенными неприродными факторами, такими как хирургическая операция, рак и неподвижный образ жизни, однако, в некоторых случаях, тромбоз ассоциируется с генетической предрасположенностью, например, он может вызываться антифосфолипидным синдромом и аутосомно-доминантным состоянием, ассоциированным с присутствием фактора V Лейдена. (Bertina R.M. et al. Nature 1994; 369:64-67).

Лечение

Все наиболее часто используемые средства, такие как антикоагулянты, варфарин, гепарин и низкомолекулярный гепарин (НМГ) имеют множество недостатков.

Варфарин обычно используется для лечения пациентов, страдающих трепетанием предсердий. Такое лекарственное средство взаимодействует с активируемыми витамином К факторами свертывания крови, которыми являются факторы II, VII, IX и X. Белки-антикоагулянты С и S также ингибируются варфарином. Терапия лекарственными средствами, проводимая с использованием варфарина, также сталкивается с определенными проблемами, заключающимися в том, что варфарин взаимодействует с другими лекарственными средствами, включая лекарственные средства, используемые для лечения трепетания предсердий, такие как амиодарон. Поскольку исход терапии с использованием варфарина трудно предсказать, то для детектирования каких-либо признаков аномального кровотечения, пациент должен пройти тщательное обследование.

Гепарин действует путем активации антитромбина, который ингибирует тромбин и фактор X. (Bjork I, Lindahl U. Mol. Cell Biochem. 1982 48:161-182). Лечение гепарином может приводить к иммунным реакциям, стимулирующим агрегацию тромбоцитов в кровеносных сосудах, что может вызывать тромбоз. Такими известными побочными эффектами являются индуцированная гепарином тромбоцитопения (ГИТ), а поэтому необходимо проводить обследование пациента. Продолжительное лечение гепарином может также приводить к остеопорозу. НМГ может также ингибировать фактор 2, но в меньшей степени, чем нефрагментированный гепарин (НФГ). НМГ участвует в развитии тромбоцитопении (ГИТ).

Таким образом, при применении современных антикоагулянтов невозможно предсказать исход и специфичность лечения, а поэтому, для предупреждения побочных эффектов, таких как аномальное кровотечение, необходимо тщательное обследование пациента. В настоящее время не существует антикоагулянтов, механизм действия которых относился бы только к «внешнему пути» или к «внутреннему пути».

Описание сущности изобретения

Настоящее изобретение относится к способам, соединениям и к композициям для модуляции экспрессии мРНК и белка фактора 11. В некоторых вариантах изобретения, специфические ингибиторы фактора 11 модулируют экспрессию мРНК и белка фактора 11. В некоторых вариантах изобретения, специфические ингибиторы фактора 11 представляют собой нуклеиновые кислоты, белки или небольшие молекулы.

В некоторых вариантах изобретения, модуляция может происходить в клетках или тканях. В некоторых вариантах изобретения, такими клетками или тканями являются клетки или ткани животного. В некоторых вариантах изобретения, указанным животным является человек. В некоторых вариантах изобретения, уровни мРНК фактора 11 являются пониженными. В некоторых вариантах изобретения, уровни белка фактора 11 являются пониженными. Такое снижение может зависеть от времени или от дозы.

Настоящее изобретение также относится к способам, соединениям и композициям, которые могут быть применены для предупреждения, лечения и ослабления симптомов заболеваний, расстройств и состояний. В некоторых вариантах изобретения, такие заболевания, расстройства и состояния представляют собой тромбоэмболические осложнения. Указанные тромбоэмболические осложнения включают тромбоз, эмболию и тромбоэмболию различных категорий. В некоторых вариантах изобретения, такими тромбоэмболическими осложнениями являются тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт.

Указанные заболевания, расстройства и состояния могут быть ассоциированы с одним или несколькими факторами риска и являются этиологическим фактором или наиболее частой причиной исхода заболевания. Некоторыми факторами риска и причиной развития тромбоэмболических осложнений являются неподвижный образ жизни, хирургическая операция (в частности, ортопедическая хирургическая операция), злокачественная опухоль, беременность, возрастные изменения, применение пероральных контрацептивов, трепетание предсердий, предшествующие тромбоэмболические осложнения, хроническое воспалительное заболевание и наследуемые или приобретенные расстройства, ассоциированные с образованием протромботических сгустков. Исходом некоторых заболеваний, ассоциированных с развитием тромбоэмболических осложнений, являются снижение потока крови через пораженные сосуды, гибель ткани и летальный исход.

В некоторых вариантах изобретения, способы лечения включают введение индивидууму, нуждающемуся в этом, специфического ингибитора фактора 11.

Подробное описание изобретения

Следует отметить, что представленное выше общее описание и нижеследующее подробное описание приводятся лишь в целях иллюстрации и лучшего понимания настоящего изобретения и не должны рассматриваться как ограничение заявленного изобретения. В настоящем описании, при употреблении слов в единственном числе подразумевается, что они могут быть использованы и во множественном числе, если это не оговорено особо. Используемый здесь союз «или» означает «и/или», если это не указано конкретно. Кроме того, используемый здесь термин «включая», а также другие его грамматические формы, такие как «включает» или «включенный», не имеют ограничивающего смысла. Кроме того, такие термины, как «элемент» или «компонент» охватывают как элементы, так и компоненты, включающие один объект, и элементы и компоненты, которые включают более чем один субэлемент или субкомпонент, если это не указано конкретно.

Заголовки разделов настоящего описания приводятся лишь в организационных целях и не должны рассматриваться как ограничение предмета изобретения. Все документы или их части, цитируемые в настоящей заявке, включая, но не ограничиваясь ими, патенты, патентные заявки, статьи, монографии и договора, вводятся в настоящее описание частично, а также во всей своей полноте посредством ссылки.

Определения

Если это не указано конкретно в разделе «Определения», номенклатура, используемая в соответствии с настоящим изобретением, а также процедуры и методы, применяемые в аналитической химии, химии органического синтеза, а также в медицинской и фармацевтической химии, и описанные в настоящей заявке, хорошо известны и широко применяются специалистами в данной области. Химический синтез и химический анализ могут быть осуществлены с применением стандартных методов. Все патенты, патентные заявки, опубликованные заявки и другие публикации, а также регистрационные номера GENBANK и представленная информация о последовательностях, полученная из баз данных, таких как базы данных Национального центра биотехнологической информации (NCBI), и другая информация, если она приводится в описании настоящей заявки, вводятся в описание обсуждаемого документа частично, а также во всей своей полноте посредством ссылки.

Представленные ниже термины, если это не оговорено особо, имеют следующие значения:

Термин «2′-O-метоксиэтил» (также обозначаемый 2′-MOE и 2′-O(CH2)2-OCH3) означает O-метоксиэтильную модификацию во 2′-положении фурозильного кольца. Модифицированным сахаром является сахар, модифицированный 2′-O-метоксиэтилом.

Термин «2′-O-метоксиэтил-нуклеотид» означает нуклеотид, включающий сахарную группу, модифицированную 2′-O-метоксиэтилом.

Термин «5-метилцитозин» означает цитозин, модифицированный метильной группой, присоединенной в 5′-положении. 5-метилцитозин представляет собой модифицированное нуклеотидное основание.

Термин «активное фармацевтическое средство» означает вещество или вещества, присутствующие в фармацевтической композиции, которая при ее введении индивидууму дает терапевтический эффект. Так, например, в некоторых вариантах изобретения активным фармацевтическим средством является антисмысловой олигонуклеотид, нацеленный на фактор 11.

Термины «активная область-мишень» или «область-мишень» означают область, на которую нацелены одно или несколько активных антисмысловых соединений. Термин «активные антисмысловые соединения» означает антисмысловые соединения, снижающие уровни нуклеиновой кислоты-мишени или белка-мишени.

Термин «сопутствующее введение» означает совместное введение двух средств любым способом, позволяющим продуцировать у пациента фармакологические эффекты в ответ на одновременное введение этих двух средств. Сопутствующее введение не означает, что оба средства должны быть обязательно введены в виде одной фармацевтической композиции или в виде одной лекарственной формы или одним и тем же способом введения. Эффекты от введения этих двух средств необязательно должны наблюдаться в одно и то же время. Такие эффекты должны лишь совпадать по времени и необязательно должны быть коэкстенсивными.

Термин «введение» означает доставку фармацевтического средства индивидууму, и этот термин включает, но не ограничивается ими, введение этого средства специалистом-медиком и самостоятельное введение.

Термин «улучшение» означает ослабление по меньшей мере одного показателя, признака или симптома, ассоциированного с указанным заболеванием, расстройством или состоянием. Тяжесть заболеваний может быть определена по субъективным или объективным критериям, известным специалистам.

Термин «животное» относится к человеку или к животному, не являющемуся человеком, включая, но не ограничиваясь ими, мышей, крыс, кроликов, собак, кошек, свиней и приматов, не являющихся человеком, включая, но не ограничиваясь ими, обезьян и шимпанзе.

Термин «соединение-антидот» означает соединение, обладающее способностью снижать интенсивность или продолжительность какой-либо активности, опосредуемой антисмысловой молекулой.

Термин «олигонуклеотид-антидот» означает соединение-антидот, включающее олигонуклеотид, который является комплементарным антисмысловому соединению и обладает способностью гибридизоваться с указанным соединением.

Термин «белок-антидот» означает соединение-антидот, содержащее пептид.

Термин «антитело» означает молекулу, характеризующуюся способностью специфически взаимодействовать с антигеном по соответствующему механизму, где определения каждого из терминов «антитело» и «антиген» взаимосвязаны друг с другом. Термин «антитело» может означать полноразмерную молекулу антитела или любой его фрагмент, или любую его область, такую как тяжелая цепь, легкая цепь, Fab-область и Fc-область.

Термин «антисмысловая активность» означает любую детектируемую или измеримую активность, направленную на гибридизацию антисмыслового соединения с его нуклеиновой кислотой-мишенью. В некоторых вариантах изобретения, антисмысловая активность означает снижение количества или уровня экспрессии нуклеиновой кислоты-мишени или белка-мишени, кодируемого такой нуклеиновой кислотой-мишенью.

Термин «антисмысловое соединение» означает олигомерное соединение, обладающее способностью гибридизоваться с нуклеиновой кислотой-мишенью посредством водородной связи.

Термин «ингибирование антисмысловым соединением» означает снижение уровней нуклеиновой кислоты-мишени или уровней белка-мишени в присутствии антисмысловоого соединения, комплементарного нуклеиновой кислоте-мишени, по сравнению с уровнями нуклеиновой кислоты-мишени или уровнями белка-мишени в отсутствии такого антисмыслового соединения.

Термин «антисмысловой олигонуклеотид» означает одноцепочечный олигонуклеотид, имеющий нуклеотидную последовательность, которая способна гибридизироваться с соответствующей областью или с соответствующим сегментом нуклеиновой кислоты-мишени.

Термин «бициклический сахар» означает фурозильное кольцо, модифицированное мостиковой связью между двумя атомами неконденсированного кольца. Бициклический сахар представляет собой модифицированный сахар.

Термин «бициклическая нуклеиновая кислота» или «БНК» означают нуклеозид или нуклеотид, где фуранозная часть нуклеозида или нуклеотида включает мостик, соединяющий два атома углерода на фуранозном кольце, образуя, тем самым, бициклическую систему.

Термины «кэп-структура» или «концевая кэп-молекула» означают химические модификации, которые были введены у любого конца антисмыслового соединения.

Термин «химически отличающаяся область» означает область антисмыслового соединения, которая по своим химическим свойствам в определенной степени отличается от другой области того же самого антисмыслового соединения. Так, например, область, имеющая 2′-O-метоксиэтил-нуклеотиды, по своим химическим свойствам отличается от области, имеющей нуклеотиды, не содержащие 2′-O-метоксиэтиловых модификаций.

Термин «химерное антисмысловое соединение» означает антисмысловое соединение, имеющее по меньшей мере две химически отличающихся области.

Термин «совместное введение» означает введение индивидууму двух или более фармацевтических средств. Два или более фармацевтических средства могут присутствовать в одной фармацевтической композиции, либо не могут присутствовать в отдельных фармацевтических композициях. Каждое из двух или более фармацевтических средств может быть введено одним и тем же или различными способами введения. Термин «совместное введение» охватывает одновременное или последовательное введение.

Термин «фактор свертывания крови» означает любой из факторов I, II, III, IV, V, VII, VIII, IX, X, XI, XII, XIII или TAFI в каскаде реакций свертывания крови. Термин «нуклеиновая кислота фактора свертывания крови» означает любую нуклеиновую кислоту, кодирующую фактор свертывания крови. Так, например, в некоторых вариантах изобретения, нуклеиновой кислотой, кодирующей фактор свертывания крови, являются, но не ограничиваются ими, последовательность ДНК, кодирующая фактор свертывания крови (включая геномную ДНК, содержащую интроны и экзоны), последовательность РНК, транскрибируемая из ДНК, кодирующей фактор свертывания крови, и последовательность мРНК, кодирующая фактор свертывания крови. Термин «мРНК фактора свертывания крови» означает мРНК, кодирующая белок фактора свертывания крови.

Термин «комплементарность» означает способность образовывать пары между нуклеотидными основаниями первой нуклеиновой кислоты и второй нуклеиновой кислоты.

Термин «смежные нуклеотидные основания» означает нуклеотидные основания, расположенные непосредственно друг за другом.

Термин «разбавитель» означает ингредиент композиции, который не обладает фармакологической активностью, но обладает необходимыми или желательными фармацевтическими свойствами. Так, например, разбавитель в композиции, вводимой путем инъекции, может представлять собой жидкость, например физиологический раствор.

Термин «доза» означает определенное количество фармацевтического средства, доставляемого путем однократного введения или введения в течение определенного периода времени. В некоторых вариантах изобретения, доза может быть введена в виде одной, двух или более болюсов, таблеток или инъекций. Так, например, в некоторых вариантах изобретения, где желательно подкожное введение, для доставки нужной дозы требуется объем, который невозможно ввести одной инъекцией, а поэтому для доставки необходимой дозы могут потребоваться две или более инъекции. В некоторых вариантах изобретения, фармацевтическое средство вводят путем вливания в течение длительного периода времени или непрерывно. Дозы могут быть определены как количество фармацевтического средства в час, в день, в неделю или в месяц.

Термин «эффективное количество» означает количество активного фармацевтического средства, достаточное для достижения желаемого физиологического эффекта у индивидуума, нуждающегося в введении такого средства. Эффективное количество может варьироваться у различных индивидуумов в зависимости от состояния здоровья и физического состояния индивидуума, подвергаемого лечению, таксономической группы индивидуумов, подвергаемых лечению, способа приготовления композиции, тяжести патологического состояния у индивидуума и других релевантных факторов.

Термин «нуклеиновая кислота фактора 11» или «нуклеиновая кислота фактора XI» или «нуклеиновая кислота F 11» или «нуклеиновая кислота F XI» означает любую нуклеиновую кислоту, кодирующую фактор 11. Так, например, в некоторых вариантах изобретения, нуклеиновая кислота фактора 11 включает последовательность ДНК, кодирующую фактор 11, последовательность РНК, транскрибируемую из ДНК, кодирующей фактор 11 (включая геномную ДНК, содержащую интроны и экзоны), и последовательность мРНК, кодирующую фактор 11. Термин «мРНК фактора 11» означает мРНК, кодирующую белок фактора 11.

Термин «специфический ингибитор фактора 11» означает любой агент, обладающий способностью специфически ингибировать экспрессию мРНК фактора 11 и/или белка фактора 11 на молекулярном уровне. Так, например, специфическими ингибиторами фактора 11 являются нуклеиновые кислоты (включая антисмысловые соединения), пептиды, антитела, небольшие молекулы и другие агенты, обладающие способностью ингибировать экспрессию мРНК фактора 11 и/или белка фактора 11. В некоторых вариантах изобретения, специфические ингибиторы фактора 11, благодаря их способности специфически модулировать экспрессию мРНК фактора 11 и/или экспрессию белка фактора 11, могут оказывать влияние на другие компоненты каскада реакций свертывания крови, включая компоненты, участвующие в последующем пути этих реакций. Аналогичным образом, в некоторых вариантах изобретения, специфические ингибиторы фактора 11 могут влиять и на другие молекулярные процессы у животного.

Термин «специфический антидот ингибитора фактора 11» означает соединение, обладающее способностью ослаблять действие специфического ингибитора фактора 11. В некоторых вариантах изобретения, антидот специфического ингибитора фактора 11 выбран из пептида фактора 11; олигонуклеотида-антидота фактора 11, включая соединение-антидот фактора 11, комплементарное антисмысловому соединению фактора 11, и любого соединения или белка, влияющего на внутренний или внешний путь каскада реакций свертывания крови.

Термин «полностью комплементарный» или «комплементарный на 100%» означает, что каждое нуклеотидное основание первой нуклеиновой кислоты комплементарно нуклеотидному основанию второй нуклеиновой кислоты. В некоторых вариантах изобретения, первой нуклеиновой кислотой является антисмысловое соединение, а нуклеиновой кислотой-мишенью является вторая нуклеиновая кислота.

Термин «гэпмер» означает химерное антисмысловое соединение, в котором внутренняя область, имеющая множество нуклеозидов, обеспечивающих расщепление РНКазой H, расположена между внешними областями, имеющими один или более нуклеозидов, где указанные нуклеозиды, составляющие внутреннюю область, по своим химическим свойствам отличаются от нуклеозида или нуклеозидов, составляющих внешние области. Внутренняя область может называться «гэп-сегментом», а внешние области могут называться «сегментами-крыльями».

Термин «уширенный гэп» означает химерное антисмысловое соединение, имеющее гэп-сегмент длиной в 12 или более смежных 2′-дезоксирибонуклеозидов, расположенных между 5′- и 3′-сегментами-крыльями, имеющими от одного до шести нуклеозидов, и непосредственно смежных с этими сегментами.

Термин «гибридизация» означает отжиг комплементарных молекул нуклеиновой кислоты. В некоторых вариантах изобретения, комплементарными молекулами нуклеиновой кислоты являются антисмысловое соединение и нуклеиновая кислота-мишень.

Термин «идентификация животного с риском развития тромбоэмболических осложнений» означает идентификацию животного, у которого было диагностировано тромбоэмболическое осложнение, или идентификацию животного с предрасположенностью к развитию тромбоэмболического осложнения. Индивидуумами с предрасположенностью к развитию тромбоэмболического осложнения являются индивидуумы с одним или более факторами риска развития тромбоэмболических осложнений, включая неподвижный образ жизни, хирургическую операцию (а в частности, ортопедическую хирургическую операцию), злокачественную опухоль, беременность, возрастные изменения, применение пероральных контрацептивов, и наследуемые или приобретенные расстройства, ассоциированные с образованием протромботических сгустков. Такая идентификация может быть осуществлена любым методом, включая ознакомление с историей болезни пациента и стандартные клинические испытания или анализы.

Термин «непосредственно смежный» означает, что между непосредственно смежными элементами отсутствуют какие-либо встроенные элементы.

Термин «индивидуум» относится к человеку или к животному, не являющемуся человеком, которые были отобраны для лечения или терапии.

Термин «межнуклеозидная связь» означает химическую связь между нуклеозидами.

Термин «связанные нуклеозиды» означает смежные нуклеозиды, связанные друг с другом.

Термин «несоответствующее» или «некомплементарное нуклеотидное основание» означает нуклеотидное основание первой нуклеиновой кислоты, не обладающее способностью спариваться с соответствующим нуклеотидным основанием второй нуклеиновой кислоты или нуклеиновой кислоты-мишени.

Термин «модифицированная межнуклеозидная связь» означает замену или любую модификацию природной межнуклеозидной связи (то есть, фосфодиэфирной межнуклеозидной связи).

Термин «модифицированное нуклеотидное основание» означает любое нуклеотидное основание, за исключением аденина, цитозина, гуанина, тимидина или урацила. Термин «немодифицированное нуклеотидное основание» означает пуриновые основания, такие как аденин (А) и гуанин (G), и пиримидиновые основания, такие как тимин (T), цитозин (C) и урацил (U).

Термин «модифицированный нуклеотид» означает нуклеотид, имеющий, независимо, модифицированную сахарную группу, модифицированную межнуклеозидную связь или модифицированное нуклеотидное основание. Термин «модифицированный нуклеозид» означает нуклеозид, имеющий, независимо, модифицированную сахарную группу или модифицированное нуклеотидное основание.

Термин «модифицированный олигонуклеотид» означает олигонуклеотид, включающий модифицированную межнуклеозидную связь, модифицированный сахар или модифицированное нуклеотидное основание.

Термин «модифицированный сахар» означает природный сахар с замещением или модификацией.

Термин «мотив» означает набор химических отличающихся областей, присутствующих в антисмысловом соединении.

Термин «природная межнуклеозидная связь» означает фосфодиэфирную 3′- 5′-связь.

Термин «природная сахарная группа» означает сахар, присутствующий в ДНК (2′-H) или РНК (2′-OH).

Термин «нуклеиновая кислота» означает молекулы, состоящие из мономерных нуклеотидов. Нуклеиновыми кислотами являются рибонуклеиновые кислоты (РНК), дезоксирибонуклеиновые кислоты (ДНК), одноцепочечные нуклеиновые кислоты, двухцепочечные нуклеиновые кислоты, короткие интерферирующие рибонуклеиновые кислоты (киРНК) и микроРНК (миРНК).

Термин «нуклеотидное основание» означает гетероциклическую молекулу, способную спариваться с основанием другой нуклеиновой кислоты.

Термин «последовательность нуклеотидных оснований» означает порядок расположения смежных нуклеотидных оснований независимо от каких-либо модификаций сахаров, связей или нуклеотидных оснований.

Термин «нуклеозид» означает нуклеотидное основание, связанное с сахаром.

Термин «нуклеозидный миметик» включает структуры, используемые для замены сахара или сахара и основания и, необязательно, связи в одном или нескольких положениях олигомерного соединения, например, такие структуры, как нуклеозидные миметики, имеющие морфолино, циклогексенил, циклогексил, тетрагидропиранил; и бициклические или трициклические сахарные миметики, например не фуранозные сахарные звенья. Нуклеотидными миметиками являются структуры, используемые для замены нуклеозида и связи в одном или нескольких положениях олигомерного соединения, например, такие как связанные с пептидом нуклеиновые кислоты или морфолино-связи (морфолино-группы, связанные -N(H)-C(=O)-O-связью или другой нефосфодиэфирной связью). Термин «сахарный суррогат» перекрывается с несколько более широким термином «нуклеозидный миметик», но указывает только на замену сахарного звена (фуранозного кольца). Используемые здесь тетрагидропиранильные кольца приводятся в иллюстративных целях, лишь в качестве примера сахарного суррогата, где фуранозная сахарная группа была заменена тетрагидропиранильной циклической системой.

Термин «нуклеотид» означает нуклеозид, имеющий фосфатную группу, ковалентно связанную с сахарной частью нуклеозида.

Термин «олигомерное соединение» или «олигомер» означает полимер, состоящий из мономерных связанных субъединиц, способных гибридизироваться по меньшей мере с одной областью молекулы нуклеиновой кислоты.

Термин «олигонуклеотид» означает полимер из связанных нуклеозидов, каждый из которых, независимо друг от друга, может быть модифицированным или немодифицированным.

Термин «парентеральное введение» означает введение путем инъекции или вливания. Парентеральным введением является подкожное введение, внутривенное введение, внутримышечное введение, внутриартериальное введение, внутрибрюшинное введение или внутричерепное введение, например интратекальное введение или интрацеребровентрикулярное введение.

Термин «пептид» означает молекулу, образованную посредством связывания по меньшей мере двух аминокислот амидными связями. Термин «пептид» относится к полипептидам и белкам.

Термин «фармацевтическая композиция» означает смесь веществ, подходящих для введения индивидууму. Так, например, фармацевтическая композиция может содержать одно или несколько активных фармацевтических средств и стерильный водный раствор.

Термин «фармацевтически приемлемые соли» означает физиологически и фармацевтически приемлемые соли антисмысловых соединений, то есть, соли, которые сохраняют нужную биологическую активность родительского олигонуклеотида и не дают каких-либо нежелательных токсических эффектов.

Термин «фосфортиоатная связь» означает связь между нуклеозидами, где указанную фосфодиэфирную связь модифицируют путем замещения одного немостикового атома кислорода атомом серы. Фосфортиоатная связь (P=S) представляет собой модифицированную межнуклеозидную связь.

Термин «часть» означает определенное число смежных (то есть, связанных) нуклеотидных оснований нуклеиновой кислоты. В некоторых вариантах изобретения, термин «часть» означает определенное число смежных нуклеотидных оснований нуклеиновой кислоты-мишени. В некоторых вариантах изобретения, термин «часть» означает определенное число смежных нуклеотидных оснований антисмыслового соединения.

Термин «предупреждение» означает замедление или предотвращение начала или развития заболевания, расстройства или состояния на период времени от нескольких минут и до конца жизни. Термин «предупреждение» также означает снижение риска развития заболевания, расстройства или состояния.

Термин «пролекарство» означает терапевтическое средство, полученное в неактивной форме, которая затем превращается в активную форму в организме или в клетках под действием эндогенных ферментов или других химических соединений или в других условиях.

Термин «побочные эффекты» означает физиологические ответы, вырабатывающиеся в процессе лечения и являющиеся нежелательными эффектами. В некоторых вариантах изобретения, побочными эффектами являются реакции, возникающие в области инъекции; нарушения функции печени, выявленные в результате обследования; нарушения функции почек; гепатотоксичность; токсическое действие на почки; нарушения функции центральной нервной системы; миопатии; и недомогания. Так, например, на гепатотоксичность или нарушение функции печени могут указывать повышенные уровни аминотрансферазы в сыворотке. Так, например, на гепатотоксичность и нарушения функции печени могут указывать повышенные уровни билирубина.

Термин «одноцепочечный олигонуклеотид» означает олигонуклеотид, который не гибридизуется с комплементарной цепью.

Термин «специфически гибридизующийся» относится к антисмысловому соединению, в котором степень комплементарности между антисмысловым олигонуклеотидом и нуклеиновой кислотой-мишенью является достаточной для достижения желаемого эффекта, но при этом оказывает минимальное действие или вообще не оказывает какого-либо действия на нуклеиновые кислоты, не являющиеся мишенями, в условиях, при которых такое специфическое связывание является желательным, то есть в физиологических условиях при проведении in vivo анализов и терапевтического лечения.

Термин «нацеливание» или «нацеленный» относится к способу конструирования и отбора антисмыслового соединения, которое будет специфически гибридизоваться с нуклеиновой кислотой-мишенью и давать желаемый эффект.

Термины «нуклеиновая кислота-мишень», «РНК-мишень» и «РНК-транскрипт, являющийся мишенью» означают нуклеиновую кислоту, на которую могут быть нацелены антисмысловые соединения.

Термин «сегмент-мишень» означает нуклеотидную последовательность нуклеиновой кислоты-мишени, на которую нацелено антисмысловое соединение. Термин «5′-сайт-мишень» означает самый крайний 5′-концевой нуклеотид сегмента-мишени. Термин «3′-сайт-мишень» означает самый крайний 3′-концевой нуклеотид сегмента-мишени.

Термин «терапевтически эффективное количество» означает количество фармацевтического средства, достаточное для достижения у индивидуума терапевтического эффекта.

Термин «тромбоэмболическое осложнение» означает любое заболевание, расстройство или состояние, приводящее к эмболии, вызываемой тромбами. Примерами таких заболеваний, расстройств и состояний являются различные категории тромбоза, эмболии и тромбоэмболии. В некоторых вариантах изобретения, такими заболеваниями, расстройствами и состояниями являются тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт.

Термин «лечение» означает введение фармацевтической композиции для положительного изменения течения заболевания, расстройства или состояния или улучшение состояния здоровья пациента при таком заболевании, расстройстве или состоянии.

Термин «немодифицированный нуклеотид» означает нуклеотид, состоящий из природных нуклеотидных оснований, сахарных групп и межнуклеозидных связей. В некоторых вариантах изобретения, немодифицированным нуклеотидом является РНК-нуклеотид (то есть β-D-рибонуклеозиды) или ДНК-нуклеотид (то есть β-D-дезоксирибонуклеозид).

Некоторые варианты осуществления изобретения

В некоторых своих вариантах настоящее изобретение относится к способам, соединениям и композициям, применяемым для снижения уровня экспрессии мРНК и белка фактора 11.

В некоторых своих вариантах настоящее изобретение относится к способам, соединениям и композициям, применяемым для лечения, предупреждения или ослабления симптомов заболеваний, расстройств и состояний, ассоциированных с фактором 11 у индивидуума, нуждающегося в этом. В настоящем изобретении также рассматриваются способы и соединения, применяемые в целях приготовления лекарственного препарата для лечения, предупреждения или ослабления симптомов заболевания, расстройства и состояния, ассоциированных с фактором 11. Заболеваниями, расстройствами или состояниями, ассоциированными с фактором 11, являются тромбоэмболические осложнения, такие как тромбоз, эмболия, тромбоэмболия, тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт.

В некоторых своих вариантах настоящее изобретение относится к применению специфического ингибитора фактора 11 для лечения, предупреждения или ослабления симптомов заболевания, ассоциированного с фактором 11. В некоторых вариантах изобретения специфическими ингибиторами фактора 11 являются нуклеиновые кислоты (включая антисмысловые соединения), пептиды, антитела, небольшие молекулы и другие средства, обладающие способностью ингибировать экспрессию мРНК фактора 11 и/или белка фактора 11.

В некоторых вариантах изобретения специфическими ингибиторами фактора 11 являются пептиды или белки, такие как, но не ограничивающиеся ими, ингибиторы протеазы альфа 1, антитромбин III, ингибиторы Cl и ингибиторы плазмина альфа 2, описанные в публикации J. Clin. Invest. 1982, 69:844-852; антитрипсин альфа 1 (альфа-1AT), описанный в публикации Thromb. Res. 1987, 48:145-151; пептидные ингибиторы фактора 11, описанные в заявке USPPN 2008/021998 и в публикации Blood 1998, 92:4198-206; MAP4-RGKWC, описанный в публикации Thromb Res 2001, 104:451-465; GPI бета-2, описанный в публикации Proc. Natl. Acad. Sci. 2004, 101:3939-44; ингибитор протеазы Lentinus, описанный в публикации Eur. J. Biochem. 1999, 262:915-923; ингибитор протеиназы нексина-2/домена предшественника амилоидного бета-белка Кунитца (APPI) и антитромбин (AT), описанные в публикации J. Biol. Chem. 2004, 279:29485-29492; и апротинин, описанный в публикации J. Biol. Chem. 2005, 280:23523-30.

В некоторых вариантах настоящего изобретения специфическими ингибиторами фактора 11 являются антитела, такие как, но не ограничивающиеся ими, антитела Winston-Salem (IgG3 каппа) и Baltimore (IgGl каппа), описанный в публикации Blood 1988, 72:1748-54; 5F4, 3Cl и IFl, описанные в публикации J. Biol. Chem. 1985, 260:10714-719; моноклональные антитела, описанные в публикации Throm Haemost 1990, 63:417-23; XI-5108, описанное в публикации J. Thromb. Haem. 2006, 4:1496-1501; моноклональные антитела 4-1, описанные в публикации Thromb. Res. 1986, 42:225-34; и антитело абциксимаб, описанное в примере 19 патента USPN 6566140.

В некоторых вариантах изобретения специфическими ингибиторами фактора 11 являются небольшие молекулы, такие как, но не ограничивающиеся ими, диизопропилфторфосфаты (DFP); низкомолекулярные ингибиторы, описанные в примерах 1-7 заявки USPPN 2004/0180855; и п-аминобензамидин (pAB), описанный в публикации J. Biol. Chem. 2005, 280:23523-30.

В некоторых своих вариантах настоящее изобретение относится к применению описанного здесь специфического ингибитора фактора 11 для лечения, предупреждения или ослабления симптомов тромбоэмболических осложнений, таких как тромбоз, эмболия, тромбоэмболия, тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт.

В некоторых своих вариантах настоящее изобретение относится к применению описанных здесь специфических ингибиторов фактора 11 в целях приготовления лекарственного препарата для лечения, ослабления симптомов или предупреждения тромбоэмболических осложнений, таких как тромбоз, эмболия, тромбоэмболия, тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт.

В некоторых своих вариантах настоящее изобретение относится к применению описанного здесь специфического ингибитора фактора 11 для лечения, предупреждения или ослабления симптомов тромбоэмболических осложнений, описанных в настоящей заявке, путем проведения комбинированной терапии вместе с дополнительным средством или дополнительной терапией, описанными в настоящей заявке. Введение лекарственных средств или проведение терапии могут быть осуществлены одновременно или последовательно.

В некоторых своих вариантах настоящее изобретение относится к применению описанного здесь специфического ингибитора фактора 11 для лечения, предупреждения или ослабления симптомов тромбоэмболических осложнений, описанных в настоящей заявке, путем проведения комбинированной терапии в сочетании с дополнительным средством или терапии, описанной в настоящей заявке. Введение лекарственных средств или проведение терапии могут быть осуществлены одновременно или последовательно.

В некоторых своих вариантах настоящее изобретение относится к применению описанного здесь специфического ингибитора фактора 11 для лечения, предупреждения или ослабления симптомов тромбоэмболических осложнений, описанных в настоящей заявке, у пациента, которому может быть затем введено дополнительное лекарственное средство или проведено лечение, как описано в настоящей заявке.

В некоторых своих вариантах, настоящее изобретение относится к набору для лечения, предупреждения или ослабления симптомов описанных здесь тромбоэмболических осложнений, где указанный набор включает: (i) описанный здесь специфический ингибитор фактора 11; и альтернативно, (ii) дополнительный агент или терапевтические средства, описанные в настоящей заявке.

Набор согласно изобретению может также включать инструкции по его применению для лечения, предупреждения или ослабления симптомов тромбоэмболических осложнений, описанных в настоящей заявке, путем проведения описанной здесь комбинированной терапии.

В некоторых своих вариантах, настоящее изобретение относится к антисмысловым соединениям, нацеленным на нуклеиновую кислоту фактора 11. В некоторых вариантах изобретения, нуклеиновой кислотой фактора 11 являются последовательность, имеющаяся в базе данных GENBANK рег. № NM_000128.3 (представленная здесь как SEQ ID NO:1); последовательность, имеющаяся в базе данных GENBANK рег. № NT_022792.17 и усеченная в пределах от 19598000 до 19624000, (представленная здесь как SEQ ID NO:2); последовательность, имеющаяся в базе данных GENBANK рег. № NM_028066.1 (представленная здесь как SEQ ID NO:6); экзоны 1-15 последовательности, имеющейся в базе данных GENBANK рег. № NW_001118167.1 (представленной здесь как SEQ ID NO:274).

В некоторых своих вариантах, настоящее изобретение относится к соединению, содержащему модифицированный олигонуклеотид. В некоторых вариантах изобретения, соединение согласно изобретению содержит модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов.

В некоторых вариантах изобретения, соединение согласно изобретению может включать модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. В некоторых вариантах изобретения, соединение согласно изобретению может включать модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину.

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 656-676 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 656-676 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 665-687 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных частей последовательности нуклеотидных оснований 665-687 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 675-704 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 675-704 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 677-704 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 677-704 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 678-697 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 678-697 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 70% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 680-703 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 680-703 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3 и в примере 30).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 683-702 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарной части последовательности нуклеотидных оснований 683-702 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 738-759 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 738-759 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3 и в примере 30).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 738-760 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 738-760 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 60% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 738-762 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 738-762 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 45% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1018-1042 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1018-1042 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1062-1089 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1089 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 70% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1062-1090 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1090 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 60% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1062-1091 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1091 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 20% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1275-1301 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1091 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1276-1301 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1091 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 30).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1284-1308 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1091 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1291-1317 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1062-1091 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединению, включающему модифицированный олигонуклеотид, содержащий нуклеотидную последовательность, комплементарную по меньшей мере части последовательности нуклеотидных оснований 1275-1318 SEQ ID NO:1. Указанный модифицированный олигонуклеотид может содержать по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований, комплементарных части последовательности нуклеотидных оснований 1275-1318 SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, или по меньшей мере на 99% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может содержать нуклеотидную последовательность, которая на 100% комплементарна части последовательности SEQ ID NO:1, имеющей такую же длину. Указанный модифицированный олигонуклеотид может по меньшей мере на 70% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых своих вариантах, настоящее изобретение относится к соединениям, включающим модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-241.

В некоторых своих вариантах, настоящее изобретение относится к соединениям, включающим модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-269.

В некоторых своих вариантах, настоящее изобретение относится к соединениям, включающим модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:242-269.

В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, или по меньшей мере 18 нуклеотидных оснований нуклеотидной последовательности, выбранной из ISIS NO:22, 31, 32, 34, 36-38, 40, 41, 43, 51-53, 55, 56, 59, 60, 64, 66, 71, 73, 75, 96, 98-103, 105-109, 113-117, 119, 124, 127, 129, 171, 172, 174, 176, 178, 179, 181-197, 199-211 и 213-232. В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO:22, 31, 32, 34, 36-38, 40, 41, 43, 51-53, 55, 56, 59, 60, 64, 66, 71, 73, 75, 96, 98-103, 105-109, 113-117, 119, 124, 127, 129, 171, 172, 174, 176, 178, 179, 181-197, 199-211 и 213-232. В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из нуклеотидной последовательности, выбранной из SEQ ID NO:22, 31, 32, 34, 36-38, 40, 41, 43, 51-53, 55, 56, 59, 60, 64, 66, 71, 73, 75, 96, 98-103, 105-109, 113-117, 119, 124, 127, 129, 171, 172, 174, 176, 178, 179, 181-197, 199-211 и 213-232. Указанный модифицированный олигонуклеотид может по меньшей мере на 70% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, или по меньшей мере 18 нуклеотидных оснований нуклеотидной последовательности, выбранной из ISIS NO:22, 31, 34, 37, 40, 43, 51-53, 60, 98, 100-102, 105-109, 114, 115, 119, 171, 174, 176, 179, 181, 186, 188-193, 195, 196, 199-210 и 213-232. В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO:22, 31, 34, 37, 40, 43, 51-53, 60, 98, 100-102, 105-109, 114, 115, 119, 171, 174, 176, 179, 181, 186, 188-193, 195, 196, 199-210 и 213-232. В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из нуклеотидной последовательности, выбранной из SEQ ID NO:22, 31, 34, 37, 40, 43, 51-53, 60, 98, 100-102, 105-109, 114, 115, 119, 171, 174, 176, 179, 181, 186, 188-193, 195, 196, 199-210 и 213-232. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, или по меньшей мере 18 нуклеотидных оснований нуклеотидной последовательности, выбранной из ISIS NO:31, 37, 100, 105, 179, 190-193, 196, 202-207, 209, 210, 214-219, 221-224, 226, 227, 229 и 231. В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO:31, 37, 100, 105, 179, 190-193, 196, 202-207, 209, 210, 214-219, 221-224, 226, 227, 229 и 231. В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из нуклеотидной последовательности, выбранной из SEQ ID NO:31, 37, 100, 105, 179, 190-193, 196, 202-207, 209, 210, 214-219, 221-224, 226, 227, 229 и 231. Указанный модифицированный олигонуклеотид может по меньшей мере на 90% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 3).

В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, или по меньшей мере 18 нуклеотидных оснований нуклеотидной последовательности, выбранной из SEQ ID NO:34, 52, 53, 114, 115, 190, 213-232, 242-260 и 262-266. В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO:34, 52, 53, 114, 115, 190, 213-232, 242-260 и 262-266. В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из нуклеотидной последовательности, выбранной из SEQ ID NO:34, 52, 53, 114, 115, 190, 213-232, 242-260 и 262-266. Указанный модифицированный олигонуклеотид может по меньшей мере на 70% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 30).

В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, или по меньшей мере 18 нуклеотидных оснований нуклеотидной последовательности, выбранной из SEQ ID NO:34, 52, 53, 114, 115, 190, 213-216, 218-226, 243-246, 248, 249, 252-259, 264 и 265. В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO:34, 52, 53, 114, 115, 190, 213-216, 218-226, 243-246, 248, 249, 252-259, 264 и 265. В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из нуклеотидной последовательности, выбранной из SEQ ID NO:34, 52, 53, 114, 115, 190, 213-216, 218-226, 243-246, 248, 249, 252-259, 264 и 265. Указанный модифицированный олигонуклеотид может по меньшей мере на 80% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 30).

В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, или по меньшей мере 18 нуклеотидных оснований нуклеотидной последовательности, выбранной из SEQ ID NO:34, 190, 215, 222, 223, 226, 246 и 254. В некоторых вариантах изобретения, модифицированный олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO:34, 190, 215, 222, 223, 226, 246 и 254. В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из нуклеотидной последовательности, выбранной из SEQ ID NO:34, 190, 215, 222, 223, 226, 246 и 254. Указанный модифицированный олигонуклеотид может по меньшей мере на 90% снижать уровни человеческой мРНК, как было определено с применением аналитического ОТ-ПЦР-метода, необязательно, в клетках HepG2 (например, как описано в примере 30).

В некоторых вариантах изобретения, указанное соединение состоит из одноцепочечного модифицированного олигонуклеотида.

В некоторых вариантах изобретения, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов.

В некоторых вариантах изобретения, нуклеотидная последовательность модифицированного олигонуклеотида на 100% комплементарна нуклеотидной последовательности SEQ ID NO:1 или SEQ ID NO:2 или SEQ ID NO:6 или SEQ ID NO:274.

В некоторых вариантах изобретения, указанное соединение имеет по меньшей мере одну модифицированную межнуклеозидную связь. В некоторых вариантах изобретения, указанной межнуклеозидной связью является фосфортиоатная межнуклеозидная связь.

В некоторых вариантах изобретения, указанное соединение имеет по меньшей мере один нуклеозид, содержащий модифицированный сахар. В некоторых вариантах изобретения, по меньшей мере одним модифицированным сахаром является бициклический сахар. В некоторых вариантах изобретения, по меньшей мере один модифицированный сахар содержит 2'-O-метоксиэтил.

В некоторых своих вариантах, настоящее изобретение относится к соединениям, включающим модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-241, SEQ ID NO:15-269 или SEQ ID NO:242-269, где по меньшей мере один нуклеозид содержит модифицированный сахар.

В некоторых вариантах изобретения, указанным по меньшей мере одним модифицированным сахаром является бициклический сахар.

В некоторых вариантах изобретения, указанный по меньшей мере один бициклический сахар содержит 4′-(CH2)n-O-2′-мостик, где n равно 1 или 2.

В некоторых вариантах изобретения, указанный по меньшей мере один бициклический сахар содержит 4′-CH(CH3)-O-2′-мостик.

В некоторых вариантах изобретения, указанный по меньшей мере один модифицированный сахар содержит 2′-O-метоксиэтильную группу.

В некоторых своих вариантах, настоящее изобретение относится к соединениям, включающим модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-241, SEQ ID NO:15-269 или SEQ ID NO:242-269, где указанное соединение включает по меньшей мере один модифицированный тетрагидропираном нуклеозид, в котором фуранозное кольцо заменено тетрагидропирановым кольцом.

В некоторых вариантах изобретения, указанный по меньшей мере один нуклеозид, модифицированный тетрагидропираном, имеет структуру:

В некоторых вариантах изобретения, указанное соединение имеет по меньшей мере один нуклеозид, содержащий модифицированное нуклеотидное основание. В некоторых вариантах изобретения, модифицированным нуклеотидным основанием является 5-метилцитозин.

В некоторых вариантах изобретения, модифицированный олигонуклеотид указанного соединения включает:

(i) гэп-сегмент, состоящий из связанных дезоксинуклеозидов;

(ii) 5′-сегмент-крыло, состоящий из связанных нуклеозидов;

(iii) 3′-сегмент-крыло, состоящий из связанных нуклеозидов, где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами, и где каждый нуклеозид каждого сегмента-крыла содержит модифицированный сахар. В некоторых таких вариантах, каждый цитозин в модифицированном олигонуклеотиде представляет собой 5-метилцитозин.

В некоторых вариантах изобретения, модифицированный олигонуклеотид указанного соединения включает:

(i) гэп-сегмент, состоящий из десяти связанных дезоксинуклеозидов;

(ii) 5′-сегмент-крыло, состоящий из пяти связанных нуклеозидов;

(iii) 3′-сегмент-крыло, состоящий из пяти связанных нуклеозидов, где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами, и где каждый нуклеозид каждого сегмента-крыла содержит 2′-O-метоксиэтилированный сахар; и где каждой межнуклеозидной связью является фосфортиоатная связь. В некоторых таких вариантах, каждый цитозин в модифицированном олигонуклеотиде представляет собой 5-метилцитозин.

В некоторых вариантах изобретения, модифицированный олигонуклеотид указанного соединения включает:

(i) гэп-сегмент, состоящий из четырнадцати связанных дезоксинуклеозидов;

(ii) 5′-сегмент-крыло, состоящий из трех связанных нуклеозидов;

(iii) 3′-сегмент-крыло, состоящий из трех связанных нуклеозидов, где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами, и где каждый нуклеозид каждого сегмента-крыла содержит 2′-O-метоксиэтилированный сахар; и где каждой межнуклеозидной связью является фосфортиоатная связь. В некоторых таких вариантах, каждый цитозин в модифицированном олигонуклеотиде представляет собой 5-метилцитозин.

В некоторых вариантах изобретения, модифицированный олигонуклеотид указанного соединения включает:

(i) гэп-сегмент, состоящий из тринадцати связанных дезоксинуклеозидов;

(ii) 5′-сегмент-крыло, состоящий из двух связанных нуклеозидов;

(iii) 3′-сегмент-крыло, состоящий из пяти связанных нуклеозидов, где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами, и где каждый нуклеозид каждого сегмента-крыла содержит 2′-O-метоксиэтилированный сахар; и где каждой межнуклеозидной связью является фосфортиоатная связь. В некоторых таких вариантах, каждый цитозин в модифицированном олигонуклеотиде представляет собой 5-метилцитозин.

В некоторых своих вариантах, настоящее изобретение относится к композиции, содержащей модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 12 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-241, или его соли, и фармацевтически приемлемый носитель или разбавитель.

В некоторых своих вариантах, настоящее изобретение относится к композиции, содержащей модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 12 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-269, или его соли, и фармацевтически приемлемый носитель или разбавитель.

В некоторых своих вариантах, настоящее изобретение относится к композиции, содержащей модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 12 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:241-269, или его соли, и фармацевтически приемлемый носитель или разбавитель.

В некоторых своих вариантах, настоящее изобретение относится к способам, включающим введение животному соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-241.

В некоторых своих вариантах, настоящее изобретение относится к способам, включающим введение животному соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:15-269.

В некоторых своих вариантах, настоящее изобретение относится к способам, включающим введение животному соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий нуклеотидную последовательность, содержащую по меньшей мере 8 смежных нуклеотидных оснований нуклеотидной последовательности, выбранной из нуклеотидных последовательностей, представленных в SEQ ID NO:241-269.

Указанным животным является человек.

В некоторых вариантах изобретения, указанное введение предотвращает тромбоз глубокой вены или эмболию легких.

В некоторых вариантах изобретения, указанное соединение вводят вместе с любым соединением, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана и LOVENOX.

В некоторых вариантах изобретения, указанное соединение вводят вместе с любым ингибитором фактора Xa.

В некоторых вариантах изобретения, ингибитором фактора Xa является любое из таких соединений, как ривароксабан, LY517717, YM150, апиксабан, PRT054021 и DU-176b.

В некоторых вариантах изобретения, указанное соединение вводят одновременно с любым соединением, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана и LOVENOX.

В некоторых вариантах изобретения, указанным введением является парентеральное введение. В некоторых вариантах изобретения, указанным парентеральным введением является подкожное или внутривенное введение.

В некоторых своих вариантах, настоящее изобретение относится к способам, включающим идентификацию животного с риском развития тромбоэмболических осложнений и введение указанному животному терапевтически эффективного количества соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов, где указанный модифицированный олигонуклеотид является комплементарным нуклеиновой кислоте фактора 11.

В некоторых вариантах изобретения, тромбоэмболическими осложнениями являются тромбоз глубокой вены, эмболия легких или их комбинация.

В некоторых своих вариантах, настоящее изобретение относится к способам, включающим идентификацию животного, страдающего нарушением свертывания крови, путем введения указанному животному терапевтически эффективного количества соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов, где указанный модифицированный олигонуклеотид является комплементарным нуклеиновой кислоте фактора 11.

В некоторых вариантах изобретения, указанное соединение вводят вместе с любым соединением, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана и LOVENOX.

В некоторых вариантах изобретения, указанное соединение вводят одновременно с любым соединением, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана и LOVENOX.

В некоторых своих вариантах, настоящее изобретение относится к способам снижения риска развития тромбоэмболических осложнений у животного путем введения указанному животному терапевтически эффективного количества соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов, где указанный модифицированный олигонуклеотид является комплементарным нуклеиновой кислоте фактора 11.

В некоторых своих вариантах, настоящее изобретение относится к способам лечения нарушения свертывания крови путем введения указанному животному терапевтически эффективного количества соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов, где указанный модифицированный олигонуклеотид является комплементарным нуклеиновой кислоте фактора 11.

В некоторых своих вариантах, настоящее изобретение относится к способам ингибирования экспрессии фактора 11 у животного путем введения указанному животному терапевтически эффективного количества соединения, содержащего модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов, где указанный модифицированный олигонуклеотид является комплементарным нуклеиновой кислоте фактора 11.

В некоторых вариантах изобретения, ингибирование фактора 11 у животного блокируют путем введения антидота, нацеленного против модифицированного олигонуклеотида.

В некоторых вариантах изобретения, указанным антидотом является олигонуклеотид, комплементарный модифицированному олигонуклеотиду.

Антисмысловые соединения

Олигомерными соединениями являются, но не ограничиваются ими, олигонуклеотиды, олигонуклеозиды, олигонуклеотидные аналоги, олигонуклеотидные миметики, антисмысловые соединения, антисмысловые олигонуклеотиды и киРНК. Олигомерное соединение может быть «антисмысловым» по отношению к нуклеиновой кислоте-мишени, что означает, что это соединение обладает способностью гибридизироваться с нуклеиновой кислотой-мишенью посредством водородных связей.

В некоторых вариантах изобретения, антисмысловое соединение имеет нуклеотидную последовательность, которая, при ее записи в направлении 5′ → 3′, содержит обратный комплемент сегмента-мишени целевой нуклеиновой кислоты, на которую нацелено это соединение. В некоторых таких вариантах, антисмысловой олигонуклеотид имеет нуклеотидную последовательность, которая, при ее записи в направлении 5′ → 3′, содержит обратный комплемент сегмента-мишени целевой нуклеиновой кислоты, на которую нацелен этот олигонуклеотид.

В некоторых вариантах изобретения, антисмысловое соединение, нацеленное против нуклеиновой кислоты фактора 11, имеет длину в 12-30 субъединиц. Другими словами, указанные антисмысловые соединения имеют от 12 до 30 связанных субъединиц. В других вариантах изобретения, указанное антисмысловое соединение имеет 8-80, 12-50, 15-30, 18-24, 19-22 или 20 связанных субъединиц. В некоторых таких вариантах, указанные антисмысловые соединения имеют длину в 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 связанных субъединиц или длину в интервале, определенном любыми двумя из вышеуказанных значений. В некоторых вариантах изобретения, антисмысловое соединение представляет собой антисмысловой олигонуклеотид, а связанные субъединицы представляют собой нуклеотиды.

В некоторых вариантах изобретения, антисмысловые олигонуклеотиды, нацеленные против нуклеиновой кислоты фактора 11, могут быть укороченными или усеченными. Так, например, одна субъединица может быть делетирована у 5′-конца (усечение по 5′-концу), или альтернативно, у 3′-конца (усечение по 3′-концу). Укороченное или усеченное антисмысловое соединение, нацеленное против нуклеиновой кислоты фактора 11, может иметь делецию у 5′-конца в две субъединицы или, альтернативно, оно может иметь делецию у 3′-конца в две субъединицы. Альтернативно, делетированные нуклеозиды могут быть распределены по всему антисмысловому соединению, например, в данном антисмысловом соединении, один нуклеозид может быть делетирован у 5′-конца, а один нуклеозид может быть делетирован у 3′-конца.

Если в удлиненном антисмысловом соединении присутствует одна дополнительная субъединица, то такая дополнительная субъединица может быть локализована у 5′- или 3′-конца антисмыслового соединения. Если присутствуют две или более дополнительные субъединицы, то такие дополнительные субъединицы могут быть смежными друг с другом, например, в указанном антисмысловом соединении, две субъединицы могут быть добавлены у 5′-конца (5′-добавление) или, альтернативно, у 3′-конца (3′-добавление). Альтернативно, добавленные субъединицы могут быть распределены по всему антисмысловому соединению, например, в данном антисмысловом соединении, одна субъединица может быть добавлена у 5′-конца, а одна субъединица может быть добавлена у 3′-конца.

Длина антисмыслового соединения, такого как антисмысловой олигонуклеотид, может быть увеличена или уменьшена, и/или в него могут быть введены несоответствующие основания с сохранением активности. Так, например, как описано в публикации Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), серию антисмысловых олигонуклеотидов длиной в 13-25 нуклеотидных оснований тестировали на способность индуцировать расщепление РНК-мишени в модели с инъекцией в ооцит. Антисмысловые олигонуклеотиды длиной в 25 нуклеотидных оснований, где у их концов имеются 8 или 11 несоответствующих оснований, обладали способностью направлять специфическое расщепление мРНК-мишени, хотя и в меньшей степени, чем антисмысловые олигонуклеотиды, не содержащие таких несоответствий. Аналогичным образом, специфическое расщепление мишени достигалось с использованием антисмысловых олигонуклеотидов длиной в 13 нуклеотидных оснований, включая 1 или 3 несоответствия.

В публикации Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) была продемонстрирована способность олигонуклеотида, который является на 100% комплементарным мРНК bcl-2 и имеет 3 несоответствия по сравнению с мРНК bcl-xL, снижать уровень экспрессии bcl-2 и bcl-xL in vitro и in vivo. Кроме того, этот олигонуклеотид обладал сильной противоопухолевой активностью in vivo.

В публикации Maher & Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) было описано тестирование серии тандема из антисмысловых олигонуклеотидов длиной в 14 нуклеотидных оснований и антисмысловых олигонуклеотидов длиной в 28 и 42 нуклеотидных оснований, состоящей из последовательности двух или трех тандемных антисмысловых олигонуклеотидов, соответственно, на их способность прекращать трансляцию человеческой DHFR в анализе с использованием кроличьих ретикулоцитов. Каждый из трех отдельно взятых антисмысловых олигонуклеотидов длиной в 14 нуклеотидных оснований обладал способностью ингибировать трансляцию, хотя и в несколько меньшей степени, чем антисмысловые олигонуклеотиды длиной в 28 или 42 нуклеотидных основания.

Мотивы антисмысловых соединений

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные против нуклеиновой кислоты фактора 11, имеют химически модифицированные субъединицы, организованные в паттерны или мотивы, которые сообщают указанным антисмысловым соединениям такие свойства, как повышенная ингибирующая активность, повышенная аффинность связывания с нуклеиновой кислотой-мишенью или резистентность к разложению in vivo под действием нуклеаз.

Химерные антисмысловые соединения обычно содержат по меньшей мере одну область, модифицированную так, чтобы она сообщала повышенную резистентность к разложению нуклеазой, повышенную способность к поглощению клетками, повышенную аффинность связывания с нуклеиновой кислотой-мишенью и/или повышенную ингибирующую активность. Вторая область химерного антисмыслового соединения может служить, но необязательно, в качестве субстрата для клеточной эндонуклеазы РНКазы Н, которая расщепляет РНК-цепь дуплекса РНК:ДНК.

Рассматриваемыми химерными антисмысловыми соединениями являются антисмысловые соединения, имеющие гэпмерный мотив. В гэпмере, внутренняя область, имеющая множество нуклеотидов, сообщающих способность к расщеплению РНказой Н, расположена между внешними областями, имеющими множество нуклеотидов, которые по своим химическим свойствам отличаются от нуклеозидов внутренней области. В случае антисмыслового олигонуклеотида, имеющего гэпмерный мотив, гэп-сегмент обычно служит в качестве субстрата для расщепления эндонуклеазой, а сегменты-крылья содержат модифицированные нуклеозиды. В некоторых вариантах изобретения, области гэпмера отличаются типами сахарных групп, составляющих каждую такую отличающуюся область. В некоторых вариантах изобретения, типами сахарных групп, используемыми для дифференциации областей гэпмера, могут быть β-D-рибонуклеозиды, β-D-дезоксирибонуклеозиды, 2′-модифицированные нуклеозиды (такими 2'-модифицированными нуклеозидами могут быть 2′-MOE и 2′-О-CH3 и т.п.) и нуклеозиды, модифицированные бициклическим сахаром (такими нуклеозидами, модифицированными бициклическим сахаром, могут быть нуклеозиды, имеющие 4′-(CH2)n-O-2′-мостик, где n=1 или n=2). Каждая отдельная область предпочтительно, содержит одинаковые сахарные группы. Мотив «крыло-гэп-крыло» часто обозначается «X-Y-Z», где «X» означает длину области 5′-крыла, «Y» означает длину гэп-области, а «Z» означает длину области 3′-крыла. Используемый здесь гэпмер, обозначенный «X-Y-Z», имеет такую конфигурацию, при которой гэп-сегмент является непосредственно смежным с сегментом 5′-крыла и с сегментом 3′-крыла. Таким образом, между сегментом 5′-крыла и гэп-сегментом или гэп-сегментом и сегментом 3′-крыла отсутствуют какие-либо встроенные нуклеотиды. Любое из описанных здесь антисмысловых соединений может иметь гэпмерный мотив. В некоторых вариантах изобретения, X и Z являются одинаковыми, а в других вариантах они являются различными. В предпочтительном варианте изобретения, Y представляет собой область длиной в 8-15 нуклеотидов. X, Y или Z могут представлять собой любые области из 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 или более нуклеотидов. Таким образом, гэпмерами согласно изобретению являются, но не ограничиваются ими, например, 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 5-8-5 или 6-8-6.

В некоторых вариантах изобретения, антисмысловые соединения содержат мотив «крыло»-мер, имеющий конфигурацию крыло-гэп или гэп-крыло, то есть конфигурацию X-Y или Y-Z, описанную выше для гэпмерной конфигурации. Таким образом, «крыло»-мерными конфигурациями согласно изобретению являются, но не ограничиваются ими, например, конфигурации 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8 или 6-8.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, имеют гэпмерный мотив 5-10-5.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, имеют гэпмерный мотив 3-14-3.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, имеют гэпмерный мотив 2-13-5.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, имеют гэпмерный мотив 5-8-5.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, имеют гэпмерный мотив 6-8-6.

В некоторых вариантах изобретения, антисмысловое соединение, нацеленные на нуклеиновую кислоту фактора 11, имеет мотив с уширенным гэпом.

В некоторых вариантах изобретения, антисмысловой олигонуклеотид с уширенным гэпом, нацеленный против нуклеиновой кислоты фактора 11, имеет гэп-сегмент из четырнадцати 2'-дезоксирибонуклеотидов, расположенных между сегментами-крыльями, состоящими из трех химически модифицированных нуклеозидов и непосредственно смежных с этими сегментами. В некоторых вариантах изобретения, указанная химическая модификация включает 2′-сахарную модификацию. В другом варианте изобретения, указанная химическая модификация включает 2′-MOE-сахарную модификацию.

В некоторых вариантах изобретения, антисмысловой олигонуклеотид с уширенным гэпом, нацеленный против нуклеиновой кислоты фактора 11, имеет гэп-сегмент из тринадцати 2′-дезоксирибонуклеотидов, расположенных между 5′-сегментом-крылом, состоящим из трех химически модифицированных нуклеозидов, и 3′-сегментом-крылом, состоящим из пяти химически модифицированных нуклеозидов, и непосредственно смежных с этими сегментами. В некоторых вариантах изобретения, указанная химическая модификация включает 2′-сахарную модификацию. В другом варианте изобретения, указанная химическая модификация включает 2′-MOE-сахарную модификацию.

Нуклеиновые кислоты-мишени, области-мишени и нуклеотидные последовательности

Нуклеотидными последовательностями, кодирующими фактор 11, являются, но не ограничиваются ими: последовательность, впервые депонированная в GENBANK, рег. № NM_000128.3, 24 марта 1999 и представленная здесь как SEQ ID NO:1; последовательность, усеченная в пределах от 19598000 до 19624000, которая была впервые депонирована в GENBANK рег. № NT_022792.17 29 ноября 2000 и представлена здесь как SEQ ID NO:2; последовательность, впервые депонированная в GENBANK, рег. № NM_028066.1, 2 июня 2002 и представленная здесь как SEQ ID NO:6; и экзоны 1-15 последовательности, впервые депонированной в GENBANK, рег. № GENBANK NW_001118167.1, 28 марта 2006, и представленной здесь как SEQ ID NO:274.

Следует отметить, что последовательность, представленная в каждой SEQ ID NO в описанных здесь примерах, независимо представляет собой последовательность, имеющую модификацию сахарной группы, межнуклеозидной связи или нуклеотидного основания. Такие антисмысловые соединения, определенные в SEQ ID NO, могут независимо содержать одну или несколько модификаций сахарной группы, межнуклеозидной связи или нуклеотидного основания. Антисмысловые соединения, описанные под номером Isis (Isis №), представляют собой комбинацию последовательности нуклеотидных оснований и мотива.

В некоторых вариантах изобретения, областью-мишенью является область нуклеиновой кислоты-мишени с определенной структурой. Так, например, область-мишень может включать 3′UTR, 5′UTR, экзон, интрон, область стыка экзон/интрон, кодирующую область, область инициации трансляции, область терминации трансляции или другую определенную область нуклеиновой кислоты. Области фактора 11 с определенной структурой могут быть взяты из баз данных последовательностей, таких как NCBI, в которых они депонированы под соответствующим регистрационным номером, и такая информация вводится в настоящее описание посредством ссылки. В некоторых вариантах изобретения, область-мишень может включать последовательность, простирающуюся от 5′-сайта-мишени одного сегмента-мишени в области-мишени до 3′-сайта-мишени другого сегмента-мишени в той же самой области-мишени.

Термин «нацеливание» включает определение по меньшей мере одного сегмента-мишени, с которым гибридизуется антисмысловое соединение, в результате чего достигается нужный эффект. В некоторых вариантах изобретения, указанным желаемым эффектом являются снижение уровней нуклеиновой кислоты, то есть мРНК-мишени. В некоторых вариантах изобретения, желаемым эффектом являются снижение уровней белка, кодируемого нуклеиновой кислотой-мишенью, или фенотипические изменения, ассоциированные с указанной нуклеиновой кислотой-мишенью.

Область-мишень может содержать один или несколько сегментов-мишеней. Множество сегментов-мишеней в области-мишени может быть перекрывающимся. Альтернативно, такие области могут быть неперекрывающимися. В некоторых вариантах изобретения, сегменты-мишени в области-мишени отделены друг от друга не более чем примерно на 300 нуклеотидов. В некоторых вариантах изобретения, сегменты-мишени в области-мишени отделены друг от друга нуклеотидами, число которых составляет примерно, или не более чем, или примерно не более чем 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 или 10 нуклеотидов, присутствующих в нуклеиновой кислоте-мишени, или число в интервале, определенном любыми двумя из вышеуказанных величин. В некоторых вариантах изобретения, сегменты-мишени в области-мишени отделены друг от друга не более чем, или не более чем примерно 5 нуклеотидами, присутствующими в нуклеиновой кислоте-мишени. В некоторых вариантах изобретения, указанные сегменты-мишени являются смежными. В настоящем изобретении также рассматриваются области-мишени, определенные интервалом, имеющим исходную нуклеиновую кислоту, которая находится в любом положении указанного здесь 5′-сайта-мишени или 3′-сайта-мишени.

Подходящие сегменты-мишени могут присутствовать в 5′UTR, в кодирующей области, в 3′UTR, в интроне, в экзоне или в области стыка «экзон/интрон». Подходящими сегментами-мишенями также являются сегменты-мишени, содержащие старт-кодон или стоп-кодон. Подходящий сегмент-мишень может, в частности, не содержать некоторые области с определенной структурой, такие как старт-кодон или стоп-кодон.

Определение подходящих сегментов-мишеней может включать сравнение последовательности нуклеиновой кислоты-мишени с другими последовательностями, имеющимися в геноме. Так, например, для идентификации областей гомологии различных нуклеиновых кислот может быть использован алгоритм BLAST. Такое сравнение позволяет исключить отбор последовательностей антисмысловых соединений, которые могут неспецифически гибридизоваться с последовательностями, не являющимися выбранной нуклеиновой кислотой-мишенью (то есть, последовательностями, не являющимися мишенью, или нежелательными последовательностями).

Антисмысловые соединения в активной области-мишени могут отличаться по своей активности (например, определяемой по проценту снижения уровней нуклеиновой кислоты-мишени). В некоторых вариантах изобретения, снижение уровней мРНК фактора 11 является показателем ингибирования экспрессии фактора 11. Снижение уровней белка фактора 11 также является показателем ингибирования экспрессии мРНК-мишени. Кроме того, показателем ингибирования экспрессии фактора 11 являются фенотипические изменения. Так, например, показателем ингибирования экспрессии фактора 11 может служить более длительное время АПТВ (активированное парциальное тромбопластиновое время). В другом примере, показателем ингибирования экспрессии фактора 11 может служить более длительное время АПТВ в сочетании с нормальным временем ПВ. В другом примере, показателем ингибирования экспрессии фактора 11 может служить пониженное количество тромбоцитарного фактора 4 (PF-4). В другом примере, показателем ингибирования экспрессии фактора 11 может служить снижение уровня образования тромбов или увеличение времени образования тромбов.

Гибридизация

В некоторых вариантах изобретения, гибридизация происходит между антисмысловым соединением, описанным в настоящей заявке, и нуклеиновой кислотой фактора 11. Наиболее распространенный механизм гибридизации заключается в образовании водородных связей (например, водородных связей Уотсона-Крика, Хугстена или обратных водородных связей Хугстена) между комплементарными нуклеотидными основаниями молекул нуклеиновой кислоты.

Гибридизация может происходить в различных условиях. Условия жесткости зависят от последовательностей и определяются природой и составом гибридизующихся молекул нуклеиновой кислоты.

Методы идентификации специфической гибридизации последовательности с нуклеиновой кислотой-мишенью хорошо известны специалистам. В некоторых вариантах изобретения, описанные здесь антисмысловые соединения обладают способностью специфически гибридизоваться с нуклеиновой кислотой фактора 11.

Комплементарность

Антисмысловое соединение и нуклеиновая кислота-мишень комплементарны друг другу в том случае, когда достаточное число нуклеотидных оснований антисмыслового соединения могут образовывать водородные связи с соответствующими нуклеотидными основаниями нуклеиновой кислоты-мишени, в результате чего будет достигаться желаемый эффект (например, ингибирование нуклеиновой кислоты-мишени, такой как нуклеиновая кислота фактора 11, антисмысловым соединением).

При этом, допускается присутствие некомплементарных нуклеотидных оснований между антисмысловым соединением и нуклеиновой кислотой фактора 11, при условии, что антисмысловое соединение будет сохранять свою способность специфически гибридизироваться с нуклеиновой кислотой-мишенью. Кроме того, антисмысловое соединение может гибридизироваться с одним или несколькими сегментами нуклеиновой кислоты фактора 11, таким образом, что промежуточные или соседние сегменты не будут участвовать в событии гибридизации (например, не будут образовывать петлевую структуру, структуру с несоответствиями или шпилечную структуру).

В некоторых вариантах изобретения, описанные здесь антисмысловые соединения или их специфическая часть комплементарны или по меньшей мере на 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% комплементарны нуклеиновой кислоте фактора 11, области-мишени, сегменту-мишени или их специфической части. Процент комплементарности антисмыслового соединения нуклеиновой кислоте-мишени может быть определен рутинными методами.

Так, например, антисмысловое соединение, в котором 18 из 20 нуклеотидных оснований антисмыслового соединения комплементарны области-мишени, а поэтому они могут специфически гибридизироваться с этой областью, рассматривается как соединение с 90%-ной комплементарностью. В этом примере, остальные не-комплементарные нуклеотидные основания могут присутствовать в виде кластера, либо они могут находиться между комплементарными нуклеотидными основаниями, но они необязательно должны быть смежными друг с другом или с комплементарными нуклеотидными основаниями. Такие антисмысловые соединения длиной в 18 нуклеотидных оснований, имеющей 4 (четыре) некомплементарных нуклеотидных основания, фланкированных двумя областями, которые являются полностью комплементарными нуклеиновой кислоте-мишени, в основном, на 77,8% комплементарны нуклеиновой кислоте-мишени, а поэтому они входят в объем настоящего изобретения. Процент комплементарности антисмыслового соединения по отношению к области нуклеиновой кислоты-мишени может быть определен рутинным методом с использованием пакета программ BLAST (программ поиска локальных соответствий оснований выравниваемых последовательностей) и пакета программ PowerBLAST, известных специалистам (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Процент гомологии, идентичность или комплементарность последовательностей могут быть определены, например, с помощью программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), с использованием параметров по умолчанию и алгоритма Смита и Уотермана (Adv. Appl. Math., 1981, 2, 482 489).

В некоторых вариантах изобретения, описанные здесь антисмысловые соединения или их специфические части полностью комплементарны (то есть на 100% комплементарны) нуклеиновой кислоте-мишени или ее специфической части. Так, например, антисмысловое соединение может быть полностью комплементарным нуклеиновой кислоте фактора 11 или ее области-мишени, сегменту-мишени или последовательности-мишени. Используемый здесь термин «полностью комплементарный» означает, что каждое нуклеотидное основание антисмыслового соединения обладает способностью точно спариваться с соответствующими нуклеотидными основаниями нуклеиновой кислоты-мишени. Так, например, антисмысловое соединение из 20 нуклеотидных оснований являются полностью комплементарными последовательности-мишени длиной в 400 нуклеотидных оснований, при условии, что соответствующая часть нуклеиновой кислоты-мишени из 20 нуклеотидных оснований будет полностью комплементарна антисмысловому соединению. Термин «полностью комплементарный» может также употребляться и по отношению к специфической части первой и/или второй нуклеиновой кислоты. Так, например, 20 нуклеотидных оснований, являющиеся частью антисмыслового соединения из 30 нуклеотидных оснований, могут быть «полностью комплементарными» последовательности-мишени длиной в 400 нуклеотидных оснований. 20 нуклеотидных оснований, являющиеся частью олигонуклеотида из 30 нуклеотидных оснований, полностью комплементарны последовательности-мишени, если указанная последовательность-мишень имеет соответствующую часть из 20 нуклеотидных оснований, где каждое нуклеотидное основание комплементарно 20 нуклеотидным основаниям, составляющим часть антисмыслового соединения. При этом, полноразмерное антисмысловое соединение из 30 нуклеотидных оснований может быть, а может и не быть, полностью комплементарным последовательности-мишени, в зависимости от того, являются ли остальные 10 нуклеотидных оснований антисмыслового соединения также комплементарными последовательности-мишени.

Некомплементарное нуклеотидное основание может присутствовать у 5′-конца или 3′-конца антисмыслового соединения. Альтернативно, некомплементарное нуклеотидное основание или некомплементарные нуклеотидные основания могут присутствовать во внутреннем положении антисмыслового соединения. Если присутствуют два или более некомплементарных нуклеотидных основания, то они могут быть смежными (то есть связанными) или несмежными. В одном из вариантов изобретения, некомплементарное нуклеотидное основание присутствует в сегменте-крыле антисмыслового олигонуклеотида-гэпмера.

В некоторых вариантах изобретения, антисмысловые соединения, имеющие длину в 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидных оснований или менее, содержат не более чем 4, не более чем 3, не более чем 2 или не более чем 1 нуклеотидное основание, которое не является комплементарным нуклеиновой кислоте-мишени, такой как нуклеиновая кислота фактора 11 или ее специфическая часть.

В некоторых вариантах изобретения, антисмысловые соединения, имеющие длину в 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидных оснований или менее, содержат не более чем 6, не более чем 5, не более чем 4, не более чем 3, не более чем 2 или не более чем 1 нуклеотидное основание, которое не является комплементарным нуклеиновой кислоте-мишени, такой как нуклеиновая кислота фактора 11 или ее специфическая часть.

Описанными здесь антисмысловыми соединениями также являются антисмысловые соединения, которые комплементарны части нуклеиновой кислоты-мишени. Используемый здесь термин «часть» означает определенное количество смежных (то есть, связанных) нуклеотидных оснований в области или сегменте нуклеиновой кислоты-мишени. Термин «часть» может также означать определенное число смежных нуклеотидных оснований антисмыслового соединения. В некоторых вариантах изобретения, антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени из 8 нуклеотидных оснований. В некоторых вариантах изобретения, антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени из 12 нуклеотидных оснований. В некоторых вариантах изобретения, антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени из 15 нуклеотидных оснований. В настоящем изобретении также рассматриваются антисмысловые соединения, комплементарные по меньшей мере 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более нуклеотидным основаниям, составляющим часть сегмента-мишени, или любому числу нуклеотидных оснований, входящему в интервалы между любыми двумя этими величинами.

Идентичность

Описанные здесь антисмысловые соединения могут также иметь определенный процент идентичности конкретной нуклеотидной последовательности, SEQ ID NO:, или соединению, имеющему конкретный номер по Isis, или его части. Используемое здесь антисмысловое соединение является идентичным описанной здесь последовательности, если это соединение обладает такой же самой способностью спариваться с нуклеотидными основаниями. Так, например, РНК, которая вместо тимидина, присутствующего в описанной здесь последовательности ДНК, содержит урацил, также должна рассматриваться как последовательность, идентичная последовательности ДНК, поскольку как урацил, так и тимидин спариваются с аденином. В настоящем изобретении также рассматриваются описанные здесь укороченные и удлиненные варианты антисмысловых соединений, а также соединения, имеющие основания, не идентичные основаниям описанных здесь антисмысловых соединений. Такие неидентичные основания могут быть смежными друг с другом или распределены по всему антисмысловому соединению. Процент идентичности антисмысловых соединений вычисляют по числу оснований, которые обнаруживают спаривание, идентичное спариванию оснований сравниваемой последовательности.

В некоторых вариантах изобретения, антисмысловые соединения или их части по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичны одному или нескольким антисмысловым соединениям или SEQ ID NO:, или их частям, описанным в настоящей заявке.

В некоторых вариантах изобретения, часть антисмыслового соединения сравнивают с частью нуклеиновой кислоты-мишени, имеющей ту же самую длину. В некоторых вариантах изобретения, часть, имеющую 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 нуклеотидных оснований, сравнивают с частью нуклеиновой кислоты-мишени, имеющей ту же самую длину.

В некоторых вариантах изобретения, часть антисмыслового олигонуклеотида сравнивают с частью нуклеиновой кислоты-мишени, имеющей ту же самую длину. В некоторых вариантах изобретения, часть, имеющую 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 нуклеотидных оснований, сравнивают с частью нуклеиновой кислоты-мишени, имеющей ту же самую длину.

Модификации

Нуклеозидом является комбинация основания и сахара. Нуклеотидной частью (также известной как основание) нуклеозида обычно является молекула гетероциклического основания. Нуклеотидами также являются нуклеозиды, которые дополнительно включают фосфатную группу, ковалентно связанную с сахарной частью нуклеозида. В нуклеозидах, включающих пентофуранозильный сахар, фосфатная группа может быть связана с 2′-, 3′- или 5′-гидроксильной частью сахара. Олигонуклеотиды, а именно, линейные полимерные олигонуклеотиды, образуются посредством ковалентной связи смежных нуклеозидов друг с другом. В олигонуклеотидной структуре, фосфатные группы обычно образуются посредством межнуклеозидных связей олигонуклеотида.

Модификации антисмысловых соединений включают замены или модификации в межнуклеозидных связях, сахарных группах или нуклеотидных основаниях. Модифицированные антисмысловые соединения часто являются более предпочтительными, чем их нативные формы, поскольку они обладают нужными свойствами, такими как, например, повышенный уровень поглощения клетками, повышенная аффинность по отношению к нуклеиновой кислоте-мишени, повышенная стабильность в присутствии нуклеаз или повышенная ингибирующая активность.

Химически модифицированные нуклеозиды могут быть также использованы для повышения аффинности связывания укороченного или усеченного антисмыслового олигонуклеотида с его нуклеиновой кислотой-мишенью. Следовательно, сравнимые результаты, в большинстве случаев, могут быть получены с использованием еще более коротких антисмысловых соединений, имеющих такие химически модифицированные нуклеозиды.

Модифицированные межнуклеозидные связи

Природной межнуклеозидной связью РНК и ДНК является 3'-5'-фосфодиэфирная связь. Антисмысловые соединения, имеющие одну или несколько модифицированных, то есть, неприродных межнуклеозидных связей, часто являются более предпочтительными по сравнению с антисмысловыми соединениями, имеющими природные межнуклеозидные связи, поскольку они обладают нужными свойствами, такими как, например, повышенный уровень поглощения клетками, повышенная аффинность по отношению к нуклеиновым кислотам-мишеням и повышенная стабильность в присутствии нуклеаз.

Олигонуклеотиды, имеющие модифицированные межнуклеозидные связи, включают межнуклеозидные связи, которые имеют атом фосфора, а также межнуклеозидные связи, не имеющие атома фосфора. Репрезентативными фосфор-содержащими межнуклеозидными связями являются, но не ограничиваются ими, фосфодиэфиры, фосфотриэфиры, метилфосфонаты, фосфорамидат и фосфортиоаты. Методы получения связей, содержащих и не содержащих фосфор, хорошо известны специалистам.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, содержат одну или несколько модифицированных межнуклеозидных связей. В некоторых вариантах изобретения, модифицированными межнуклеозидными связями являются фосфортиоатные связи. В некоторых вариантах изобретения, каждой межнуклеозидной связью антисмыслового соединения является фосфортиоатная межнуклеозидная связь.

Модифицированные сахарные группы

Антисмысловые соединения согласно изобретению могут содержать, но необязательно, один или несколько нуклеозидов, которые имеют модифицированную сахарную группу. Такие модифицированные сахаром нуклеозиды могут сообщать антисмысловым соединениям повышенную устойчивость к нуклеазе, повышенную аффинность связывания или некоторые другие желательные биологические свойства. В некоторых вариантах изобретения, нуклеозиды содержат химически модифицированные рибофуранозные циклические группы. Примерами получения химически модифицированных рибофуранозных циклических групп являются, но не ограничиваются ими, присоединение групп-заместителей (включая присоединение 5′- и 2′-групп заместителей, создание мостиковой связи между атомами неконденсированного кольца с образованием бициклических нуклеиновых кислот (BNA) и замену атома кислорода рибозильного кольца группами S, N(R), или C(R1)(R)2 (где R=H, Cl-C12-алкил или защитная группа) и их комбинации. Примерами получения химически модифицированных сахаров являются получение 2′-F-5′-метил-замещенного нуклеозида (описание других 5′,2′-бис-замещенных нуклеозидов можно найти в Международной заявке РСТ WO 2008/101157, опубликованной 8/21/08) или замена атома кислорода рибозильного кольца атомом S с дополнительным замещением в 2′-положении (см. заявку на патент США US2005-0130923, опубликованную 16 июня 2005) или, альтернативно, 5′-замещение БНК (см. Международную заявку РСТ WO 2007/134181, опубликованную 11/22/07, где LNA замещена, например, 5′-метильной или 5′-винильной группой).

Примерами нуклеозидов, имеющих модифицированные сахарные группы, являются, но не ограничиваются ими, нуклеозиды, содержащие группы-заместители, такие как 5′-винил, 5′-метил (R или S), 4′-S, 2′-F, 2′-OCH3 и 2′-O(CH2)2OCH3. Заместитель в 2′-положении может быть также выбран из аллила, амино, азидо, тио, O-аллила, O-C1-C10-алкила, OCF3, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn) и O-CH2-C(=O)-N(Rm)(Rn), где каждый из Rm и Rn независимо представляет собой H или замещенный или незамещенный C1-C10-алкил.

Примерами бициклических нуклеиновых кислот (BNA) являются, но не ограничиваются ими, нуклеозиды, содержащие мостиковую связь между атомами 4′- и 2′-рибозильного кольца. В некоторых вариантах изобретения, описанными здесь антисмысловыми соединениями являются один или несколько нуклеозидов BNA, которые имеют мостиковую связь одной из формул: 4′-(CH2)-O-2′ (LNA); 4′-(CH2)-S-2′; 4′-(CH2)-O-2′ (LNA); 4′-(CH2)2-O-2′ (ENA); 4′-C(CH3)2-O-2′ (см. PCT/US2008/068922); 4′-CH(CH3)-O-2′ и 4′-C-H(CH2OCH3)-O-2′ (см. патент США 7399845, выданный 15 июля, 2008); 4′-CH2-N(OCH3)-2′ (см. PCT/US2008/064591); 4′-CH2-O-N(CH3)-2′ (см. заявку на патент США US2004-0171570, опубликованную 2 сентября, 2004); 4′-CH2-N(R)-O-2′ (см. патент США 7427672, выданный 23 сентября, 2008); 4′-CH2-C(CH3)-2′ и 4′-CH2-C-(=CH2)-2′ (см. PCT/US2008/066154), где R независимо представляет собой H, Cl-C12-алкил или защитную группу. Каждая из вышеупомянутых BNA имеет различные стереохимические сахарные конфигурации, включая, например, α-L-рибофуранозу и β-D-рибофуранозу (см. Международную заявку PCT/DK98/00393, опубликованную 25 марта 1999 как WO 99/14226).

В некоторых вариантах изобретения, нуклеозиды модифицированы путем замены рибозильного кольца сахарным суррогатом. Такими модификациями являются, но не ограничиваются ими, замена рибозильного кольца суррогатной циклической системой (иногда называемой аналогами ДНК), такой как морфолино-кольцо, циклогексенильное кольцо, циклогексильное кольцо или тетрагидропиранильное кольцо, такое как кольцо, имеющее одну из нижеследующих формул:

Многие другие бицикло- и трицикло-системы циклических сахарных суррогатов, которые могут быть использованы для модификации нуклеозидов, включаемых в антисмысловые соединения, также известны специалистам (см., например, обзорную статью Leumann, J. C., Bioorganic & Medicinal Chemistry, 2002, 10, 841-854). Такие циклические системы могут быть подвергнуты различным дополнительным замещениям для повышения активности.

Методы получения модифицированных сахаров хорошо известны специалистам.

В нуклеотидах, имеющих модифицированные сахарные группы, молекулы нуклеотидных оснований (природные, модифицированные или их комбинации) сохраняют для их гибридизации с соответствующей нуклеиновой кислотой-мишенью.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, включают один или несколько нуклеотидов, имеющих модифицированные сахарные группы. В некоторых вариантах изобретения, модифицированной сахарной группой является 2′-MOE. В некоторых вариантах изобретения, 2′-MOE-модифицированные нуклеотиды присутствуют в мотиве гэпмера.

Модифицированные нуклеотидные основания

Модификации или замещения нуклеотидного основания (или основания) по своей структуре отличаются от природных или синтетических немодифицированных нуклеотидных оснований, но по своим функциям они эквивалентны таким основаниям. Природные и модифицированные нуклеотидные основания способны участвовать в образовании водородных связей. Такие нуклеотидные модификации могут сообщать антисмысловым соединениям устойчивость к нуклеазе, аффинность связывания или некоторые другие желательные биологические свойства. Модифицированными нуклеотидными основаниями являются синтетические и природные нуклеотидные основания, такие как, например, 5-метилцитозин (5-me-C). Некоторые нуклеотидные замены, включая замены 5-метилцитозином, могут быть, в частности, использованы для повышения аффинности связывания антисмыслового соединения с нуклеиновой кислотой-мишенью. Так, например, было показано, что замены 5-метилцитозином повышают стабильность дуплекса нуклеиновой кислоты при увеличении температуры на 0,6-1,2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp.276-278).

Другими модифицированными нуклеотидными основаниями являются 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метильные и другие алкильные производные аденина и гуанина, 2-пропильные и другие алкильные производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галогенурацил и -цитозин, 5-пропинил(-C≡C-CH3)урацил и -цитозин и другие алкинильные производные пиримидиновых оснований, 6-азоурацил, -цитозин и -тимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-галоген-, 8-амино-, 8-тиол-, 8-тиоалкил-, 8-гидроксил- и другие 8-замещенные аденины и гуанины, 5-галоген-, а в частности, 5-бром-, 5-трифторметил- и другие 5-замещенные урацилы и цитозины, 7-метилгуанин и 7-метиладенин, 2-F-аденин, 2-аминоаденин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин, и 3-деазагуанин и 3-деазааденин.

Молекулами гетероциклических оснований могут быть также молекулы, в которых пуриновое или пиримидиновое основание заменено другими гетероциклами, например 7-деазааденином, 7-деазагуанозином, 2-аминопиридином и 2-пиридоном. Нуклеотидными основаниями, которые, в частности, могут быть использованы для повышения аффинности связывания антисмысловых соединений, являются 5-замещенные пиримидины, 6-азапиримидины и N-2-, N-6- и О-6-замещенные пурины, включая 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин.

В некоторых вариантах изобретения, антисмысловые соединения, нацеленные на нуклеиновую кислоту фактора 11, содержат одно или несколько модифицированных нуклеотидных оснований. В некоторых вариантах изобретения, антисмысловые олигонуклеотиды с уширенным гэпом, нацеленные на нуклеиновую кислоту фактора 11, содержат одно или несколько модифицированных нуклеотидных оснований. В некоторых вариантах изобретения, модифицированным нуклеотидным основанием является 5-метилцитозин. В некоторых вариантах изобретения, каждый цитозин представляет собой 5-метилцитозин.

Композиции и способы получения фармацевтических композиций

Антисмысловые олигонуклеотиды могут быть смешаны с фармацевтически приемлемыми активными или инертными веществами, подходящими для получения фармацевтических композиций или препаратов. Композиции и способы получения фармацевтических композиций зависят от ряда факторов, включая, но не ограничиваясь ими, способ введения, тяжесть заболевания или вводимую дозу.

Антисмысловое соединение, нацеленное на нуклеиновую кислоту фактора 11, может быть использовано в фармацевтических композициях в комбинации с подходящими фармацевтически приемлемым разбавителем или носителем. Фармацевтически приемлемым разбавителем является забуференный фосфатом физиологический раствор (PBS). PBS представляет собой разбавитель, используемый в парентерально вводимых композициях. В соответствии с этим, в одном из вариантов изобретения, фармацевтическая композиция, используемая в описанных здесь способах, содержит антисмысловое соединение, нацеленное на нуклеиновую кислоту фактора 11, и фармацевтически приемлемый разбавитель. В некоторых вариантах изобретения, фармацевтически приемлемым разбавителем является PBS. В некоторых вариантах изобретения, антисмысловым соединением является антисмысловой олигонуклеотид.

Фармацевтические композиции, содержащие антисмысловые соединения, включают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров, или любой другой олигонуклеотид, которые, после их введения животному, включая человека, обладают способностью доставлять (прямо или опосредованно) биологически активный метаболит или его остаток. В соответствии с этим, например, в настоящем изобретении также описаны фармацевтически приемлемые соли антисмысловых соединений, пролекарства, фармацевтически приемлемые соли таких пролекарств и другие биоэквиваленты. Подходящими фармацевтически приемлемыми солями являются, но не ограничиваются ими, соли натрия и калия.

Введение пролекарства может означать включение дополнительных нуклеозидов у одного или обоих концов антисмыслового соединения, которое расщепляется в организме под действием эндогенных нуклеаз с образованием активного антисмыслового соединения.

Конъюгированные антисмысловые соединения

Антисмысловые соединения могут быть ковалентно связаны с одной или несколькими молекулами или конъюгатами, что может приводить к повышению активности и к улучшению распределения полученных антисмысловых олигонуклеотидов в клетках или их поглощения этими клетками. Типичными группами конъюгата являются молекулы холестерина и молекулы липида. Другими группами конъюгата являются углеводы, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители.

Антисмысловые соединения могут быть также модифицированы так, чтобы они содержали одну или несколько стабилизирующих групп, которые обычно присоединяются к одному или к обоим концам антисмысловых соединений, что приводит к улучшению их свойств, таких как, например, устойчивость к нуклеазе. В стабилизирующие группы также входят кэп-структуры. Такие концевые модификации защищают антисмысловое соединение, имеющее концевую нуклеиновую кислоту, от расщепления экзонуклеазой, и могут облегчать доставку такого соединения в клетку и/или его нужную локализацию в клетке. Кэп может присутствовать у 5′-конца (5′-кэп) или у 3′-конца (3′-кэп), либо он может присутствовать на обоих концах. Кэп-структуры хорошо известны специалистам, и такими структурами являются, например, инвертированные неосновные дезокси-кэпы. Другими 3′- и 5′- стабилизирующими группами, которые могут быть использованы для кэпирования одного или обоих концов антисмыслового соединения в целях сообщения ему устойчивости к нуклеазе, являются группы, описанные в заявке WO 03/004602, опубликованной 16 января 2003.

Клеточная культура и лечение антисмысловыми соединениями

Влияние антисмысловых соединений на уровни, активность или экспрессию нуклеиновых кислот фактора 11 может быть протестировано in vitro в клетках различных типов. Клетки различных типов, используемые для таких анализов, были закуплены у коммерческих фирм-поставщиков (например, в Американской коллекции типовых культур, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) и культивированы в соответствии с инструкциями производителей с использованием коммерчески доступных реагентов (например, Invitrogen Life Technologies, Carlsbad, CA). Репрезентативными клетками являются, но не ограничиваются ими, клетки HepG2, клетки Hep3B и первичные гепатоциты.

In vitro тестирование антисмысловых олигонуклеотидов

В настоящем изобретении описаны методы обработки клеток антисмысловыми олигонуклеотидами, где указанные методы могут быть соответствующим образом модифицированы для проведения лечения другими антисмысловыми соединениями.

В основном, клетки, при достижении ими приблизительно 60-80% конфлюентности в культуре, обрабатывают антисмысловыми олигонуклеотидами.

Одним из реагентов, обычно используемых для введения антисмысловых олигонуклеотидов в культивированные клетки, является реагент для трансфекции катионного липида липофектина (LIPOFECTIN) (Invitrogen, Carlsbad, CA). Антисмысловые олигонуклеотиды смешивают с липофектином в среде OPTI-MEM 1 (Invitrogen, Carlsbad, CA) для достижения нужной конечной концентрации антисмыслового олигонуклеотида и концентрации липофектина, которая обычно составляет в пределах от 2 до 12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Другим реагентом, обычно используемым для введения антисмысловых олигонуклеотидов в культивированные клетки, является липофектамин (LIPOFECTAMINE) (Invitrogen, Carlsbad, CA). Антисмысловый олигонуклеотид смешивают с липофектамином в среде OPTI-MEM 1 с пониженным содержанием сыворотки (Invitrogen, Carlsbad, CA) для достижения нужной конечной концентрации антисмыслового олигонуклеотида и концентрации липофектамина, которая обычно составляет в пределах от 2 до 12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Другим методом, применяемым для введения антисмысловых олигонуклеотидов в культивированные клетки, является электропорация.

Клетки обрабатывают антисмысловыми олигонуклеотидами рутинными методами. Клетки обычно собирают через 16-24 часа после обработки антисмысловыми олигонуклеотидами, а затем уровни РНК или белка, кодируемого нуклеиновыми кислотами-мишенями, измеряют методами, известными специалистам и описанными в настоящей заявке. В основном, если обработку проводят с множеством повторностей, то данные представляют как среднее величин, полученных при повторных обработках.

В различных клеточных линиях, концентрация используемого антисмыслового олигонуклеотида варьируется. Методы определения оптимальной концентрации антисмыслового олигонуклеотида в конкретной клеточной линии хорошо известны специалистам. При трансфекции липофектамином антисмысловые олигонуклеотиды обычно используются в концентрации от 1 нМ до 300 нМ. При трансфекции методом электропорации антисмысловые олигонуклеотиды используются в более высокой концентрации, а именно, в пределах от 625 до 20000 нМ.

Выделение РНК

Анализ РНК может быть осуществлен на полноразмерной клеточной РНК или поли(A)+ мРНК. Методы выделения РНК хорошо известны специалистам. РНК получают методами, хорошо известными специалистам, например, с использованием реагента TRIZOL (Invitrogen, Carlsbad, CA) в соответствии с протоколами, рекомендованными производителями.

Анализ на ингибирование уровней или экспрессии мишеней

Ингибирование уровней или экспрессии нуклеиновой кислоты фактора 11 может быть проанализировано различными методами, известными специалистам. Так, например, уровни нуклеиновой кислоты-мишени могут быть количественно оценены, например, с помощью Нозерн-блот-анализа, конкурентной полимеразной цепной реакции (ПЦР) или количественной ПЦР в реальном времени. Анализ РНК может быть осуществлен на полноразмерной клеточной РНК или поли(A)+ мРНК. Методы выделения РНК хорошо известны специалистам. Нозерн-блот-анализ также является рутинным методом. Количественная ПЦР в реальном времени может быть легко осуществлена с помощью системы детектирования последовательностей на коммерчески доступном оборудовании ABI PRISM 7600, 7700 или 7900, поставляемом PE-Applied Biosystems, Foster City, CA, в соответствии с инструкциями производителей.

Анализ уровней РНК-мишени, проводимый с помощью количественной ПЦР в реальном времени

Количественная оценка уровней РНК-мишени может быть осуществлена путем количественной ПЦР в реальном времени с помощью системы детектирования последовательностей на коммерчески доступном оборудовании ABI PRISM 7600, 7700 или 7900 (PE-Applied Biosystems, Foster City, CA) в соответствии с инструкциями производителей. Методы проведения количественной ПЦР в реальном времени хорошо известны специалистам.

Перед проведением ПЦР в реальном времени, выделенную РНК подвергают реакции с обратной транскриптазой (ОТ), в результате чего продуцируется комплементарная ДНК (кДНК), которую затем используют в качестве субстрата для ПЦР-амплификации в реальном времени. Реакции с ОТ и ПЦР в реальном времени осуществляют последовательно в одной и той же лунке с образцом. Реагенты для реакций ОТ и ПЦР в реальном времени закупают у Invitrogen (Carlsbad, CA). Реакции с ОТ и ПЦР в реальном времени осуществляют методами, хорошо известными специалистам.

Количества гена-мишени (или РНК-мишени), полученные с помощью ПЦР в реальном времени, нормализуют по уровню экспрессии гена, которая является постоянной, например, такого как ген циклофилина А, или по количеству полноразмерной РНК с использованием RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Экспрессию циклофилина А количественно оценивают одновременно или параллельно с мишенью, либо по отдельности, с помощью ПЦР в реальном времени. Полноразмерную РНК количественно оценивают с использованием реагента для количественного определения РНК, RIBOGREEN, (Invetrogen, Inc. Eugene, OR). Методы количественной оценки РНК с использованием RIBOGREEN описаны в публикации Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). Измерение интенсивности флуоресценции RIBOGREEN проводят на оборудовании CYTOFLUOR 4000 (PE Applied Biosystems).

Зонды и праймеры конструируют так, чтобы они гибридизовались с нуклеиновой кислотой фактора 11. Методы конструирования зондов и праймеров для ПЦР в реальном времени хорошо известны специалистам, и могут быть осуществлены с использованием компьютерной программы, такой как PRIMER EXPRESS (Applied Biosystems, Foster City, CA).

Анализ уровней белка

Ингибирование нуклеиновых кислот фактора 11 антисмысловыми соединениями может быть оценено путем измерения уровней белка фактора 11. Уровни белка фактора 11 могут быть измерены или количественно оценены различными методами, хорошо известными специалистам, такими как иммунопреципитация, вестерн-блот-анализ (иммуноблоттинг), твердофазный иммуноферментный анализ (ELISA), анализы для количественной оценки белков, анализы на активность белка (например, анализы на каспазную активность), иммуногистохимический анализ, иммуноцитохимический анализ или клеточный сортинг с активацией флуоресценции (FACS). Антитела, нацеленные против мишени, могут быть идентифицированы и получены из различных источников, таких как антитела каталога MSRS (Aerie Corporation, Birmingham, MI), либо они могут быть получены стандартными методами продуцирования моноклональных или поликлональных антител, хорошо известных специалистам. Антитела, используемые для детектирования фактора 11 у мышей, крыс, обезьян и человека, являются коммерчески доступными.

In vivo тестирование антисмысловых соединений

Антисмысловые соединения, например антисмысловые олигонуклеотиды, присутствующие у животных, тестируют для оценки их способности ингибировать экспрессию фактора 11 и продуцировать фенотипические изменения, такие как длительное время АПТВ, более длительное время АПТВ в сочетании с нормальным временем ПВ, пониженное количество тромбоцитарного фактора 4 (PF-4), и пониженный уровень образования тромбов или повышенное время образования тромбов. Такое тестирование может быть проведено на нормальных животных или на экспериментальных моделях заболевания. Для введения животным антисмысловые олигонуклеотиды получают в фармацевтически приемлемом разбавителе, таком как забуференный фосфатом физиологический раствор. Введение может быть осуществлено парентерально, например внутрибрюшинно, внутривенно и подкожно. Вычисление доз и чистоты введения антисмысловых олигонуклеотидов может быть осуществлено самим специалистом в данной области, и результаты такого вычисления зависят от таких факторов, как способ введения и масса тела животного. После обработки антисмысловыми олигонуклеотидами, из ткани печени выделяют РНК и определяют изменение уровней экспрессии нуклеиновой кислоты фактора 11. Изменение уровней белка фактора 11 также определяют с помощью анализа на образование тромбина. Кроме того, влияние на время образования сгустков, например, ПВ и АПТВ определяют с использованием плазмы, взятой у обработанных животных.

Переносимость доз

В некоторых вариантах изобретения, описанные здесь соединения дают минимальные побочные эффекты. Побочными эффектами являются ответы на введение антисмыслового соединения, которые обычно не имеют отношения к нацеливанию на фактор 11, например, такие как воспалительный ответ у животного. В некоторых вариантах изобретения, эти соединения хорошо переносятся животным. Улучшение переносимости доз может зависеть от ряда факторов, включая, но не ограничиваясь ими, нуклеотидную последовательность антисмыслового соединения, химические модификации нуклеотидов, конкретный мотив немодифицированных и модифицированных нуклеозидов в антисмысловом соединении или их комбинации. Переносимость дозы может быть определена по ряду факторов. Такими факторами являются масса тела, масса органа, функция печени, функция почек, число тромбоцитов и лейкоцитарная формула.

В некоторых вариантах изобретения, рассматриваемые здесь соединения оказывают минимальное действие на массу органов. В некоторых вариантах изобретения, указанные соединения дают менее, чем 7-кратное, 6-кратное, 5-кратное, 4-кратное, 3-кратное, 2-кратное увеличение массы селезенки и/или печени, либо вообще не оказывают значительного влияния на массу указанных органов.

В некоторых вариантах изобретения, описанные здесь соединения оказывают минимальное действие на функцию печени. Факторами, используемыми для оценки функции печени, являются уровни ALT, уровни AST, уровни билирубина в плазме и уровни альбумина в плазме. В некоторых вариантах изобретения, описанные здесь соединения дают менее, чем 7-кратное, менее, чем 6-кратное, менее, чем 5-кратное, менее, чем 4-кратное, менее, чем 3-кратное или менее, чем 2-кратное увеличение уровней ALT или AST, либо вообще не оказывают значительного влияния на уровни ALT или AST. В некоторых вариантах изобретения, описанные здесь соединения дают менее, чем 3-кратное или менее, чем 2-кратное увеличение уровней билирубина в плазме, либо вообще не оказывают значительного влияния на уровни билирубина в плазме.

В некоторых вариантах изобретения, описанные здесь соединения оказывают минимальное действие на функцию почек. В некоторых вариантах изобретения, описанные здесь соединения дают менее, чем 3-кратное или менее, чем 2-кратное увеличение концентрации азота мочевины в плазме крови (BUN), либо вообще не оказывают значительного влияния на концентрацию такого соединения. В некоторых вариантах изобретения, описанные здесь соединения дают менее, чем 6-кратное, 5-кратное, 4-кратное, 3-кратное или 2-кратное увеличение отношения «белок:креатинин» в моче, либо вообще не оказывают значительного влияния на такое отношение.

В некоторых вариантах изобретения, описанные здесь соединения оказывают минимальное действие на гематологические факторы. В некоторых вариантах изобретения, описанные здесь соединения дают менее, чем 60%, 50%, 40%, 30%, 20%, 10% или 5%-ное снижение числа тромбоцитов. В некоторых вариантах изобретения, описанные здесь соединения дают менее, чем 4-кратное, 3-кратное или 2-кратное увеличение числа моноцитов, либо вообще не оказывают значительного влияния на число моноцитов.

В некоторых вариантах изобретения, указанные соединения также обладают желательными фармакокинетическими свойствами. В некоторых вариантах изобретения, антисмысловые соединения имеют относительно длительное время полужизни в соответствующих биологических жидкостях или тканях.

В некоторых вариантах изобретения, указанные соединения или композиции также имеют желательную вязкость. В некоторых вариантах изобретения, вязкость указанного соединения или композиции не превышает 40 сП при концентрации 165-185 мг/мл.

В других вариантах изобретения, указанные соединения имеют комбинацию вышеуказанных свойств и с высокой эффективностью снижают уровень экспрессии мРНК фактора 11 у животного-модели.

Некоторые показания

В некоторых своих вариантах, настоящее изобретение относится к способам лечения индивидуума, включающим введение одной или нескольких фармацевтических композиций согласно изобретению. В некоторых вариантах изобретения, указанный индивидуум страдает тромбоэмболическим осложнением. В некоторых вариантах изобретения, указанным индивидуумом является индивидуум с риском развития нарушения свертывания крови, включая, но не ограничиваясь ими, инфаркт, тромбоз, эмболию, тромбоэмболию, такую как тромбоз глубокой вены, эмболия легких, инфаркт миокарда и инсульт. Такими индивидуумами также являются индивидуумы с приобретенными нарушениями, заболеваниями или расстройствами, приводящими к риску развития тромбоза, например к риску, связанному с хирургической операцией, раком, неподвижным образом жизни, сепсисом, атеросклерозом, трепетанием предсердий, а также с генетической предрасположенностью, например с антифосфолипидным синдромом и аутосомно-доминантным состоянием, ассоциированным с фактором Лейдена V. В некоторых вариантах изобретения, таким индивидуумом является индивидуум, нуждающийся в терапии антикоагулянтами. Примерами таких индивидуумов являются, но не ограничиваются ими, индивидуумы, подвергавшиеся «большой» ортопедической хирургической операции (то есть восстановительной хирургической операции на колене/бедре или хирургической операции по поводу перелома бедра), и пациенты, которые, для предупреждения инсульта, нуждаются в постоянном лечении, такие как пациенты, у которых наблюдается трепетание предсердий. В некоторых своих вариантах, настоящее изобретение относится к способам профилактического снижения уровней экспрессии фактора 11 у индивидуума. Некоторые варианты изобретения включают лечение индивидуума, нуждающегося в этом, путем введения данному индивидууму терапевтически эффективного количества антисмыслового соединения, нацеленного на нуклеиновую кислоту фактора 11.

В одном из вариантов изобретения, введение терапевтически эффективного количества антисмыслового соединения, нацеленного на нуклеиновую кислоту фактора 11, осуществляют вместе с мониторингом уровней фактора 11 в сыворотке индивидуума для оценки ответа индивидуума на введение антисмыслового соединения. Ответ индивидуума на введение антисмыслового соединения используется лечащим врачом для определения количества соединения, необходимого для терапевтического лечения, и необходимости продолжения такого лечения.

В некоторых вариантах изобретения, введение терапевтически эффективного количества антисмыслового соединения, нацеленного на нуклеиновую кислоту фактора 11 приводит к снижению уровня экспрессии фактора 11 по меньшей мере на 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 99% или на величину в пределах интервала, определяемого любыми двумя из указанных величин. В некоторых вариантах изобретения, введение терапевтически эффективного количества антисмыслового соединения, нацеленного на нуклеиновую кислоту фактора 11 приводит к изменению показателя свертывания крови, измеренного с помощью стандартного теста, например, такого как, но не ограничивающегося ими, тест на активированное парциальное тромбопластиновое время (АПТВ), тест на протромбиновое время (ПВ), тест на тромбиновое время (ТТВ), время кровотечения или на уровни D-димера. В некоторых вариантах изобретения, введение терапевтически эффективного количества антисмыслового соединения, нацеленного на нуклеиновую кислоту фактора 11 приводит к увеличению показателя свертывания крови по меньшей мере на 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 99%, или на величину в пределах интервала, определяемого любыми двумя из указанных величин. В некоторых вариантах изобретения, введение терапевтически эффективного количества антисмыслового соединения, нацеленного на нуклеиновую кислоту фактора 11 приводит к снижению показателя свертывания крови по меньшей мере на 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 99% или на величину в пределах интервала, определяемого любыми двумя из указанных величин.

В некоторых вариантах изобретения, фармацевтические композиции, содержащие антисмысловое соединение, нацеленное на фактор 11, используют для приготовления лекарственного препарата для лечения пациента, страдающего тромбоэмболическими осложнениями или восприимчивого к тромбоэмболическим осложнениям.

Некоторые способы комбинированной терапии

В некоторых вариантах изобретения, одну или несколько фармацевтических композиций согласно изобретению вводят вместе с одним или несколькими другими фармацевтическими средствами. В некоторых вариантах изобретения, указанное одно или несколько других фармацевтических средств предназначены для лечения такого же заболевания, расстройства или состояния, которое может быть подвергнуто лечению одной или несколькими фармацевтическими композициями согласно изобретению. В некоторых вариантах изобретения, указанное одно или несколько других фармацевтических средств предназначены для лечения другого заболевания, расстройства или состояния, отличающегося от того заболевания, расстройства или состояния, для лечения которого предназначены одна или несколько фармацевтических композиций согласно изобретению. В некоторых вариантах изобретения, указанное одно или несколько других фармацевтических средств предназначены для устранения нежелательного побочного эффекта, вызываемого введением одной или нескольких фармацевтических композиций согласно изобретению. В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению вводят вместе с другим фармацевтическим средством для устранения нежелательного эффекта, вызываемого введением другого фармацевтического средства. В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению вводят вместе с другим фармацевтическим средством для достижения комбинаторного эффекта. В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению вводят вместе с другим фармацевтическим средством для достижения синергического эффекта.

В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению вводят одновременно с одним или несколькими другими фармацевтическими средствами. В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению и одно или несколько других фармацевтических средств вводят в различные периоды времени. В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению и одно или несколько других фармацевтических средств получают вместе в одном препарате. В некоторых вариантах изобретения, одну или несколько других фармацевтических композиций согласно изобретению и одно или несколько других фармацевтических средств получают по отдельности.

В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются антикоагулянты или антитромбоцитарные средства. В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются ингибиторы НСПВС/циклооксигеназы, такие как аспирин. В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются ингибиторы аденозиндифосфатного (АДФ) рецептора, такие как клопидогрель (PLAVIX) и тиклопидин (TICLID). В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются ингибиторы фосфодиэстеразы, такие как цилостазол (PLETAL). В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются ингибиторы гликопротеина IIB/IIIA, такие как абциксимаб (REOPRO), эптифибатит (INTEGRILIN), тирофибан (AGGRASTAT) и дефибротид. В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются ингибиторы поглощения аденозина, такие как дипиридамол (PERSANTINE). В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе с фармацевтической композицией согласно изобретению, являются, но не ограничиваются ими, варфарин (и родственные кумарины), гепарин, ингибиторы тромбина прямого действия (такие как лепирудин, бивалирудин), апиксабан, LOVENOX и низкомолекулярные соединения, которые непосредственно влияют на ферментативное действие конкретных факторов свертывания крови (например, ривароксабан, который ингибирует фактор Xa). В некоторых вариантах изобретения, фармацевтическими средствами, которые могут быть введены вместе со специфическим ингибитором фактора 11 согласно изобретению, являются, но не ограничиваются ими, дополнительный ингибитор фактора 11. В некоторых вариантах изобретения, антикоагулянт и антитромобоцитарное средство вводят до введения фармацевтической композиции согласно изобретению. В некоторых вариантах изобретения, антикоагулянт или антитромобоцитарное средство вводят после введения фармацевтической композиции согласно изобретению. В некоторых вариантах изобретения, антикоагулянт и антитромобоцитарное средство вводят одновременно с фармацевтической композицией согласно изобретению. В некоторых вариантах изобретения, доза совместно вводимых антикоагулянта и антитромобоцитарного средства равна дозе антикоагулянта и антитромобоцитарного средства, вводимых отдельно. В некоторых вариантах изобретения, доза совместно вводимых антикоагулянта и антитромобоцитарного средства меньше дозы антикоагулянта и антитромобоцитарного средства, вводимых отдельно. В некоторых вариантах изобретения, доза совместно вводимых антикоагулянта и антитромбоцитарного средства выше дозы антикоагулянта и антитромбоцитарного средства, вводимых отдельно.

В некоторых вариантах изобретения, введение вместе со вторым соединением приводит к усилению антикоагулирующего действия первого соединения, а поэтому совместное введение этих соединений дает антикоагулирующий эффект, превышающий эффект от введения только первого соединения. В других вариантах изобретения, такое совместное введение дает антикоагулирующий эффект, равный аддитивному действию указанных соединений при их введении по отдельности. В некоторых вариантах изобретения, такое совместное введение дает антикоагулирующий эффект, превышающий аддитивное действие указанных соединений при их введении по отдельности. В некоторых вариантах изобретения, введение данного соединения вместе со вторым соединением приводит к усилению антитромботической активности, без увеличения риска возникновения кровотечения. В некоторых вариантах изобретения, указанным первым соединением является антисмысловое соединение. В некоторых вариантах изобретения, указанным вторым соединением является антисмысловое соединение.

В некоторых вариантах изобретения, антидот вводят в любое время после введения специфического ингибитора фактора 11. В некоторых вариантах изобретения, антидот вводят в любое время после введения антисмыслового олигонуклеотида, нацеленного на фактор 11. В некоторых вариантах изобретения, антидот вводят через несколько минут, часов, дней, недель или месяцев после введения антисмыслового соединения, нацеленного на фактор 11. В некоторых вариантах изобретения, антидот является комплементарным (например, является смысловой цепью) антисмысловому соединению, нацеленному на фактор 11. В некоторых вариантах изобретения, антидотом является белок фактора 7, фактора 7a, фактора 11 или фактора 11a. В некоторых вариантах изобретения, белком фактора 7, фактора 7a, фактора 11 или фактора 11a является белок человеческого фактора 7, человеческого фактора 7a, человеческого фактора 11 или человеческого фактора 11а. В некоторых вариантах изобретения, белком фактора 7 является NOVOSEVEN.

Некоторые способы терапии с одновременным введением антитромбоцитарного средства

В некоторых вариантах изобретения, ингибиторы фактора 11 вводят в комбинации с антитромбоцитарными терапевтическими средствами. В некоторых вариантах изобретения, введение ингибитора фактора 11 вместе с антитромбоцитарным терапевтическим средством дает незначительный риск либо вообще не дает заметного или обнаружимого увеличения риска возникновения кровотечения по сравнению с введением только одного антитромбоцитарного терапевтического средства. В некоторых вариантах изобретения, характер или показатели риска остаются неизменными по сравнению с характером или показателями, наблюдаемыми во время терапии с использованием антитромбоцитарного средства.

Комбинированная терапия с использованием антитромбоцитарного средства и антикоагулянта часто применяется в клинической практике для лечения пациентов, у которых были диагностированы, например, тромбоэмболия, трепетание предсердий, недостаточность сердечного клапана, порок сердечного клапана, инсульт и ИБС, а также пациентов с механическим клапаном. Преимущество такой комбинированной терапии заключается в вероятности продуцирования аддитивного эффекта, выражающегося в ингибировании активности тромбоцитов и фактора свертывания крови. Проведение такой комбинированной терапии может приводить к риску усиления кровотечения (Dowd, M. Plenary Sessions/Thrombosis Research 123 (2008)).

Было показано, что предварительное проведение комбинированной терапии антитромбоцитарным средством и антикоагулянтом повышает риск кровотечения по сравнению с терапией антикоагулянтом или антитромбоцитарным средством, используемыми по отдельности. Такими комбинированными методами лечения являются лечение ингибиторами FXa (например, апиксибаном и ривароксабаном) в комбинации с ингибиторами АДФ-рецептора/P2Y12 (тиенопиридинами, такими как клопидогрель - также известный как PLAVIX) и НСПВС (например, аспирином и напроксеном) (Kubitza, D. et al, Br. J. Clin. Pharmacol. 63:4 (2006); Wong, P.C. et al. Journal of Thrombosis and Haemostasis 6 (2008); FDA Advisory Committee Briefing Document for New Drug Application 22-406 (2009)). Так, например, в публикации Wong сообщалось, что добавление некоторых доз апиксабана к дозам аспирина и к дозам аспирина + клопидогреля приводит к значительному увеличению периода кровотечения по сравнению с кровотечением, наблюдаемым при введении только аспирина и аспирина вместе с клопидогрелем. В публикации Kubitza сообщалось, что комбинированное введение ривороксабана и напроксена значительно увеличивает время кровотечения по сравнению с введением только одного напроксена.

ПРИМЕРЫ

Неограничивающее описание вариантов и ссылки на них

Хотя некоторые рассматриваемые здесь соединения, композиции и способы конкретно описаны со ссылками на некоторые из нижеследующих вариантов осуществления изобретения, однако, представленные ниже примеры приводятся лишь для иллюстрации описанных здесь соединений и не носят ограничительный характер. Каждая работа, цитируемая в настоящей заявке, во всей своей полноте вводится в настоящее описание посредством ссылки.

Пример 1

Ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых соединений

Антисмысловые олигонуклеотиды, нацеленные на нуклеиновую кислоту фактора 11, тестировали на их влияние на мРНК фактора 11 in vitro. Клетки HepG2, культивированные при плотности 10000 клеток на лунку, трансфицировали с использованием реагента липофектина вместе с 75 нМ антисмыслового олигонуклеотида. После обработки в течение примерно 24 часов, из клеток выделяли РНК, и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам.

Химерные антисмысловые олигонуклеотиды, представленные в таблицах 1 и 2, были сконструированы в виде 5-10-5-MOE-гэпмеров. Эти гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. Каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Каждый гэпмер, представленный в таблице 1, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3), а каждый гэпмер, представленный в таблице 2, нацелен на SEQ ID NO:2 (GENBANK рег. № NT_022792.17, усеченный от 19598000 до 19624000).

Пример 2

Дозозависимое ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых соединений

Двенадцать гэпмеров, обеспечивающих ингибирование человеческого фактора 11 in vitro на 84% или более, тестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 10000 клеток на лунку и трансфицировали реагентом липофектином вместе с антисмысловыми олигонуклеотидами, взятыми в концентрациях 9,375 нМ, 18,75 нМ, 37,5 нМ, 75 нМ и 150 нМ, как показано в таблице 3. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966 (последовательность прямого праймера: CAGCCTGGAGCATCGTAACA, представленная здесь как SEQ ID NO:3; последовательность обратного праймера: TTTATCGAGCTTCGTTATTCTGGTT, представленная здесь как SEQ ID NO:4; последовательность зонда: TTGTCTACTGAAGCACACCCAAACAGGGAX, представленная здесь как SEQ ID NO:5). Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам. Как проиллюстрировано в таблице 3, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы.

Пример 3

Ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых олигонуклеотидов, сконструированных методом «микропрогулки»

Дополнительные гэпмеры конструировали на основе гэпмеров, представленных в таблице 3. В результате такого конструирования получали гэпмеры, которые отличались от исходных гэпмеров, представленных в таблице 3, тем что, они имели небольшие сдвиги в направлении вверх и вниз (то есть методом «микропрогулки»). Также были созданы гэпмеры с различными мотивами, например 5-10-5 MOE, 3-14-3 MOE и 2-13-5 MOE. Эти гэпмеры тестировали in vitro. Клетки HepG2, культивированные при плотности 10000 клеток на лунку, трансфицировали с использованием реагента липофектина вместе с 75 нМ антисмыслового олигонуклеотида. После обработки в течение примерно 24 часов, из клеток выделяли РНК, и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам.

Данные ингибирования in vitro для гэпмеров, сконструированных методом «микропрогулки», сравнивали с данными ингибирования in vitro для гэпмеров, представленных в таблице 3, как указано в таблицах 4, 5, 6, 7 и 8. Эти олигонуклеотиды представляли области на человеческой мРНК (GENBANK рег. № NM_000128.3), на которой они картированы.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 4, были сконструированы в виде 5-10-5-MOE-, 3-14-3-MOE-, и 2-13-5-MOE-гэпмеров. Первыми гэпмерами, представленными в таблице 4, являются исходные гэпмеры (см. таблицу 3), из которых были сконструированы остальные гэпмеры методом «микропрогулки» и которые показаны звездочкой. Эти 5-10-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 3-14-3-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из четырнадцати 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждая из которых содержит 3 нуклеотида. 2-13-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из тринадцати 2′-дезоксинуклеотидов. Центральный гэп фланкирован у 5′-конца крылом, содержащим 2 нуклеотида, а у 3′-конца крылом, содержащим 5 нуклеотидов. В каждом мотиве (5-10-5, 3-14-3 и 2-13-5), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Каждый гэпмер, представленный в таблице 4, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3).

Как показано в таблице 4, все 5-10-5-MOE-гэпмеры, 3-14-3-MOE-гэпмеры и 2-13-5-MOE-гэпмеры, нацеленные на область-мишень, начинающуюся со старт-сайта-мишени 656 и заканчивающуюся стоп-сайтом-мишенью 704 (то есть в пределах нуклеотидных оснований 656-704) SEQ ID NO:1, ингибируют мРНК фактора 11 по меньшей мере на 20%. Многие из гэпмеров дают по меньшей мере 60%-ный ингибирующий эффект. Некоторые из гэпмеров, включая номера ISIS 416806, 416809, 416811, 416814, 416821, 416825, 416826, 416827, 416828, 416868, 416869, 416878, 416879, 416881, 416883, 416890, 416891, 416892, 416893, 416894, 416895, 416896, 416945, 416946, 416969, 416970, 416971, 416972, 416973, 412203, 413467, 413468, и 413469, дают по меньшей мере 80%-ный ингибирующий эффект. Гэпмеры, имеющие нижеследующие №№ ISIS 412203, 413467, 416825, 416826, 416827, 416868, 416878, 416879, 416892, 416893, 416895, 416896, 416945, 416972 и 416973, дают по меньшей мере 90%-ный ингибирующий эффект. Гэпмеры, имеющие нижеследующие №№ ISIS 416878, 416892, 416895 и 416896, дают по меньшей мере 95%-ный ингибирующий эффект.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 5, были сконструированы в виде 5-10-5-MOE-, 3-14-3-MOE- и 2-13-5-MOE-гэпмеров. Первыми гэпмерами, представленными в таблице 5, являются исходные гэпмеры (см. таблицу 3), из которых были сконструированы остальные гэпмеры методом «микропрогулки» и которые показаны звездочкой. Эти 5-10-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 3-14-3-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из четырнадцати 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждая из которых содержит 3 нуклеотида. 2-13-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из тринадцати 2′-дезоксинуклеотидов. Центральный гэп фланкирован у 5′-конца крылом, содержащим 2 нуклеотида, а у 3′-конца крылом, содержащим 5 нуклеотидов. В каждом мотиве (5-10-5, 3-14-3 и 2-13-5), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Каждый гэпмер, представленный в таблице 5, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3).

Как показано в таблице 5, все 5-10-5-MOE гэпмеры, 3-14-3-MOE-гэпмеры и 2-13-5-MOE-гэпмеры, нацеленные на область-мишень, начинающуюся со старт-сайта-мишени 738 и заканчивающуюся стоп-сайтом-мишенью 762 (то есть в пределах нуклеотидных оснований 738-762) SEQ ID NO:1, ингибируют мРНК фактора 11 по меньшей мере на 45%. Большинство гэпмеров дают по меньшей мере 60%-ный ингибирующий эффект. Некоторые из гэпмеров, включая номера ISIS 412206, 416830, 416831, 416898, 416899, 416900, 416903, 416975, 416976, 416977 и 416980, дают по меньшей мере 80%-ный ингибирующий эффект. Гэпмеры, имеющие нижеследующие №№ ISIS 412206, 416831 и 416900, дают по меньшей мере 90%-ный ингибирующий эффект.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 6, были сконструированы в виде 5-10-5-MOE-, 3-14-3-MOE- и 2-13-5-MOE-гэпмеров. Первыми гэпмерами, представленными в таблице 6, являются исходные гэпмеры (см. таблицу 3), из которых были сконструированы остальные гэпмеры методом «микропрогулки» и которые показаны звездочкой. Эти 5-10-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 3-14-3-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из четырнадцати 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит 3 нуклеотида. 2-13-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из тринадцати 2′-дезоксинуклеотидов. Центральный гэп фланкирован у 5′-конца крылом, содержащим 2 нуклеотида, а у 3′-конца крылом, содержащим 5 нуклеотидов. В каждом мотиве (5-10-5, 3-14-3 и 2-13-5), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Каждый гэпмер, представленный в таблице 6, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3).

Как показано в таблице 6, все 5-10-5-MOE гэпмеры, 3-14-3-MOE-гэпмеры и 2-13-5-MOE-гэпмеры, нацеленные на область-мишень, начинающуюся со старт-сайта-мишени 1018 и заканчивающуюся стоп-сайтом-мишенью 1042 (то есть, в пределах нуклеотидных оснований 1018-1042) SEQ ID NO:1, ингибируют мРНК фактора 11 по меньшей мере на 80%. Гэпмеры, имеющие нижеследующие №№ ISIS 413474, 416837, 416838, 416904, 416907 и 416908, дают по меньшей мере 90%-ный ингибирующий эффект.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 7, были сконструированы в виде 5-10-5-MOE-, 3-14-3-MOE- и 2-13-5-MOE-гэпмеров. Первыми гэпмерами, представленными в таблице 7, являются исходные гэпмеры (см. таблицу 3), из которых были сконструированы остальные гэпмеры методом «микропрогулки» и которые показаны звездочкой. Эти 5-10-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 3-14-3-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из четырнадцати 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит 3 нуклеотида. 2-13-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из тринадцати 2′-дезоксинуклеотидов. Центральный гэп фланкирован у 5′-конца крылом, содержащим 2 нуклеотида, а у 3′-конца крылом, содержащим 5 нуклеотидов. В каждом мотиве (5-10-5, 3-14-3 и 2-13-5), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Каждый гэпмер, представленный в таблице 5, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3).

Как показано в таблице 7, все 5-10-5-MOE гэпмеры, 3-14-3-MOE-гэпмеры и 2-13-5-MOE-гэпмеры, нацеленные на область-мишень, начинающуюся со старт-сайта-мишени 1062 и заканчивающуюся стоп-сайтом-мишенью 1091 (то есть в пределах нуклеотидных оснований 1062-1091) SEQ ID NO:1, ингибируют мРНК фактора 11 по меньшей мере на 20%. Многие гэпмеры, включая 412215, 413476, 413476, 416839, 416840, 416841, 416842, 416843, 416844, 416845, 416846, 416847, 416909, 416910, 416911, 416912, 416913, 416914, 416915, 416916, 416917, 416918, 416986, 416987, 416988, 416989, 416990, 416991, 416992, 416993, 416994, 416995, дают по меньшей мере 50%-ный ингибирующий эффект. Гэпмеры, имеющие нижеследующие №№ ISIS: 412215, 413476, 413476, 416839, 416840, 416841, 416842, 416843, 416844, 416845, 416910, 416911, 416912, 416913, 416914, 416916, 416917, 416986, 416987, 416989, 416991, 416992, 416993 и 416994, дают по меньшей мере 80%-ный ингибирующий эффект. Гэпмеры, имеющие нижеследующие №№ ISIS: 413476, 413476, 416842, 416844, 416910, 416911, 416912, 416913, 416916, 416917 и 416993, дают по меньшей мере 90%-ный ингибирующий эффект.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 8, были сконструированы в виде 5-10-5-MOE-, 3-14-3-MOE- и 2-13-5-MOE-гэпмеров. Первыми гэпмерами, представленными в таблице 8, являются исходные гэпмеры (см. таблицу 3), из которых были сконструированы остальные гэпмеры методом «микропрогулки» и которые показаны звездочкой. Эти 5-10-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 3-14-3-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из четырнадцати 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит 3 нуклеотида. 2-13-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из тринадцати 2′-дезоксинуклеотидов. Центральный гэп фланкирован у 5′-конца крылом, содержащим 2 нуклеотида, а у 3′-конца крылом, содержащим 5 нуклеотидов. В каждом мотиве (5-10-5, 3-14-3 и 2-13-5), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Каждый гэпмер, представленный в таблице 8, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3).

Как показано в таблице 8, все 5-10-5-MOE гэпмеры, 3-14-3-MOE-гэпмеры и 2-13-5-MOE-гэпмеры, нацеленные на область-мишень, начинающуюся со старт-сайта-мишени 1275 и заканчивающуюся стоп-сайтом-мишенью 1318 (то есть в пределах нуклеотидных оснований 1275-1318) SEQ ID NO:1, ингибируют мРНК фактора 11 по меньшей мере на 70%. Многие гэпмеры, включая 412223, 412224, 412225, 413482, 416848, 416849, 416850, 416851, 416852, 416853, 416854, 416855, 416856, 416857, 416858, 416859, 416860, 416861, 416862, 416863, 416864, 416865, 416866, 416867, 416920, 416921, 416922, 416923, 416924, 416925, 416926, 416927, 416928, 416929, 416930, 416931, 416932, 416933, 416934, 416935, 416936, 416937, 416938, 416939, 416940, 416941, 416942, 416943, 416944, 416997, 416998, 416999, 417000, 417001, 417002, 417003, 417004, 417006, 417007, 417008, 417009, 417010, 417011, 417013, 417014, 417015, 417016, 417017, 417018, 417019 и 417020, дают по меньшей мере 80%-ный ингибирующий эффект. Гэпмеры, имеющие нижеследующие №№ ISIS: 412224, 416850, 416853, 416856, 416857, 416858, 416861, 416862, 416864, 416922, 416923, 416924, 416925, 416926, 416928, 416931, 416932, 416933, 416934, 416935, 416937, 416938, 416940, 416941, 416943, 416999, 417002, 416854 и 416859, дают по меньшей мере 90%-ный ингибирующий эффект.

Пример 4

Дозозависимое ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых соединений

Гэпмеры примера 3 (см. таблицы 4, 5, 6, 7 и 8), оказывающие ингибирующее действие in vitro на человеческий фактор 11, тестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 10000 клеток на лунку и трансфицировали реагентом липофектином вместе с антисмысловыми олигонуклеотидами, взятыми в концентрациях 9,375 нМ, 18,75 нМ, 37,5 нМ и 75 нМ, как показано в таблице 9. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам. Как проиллюстрировано в таблице 9, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы.

Гэпмеры также трансфицировали путем электропорации и измеряли уровень дозозависмого ингибирования человеческой мРНК фактора 11. Клетки высевали при плотности 20000 клеток на лунку и трансфицировали путем электропорации с использованием антисмыслового олигонуклеотида, взятого в концентрациях 0,7 мкМ, 2,2 мкМ, 6,7 мкМ и 20 мкМ, как показано в таблице 10. После обработки в течение примерно 16 часов, из клеток выделяли РНК, и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам. Как проиллюстрировано в таблице 10, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы.

Пример 5

Отбор и подтверждение эффективного дозозависимого ингибирования человеческого фактора 11 в клетках HepG2 под действием антисмысловых соединений

Гэпмеры, оказывающие значительное дозозависимое ингибирующее действие на человеческий фактор 11, как описано в примере 4, отбирали и тестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 10000 клеток на лунку и трансфицировали реагентом липофектином вместе с антисмысловыми олигонуклеотидами, взятыми в концентрациях 2,34 нМ, 4,69 нМ, 9,375 нМ, 18,75 нМ, 37,5 нМ и 75 нМ, как показано в таблице 11. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования человеческого фактора 11 по отношению к необработанным контрольным клеткам. Как показано в таблице 11, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы по сравнению с контролем.

Гэпмеры также трансфицировали путем электропорации и измеряли уровень дозозависимого ингибирования мРНК человеческого фактора 11. Клетки высевали при плотности 20000 клеток на лунку и трансфицировали путем электропорации с использованием антисмыслового олигонуклеотида, взятого в концентрациях 625 нМ, 1250 нМ, 2500 нМ, 5000 нМ, 10000 нМ и 20000 нМ, как показано в таблице 12. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК человеческого фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора человеческого 11 по отношению к необработанным контрольным клеткам. Как показано в таблице 12, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы по сравнению с контролем.

Пример 6

Отбор и подтверждение эффективного дозозависимого ингибирования человеческого фактора 11 в первичных гепатоцитах собакоподобных обезьян под действием антисмысловых соединений

Гэпмеры примера 4, оказывающие значительное дозозависимое ингибирующее действие in vitro на человеческий фактор 11, тестировали в различных дозах в первичных гепатоцитах собакоподобных обезьян. Клетки высевали при плотности 35000 клеток на лунку и трансфицировали путем электропорации с использованием антисмыслового олигонуклеотида, взятого в концентрациях 0,74 нМ, 2,2 нМ, 6,7 нМ, 20 нМ, 60 нМ и 180 нМ, как показано в таблице 13. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам. Как показано в таблице 13, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы по сравнению с контролем.

Пример 7

Отбор и подтверждение эффективного дозозависимого ингибирования человеческого фактора 11 в клетках HepB3 под действием антисмысловых соединений с использованием гэпмеров

Гэпмеры примера 4, оказывающие ингибирующее действие in vitro на человеческий фактор 11, тестировали в различных дозах в человеческих клетках HepB3. Клетки высевали при плотности 4000 клеток на лунку и трансфицировали с использованием реагента липофектина вместе с антисмысловым олигонуклеотидом, взятым в концентрациях 2,3 нМ, 4,7 нМ, 9,4 нМ, 18,75 нМ, 37,5 нМ и 75 нМ, как показано в таблице 14. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК человеческого фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам. Как показано в таблице 14, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы по сравнению с контролем.

Гэпмеры также трансфицировали путем электропорации и измеряли уровень дозозависмого ингибирования мРНК человеческого фактора 11. Клетки высевали при плотности 20000 клеток на лунку и трансфицировали путем электропорации с использованием антисмыслового олигонуклеотида, взятого в концентрациях 41,15 нМ, 123,457 нМ, 370,37 нМ, 1111,11 нМ, 3333,33 нМ и 10000 нМ, как показано в таблице 15. После обработки в течение примерно 16 часов, из клеток выделяли РНК и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования человеческого фактора 11 по отношению к необработанным контрольным клеткам. Как показано в таблице 15, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы по сравнению с контролем.

Пример 8

Ингибирование мышиного фактора 11 в первичных мышиных гепатоцитах под действием антисмысловых соединений

Химерные антисмысловые олигонуклеотиды, нацеленные на мышиный фактор 11, конструировали в виде 5-10-5-МОЕ-гэпмеров, нацеленных на мышиный фактор 11 (последовательность GENBANK рег. № NM_028066.1, представленная здесь как SEQ ID NO:6). Гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит 5 нуклеотидов. Каждый нуклеотид в каждом сегменте-крыле имеет 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Антисмысловые олигонуклеотиды оценивали на их способность снижать уровни мышиной мРНК фактора 11 в первичных мышиных гепатоцитах.

Первичные мышиные гепатоциты обрабатывали антисмысловыми олигонуклеотидами в концентрациях 6,25 нМ, 12,5 нМ, 25 нМ, 50 нМ, 100 нМ и 200 нМ в течение примерно 24 часов. Из этих клеток выделяли РНК, и уровни мышиной мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для мышиного фактора 11, RTS 2898 (последовательность прямого праймера ACATGACAGGCGCGATCTCT, представленная здесь как SEQ ID NO:7; последовательность обратного праймера TCTAGGTTCACGTACACATCTTTGC, представленная здесь как SEQ ID NO:8; последовательность зонда TTCCTTCAAGCAATGCCCTCAGCAATX, представленная здесь как SEQ ID NO:9). Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Некоторые мышиные антисмысловые олигонуклеотиды давали дозозависимое снижение уровней мРНК фактора 11.

Пример 9

Ингибирование мышиного фактора 11 в первичных мышиных гепатоцитах под действием перекрестно-реагирующих антисмысловых олигонуклеотидов

Антисмысловые олигонуклеотиды, нацеленные на мышиную нуклеиновую кислоту мышиного фактора 11, тестировали на их влияние на мРНК фактора 11 in vitro. Первичные мышиные гепатоциты, культивированные при плотности 10000 клеток на лунку, обрабатывали антисмысловым олигонуклеотидом в концентрации 100 нМ. После обработки в течение примерно 24 часов, из клеток выделяли РНК и измеряли уровни мРНК мышиного фактора 11 с помощью количественной ПЦР в реальном времени. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 16, были сконструированы в виде 5-10-5-MOE-гэпмеров. Эти гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. Каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «мышиный сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер. Термин «мышиный стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер. Все перечисленные мышиные олигонуклеотиды перекрестно реагируют с мРНК мышиного фактора 11 (GENBANK рег. № NM_028066.1), представленной здесь как SEQ ID NO:6 и с мРНК человеческого фактора 11 (GENBANK рег. № NM_000128.3), представленной здесь как SEQ ID NO:1. Термин «человеческий сайт инициации, являющийся мишенью» означает самый крайний 5′-нуклеотид в человеческой мРНК (GENBANK рег. № NM_000128.3), на которую нацелен указанный антисмысловой олигонуклеотид. Термин «человеческий стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид в человеческой мРНК (GENBANK рег. № NM_000128.3), на которую нацелен указанный антисмысловой олигонуклеотид. Термин «число несоответствий» означает число несоответствий между мышиным олигонуклеотидом и последовательностью человеческой мРНК.

Пример 10

Ингибирование in vivo мышиного фактора 11 антисмысловыми олигонуклеотидами

Некоторые антисмысловые олигонуклеотиды, нацеленные на мРНК мышиного фактора 11 (последовательность GENBANK рег. № NM_028066.1, представленную здесь как SEQ ID NO:6) и обнаруживающие статистически значимое дозозависимое ингибирование, оценивали in vivo. Мышей BALB/c обрабатывали последовательностью ISIS 404057 (TCCTGGCATTCTCGAGCATT, старт-сайт-мишенью 487, представленной здесь как SEQ ID NO:10) и последовательностью ISIS 404071 (TGGTAATCCACTTTCAGAGG, старт-сайт-мишенью 869, представленной здесь как SEQ ID NO:11).

Обработка

Мышам BALB/c два раза в неделю в течение 3 недель инъецировали 5 мг/кг, 10 мг/кг, 25 мг/кг или 50 мг/кг ISIS 404057 или ISIS 404071. Мышам контрольной группы два раза в неделю в течение 3 недель инъецировали забуференный фосфатом физиологический раствор (PBS). Через 5 дней после введения последней дозы, мышей умерщвляли. Целую печень брали для анализа РНК, а плазму брали для анализа свертывания крови (ПВ и АПТВ) и анализа на белок.

Анализ РНК

Из ткани печени экстрагировали РНК для анализа на фактор 11, проводимого с помощью ПЦР в реальном времени. Как показано в таблице 17, антисмысловые олигонуклеотиды давали дозозависимое снижение уровней мышиного фактора 11 по сравнению с PBS-контролем. Результаты представлены как процент ингибирования фактора 11 по отношению к контролю.

Таблица 17
Дозозависимое ингибирование мРНК мышиного фактора 11 антисмысловыми олигонуклеотидами у мышей BALB/c
мг/кг % ингибирования
404057 5 40
10 64
25 85
50 95
404071 5 72
10 82
25 93
50 96

Анализ ПВ и АПТВ

Протромбиновое время (ПВ) и активированное парциальное тромбопластиновое время (АПТВ) измеряли с использованием обедненной тромбоцитами плазмы (PPP), взятой у мышей, обработанных последовательностями ISIS 404057 и ISIS 404071. Величины ПВ и АПТВ, представленные в таблице 18, выражали в Международных величинах нормализованных отношений (INR). Величины INR для ПВ и АПТВ вычисляли путем деления величин ПВ или АПТВ для каждой экспериментальной группы (то есть у животных, обработанных 5 мг/кг, 10 мг/кг, 25 мг/кг и 50 мг/кг ISIS 404057 или ISIS 404071) на величины ПВ или АПТВ для PBS-обработанной группы. Затем это отношение возводили в степень, равную Международной величине показателя чувствительности (ISI) используемого тканевого фактора. Как показано в таблице 18, ПВ значительно не увеличивалось у мышей, обработанных ISIS 404057 или ISIS 404071. Однако, АПТВ у мышей, обработанных ISIS 404057 или ISIS 404071, увеличивалось в зависимости от дозы. Эти данные дают основание предположить, что снижение уровня фактора 11 под действием антисмысловых олигонуклеотидов влияет на путь контактной активации, но не влияет на внешний путь реакции свертывания крови.

Анализ на белок

Уровень профермента фактора 11 в плазме мышей, обработанных ISIS 404071, измеряли с помощью анализа на Fl1, проводимого исходя из оценки времени свертывания крови. Время свертывания крови определяли с двумя повторностями на полуавтоматическом оборудовании для оценки свертывания крови ST4 (Diagnostica Stago, NJ). Тридцать микролитров обработанной цитратом пробы плазмы, разведенной 1/20 в HEPES-NaCl-буфере с BSA, инкубировали с 30 мкл реагента для АПТВ (реагент фактора 3 тромбоцитов плюс состоящий из частиц активатор) и 30 мкл обработанной цитратом плазмы, дефицитной по фактору 11 (врожденное заболевание человека, George King Bio-Medical Inc.) при 37°C для инициации свертывания крови. Результаты интерполировали по стандартной кривой для серийного разведения цитрат-содержащей контрольной мышиной плазмы.

Как показано в таблице 19, обработка ISIS 404071 приводила к значимому дозозависимому снижению уровня белка фактора 11. Результаты представлены как процент ингибирования фактора 11 по отношению к PBS-контролю.

Таблица 19
Дозозависимое ингибирование мышиного белка фактора 11 под действием ISIS 404071 у мышей BALB/c
Доза (мг/кг) % ингибирования
5 39
10 67
25 89
50 96

Пример 11

Эффект in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом у животных с моделью FeCl3-индуцированного венозного тромбоза (ВТ) по сравнению с варфарином

Обработка

ISIS 404071 и варфарин (COUMADIN) тестировали у мышей с моделью FeCl3-индуцированного BT. Мышей BALB/c шести групп обрабатывали путем подкожного введения 1,25 мг/кг, 2,5 мг/кг, 5 мг/кг, 10 мг/кг, 20 мг/кг или 40 мг/кг ISIS 404071 два раза в неделю в течение 3 недель. Через два дня после введения последней дозы ISIS 404071, мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина. Мышей BALB/c других шести групп обрабатывали 0,5 мг/кг, 1 мг/кг, 2 мг/кг, 3 мг/кг, 4 мг/кг и 5 мг/кг варфарина путем ежедневного внутрибрюшинного введения в течение 6 дней. Через четыре часа после введения последней дозы варфарина, мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина. Мышей BALB/c двух контрольных групп обрабатывали PBS путем подкожного введения два раза в неделю в течение 3 недель. Через два дня после введения последней дозы PBS, мышей обеих групп анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина. Образование тромбов индуцировали путем введения FeCl3 мышам всех групп, за исключением мышей первой контрольной группы.

У мышей, подвергаемых FeCl3-обработке, образование тромбов индуцировали путем нанесения непосредственно на полую вену кусочка фильтровальной бумаги (2×4 мм), предварительно пропитанной 10% раствором FeCl3. После обработки в течение 3 минут, фильтровальную бумагу удаляли. Через тридцать минут после нанесения фильтровальной бумаги, вену фиксированной длины, имеющую тромб, вырезали для анализа на тромбоциты. Печень брали для анализа на РНК.

Анализ на РНК

Из ткани печени экстрагировали РНК для анализа на фактор 11, проводимого с помощью ПЦР в реальном времени. Результаты представлены как процент ингибирования фактора 11 по сравнению с PBS-контролем. Как показано в таблице 20, обработка олигонуклеотидом ISIS 404071 приводила к значимому дозозависимому снижению уровня мРНК фактора 11 по сравнению с PBS-контролем. И наоборот, обработка варфарином не приводила к значимому снижению уровня фактора 11 по сравнению с PBS-контролем.

Таблица 20
Дозозависимое снижение уровня мРНК фактора 11 у животных с моделью FeCl3-индуцированного венозного тромбоза
Обработка Доза, мг/кг % ингибирования
Варфарин 0,5 0
1 0
2 1
3 5
4 8
5 11
ISIS 404071 1,25 0
2,5 8
5 62
10 78
20 92
40 96

Количественная оценка тромбоцитарной формулы

Количественную оценку тромбоцитарного фактора-4 (PF-4), проводимую с помощью ПЦР в реальном времени, осуществляли для определения количества тромбоцитов в полой вене как показателя образования тромба. Результаты представлены как процент PF-4 у мышей, обработанных ISIS 404071 или варфарином, по отношению к PF-4 у двух контрольных PBS-обработанных групп. Как показано в таблице 21, обработка олигонуклеотидом ISIS 404071 приводила к дозозависимому снижению PF-4 по сравнению с PBS-контролем для доз 5 мг/кг и выше. Обработка варфарином приводила к снижению уровня PF-4 по сравнению с PBS-контролем при дозах 2 мг/кг и выше. Поэтому, снижение уровня фактора 11 под действием рассматриваемых здесь соединений является эффективным для ингибирования образования тромбов и сгустков крови.

Таблица 21
Анализ образования тромбов путем проведения количественной оценки PF-4 с помощью ПЦР в реальном времени у животных с моделью FeCl3-индуцированного венозного тромбоза
Доза мг/кг PF-4
PBS-FeCl3 0
PBS+FeCl3 100
Варфарин 0,5 128
1 124
2 80
3 21
4 12
5 33
ISIS 404071 1,25 143
2,5 120
5 95
10 21
20 37
40 20

Пример 12

Эффект in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом по сравнению с варфарином в анализе на кровотечение из хвоста

Обработка

Кровотечение из хвоста оценивали для того, чтобы определить, приводит ли обработка ISIS 404071 или варфарином к внутреннему кровоизлиянию у мышей. ISIS 404071 и варфарин (COUMADIN) оценивали в анализе на кровотечение из хвоста. Мышей BALB/c шести групп обрабатывали 1,25 мг/кг, 2,5 мг/кг, 5 мг/кг, 10 мг/кг, 20 мг/кг или 40 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель. Мышей BALB/c других 6 групп обрабатывали 0,5 мг/кг, 1 мг/кг, 2 мг/кг, 3 мг/кг, 4 мг/кг и 5 мг/кг варфарина путем ежедневного внутрибрюшинного введения в течение 6 дней. Мышей BALB/c отдельной контрольной группы обрабатывали PBS, который подкожно вводили два раза в неделю в течение 3 недель.

Анализ на кровотечение из хвоста

Через два дня после последней обработки ISIS 404071, варфарином или PBS, мышей помещали в камеру для анализа на кровотечение из хвоста. В данной камере, мышей анестезировали изофлураном, и стерильными ножницами отрезали небольшой кусочек хвоста (приблизительно 4 мм от кончика). Затем отрезанный кусочек хвоста сразу помещали в 15-миллилитровую пробирку Falcon, заполненную приблизительно 10 мл 0,9% буферного раствора NaCl, нагретого до 37°C. Забор крови осуществляли в течение 40 минут. Пробирки, заполненные физиологическим раствором, взвешивали до и после кровотечения. Результаты представлены в таблице 22.

Обработка ISIS 404071 не влияла на кровотечение по сравнению с PBS-обработанными мышами. Однако, у мышей, обработанных варфарином, наблюдалось усиление кровотечения по сравнению с контрольными PBS-обработанными мышами. Повышенные дозы варфарина прямо пропорционально коррелировали с увеличением потери крови. Полученные данные позволяют предположить, что рассматриваемые здесь соединения имеют низкую гемморагическую активность, особенно по сравнению с варфавином. Эти данные вместе с результатами, представленными в примере 11, позволяют предположить, что ингибирование фактора 11 описанными здесь соединениями является эффективным для достижения антитромбоцитарной активности и не ассоциируется с каким-либо риском возникновения кровотечения.

Таблица 22
Анализ на кровотечение из хвоста у животных с моделью FeCl3-индуцированного венозного тромбоза
Обработка Доза мг/кг Кровь (г)
PBS 0 0,01
Варфарин 0,5 0,07
1 0,35
2 0,39
3 0,51
4 0,52
5 0,76
ISIS 404071 1,25 0,00
2,5 0,00
5 0,03
10 0,00
20 0,06
40 0,03

Пример 13

In vivo влияние ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом и варфарином на ПВ и АПТВ

Обработка

ПВ и АПТВ измеряли с использованием обедненной тромбоцитами плазмы (PPP), взятой у мышей, обработанных ISIS 404071 или варфарином. Мышей BALB/c шести групп обрабатывали 1,25 мг/кг, 2,5 мг/кг, 5 мг/кг, 10 мг/кг, 20 мг/кг или 40 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель. Мышей BALB/c других 6 групп обрабатывали 0,5 мг/кг, 1 мг/кг, 2 мг/кг, 3 мг/кг, 4 мг/кг и 5 мг/кг варфарина путем ежедневного внутрибрюшинного введения в течение 6 дней. Мышей BALB/c контрольной группы обрабатывали PBS путем подкожного введения два раза в неделю в течение 3 недель. Через два дня после введения последней дозы брали PPP и проводили анализы на ПВ и АПТВ.

Анализ на ПВ и АПТВ

Величины ПВ и АПТВ, представленные в таблице 16, были выражены как Международные величины нормализованных отношений (INR). Величины INR для ПВ и АПТВ были определены путем деления величины ПВ или АПТВ для каждой экспериментальной группы (то есть у животных, обработанных 5 мг/кг, 10 мг/кг, 25 мг/кг и 50 мг/кг ISIS 404071) на величину ПВ или АПТВ для PBS-обработанной группы. Затем это отношение возводили в степень, равную Международной величине показателя чувствительности (ISI) используемого тканевого фактора. Как показано в таблице 23, у мышей, обработанных варфарином, ПВ значительно увеличивалось в зависимости от дозы. У мышей, обработанных варфарином, АПТВ увеличивалось, в частности, при дозах 1 мг/кг и выше. ISIS 404071 не оказывал значительного влияния на ПВ, но увеличивал АПТВ, однако, такое увеличение не было таким значительным, как у мышей, обработанных варфарином. Эти данные дают основание предположить, что ISIS 404071 влияет на путь контактной активации, но не влияет на внешний путь реакции свертывания крови, тогда как варфарин влияет и на путь контактной активации и на внешний путь реакции свертывания крови.

Таблица 23
Влияние ISIS 404071 и варфарина на ПВ и АПТВ у мышей BALB/c
Обработка Доза в мг/кг INR для ПВ INR для АПТВ
Варфарин 0,5 1,41 1,10
1 2,03 1,31
2 2,77 1,54
3 22,76 2,90
4 6,74 2,18
5 9,20 2,29
ISIS 404071 1,25 0,99 0,98
2,5 1,01 1,03
5 1,07 1,09
10 1,08 1,29
20 1,09 1,32
40 0,98 1,64

Пример 14

Эффект in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом у животных с моделью FeCl3-индуцированного венозного тромбоза (ВТ) по сравнению с апиксабаном

Обработка

ISIS 404071 и апиксабан тестировали у мышей с моделью FeCl3-индуцированного BT. Мышей BALB/c шести групп обрабатывали путем подкожного введения 1,25 мг/кг, 2,5 мг/кг, 5 мг/кг, 10 мг/кг, 20 мг/кг или 40 мг/кг ISIS 404071 два раза в неделю в течение 3 недель. Через два дня после введения последней дозы ISIS 404071, мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина. Мышей BALB/c других шести групп обрабатывали 0,5 мг/кг, 1 мг/кг, 2 мг/кг, 3 мг/кг, 4 мг/кг и 5 мг/кг апиксабана путем однократного подкожного введения. Через двадцать минут после введения апиксабана, мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина. Мышей BALB/c двух контрольных групп обрабатывали PBS путем подкожного введения два раза в неделю в течение 3 недель. Через два дня после введения последней дозы PBS, мышей обеих групп анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина. Образование тромбов индуцировали путем введения FeCl3 мышам всех групп, за исключением мышей первой контрольной группы.

У мышей, подвергаемых FeCl3-обработке, образование тромбов индуцировали путем нанесения непосредственно на полую вену кусочка фильтровальной бумаги (2×4 мм), предварительно пропитанной 10% раствором FeCl3. После обработки в течение 3 минут, фильтровальную бумагу удаляли. Через тридцать минут после нанесения фильтровальной бумаги, вену фиксированной длины, имеющую тромб, вырезали для анализа на тромбоциты. Печень брали для анализа на РНК.

Анализ на РНК

Из ткани печени экстрагировали РНК для анализа на фактор 11, проводимого с помощью ПЦР в реальном времени. Результаты представлены как процент ингибирования фактора 11 по отношению к PBS-контролю. Как показано в таблице 24, обработка олигонуклеотидом ISIS 404071 приводила к значимому дозозависимому снижению уровня мРНК фактора 11 по сравнению с PBS-контролем. И наоборот, обработка апиксабаном не приводила к значимому снижению уровня фактора 11 по сравнению с PBS-контролем.

Таблица 24
Дозозависимое снижение уровня мРНК фактора 11 у животных с моделью FeCl3-индуцированного венозного тромбоза
Доза, мг/кг % ингибирования
Апиксабан 0,5 5
2 8
5 12
10 2
20 0
ISIS 404071 1,25 15
2,5 44
5 63
10 76
25 91
50 95

Количественная оценка тромбоцитарной формулы

Количественную оценку тромбоцитарного фактора-4 (PF-4), проводимую с помощью ПЦР в реальном времени, осуществляли для определения количества тромбоцитов в полой вене как показателя образования тромба. Как показано в таблице 25, обработка олигонуклеотидом ISIS 404071 приводила к снижению уровня PF-4 по сравнению с PBS-контролем. Обработка апиксабаном также приводила к снижению уровня PF-4 по сравнению с PBS-контролем. Результаты представлены как процент PF-4 у мышей, обработанных ISIS 404071 или апиксабаном, по отношению к PF-4 у мышей двух PBS-обработанных контрольных групп.

Таблица 25
Анализ образования тромбов путем проведения количественной оценки PF-4 с помощью ПЦР в реальном времени у животных с FeCl3-индуцированным венозным тромбозом
Обработка Доза, мг/кг PF-4
PBS-FeCl3 0
PBS+FeCl3 100
Апиксабан 0,5 67
2 46
5 15
10 5
20 26
ISIS 404071 1,25 42
2,5 87
5 60
10 28
25 14
50 4

Пример 15

Эффект in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом по сравнению с апиксабаном в анализе на кровотечение из хвоста

Обработка

Кровотечение из хвоста оценивали для того, чтобы определить, приводит ли обработка ISIS 404071 или апиксабаном к внутреннему кровоизлиянию у мышей. ISIS 404071 и апиксабан оценивали в анализе на кровотечение из хвоста. Мышей BALB/c шести групп обрабатывали 1,25 мг/кг, 2,5 мг/кг, 5 мг/кг, 10 мг/кг, 20 мг/кг или 40 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель. Мышей BALB/c других 6 групп обрабатывали 0,5 мг/кг, 1 мг/кг, 2 мг/кг, 3 мг/кг, 4 мг/кг и 5 мг/кг апиксабана путем введения одной подкожной дозы. Мышей BALB/c отдельной контрольной группы обрабатывали PBS, который подкожно вводили два раза в неделю в течение 3 недель.

Анализ на кровотечение из хвоста

Через два дня после последней обработки ISIS 404071, апиксабаном или PBS, мышей помещали в камеру для анализа на кровотечение из хвоста. В данной камере, мышей анестезировали, и стерильными ножницами отрезали небольшой кусочек хвоста (приблизительно 4 мм от кончика). Затем отрезанный кусочек хвоста сразу помещали в 15-миллилитровую пробирку Falcon, заполненную приблизительно 10 мл 0,9% буферного раствора NaCl, нагретого до 37°C. Забор крови осуществляли в течение 40 минут. Пробирки, заполненные физиологическим раствором, взвешивали до и после забора крови.

Как показано в таблице 26, обработка ISIS 404071 не влияла на кровотечение по сравнению с PBS-обработанными мышами. Однако, у мышей, обработанных апиксабаном, наблюдалось усиление кровотечения по сравнению с PBS-контролем. Повышенные дозы апиксабана прямо пропорционально коррелировали с увеличением потери крови. Полученные данные позволяют предположить, что рассматриваемые здесь соединения имеют низкую гемморагическую активность, особенно по сравнению с апиксабаном. Эти данные вместе с результатами, представленными в примере 14, позволяют предположить, что ингибирование фактора 11 описанными здесь соединениями является эффективным для достижения антитромбоцитарной активности и не ассоциируется с каким-либо риском возникновения кровотечения.

Таблица 26
Анализ на кровотечение из хвоста у мышей BALB/c
мг/кг Кровь (г)
PBS 0 0,06
Апиксабан 0,5 0,03
2 0,34
5 0,37
10 0,40
20 0,52
ISIS 404071 1,25 0,00
2,5 0,03
5 0,00
10 0,04
25 0,01
50 0,01

Пример 16

Ex vivo эффект ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в комбинации с LOVENOX

Обработка

Мышей BALB/c трех групп обрабатывали 10 мг/кг, 20 мг/кг или 40 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель. Мышей контрольной группы обрабатывали PBS путем введения два раза в неделю в течение 3 недель. Через пять дней после введения последней дозы, мышей умерщвляли и брали плазму. В полученную плазму ex vivo вводили низкомолекулярный (LMW) гепарин LOVENOX в различных концентрациях, составляющих 0 мкг/мл, 2,5 мкг/мл, 5,0 мкг/мл и 7,5 мкг/мл. ПВ и АПТВ измеряли через 20 минут после введения LOVENOX.

Анализ на ПВ и АПТВ

Как показано в таблице 27, обработка LOVENOX приводила к дозозависимому увеличению ПВ. Обработка ISIS 404071 не приводила к значительному увеличению ПВ. Обработка ISIS 404071 не оказывала значительного влияния на ПВ. Это указывало на то, что обработка плазмы ISIS 404071 и LOVENOX не оказывала комбинированного действия на ПВ.

Как показано в таблице 28, обработка LOVENOX приводила к дозозависимому увеличению АПТВ. Обработка ISIS 404071 также приводила к дозозависимому увеличению АПТВ. Кроме того, как было обнаружено, обработка комбинацией ISIS 404071 и LOVENOX оказывала синергическое действие на АПТВ.

Пример 17

In vivo эффект ингибирования мышиного фактора 11 под действием антисмыслового олигонуклеотида в комбинации с LOVENOX у мышей с моделью FeCl3-индуцированного венозного тромбоза (BT)

Обработка

Комбинацию ISIS 404071 и LOVENOX тестировали у мышей с моделью FeCl3-индуцированного BT. Мышей BALB/c четырех групп обрабатывали путем подкожного введения 15 мг/кг, 30 мг/кг, 45 мг/кг или 60 мг/кг LOVENOX один раз в день в течение 3 дней. Мышей BALB/c других 4 групп обрабатывали 20 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель. После введения последней дозы ISIS 404071, мышей обрабатывали 15 мг/кг, 30 мг/кг, 45 мг/кг или 60 мг/кг LOVENOX путем подкожного введения один раз в день в течение 3 дней. Мышей BALB/c двух контрольных групп обрабатывали PBS путем подкожного введения два раза в неделю в течение трех недель. Образование тромбов индуцировали путем введения FeCl3 всем мышам, за исключением мышей первой контрольной группы. Всех мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина.

У мышей, подвергаемых FeCl3-обработке, образование тромбов индуцировали путем нанесения непосредственно на полую вену кусочка фильтровальной бумаги (2×4 мм), предварительно пропитанной 10% раствором FeCl3. После обработки в течение 3 минут, фильтровальную бумагу удаляли. Через тридцать минут после нанесения фильтровальной бумаги, вену фиксированной длины, имеющую тромб, вырезали для анализа на тромбоциты.

Количественная оценка тромбоцитарной формулы

Количественную оценку PF-4, проводимую с помощью ПЦР в реальном времени, осуществляли для определения количества тромбоцитов в полой вене как показателя образования тромба. Как показано в таблице 29, обработка LOVENOX приводила к снижению уровня PF-4 по сравнению с PBS-контролем. Обработка LOVENOX в комбинации с ISIS 404071 приводила к значительному снижению уровня PF-4 по сравнению с обработкой одним LOVENOX.

Таблица 29
Анализ образования тромбов путем проведения количественной оценки PF-4 с помощью ПЦР в реальном времени у животных с FeCl3-индуцированным венозным тромбозом
Обработка мг/кг PF-4
PBS-FeCl3 0
PBS+FeCl3 100
LOVENOX 15 57
30 33
45 10
60 5
LOVENOX (+ISIS 404071) 15 0
30 0
45 11
60 5

Пример 18

Эффект in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в комбинации с LOVENOX в анализе на кровотечение

Обработка

Кровотечение из хвоста оценивали для того, чтобы определить, приводит ли обработка ISIS 404071 и LOVENOX к внутреннему кровоизлиянию у мышей. ISIS 404071 вводили подкожно в дозе 20 мг/кг два раза в неделю в течение 3 недель мышам BALB/c четырех групп, а LOVENOX вводили подкожно в различных дозах, составляющих 15 мг/кг, 30 мг/кг, 45 мг/кг и 60 мг/кг, один раз в день в последние три дня обработки ISIS 404071. Мышам BALB/c пятой группы подкожно вводили ISIS 404071 в дозе 20 мг/кг два раза в неделю в течение 3 недель. Мышам BALB/c шестой группы подкожно вводили PBS два раза в неделю в течение трех недель в качестве контроля.

Анализ на кровотечение из хвоста

Через два дня после последней обработки, мышей помещали в камеру для анализа на кровотечение из хвоста. В данной камере, мышей анестезировали изофлураном, и стерильными ножницами отрезали небольшой кусочек хвоста (приблизительно 4 мм от кончика). Затем отрезанный кусочек хвоста сразу помещали в 15-миллилитровую пробирку Falcon, заполненную приблизительно 10 мл 0,9% буферного раствора NaCl, нагретого до 37°C. Забор крови осуществляли в течение 40 минут. Пробирки, заполненные физиологическим раствором, взвешивали до и после кровотечения.

Как показано в таблице 30, обработка LOVENOX приводила к повышению кровотечения у мышей по сравнению с PBS-обработанными мышами. Повышенные дозы LOVENOX прямо пропорционально коррелировали с усилением потери крови. Обработка комбинацией ISIS 404071 и LOVENOX не приводила к значительному увеличению кровотечения, тогда как обработка мышей одним лишь LOVENOX приводила к усилению потери крови.

Таблица 30
Анализ на кровотечение из хвоста, проводимый путем сравнения эффекта LOVENOX и комбинации LOVENOX и ISIS 404071
Доза мг/кг Кровь (г)
PBS 0,05
LOVENOX 15 0,11
30 0,20
45 0,27
60 0,47
LOVENOX (+ISIS 404071) 15 0,14
30 0,19
45 0,36
60 0,61

Пример 19

In vivo влияние ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в комбинации с LOVENOX на ПВ и АПТВ

Обработка

ПВ и АПТВ измеряли с использованием обедненной тромбоцитами плазмы (PPP), взятой у мышей, обработанных комбинацией ISIS 404071 и LOVENOX. Мышам BALB/c первой группы подкожно вводили ISIS 404071 в дозе 25 мг/кг два раза в неделю в течение 3 недель. Через 5 дней после введения последней дозы ISIS 404071, у этих мышей брали плазму. Мышам BALB/c второй группы подкожно вводили LOVENOX в дозе 20 мг/кг один раз в день в течение трех дней. Через 4 часа после введения последней дозы LOVENOX, у этих мышей брали плазму. Мышам BALB/c третьей группы подкожно вводили ISIS 404071 в дозе 20 мг/кг два раза в неделю в течение 3 недель, а через 2 дня после введения последней дозы ISIS 404071 подкожно вводили LOVENOX в дозе 20 мг/кг один раз в день. Через 4 часа после введения последней дозы LOVENOX, у этих мышей брали плазму. Мышам четвертой группы подкожно вводили PBS два раза в неделю в течение трех недель в качестве контроля. Через 5 дней после введения последней дозы, у этих мышей брали плазму.

Анализ на ПВ и АПТВ

Величины ПВ и АПТВ, представленные в таблице 31, были выражены как Международные величины нормализованных отношений (INR). Как показано в таблице 31, обработка ISIS 404071, LOVENOX или комбинацией ISIS 404071 и LOVENOX не оказывала значительного влияния на ПВ. Полученные данные позволяют предположить, что обработка комбинацией ISIS 404071 и LOVENOX не оказывает комбинированного действия на ПВ. Кроме того, как показано в таблице 31, обработка LOVENOX и обработка комбинацией ISIS 404071 и LOVENOX приводили к увеличению АПТВ. Полученные данные позволяют предположить, что обработка комбинацией ISIS 404071 и LOVENOX дает аддитивный эффект в отношении АПТВ.

Таблица 31
Влияние комбинации ISIS 404071 и LOVENOX на ПВ и АПТВ в мышиной плазме
INR для ПВ INR для АПТВ
ISIS 404071 0,95 1,31
LOVENOX 1,04 2,04
404071+LOVENOX 1,04 2,58

Пример 20

In vivo влияние ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в комбинации с апиксабаном на ПВ и АПТВ

Обработка

ПВ и АПТВ измеряли с использованием обедненной тромбоцитами плазмы (PPP), взятой у мышей, обработанных комбинацией ISIS 404071 и апиксабана. Мышам BALB/c первой группы подкожно вводили ISIS 404071 в дозе 25 мг/кг два раза в неделю в течение 3 недель. Через 5 дней после введения последней дозы ISIS 404071, у этих мышей брали плазму. Мышам BALB/c второй группы подкожно вводили апиксабан в дозе 6 мг/кг два раза в день в течение трех дней. Через 20 минут после введения последней дозы апиксабана, у этих мышей брали плазму. Мышам BALB/c третьей группы подкожно вводили ISIS 404071 в дозе 20 мг/кг два раза в неделю в течение 3 недель, и в последние три дня обработки ISIS 404071 ежедневно подкожно вводили апиксабан в дозе 6 мг/кг два раза в день. Через 20 минут после введения последней дозы апиксабана, у этих мышей брали плазму. Мышам четвертой группы подкожно вводили PBS два раза в неделю в течение 3 недель в качестве контроля. Через 5 дней после введения последней дозы PBS, у этих мышей брали плазму.

Анализ на ПВ и АПТВ

Величины ПВ и АПТВ, представленные в таблице 32, были выражены как Международные величины нормализованных отношений (INR). Как показано в таблице 32, обработка ISIS 404071 не оказывала значительного влияния на ПВ. Однако, обработка апиксабаном и комбинацией апиксабана и ISIS 404071 приводила к увеличению ПВ. Кроме того, как показано в таблице 32, обработка апиксабаном, ISIS 404071 и комбинацией ISIS 404071 и апиксабана приводила к увеличению АПТВ.

Таблица 32
Влияние комбинации ISIS 404071 и апиксабана на ПВ и АПТВ в мышиной плазме
INR для ПВ INR для АПТВ
ISIS 404071 0,95 1,31
Апиксабан 3,25 1,44
404071+ апиксабан 3,50 2,26

Пример 21

In vivo влияние ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в комбинации с варфарином на ПВ и АПТВ

Обработка

ПВ и АПТВ измеряли с использованием обедненной тромбоцитами плазмы (PPP), взятой у мышей, обработанных комбинацией ISIS 404071 и варфарина. Мышам BALB/c двух групп подкожно вводили 25 мг/кг или 50 мг/кг ISIS 404071 два раза в неделю в течение 3 недель. Через 5 дней после введения последней дозы ISIS 404071, у мышей каждой группы брали плазму. Мышей BALB/c третьей группы обрабатывали 2 мг/кг варфарина один раз в день в течение 5 дней. Через 6 часов после введения последней дозы варфарина, у мышей брали плазму. Мышей BALB/c двух других групп обрабатывали 25 мг/кг или 50 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель, и в последние 5 дней обработки ISIS 404071, мышам ежедневно подкожно вводили варфарин в дозе 2 мг/кг. Через 6 часов после последней обработки варфарином, у мышей каждой группы брали плазму. Мышам BALB/c последней группы подкожно вводили PBS два раза в неделю в течение 3 недель в качестве контроля. Через 5 дней после последней обработки PBS, у этих мышей брали плазму.

Анализ на ПВ и АПТВ

Величины ПВ и АПТВ, представленные в таблице 33, были выражены как Международные величины нормализованных отношений (INR). Как показано в таблице 33, обработка PBS или ISIS 404071 в любой дозе не оказывала влияния на ПВ. Однако, обработка 2 мг/кг варфарина, 25 мг/кг ISIS 404071 в комбинации с 2 мг/кг варфарина и 50 мг/кг ISIS 404071 в комбинации с 2 мг/кг варфарина приводила к увеличению ПВ. Полученные данные позволяют предположить, что обработка комбинацией ISIS 404071 и варфарина оказывала аддитивное действие на ПВ. Кроме того, как показано в таблице 33, обработка ISIS 404071 и варфарином оказывала воздействие на АПТВ. Обработка комбинацией ISIS 404071 и варфарина приводила к большему увеличению АПТВ, чем обработка любым из отдельно взятых лекарственных средств. Полученные данные позволяют предположить, что обработка комбинацией ISIS 404071 и варфарина дает синергический эффект в отношении АПТВ.

Таблица 33
Влияние комбинации ISIS 404071 и варфарина на ПВ и АПТВ в мышиной плазме
Доза, мг/кг INR для ПВ INR для АПТВ
ISIS 404071 25 0,98 1,37
50 0,93 1,49
Варфарин 2 21,33 2,52
ISIS 404071 (+ варфарин) 25 25,77 4,45
50 36,33 4,75

Пример 22

Антитромботический эффект in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в отношении тромбоза брыжеечной вены у мышей

Обработка

Мышам C57BL/6 первой группы подкожно вводили ISIS 404071 два раза в неделю в течение трех недель в дозе 50 мг/кг. Мышам C57BL/6 второй группы два раза в неделю в течение трех недель подкожно вводили 50 мг/кг контрольного олигонуклеотида ISIS 405277 (AAGGACCTACACTATGGAAT; антисмыслового олигонуклеотида для фактора 2), представленного здесь как SEQ ID NO:12.

Получение тромбоцитов

У не подвергавшихся ранее обработке мышей C57BL/6, из ретроорбитального венозного сплетения брали кровь путем пункции, и эту кровь собирали в полипропиленовые пробирки, содержащие 300 мкл гепарина (30 ед/мл). Богатую тромбоцитами плазму (PRP) получали путем центрифугирования при 1000 об/мин в течение 5 минут. Затем PRP переносили в свежие пробирки, содержащие 2 мкл простагландина-I2 (PGI2) (2 мкг/мл) и инкубировали при 37°C в течение 5 минут. После центрифугирования при 2600 об/мин, осадок ресуспендировали в 1 мл модифицированного раствора Тироде-буфера HEPES (137 мМ NaCl, 0,3 мМ Na2HPO4, 2 мМ KCl, 12 мМ NaHCO3, 5 мМ HEPES, 5 мМ глюкозы, 0,35% BSA, pH 7,2), содержащего 2 мкл PGI2, и инкубировали при 37°C в течение 5 минут. Суспендированный осадок центрифугировали при 2600 об/мин в течение 5 минут. Для удаления PGI2, стадию промывки повторяли два раза и тромбоциты подвергали флуоресцентному мечению 2,5 мкг/мл кальцеина АМ (Molecular Probes, Eugene, OR) в течение 10 минут при комнатной температуре.

Микроскопический анализ жизненно важных органов на тромбоз

Мышам C57BL/6, обработанным ISIS 404071 и контрольным олигонуклеотидом, внутривенно инъецировали флуоресцентно меченные тромбоциты. Этих мышей анестезировали 2,5% авертином и в стенке брюшной полости делали разрез для обнажения брыжеечных вен, имеющих диаметр 250-300 мкм и скорость сдвига приблизительно 150 с-1. Во время всего эксперимента, обнаженную брыжейку хранили во влажном состоянии путем периодического опрыскивания подогретым (37°C) PBS. Затем брыжейку просвечивали стабилизированным источником постоянного тока при 12 В, 100 В. Вены визуализировали на инвертированном микроскопе Цейсса (Германия) Axiovert 135 (объектив 32X), подсоединенном к самописцу для видеозаписи в формате S-VHS (AG-6730; Panasonic, Tokyo, Japan) с использованием видеокамеры на ПЗС (Hamamatsu Photonic Systems, Hamamatsu City, Japan). Скорость группы специализированных эритроцитов (Vrbc) измеряли с использованием оптического допплеровского измерителя скорости (Microcirculation Research Institute, Texas A&M College of Medicine, College Station, TX). Скорость сдвига венулы (τ) вычисляли исходя из закона Пуазейля для ньютоновской жидкости τ=8(Vmean/Dv), где Dv означает диаметр венулы, а Vmean определяют исходя из значения VrbC, полученного по уравнению эмпирической корреляции Vmean=Vrbc/1,6.

Результаты анализа

Тромбоз брыжеечной вены инициировали через два дня после последней инъекции антисмыслового олигонуклеотида. Тромбоз индуцировали путем нанесения на брыжеечную вену, на 5 минут, бумаги Whatman, пропитанной 10%-раствором FeCl3. Мониторинг вены проводили в течение 40 минут или до ее закупорки. Время до образования первого тромба диаметром 30-50 мкм и время до остановки кровотока составляло 30 секунд.

Образование тромбов (диаметром 30 мкм) наблюдалось у мышей, обработанных ISIS 404071, через 14,8±1,7 минут. У контрольных мышей, образование тромбов (диаметром 30 мкм) наблюдалось через 8,9±0,6 минут. У контрольных мышей закупоривающие тромбы образовывались через 19,3±0,8 минут, и наблюдалась закупорка всех пораженных венул. В противоположность этому, закупорка большинства вен у мышей, обработанных ISIS 404071, не наблюдалась, и эта закупорка наблюдалась через 40 минут после повреждения, когда наблюдения завершали. При этом закупорка вен наблюдалась у ISIS 404071-обработанных мышей только через 29,5 минут, и эти вены снова открывались за 5 минут до конца исследования.

Пример 23

Действие смыслового олигонуклеотида-антидота на in vivo ингибирование мышиного фактора 11 антисмысловым соединением у мышей BALB/c

Обработка

Действие смыслового олигонуклеотида, специфичного к ISIS 404071, в качестве антидота, тестировали у мышей BALB/c. Мышам BALB/c первой группы подкожно вводили ISIS 404071 два раза в неделю в течение трех недель в дозе 40 мг/кг. Мышам BALB/c второй группы подкожно вводили ISIS 404057 два раза в неделю в течение трех недель в дозе 40 мг/кг. Через 48 часов после последней обработки ISIS 404071 или 404057, мышам обеих групп подкожно вводили одну инъекцию 90 мг/кг ISIS 404071-специфического антидота, ISIS 418026 (CCTCTGAAAGTGGATTACCA; комплементарного ISIS 404071), представленного здесь как SEQ ID NO:13. Мышам BALB/c третьей группы подкожно вводили ISIS 404071 два раза в неделю в течение трех недель в дозе 40 мг/кг. После последней обработки ISIS 404071, мышам подкожно инъецировали PBS. Мышам BALB/c четвертой группы подкожно вводили ISIS 404057 два раза в неделю в течение трех недель в дозе 40 мг/кг. После последней обработки ISIS 404057, мышам подкожно инъецировали PBS. Через 12 часов, 1 день, 2 дня, 3 дня, 7 дней и 14 дней после введения антидота, 4 мышей от каждой группы умерщвляли. Для анализа на РНК брали всю печень, а для анализа на АПТВ брали PPP.

Анализ на РНК

РНК экстрагировали из ткани печени для анализа на фактор 11 с помощью ПЦР в реальном времени. Результаты представлены как процент ингибирования фактора 11 по отношению к PBS-контролю. Как показано в таблице 34, у мышей, обработанных ISIS 404071 в отсутствии антидота, наблюдалось прогрессирующее снижение уровня ингибирования в течение периода наблюдения, составляющего 14 дней. Однако, у мышей, обработанных ISIS 404071 и антидотом, в отличие от мышей, которым не вводили антидот, также наблюдалось быстрое снижение уровня ингибирования за период наблюдения в 14 дней. Как показано в таблице 34, обработка ISIS 418026 не оказывала влияния на ингибирование экспрессии мРНК фактора 11 у ISIS 404057-обработанных мышей.

Анализ на АПТВ

Как показано в таблице 35, у мышей, обработанных ISIS 404071 и антидотом (ISIS 418026), наблюдалось прогрессирующее снижение АПТВ за период наблюдения в 14 дней по сравнению с мышами, обработанными ISIS 404071 без антидота.

Пример 24

Действие антидота, а именно, белка фактора 7а на in vivo ингибирование мышиного фактора 11 антисмысловым соединением у мышей BALB/c

Обработка

Действие человеческого белка фактора 7a (фактора VIIa) в качестве антидота для ISIS 404071 тестировали у мышей BALB/c. Мышей BALB/c двух экспериментальных групп обрабатывали 20 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение 3 недель. Мышей BALB/c двух контрольных групп обрабатывали PBS путем подкожного введения два раза в неделю в течение 3 недель. Образование тромбов индуцировали FeCl3 у всех мышей, за исключением мышей первой контрольной группы. За 15 минут до FeCl3-обработки, мышей первой экспериментальной группы обрабатывали 5 мкг/кг антидота, а именно, человеческого белка фактора 7а (продукт № 407act, American Diagnostica Inc.). Через два дня после введения последней дозы, всех мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси с 10 мг/кг ксилазина.

У мышей, подвергаемых FeCl3-обработке, образование тромбов индуцировали путем нанесения непосредственно на полую вену кусочка фильтровальной бумаги (2×4 мм), предварительно пропитанной 10% раствором FeCl3. После обработки в течение 3 минут, фильтровальную бумагу удаляли. Через тридцать минут после нанесения фильтровальной бумаги, вену фиксированной длины, имеющую тромб, вырезали для анализа на тромбоциты.

Количественная оценка тромбоцитарной формулы

Количественную оценку тромбоцитарного фактора-4 (PF-4), проводимую с помощью ПЦР в реальном времени, осуществляли для определения количества тромбоцитов в полой вене как показателя образования тромба. Результаты представлены как процент PF-4 у мышей, обработанных и не обработанных антидотом, по отношению к PF-4 у мышей двух PBS-обработанных контрольных групп. Как показано в таблице 36, у животных, обработанных антидотом, то есть, человеческим белком фактора 7a, уровень экспрессии PF-4 превышал уровень экспрессии PF-4 у животных, обработанных только ISIS 404071. Полученные данные показали, что человеческий фактор 7а с успехом обеспечивает сохранение эффекта ингибирования антисмысловым олигонуклеотидом.

Пример 25

In vivo ингибирование мышиного фактора 11 антисмысловым олигонуклеотидом у мышей с моделью индуцированного коллагеназой внутримозгового кровоизлияния

Обработка

Действие ISIS 404071 и варфарина (COUMADIN) оценивали на модели индуцированного коллагеназой внутримозгового кровоизлияния. Мышам BALB/c первой группы подкожно вводили ISIS 404071 два раза в неделю в течение двух недель в дозе 40 мг/кг. Мышам BALB/c второй группы подкожно вводили варфарин два раза в неделю в течение двух недель в дозе 2 мг/кг. Мышам BALB/c третьей группы подкожно вводили ISIS 421208 (TCGGAAGCGACTCTTATATG, имеющий 8 несоответствий по сравнению с мышиным фактором 11 и представленный здесь как SEQ ID NO:14) два раза в неделю в течение двух недель в дозе 40 мг/кг. Мышам BALB/c четвертой группы вводили PBS два раза в неделю в течение двух недель.

Через два дня после введения последней дозы, всех мышей из всех групп анестезировали 5 мкг/г авертином. Затем, мышам на ~1 мм AP, на 1 мм RML, на ~4 мм DV от брегмы на черепной пластинке делали инъекцию 10 мкл-шприцем Гамильтона, содержащем 0,075 ед. коллагеназы (150 ед./мл). Коллагеназу вводили в течение 5 минут, и иглу оставляли в этом месте еще на 5 минут для предотвращения рефлюкса. Затем мышей анализировали на уровень кровоизлияния, степень неврологического расстройства и смертность.

В таблице 37 указан объем кровоизлияния у мышей после обработки коллагеназой, в таблице 38 указана степень неврологического расстройства у мышей, а в таблице 39 указаны данные смертности мышей. Степень неврологического расстройства измеряли по стандартной системе оценок, где отсутствие такого расстройства было оценено как балл 0, а тяжелое неврологическое расстройство было оценено как балл 5. В целом, полученные данные позволяют предположить, что обработка ISIS 404071 не оказывает значительного влияния на уровень кровоизлияния, степень неврологического расстройства или смертность у мышей. Таким образом, риск возникновения внутримозгового кровоизлияния (фактора риска у животных, обработанных варфарином) у мышей, обработанных ISIS 404071 был значительно ниже, чем у мышей, обработанных варфарином.

Таблица 37
Объем кровоизлияния после обработки коллагеназой
Объем (мм3)
PBS 51
ISIS 421208 41
ISIS 404071 38
Таблица 38
Оценка степени неврологического расстройства после обработки коллагеназой
Оценка
PBS 2,4
ISIS 421208 2,0
ISIS 404071 3,8
Таблица 39
Оценка смертности после обработки коллагеназой
% смертности
PBS 0
ISIS 421208 0
ISIS 404071 20
Варфарин 80

Пример 26

In vivo эффект ингибирования мышиного фактора 11 под действием антисмыслового олигонуклеотида в комбинации с PLAVIX у мышей с моделью FeCl3-индуцированного венозного тромбоза (BT)

Обработка

Комбинацию ISIS 404071 и PLAVIX оценивали у мышей с моделью FeCl3-индуцированного ВТ. Восемь мышей BALB/c в каждой из четырех групп, весом примерно 25 г каждая, обрабатывали 6,25 мг/кг, 12,50 мг/кг, 25,00 мг/кг или 50,00 мг/кг PLAVIX. Мышам вводили две дозы PLAVIX на 1-й день и одну дозу PLAVIX на 2-ой день за два часа до хирургической операции.

Восемь мышей BALB/c в каждой из четырех дополнительных групп, весом примерно 25 г каждая, обрабатывали 20 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение трех недель. После введения последней дозы ISIS 404071, мышей обрабатывали 6,25 мг/кг, 12,50 мг/кг, 25,00 мг/кг или 50,00 мг/кг PLAVIX. Мышам вводили две дозы PLAVIX на 1-й день и одну дозу PLAVIX на 2-ой день за два часа до хирургической операции.

Восемь мышей BALB/c в каждой из двух контрольных групп, весом примерно 25 г каждая, не обрабатывали ISIS 404071 или PLAVIX. Восемь мышей BALB/c в каждой из двух дополнительных контрольных групп, весом примерно 25 г каждая, обрабатывали 20 мг/кг ISIS 404071 путем подкожного введения два раза в неделю в течение трех недель, но не обрабатывали PLAVIX. Образование тромбов индуцировали FeCl3 у всех мышей, за исключением мышей первой и третьей контрольных групп. Всех мышей анестезировали путем внутрибрюшинной инъекции 150 мг/кг кетамина в смеси 10 мг/кг ксилазина.

У мышей, подвергаемых FeCl3-обработке, образование тромбов индуцировали путем нанесения непосредственно на полую вену кусочка фильтровальной бумаги (2×4 мм), предварительно пропитанной 10% раствором FeCl3. После обработки в течение 3 минут, фильтровальную бумагу удаляли. Через тридцать минут после нанесения фильтровальной бумаги, вену фиксированной длины, имеющую тромб, вырезали для анализа на тромбоциты.

Количественная оценка тромбоцитарной формулы

Количественную оценку тромбоцитарного фактора-4 (PF-4), проводимую с помощью ПЦР в реальном времени, использовали для определения количества тромбоцитов в полой вене как показателя образования тромба. Как показано в таблице 40, обработка PLAVIX приводила к снижению уровня PF-4 по сравнению с PBS-контролем. Обработка PLAVIX в комбинации с ISIS 404071 приводила к еще большему снижению уровня PF-4 по сравнению с обработкой только PLAVIX. Поэтому, очевидно, что комбинированная антитромбоцитарная терапия вместе с терапией антисмысловым олигонуклеотидом фактора 11 приводила к увеличению антитромбоцитарной активности. Данные представлены как процент мРНК по отношению к PBS+FeCl3-контролю.

Пример 27

Влияние in vivo ингибирования мышиного фактора 11 антисмысловым олигонуклеотидом в комбинации с PLAVIX на кровотечение из хвоста

Обработка

Кровотечение из хвоста оценивали для того, чтобы определить, приводит ли обработка ISIS 404071 в комбинации с PLAVIX к увеличению риска кровотечения. Восьми мышам BALB/c пяти групп подкожно вводили ISIS 404071 в дозе 20 мг/кг два раза в неделю в течение 3 недель. После введения последней дозы ISIS 404071, мышей обрабатывали 0 мг/кг, 6,25 мг/кг, 12,50 мг/кг, 25,00 мг/кг или 50,00 мг/кг PLAVIX. За два часа до забора крови, мышам вводили две дозы PLAVIX на 1-й день и одну дозу PLAVIX на 2-ой день.

Восемь мышей BALB/c дополнительных 5 групп обрабатывали аналогичным образом, за исключением того, что не вводили инъекции ISIS 404071.

Анализ на кровотечение из хвоста

Через два часа после последней обработки, мышей помещали в камеру для анализа на кровотечение из хвоста. В данной камере, мышей анестезировали изофлураном, и стерильными ножницами отрезали небольшой кусочек хвоста (приблизительно 4 мм от кончика). Затем отрезанный кусочек хвоста сразу помещали в 15-миллилитровую пробирку Falcon, заполненную приблизительно 10 мл 0,9% буферного раствора NaCl, нагретого до 37°C. Забор крови осуществляли в течение 40 минут. Пробирки, заполненные физиологическим раствором, взвешивали до и после забора крови.

Полученные данные, вместе с результатами, полученными как описано в примере 26, показали, что комбинированная антитромбоцитарная терапия вместе с антисмысловым олигонуклеотидом фактора 11 приводила к увеличению антитромбоцитарной активности, которое, при этом, не приводило к повышению риска кровотечения.

Таблица 41
Анализ на кровотечение из хвоста, проводимый путем сравнения действия PLAVIX и комбинации PLAVIX и ISIS 404071
Обработка ISIS 404071 мг/кг PLAVIX, мг/кг Кровь (г)
Не обрабатывали 0 0 0,040
Только PLAVIX 0 6,25 мг/кг 0,075
0 12,50 мг/кг 0,205
0 25,00 мг/кг 0,524
0 50,00 мг/кг 0,628
Только ISIS 404071 20 мг/кг 0 0
PLAVIX (+ISIS 404071) 20 мг/кг 6,25 мг/кг 0,065
20 мг/кг 12,50 мг/кг 0,300
20 мг/кг 25,00 мг/кг 0,401
20 мг/кг 50,00 мг/кг 0,577

Пример 28

Влияние in vivo низкомолекулярного ингибитора, такого как фактор Ха, используемого в комбинации с PLAVIX на кровотечение из хвоста

Обработка

Кровотечение из хвоста оценивали для того, чтобы определить, приводит ли обработка низкомолекулярным фактором 10а в комбинации с PLAVIX к увеличению риска кровотечения. Восемь мышей BALB/c пяти групп обрабатывали 0 мг/кг, 6,25 мг/кг, 12,50 мг/кг, 25,00 мг/кг или 50,00 мг/кг PLAVIX. За два часа до забора крови, мышам вводили две дозы PLAVIX на 1-й день и одну дозу PLAVIX на 2-ой день.

Восемь мышей BALB/c дополнительных пяти групп обрабатывали 0 мг/кг, 6,25 мг/кг, 12,50 мг/кг, 25,00 мг/кг или 50,00 мг/кг PLAVIX. За два часа до забора крови, мышам вводили две дозы PLAVIX на 1-й день и одну дозу PLAVIX на 2-ой день. За 20 минут до забора крови, мышей также обрабатывали 0,5 мг/кг апиксабана, то есть низкомолекулярного фактора 10а - ингибитора, путем однократного внутрибрюшинного введения.

Анализ на кровотечение из хвоста

Через два часа после последней обработки, мышей помещали в камеру для анализа на кровотечение из хвоста. В данной камере мышей анестезировали изофлураном, и стерильными ножницами отрезали небольшой кусочек хвоста (приблизительно 4 мм от кончика). Затем отрезанный кусочек хвоста сразу помещали в 15-миллилитровую пробирку Falcon, заполненную приблизительно 10 мл 0,9% буферного раствора NaCl, нагретого до 37°C. Забор крови осуществляли в течение 40 минут. Пробирки, заполненные физиологическим раствором, взвешивали до и после забора крови.

Как показано ниже в таблице 42, полученные данные продемонстрировали, что комбинированная антитромбоцитарная терапия вместе с низкомолекулярным фактором 10а - ингибитором, таким как апиксабан, приводила к увеличению риска кровотечения. Поэтому, комбинированная антитромбоцитарная терапия вместе с антисмысловым олигонуклеотидом фактора 11 давала лучший профиль безопасности по сравнению с профилем безопасности, наблюдаемым при проведении комбинированной антитромбоцитарной терапии вместе с низкомолекулярным фактором 10а - ингибитором.

Таблица 42
Анализ на кровотечение из хвоста, проводимый путем сравнения действия PLAVIX, апиксабана и комбинации PLAVIX и апиксабана
Обработка Апиксабан мг/кг PLAVIX, мг/кг Кровь (г)
Не обрабатывали 0 0 0,002
Только PLAVIX 0 6,25 мг/кг 0,061
0 12,50 мг/кг 0,149
0 25,00 мг/кг 0,246
0 50,00 мг/кг 0,258
Только апиксабан 0,5 мг/кг 0 0,004
PLAVIX (+апиксабан) 0,5 мг/кг 6,25 мг/кг 0,258
0,5 мг/кг 12,50 мг/кг 0,252
0,5 мг/кг 25,00 мг/кг 0,361
0,5 мг/кг 50,00 мг/кг 0,363

Пример 29

Время, за которое происходит снижение уровня мышиного фактора 11, опосредуемого антисмысловым олигонуклеотидом, и соответствующее отсутствие свертывание крови

Обработка

Время, за которое происходит снижение уровня мышиной мРНК фактора 11, опосредуемого антисмысловым олигонуклеотидом, наблюдали у мышей BALB/c. Мышам BALB/c подкожно вводили одну дозу 50 мг/кг ISIS 404071. Через 12 часов, 1 день, 2 дня, 3 дня, 4 дня, 7 дней, 14 дней, 28 дней и 56 дней после введения ISIS 404071 мышей умерщвляли. Для анализа на РНК брали целую печень, а для анализа на АПТВ брали PPP. Мышам контрольной группы вводили одну подкожную дозу PBS.

Анализ на РНК

РНК экстрагировали из ткани печени для анализа на фактор 11 с помощью ПЦР в реальном времени. Результаты представлены по отношению к PBS-контролю. У мышей, обработанных ISIS 404071, наблюдалось значимое снижение уровня мРНК фактора 11 на день 1. На 14-й день, экспрессия мРНК фактора 11 у мышей начинала возобновляться. На день 28, экспрессия мРНК фактора 11 у мышей полностью восстанавливалась, а результаты, полученные на день 56, показали, что мРНК фактора 11 сохранялась на уровнях, наблюдаемых до обработки. Поэтому, у ISIS 404071-обработанных мышей не наблюдался эффект отмены.

Эффект отмены ранее наблюдался при антитело-опосредуемом снижении уровня фактора 11 (Blood, First Edition Paper, prepublished online October 22, 2008; Prevention of vascular graft occlusion and thrombus-associated thrombin generation by inhibition of factor XI). Поскольку сверхэкспрессия фактора 11 может быть предотвращена при увеличении свертываемости крови, полученные данные позволяют предположить, что ингибирование фактора 11, опосредуемое антисмысловым олигонуклеотидом, является более безопасным, чем опосредуемое антителом ингибирование фактора 11, поскольку ингибирование фактора 11, опосредуемое антисмысловым олигонуклеотидом, не дает эффекта отмены.

Анализ на АПТВ

Величины АПТВ, представленные в таблице 43, были выражены как Международные величины нормализованных отношений (INR). Величины INR для АПТВ были определены путем деления величины АПТВ для мышей, обработанных ISIS 404071, на величину АПТВ для PBS-обработанной группы. Затем это отношение возводили в степень, равную Международной величине показателя чувствительности (ISI) используемого тканевого фактора. Как показано в таблице 43, у мышей, обработанных ISIS 404071, наблюдалось прогрессирующее снижение АПТВ до дня 4, а затем прогрессирующее увеличение до уровней, наблюдаемых до обработки, со дня 7 до дня 28.

Таблица 43
Влияние ISIS 404071-обработки на INR АПТВ∗
12 ч День 1 День 2 День 3 День 4 День 7 День 14 День 28 День 56
ISIS 404071 0 1,02 1,12 1,29 1,30 1,25 1,11 1,02 0
∗ Величины в таблице 43 являются приблизительными.

Пример 30

Ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых олигонуклеотидов, сконструированных методом «микропрогулки»

Дополнительные гэпмеры конструировали на основе ISIS 416850 и ISIS 416858 (см. выше таблицу 8). Эти гэпмеры имели небольшие сдвиги в направлении вверх и вниз (то есть были сконструированы на основе ISIS 416850 и ISIS 416858 методом «микропрогулки»). Гэпмеры, полученные методом «микропрогулки», были сконструированы так, что они имели мотивы 5-8-5 MOE или 6-8-6-MOE.

Эти гэпмеры, полученные методом «микропрогулки», тестировали in vitro. Клетки HepG2, культивированные при плотности 20000 клеток на лунку, трансфицировали путем электропорации с использованием антисмыслового олигонуклеотида в концентрации 8000 нМ. После обработки в течение примерно 24 часов, из клеток выделяли РНК, и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам.

ISIS 416850 и ISIS 416858, а также отобранные гэпмеры, представленные в таблицах 1 и 8 (то есть ISIS 412206, ISIS 412223, ISIS 412224, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416825, ISIS 416848, ISIS 416849, ISIS 416850, ISIS 416851, ISIS 416852, ISIS 416853, ISIS 416854, ISIS 416855, ISIS 416856, ISIS 416857, ISIS 416858, ISIS 416859, ISIS 416860, ISIS 416861, ISIS 416862, ISIS 416863, ISIS 416864, ISIS 416865, ISIS 416866 и ISIS 416867) снова тестировали in vitro вместе с гэпмерами, полученными методом «микропрогулки», в условиях, описанных выше.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 44, были сконструированы в виде 5-10-5-MOE-, 5-8-5-MOE- или 6-8-6-MOE-гэпмеров. Первыми двумя гэпмерами, представленными в таблице 44, являются исходные гэпмеры (ISIS 416850 и ISIS 416858), из которых были сконструированы ISIS 445493-445543 методом «микропрогулки», и которые показаны звездочкой. Эти 5-10-5-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 5-8-5-гэпмеры имеют длину в 18 нуклеотидов, где центральный гэп-сегмент состоит из восьми 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит 5 нуклеотидов. 6-8-6-гэпмеры имеют длину в 20 нуклеотидов, где центральный гэп-сегмент состоит из восьми 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) сегментами-крыльями, каждый из которых содержит шесть нуклеотидов. В каждом мотиве (5-10-5, 5-8-5 и 6-8-6), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «человеческий старт-сайт, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер в человеческой последовательности. Термин «человеческий стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер в человеческой последовательности. Каждый гэпмер, представленный в таблице 44, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3). Каждый гэпмер, представленный в таблице 44, также вступает в полную перекрестную реакцию с генной последовательностью фактора 11 маккак-резуса, представленной здесь как SEQ ID NO:274 (экзоны 1-15 GENBANK рег. № NW_001118167.1). «Старт-сайт макак-резуса» означает самый крайний 5′-нуклеотид, на который нацелен данный гэпмер в последовательности макак-резуса. «Стоп-сайт макак-резуса» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер в последовательности макак-резуса.

Как показано в таблице 44, все гэпмеры, сконструированные методом «микропрогулки» и нацеленные на область-мишень, начинающуюся со старт-сайта-мишени 1275 и заканчивающуюся стоп-сайтом-мишенью 1317 (то есть в пределах нуклеотидных оснований 1275-1317) SEQ ID NO:1, ингибируют мРНК фактора 11 по меньшей мере на 60%. Аналогичным образом, все повторно тестированные гэпмеры, представленные в таблицах 1 и 8, дают по меньшей мере 60%-ный ингибирующий эффект.

Некоторые из гэпмеров дают по меньшей мере 70%-ный ингибирующий эффект, включая гэпмеры номеров ISIS: 412206, 412224, 412225, 413481, 413482, 416825, 416848, 416849, 416850, 416851, 416852, 416853, 416854, 416855, 416856, 416857, 416858, 416859, 416860, 416861, 416862, 416863, 416864, 416865, 416866, 416867, 445494, 445495, 445496, 445497, 445498, 445499, 445500, 445501, 445502, 445503, 445504, 445505, 445506, 445507, 445508, 445509, 445510, 445511, 445512, 445513, 445514, 445515, 445516, 445517, 445518, 445519, 445520, 445521, 445522, 445523, 445524, 445525, 445526, 445527, 445528, 445529, 445530, 445531, 445532, 445533, 445534, 445535, 445536, 445537, 455538, 445539, 445540, 445541, 445542 и 445543.

Некоторые из гэпмеров дают по меньшей мере 80%-ный ингибирующий эффект, включая гэпмеры номеров ISIS: 412206, 412224, 412225, 413481, 413482, 416825, 416848, 416849, 416850, 416851, 416852, 416853, 416854, 416855, 416856, 416857, 416858, 416859, 416860, 416861, 416862, 416863, 416864, 416865, 416866, 416867, 445494, 445495, 445496, 445497, 445498, 445500, 445501, 445502, 445503, 445504, 445505, 445506, 445507, 445508, 445509, 445510, 445513, 445514, 445519, 445520, 445521, 445522, 445525, 445526, 445529, 445530, 445531, 445532, 445533, 445534, 445535, 445536, 455538, 445541 и 445542.

Некоторые из гэпмеров дают по меньшей мере 90%-ный ингибирующий эффект, включая гэпмеры номеров ISIS: 412206, 416825, 416850, 416857, 416858, 416861, 445522 и 445531.

Пример 31

Дозозависимое ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых соединений

Гэпмеры примера 30, оказывающие ингибирующее действие in vitro на человеческий фактор 11, тестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 20000 клеток на лунку и трансфицировали путем электропорации вместе с антисмысловыми олигонуклеотидами, взятыми в концентрациях 123,46 нМ, 370,37 нМ, 1111,11 нМ, 3333,33 нМ и 10000 нМ как показано в таблице 45. После обработки в течение примерно 16 часов, из клеток выделяли РНК, и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зонда для человеческого фактора 11, RTS 2966. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам. Как проиллюстрировано в таблице 45, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы.

Полумаксимальную ингибирующую концентрацию (IC50) каждого олигонуклеотида вычисляли путем построения кривой зависимости концентраций используемых антисмысловых олигонуклеотидов от процента ингибирования экспрессии мРНК фактора 11, достигаемого при каждой концентрации, где указанная концентрация антисмыслового олигонуклеотида представляет собой концентрацию, при которой достигается 50% ингибирование мРНК фактора 11 по сравнению с PBS-контролем. Величины IC50 представлены в таблице 45.

Пример 32

Дозозависимое ингибирование человеческого фактора 11 в клетках HepG2 под действием антисмысловых олигонуклеотидов, сконструированных методом «микропрогулки»

Дополнительные гэпмеры конструировали на основе ISIS 416850 и ISIS 416858 (см. выше таблицу 8). Эти гэпмеры имели небольшие сдвиги в направлении вверх и вниз (то есть были сконструированы на основе ISIS 416850 и ISIS 416858 методом «микропрогулки»). Гэпмеры, полученные методом «микропрогулки», были сконструированы так, что они имели мотивы 3-8-3-MOE, 4-8-4-MOE, 2-10-2-MOE, 3-10-3-MOE или 4-10-4-MOE.

Эти гэпмеры тестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 20000 клеток на лунку и трансфицировали путем электропорации с использованием антисмыслового олигонуклеотида в концентрациях 375 нМ, 750 нМ, 1500 нМ, 3000 нМ, 6000 нМ и 12000 нМ, как указано в таблице 47. После обработки в течение примерно 16 часов, из клеток выделяли РНК, и уровни мРНК фактора 11 измеряли с помощью количественной ПЦР в реальном времени. Уровни мРНК фактора 11 корректировали на общее содержание РНК, как было измерено с использованием реагента RIBOGREEN. Результаты представлены как процент ингибирования фактора 11 по отношению к необработанным контрольным клеткам.

ISIS 416850, ISIS 416858, ISIS 445522 и ISIS 445531 (см. выше таблицу 45) снова тестировали in vitro вместе с гэпмерами, полученными методом «микропрогулки», в условиях, описанных выше.

Химерные антисмысловые олигонуклеотиды, представленные в таблице 46, были сконструированы в виде 3-8-3-MOE, 4-8-4-MOE, 2-10-2-MOE, 3-10-3-MOE или 4-10-4-MOE-гэпмеров. 3-8-3-гэпмер имеет длину в 14 нуклеотидов, где центральный гэп-сегмент состоит из восьми 2′дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит три нуклеотида. 4-8-4-гэпмер имеет длину в 16 нуклеотидов, где центральный гэп-сегмент состоит из восьми 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит четыре нуклеотида. 2-10-2-гэпмер имеет длину в 14 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит два нуклеотида. 3-10-3-гэпмер имеет длину в 16 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит три нуклеотида. 4-10-4-гэпмер имеет длину в 18 нуклеотидов, где центральный гэп-сегмент состоит из десяти 2′-дезоксинуклеотидов и фланкирован с обеих сторон (в направлении 5′ и 3′) крыльями, каждое из которых содержит четыре нуклеотида. В каждом мотиве (3-8-3, 4-8-4, 2-10-2, 3-10-3 и 4-10-4), каждый нуклеотид в 5′-сегменте-крыле и каждый нуклеотид в 3′-сегменте-крыле имеют 2′-MOE-модификацию. Межнуклеозидными связями в каждом гэпмере являются фосфортиоатные (P=S) связи. Все цитидиновые остатки в каждом гэпмере представляют собой 5-метилцитидины. Термин «человеческий старт-сайт, являющийся мишенью» означает самый крайний 5′-нуклеотид, на который нацелен гэпмер в человеческой последовательности. Термин «человеческий стоп-сайт, являющийся мишенью» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер в человеческой последовательности. Каждый гэпмер, представленный в таблице 46, нацелен на SEQ ID NO:1 (GENBANK рег. № NM_000128.3). Каждый гэпмер, представленный в таблице 46, также вступает в полную перекрестную реакцию с генной последовательностью фактора 11 макак-резуса, представленной здесь как SEQ ID NO:274 (экзоны 1-15 GENBANK рег. № NW_001118167.1). «Старт-сайт макак-резуса» означает самый крайний 5′-нуклеотид, на который нацелен данный гэпмер в последовательности макак-резуса. «Стоп-сайт макак-резуса» означает самый крайний 3′-нуклеотид, на который нацелен данный гэпмер в последовательности макак-резуса.

Данные дозозависимого ингибирования представлены в таблице 47. Как показано в таблице 47, уровни мРНК фактора 11 в клетках, обработанных антисмысловым олигонуклеотидом, снижались в зависимости от дозы. Также вычисляли IC50 каждого антисмыслового олигонуклеотида, и эти данные представлены в таблице 47. Первыми двумя гэпмерами, представленными в таблице 47, являются исходные гэпмеры (ISIS 416850 и ISIS 416858), из которых были сконструированы остальные гэпмеры методом «микропрогулки», и которые показаны звездочкой.

Пример 33

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у мышей CD1

Мышей CD1 обрабатывали антисмысловыми олигонуклеотидами ISIS, нацеленными на человеческий фактор 11, и оценивали на изменение уровней различных метаболических маркеров.

Обработка

Каждой мыши в группах из пяти животных CD1 подкожно инъецировали 50 мг/кг ISIS 416825, ISIS 416826, ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416864, ISIS 416892, ISIS 416925, ISIS 416999, ISIS 417002 или ISIS 417003 два раза в неделю в течение 2, 4 или 6 недель. Пяти мышам контрольной группы подкожно инъецировали PBS в течение 2 недель. Мышей всех экспериментальных групп (то есть мышей, обработанных ASO через 2, 4, 6 недель) сравнивали с мышами контрольной группы (то есть PBS, 2 недели).

Через три дня после введения последней дозы мышам всех групп, этих мышей умерщвляли. Затем измеряли массу органов и брали кровь для последующего анализа.

Масса органов

По окончании исследования измеряли массу печени, селезенки и почек, и эти данные представлены в таблицах 48, 49 и 50 как процент от PBS-контроля, нормализованный по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени, измеряли концентрации трансаминаз плазмы на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты измерений уровней аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST) выражали в МЕ/л, и эти результаты представлены в таблицах 51 и 52. Уровни билирубина и альбумина в плазме также измеряли на том же самом анализаторе, применяемом в методах медицинской химии, и выражали в мг/дл. Результаты представлены в таблицах 53 и 54. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) и концентрации креатинина в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты представлены в таблицах 55 и 56 и выражены в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у мышей всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), среднего объема эритроцитов (MCV), среднего содержания гемоглобина в эритроцитах (MCH), и средней концентрации гемоглобина в эритроцитах (MCHC) и для их анализов, а также для определения числа различных клеток, таких как WBC (нейтрофилы, лимфоциты и моноциты), эритроциты (RBC), тромбоциты и общего содержания гемоглобина. Результаты представлены в таблицах 57-67. Проценты, представленные в этих таблицах, означают процент от общего числа форменных элементов крови. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и/или более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 34

Оценка времени полужизни антисмыслового олигонуклеотида в печени мышей CD1

Мышей CD1 обрабатывали антисмысловыми олигонуклеотидами ISIS, нацеленными на человеческий фактор 11, а затем оценивали время полужизни олигонуклеотида, а также время разложения олигонуклеотида и время его элиминации из печени.

Обработка

Каждую мышь в группе из пятнадцати мышей CD1 подкожно инъецировали два раза в неделю в течение 2 недель 50 мг/кг ISIS 416825, ISIS 416826, ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416864, ISIS 416892, ISIS 416925, ISIS 416999, ISIS 417002 или ISIS 417003. Через 3 дня, 28 дней и 56 дней после введения последней дозы, пять мышей в каждой группе умерщвляли. Затем брали печень для анализа.

Определение концентрации олигонуклеотидов

Была измерена концентрация полноразмерного олигонуклеотида, а также общая концентрация олигонуклеотидов (включая форму, образованную путем разложения). Применяемый метод представляет собой модификацию опубликованных ранее методов (Leeds et al., 1996; Geary et al., 1999), и этот метод состоит из стадии экстракции фенолом-хлороформом (жидким фенолом - жидким хлороформом) и стадии твердофазной экстракции. Перед экстракцией добавляли внутренний стандарт (ISIS 355868, 27-мерный фосфортиоатный олигонуклеотид, модифицированный 2′-O-метоксиэтилом, GCGTTTGCTCTTCTTCTTGCGTTTTTT и обозначенный здесь как SEQ ID NO:270). Концентрации в образцах ткани вычисляли с помощью калибровочных кривых, где наименьший предел количественной оценки (LLOQ) составляет приблизительно 1,14 мкг/г. Затем определяли время полужизни с помощью программы WinNonlin (PHARSIGHT).

Результаты представлены в таблицах 68 и 69 и выражены в мкг/г ткани печени. Время полужизни каждого олигонуклеотида представлено в таблице 70.

Пример 35

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у крыс Sprague-Dawley

Крыс Sprague-Dawley обрабатывали антисмысловыми олигонуклеотидами ISIS, нацеленными на человеческий фактор 11, и оценивали на изменение уровней различных метаболических маркеров.

Обработка

Каждой крысе в группах из четырех крыс Sprague-Dawley подкожно инъецировали 50 мг/кг ISIS 416825, ISIS 416826, ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416848, ISIS 416864, ISIS 416892, ISIS 416925, ISIS 416999, ISIS 417002 или ISIS 417003 два раза в неделю в течение 6 недель. Четырем крысам Sprague-Dawley контрольной группы подкожно инъецировали PBS два раза в неделю в течение 6 недель. До и во время проведения обработки измеряли массу тела. Перед началом обработки брали образцы мочи. Через три дня после введения последней дозы брали образцы мочи, после чего крыс умерщвляли. Затем измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Массу тела крыс измеряли в начале исследования, а затем два раза в неделю. Массы тела представлены в таблице 71 и выражены как процент изменения массы тела по отношению к массе тела в начале исследования. Массы печени, селезенки и почек измеряли в конце исследования, и полученные результаты представлены в таблице 71 как процент от контроля, обработанного физиологическим раствором, нормализованный по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени, измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты измерений уровней аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST) выражали в МЕ/л, и эти результаты представлены в таблице 72. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Уровни билирубина и альбумина в плазме также измеряли на том же самом анализаторе, применяемом в методах медицинской химии, и результаты, представленные в таблице 72, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов на функцию почек измеряли концентрации азота мочевины в плазме (BUN) и концентрации креатинина в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты представлены в таблице 73 и выражены в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований. Отношение количества белка в моче к количеству креатинина во всех образцах мочи также вычисляли до и после обработки антисмысловыми олигонуклеотидами, и результаты представлены в таблице 74. Антисмысловые олигонуклеотиды, которые не давали более чем 5-кратное увеличение отношения белок/креатинин в моче по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у крыс всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), среднего объема эритроцитов (MCV), среднего содержания гемоглобина в эритроцитах (MCH), и средней концентрации гемоглобина в эритроцитах (MCHC) и для их анализов, а также для определения числа различных клеток, таких как WBC (нейтрофилы, лимфоциты и моноциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 75 и 76. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 36

Оценка времени полужизни антисмыслового олигонуклеотида в печени и почках крыс Sprague-Dawley

Крыс Sprague-Dawley обрабатывали антисмысловыми олигонуклеотидами ISIS, нацеленными на человеческий фактор 11, а затем оценивали время полужизни олигонуклеотида, а также время разложения олигонуклеотида и время его элиминации из печени и почек.

Обработка

Каждой крысе в группе из четырех крыс Sprague-Dawley подкожно инъецировали два раза в неделю в течение 2 недель 20 мг/кг ISIS 416825, ISIS 416826, ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416864, ISIS 416892, ISIS 416925, ISIS 416999, ISIS 417002 или ISIS 417003. Через 3 дня после введения последней дозы, крыс умерщвляли, и брали печень и почки для анализа.

Определение концентрации олигонуклеотидов

Была измерена концентрация полноразмерного олигонуклеотида, а также общая концентрация олигонуклеотидов (включая форму, образованную путем разложения). Применяемый метод представляет собой модификацию описанных ранее методов (Leeds et al., 1996; Geary et al., 1999), которая состоит из стадии экстракции фенолом-хлороформом (жидким фенолом - жидким хлороформом) и стадии твердофазной экстракции. Перед экстракцией добавляли внутренний стандарт (ISIS 355868, 27-мерный фосфортиоатный олигонуклеотид, модифицированный 2′-O-метоксиэтилом, GCGTTTGCTCTTCTTCTTGCGTTTTTT, и обозначенный здесь как SEQ ID NO:270). Концентрации в образцах ткани вычисляли с помощью калибровочных кривых, где наименьший предел количественной оценки (LLOQ) составлял приблизительно 1,14 мкг/г. Результаты, представленные в таблицах 77 и 78, выражали в мкг/г ткани печени или почек. Затем определяли время полужизни с помощью программы WinNonlin (PHARSIGHT).

Пример 37

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у мышей CD1

Мышей CD1 обрабатывали антисмысловыми олигонуклеотидами ISIS, нацеленными на человеческий фактор 11, и оценивали на изменение уровней различных метаболических маркеров.

Обработка

Каждой мыши в группах из пяти мышей CD1 подкожно инъецировали 50 мг/кг ISIS 412223, ISIS 412224, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416848, ISIS 416849, ISIS 416850, ISIS 416851, ISIS 416852, ISIS 416853, ISIS 416854, ISIS 416855, ISIS 416856, ISIS 416857, ISIS 416858, ISIS 416859, ISIS 416860, ISIS 416861, ISIS 416862, ISIS 416863, ISIS 416864, ISIS 416865, ISIS 416866 или ISIS 416867 два раза в неделю в течение 6 недель. Мышам контрольной группы из десяти мышей CD1 подкожно инъецировали PBS два раза в неделю в течение 6 недель. До и во время проведения обработки измеряли массу тела. Через три дня после введения последней дозы, мышей умерщвляли, измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Массу тела измеряли в начале исследования, а затем два раза в неделю. Массы тела мышей, представленные в таблице 80, выражены как увеличение количества в граммах по отношению к массе PBS-контроля до начала обработки. По окончании исследований измеряли массы тела печени, селезенки и почек, и результаты этих исследований также представлены в таблице 80 как процент по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты измерений уровней аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST) выражали в МЕ/л, и эти результаты представлены в таблице 81. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Уровни билирубина, холестерина и альбумина в плазме также измеряли на том же самом анализаторе, применяемом в методах медицинской химии, и результаты, представленные в таблице 81, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) на автоматическом анализаторе, применяемом в методах медицинской химии, и результаты, представленные в таблице 82, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у мышей всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), а также для определения числа различных клеток крови, таких как WBC (нейтрофилы, лимфоциты и моноциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 83 и 84. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 38

Оценка времени полужизни антисмыслового олигонуклеотида в печени мышей CD1

Проводили дополнительную оценку пятнадцати антисмысловых олигонуклеотидов на мышах CD1 (пример 37). Мышей CD1 обрабатывали антисмысловыми олигонуклеотидами ISIS, а затем оценивали время полужизни олигонуклеотида, а также время разложения олигонуклеотида и время его выведения из печени.

Обработка

Каждой мыши в группе из пятнадцати мышей CD1 подкожно инъецировали два раза в неделю в течение 2 недель 50 мг/кг ISIS 412223, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416851, ISIS 416852, ISIS 416856, ISIS 416860, ISIS 416861, ISIS 416863, ISIS 416866, ISIS 416867, ISIS 412224, ISIS 416848 или ISIS 416859. Через 3 дня, 28 дней и 56 дней после введения последней дозы, пять мышей в каждой группе умерщвляли, и брали печень для анализа.

Определение концентрации олигонуклеотидов

Была измерена концентрация полноразмерного олигонуклеотида. Применяемый метод представляет собой модификацию опубликованных ранее методов (Leeds et al., 1996; Geary et al., 1999), которая состоит из стадии экстракции фенолом-хлороформом (жидким фенолом - жидким хлороформом) и стадии твердофазной экстракции. Перед экстракцией добавляли внутренний стандарт (ISIS 355868, 27-мерный фосфортиоатный олигонуклеотид, модифицированный 2′-O-метоксиэтилом, GCGTTTGCTCTTCTTCTTGCGTTTTTT и обозначенный здесь как SEQ ID NO:270). Концентрации в образцах ткани вычисляли с помощью калибровочных кривых, где наименьший предел количественной оценки (LLOQ) составляет приблизительно 1,14 мкг/г. Результаты, представленные в таблице 85, выражены в мкг/г ткани печени. Время полужизни каждого олигонуклеотида также представлено в таблице 85.

Пример 39

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у крыс Sprague-Dawley

Пятнадцать антисмысловых олигонуклеотидов, которые были проанализированы на мышах CD1 (пример 37), дополнительно оценивали на крысах Sprague-Dawley на изменение уровней различных метаболических маркеров.

Обработка

Каждой крысе в группах из четырех крыс Sprague-Dawley подкожно инъецировали 50 мг/кг ISIS 412223, ISIS 412224, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416848, ISIS 416851, ISIS 416852, ISIS 416856, ISIS 416859, ISIS 416860, ISIS 416861, ISIS 416863, ISIS 416866 или ISIS 416867 два раза в неделю в течение 6 недель. Четырем крысам Sprague-Dawley контрольной группы подкожно инъецировали PBS два раза в неделю в течение 6 недель. До и во время проведения обработки измеряли массу тела. Через три дня после введения последней дозы брали образцы мочи, после чего крыс умерщвляли, измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Массу тела крыс измеряли в начале исследования, а затем два раза в неделю. Массы тела представлены в таблице 86 и выражены как процент увеличение массы в граммах по отношению к массе тела PBS-контроля до начала обработки. По окончании исследований измеряли массы тела печени, селезенки и почек, и результаты этих исследований представлены в таблице 86 как процент по массе тела. Антисмысловые олигонуклеотиды, которые не давали более, чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты измерений уровней аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST) выражали в МЕ/л, и эти результаты представлены в таблице 87. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Уровни билирубина и альбумина в плазме также измеряли на том же самом анализаторе, применяемом в методах медицинской химии, и результаты, представленные в таблице 87, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) и концентрации креатинина в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты представлены в таблице 88 и выражены в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований. Общий белок в моче и отношение количества белка к количеству креатинина в моче во всех образцах мочи вычисляли после обработки антисмысловыми олигонуклеотидами, и результаты представлены в таблице 88. Антисмысловые олигонуклеотиды, которые не давали более чем 5-кратное увеличение отношения белок/креатинин в моче по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у крыс всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), а также для определения числа различных клеток, таких как WBC (нейтрофилы и лимфоциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 89 и 90. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 40

Оценка времени полужизни антисмыслового олигонуклеотида в печени и почках крыс Sprague-Dawley

Крыс Sprague-Dawley обрабатывали антисмысловыми олигонуклеотидами ISIS, нацеленными на человеческий фактор 11, а затем оценивали время полужизни олигонуклеотида, а также время разложения олигонуклеотида и время его выведения из печени и почек.

Обработка

Каждой крысе в группе из четырех крыс Sprague-Dawley подкожно инъецировали два раза в неделю в течение 2 недель 20 мг/кг ISIS 412223, ISIS 412224, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416848, ISIS 416851, ISIS 416852, ISIS 416856, ISIS 416859, ISIS 416860, ISIS 416861, ISIS 416863, ISIS 416866 или ISIS 416867. Через три дня после введения последней дозы, крыс умерщвляли, и брали печень и почки.

Определение концентрации олигонуклеотидов

Была измерена концентрация полноразмерного олигонуклеотида, а также общая концентрация олигонуклеотидов (включая форму, образованную путем разложения). Применяемый метод представляет собой модификацию опубликованных ранее методов (Leeds et al., 1996; Geary et al., 1999), которая состоит из стадии экстракции фенолом-хлороформом (жидким фенолом - жидким хлороформом) и стадии твердофазной экстракции. Перед экстракцией добавляли внутренний стандарт (ISIS 355868, 27-мерный фосфортиоатный олигонуклеотид, модифицированный 2′-O-метоксиэтилом, GCGTTTGCTCTTCTTCTTGCGTTTTTT и обозначенный здесь как SEQ ID NO:270). Концентрации в образцах ткани вычисляли с помощью калибровочных кривых, где наименьший предел количественной оценки (LLOQ) составляет приблизительно 1,14 мкг/г. Результаты, представленные в таблицах 91 и 92, выражали в мкг/г ткани печени или почек. Затем определяли время полужизни с помощью программы WinNonlin (PHARSIGHT).

Пример 41

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у мышей CD1

Олигонуклеотиды ISIS с мотивами 6-8-6-МОЕ и 5-8-5-МОЕ, нацеленные на человеческий фактор 11, вводили мышам CD1 и оценивали на изменение уровней различных метаболических маркеров.

Обработка

Каждой мыши в группах из пяти мышей CD1 подкожно инъецировали 50 мг/кг ISIS 416850, ISIS 445498, ISIS 445503, ISIS 445504, ISIS 445505, ISIS 445509, ISIS 445513, ISIS 445522, ISIS 445530, ISIS 445531 или ISIS 445532 два раза в неделю в течение 6 недель. Мышам CD1 контрольной группы из пяти мышей CD1 подкожно инъецировали PBS два раза в неделю в течение 6 недель. До обработки и по окончании обработки измеряли массу тела. Через три дня после введения последней дозы, мышей умерщвляли, измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Изменения массы тела у мышей представлены в таблице 94 и выражены как увеличение массы тела в граммах по сравнению с массой тела PBS-контроля до начала обработки. По окончании исследований измеряли массы тела печени, селезенки и почек, и результаты этих исследований также представлены в таблице 94 как процент по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты измерений уровней аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST) выражали в МЕ/л, и эти результаты представлены в таблице 95. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Также измеряли уровни билирубина и альбумина в плазме, и результаты, представленные в таблице 95, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты, представленные в таблице 96, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у мышей всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), а также для определения числа различных клеток крови, таких как WBC (нейтрофилы и лимфоциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 97 и 98. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 42

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у крыс Sprague-Dawley

Восемь антисмысловых олигонуклеотидов, которые были проанализированы на мышах CD1 (пример 41), дополнительно оценивали на крысах Sprague-Dawley на изменение уровней различных метаболических маркеров.

Обработка

Каждой крысе в группах из четырех крыс Sprague-Dawley подкожно инъецировали 50 мг/кг ISIS 445498, ISIS 445504, ISIS 445505, ISIS 445509, ISIS 445513, ISIS 445522, ISIS 445530 или ISIS 445531 два раза в неделю в течение 6 недель. Крысам Sprague-Dawley контрольной группы подкожно инъецировали PBS два раза в неделю в течение 6 недель. До и во время проведения обработки измеряли массу тела. Через три дня после введения последней дозы брали образцы мочи, после чего крыс умерщвляли, измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Массу тела крыс измеряли в начале исследования, а затем два раза в неделю. Массы тела представлены в таблице 99 и выражены как процент увеличения массы по отношению к массе тела PBS-контроля до начала обработки. Массы печени, селезенки и почек измеряли по окончании исследования, и полученные результаты представлены в таблице 99 как процент по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Затем измеряли концентрации ALT (аланинтрансаминазы) и AST (аспартаттрансаминазы), и результаты, представленные в таблице 100, выражали в МЕ/л. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Уровни билирубина и альбумина в плазме также измеряли на том же самом анализаторе, применяемом в методах медицинской химии, и результаты, представленные в таблице 100, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) и концентрации креатинина в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты представлены в таблице 101 и выражены в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований. Общий белок в моче и отношение количества белка к количеству креатинина в моче во всех образцах мочи вычисляли после обработки антисмысловыми олигонуклеотидами, и результаты представлены в таблице 101. Антисмысловые олигонуклеотиды, которые не давали более чем 5-кратное увеличение отношение белок/креатинин в моче по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у крыс всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), а также для определения числа различных клеток, таких как WBC (нейтрофилы, лимфоциты и моноциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 102 и 103. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 43

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у мышей CD1

Олигонуклеотиды ISIS с мотивами 4-8-4 MOE, 3-8-3 MOE, 2-10-2 MOE, 3-10-3 MOE и 4-10-4 MOE, нацеленные на человеческий фактор 11, вводили мышам CD1 и оценивали на изменение уровней различных метаболических маркеров.

Обработка

Каждой мыши в группах из пяти мышей CD1 подкожно инъецировали 50 мг/кг ISIS 449707, ISIS 449708, ISIS 449409, ISIS 449710 или ISIS 449711 два раза в неделю в течение 6 недель. Мышам CD1 контрольной группы из пяти мышей CD1 подкожно инъецировали PBS два раза в неделю в течение 6 недель. До и по окончании обработки измеряли массу тела. Через три дня после введения последней дозы, мышей умерщвляли, измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Масса тела у мышей, измеренная по окончании исследования, представлена в таблице 104 и выражена в граммах. Массы печени, селезенки и почек, также измеренные по окончании исследования, представлены в таблице 104 как процент по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Затем измеряли концентрации ALT (аланинтрансаминазы) и AST (аспартаттрансаминазы) в плазме, и результаты, представленные в таблице 105, выражены в МЕ/л. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Уровни билирубина и альбумина в плазме также измеряли на том же самом анализаторе, применяемом в методах медицинской химии, и результаты, представленные в таблице 105, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) и креатинина в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты, представленные в таблице 106, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у мышей всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), а также для определения числа различных клеток крови, таких как WBC (нейтрофилы, лимфоциты и моноциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 107 и 108. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 44

Переносимость антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11 у крыс Sprague-Dawley

Пять антисмысловых олигонуклеотидов, которые были проанализированы на мышах CD1 (пример 43), дополнительно оценивали на крысах Sprague-Dawley на изменение уровней различных метаболических маркеров.

Обработка

Каждой крысе в группах из четырех крыс Sprague-Dawley подкожно инъецировали 50 мг/кг ISIS 449707, ISIS 449708, ISIS 449709, ISIS 449710, или ISIS 449711 два раза в неделю в течение 6 недель. Четырем крысам Sprague-Dawley контрольной группы подкожно инъецировали PBS два раза в неделю в течение 6 недель. До и во время обработки измеряли массу тела. Через три дня после введения последней дозы брали образцы мочи, после чего крыс умерщвляли, измеряли массу органов и брали кровь для последующего анализа.

Масса тела и масса органов

Массу тела крыс измеряли в начале и по окончании исследования. Изменения массы тела представлены в таблице 99 и выражены как процент увеличения массы в граммах по отношению к массе тела PBS-контроля до начала обработки. По окончании исследования измеряли массы печени, селезенки и почек, и полученные результаты представлены в таблице 99 как процент по массе тела. Антисмысловые олигонуклеотиды, которые не давали более чем 6-кратное увеличение массы печени и селезенки по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации ALT и AST в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Затем измеряли концентрации аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST), и результаты, представленные в таблице 110, выражали в МЕ/л. Антисмысловые олигонуклеотиды, которые не давали более чем 7-кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Затем измеряли уровни билирубина и альбумина в плазме, и результаты, представленные в таблице 110, выражали в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек измеряли концентрации азота мочевины в плазме (BUN) и концентрации креатинина в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Результаты представлены в таблице 111 и выражены в мг/дл. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней BUN по сравнению с PBS-контролем, отбирали для дальнейших исследований. После обработки антисмысловыми олигонуклеотидами вычисляли общий белок в моче и отношение белок/креатинин во всех образцах мочи, и полученные результаты также представлены в таблице 111. Антисмысловые олигонуклеотиды, которые не давали более чем 5-кратное увеличение отношения белок/креатинин в моче по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Анализ крови

Кровь, которую брали у крыс всех групп, посылали в Институт диагностических исследований (Antech Diagnostics) для определения гематокрита (HCT), а также для определения числа различных клеток, таких как WBC (нейтрофилы, лимфоциты и моноциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 112 и 113. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований.

Пример 45

Дозозависимый фармакологический эффект антисмысловых олигонуклеотидов, нацеленных на человеческий фактор 11, у собакоподобных обезьян

Несколько антисмысловых олигонуклеотидов тестировали у собакоподобных обезьян для определения фармакологического действия указанных олигонуклеотидов на активность фактора 11, свертывание крови и время кровотечения, и повреждающего действия на печень и почки, а также для оценки их переносимости. Все олигонуклеотиды ISIS, используемые в данном исследовании, нацелены на мРНК человеческого фактора 11 и также вступают в полную перекрестную реакцию с генной последовательностью макак-резусов (см. таблицу 44). Было высказано предположение, что олигонуклеотиды ISIS макак-резуса также вступают в полную перекрестную реакцию с генной последовательностью собакоподобных обезьян. Во время проведения исследования, геномная последовательность собакоподобных обезьян отсутствовала в базе данных Национального центра биотехнологической информации (NCBI), а поэтому перекрестная реакция с генной последовательностью собакоподобных обезьян не могла быть подтверждена.

Обработка

Группам обезьян, каждая из которых включала два самца и три самки обезьян, подкожно инъецировали ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416864 или ISIS 417002 в возрастающих дозах. Антисмысловой олигонуклеотид вводили обезьянам в дозе 5 мг/кг три раза в неделю в течение 1-й недели; 5 мг/кг два раза в неделю в течение 2-й и 3-й недели; 10 мг/кг три раза в неделю в течение 4-й недели; 10 мг/кг два раза в неделю в течение 5-й и 6-й недели; 25 мг/кг три раза в неделю в течение 7-й недели; и 25 мг/кг два раза в неделю в течение 8-й, 9-й, 10-й, 11-й и 12-й недели. Одной контрольной группе, состоящей из двух самцов и трех самок обезьян, подкожно инъецировали PBS в соответствии с той же самой схемой введения доз. Дополнительной экспериментальной группе, состоящей из двух самцов и трех самок обезьян, подкожно инъецировали ISIS 416850 в режиме непрерывного введения более низких доз. Антисмысловой олигонуклеотид вводили обезьянам в дозе 5 мг/кг три раза в неделю в течение 1-й недели; 5 мг/кг два раза в неделю в течение 2-й и 3-й недели; 10 мг/кг три раза в неделю в течение 4-й недели и 10 мг/кг два раза в неделю в течение 5-12 недель. Массу тела измеряли каждую неделю. Пробы крови брали за 14 и 5 дней до начала обработки, а затем один раз в неделю для анализа на активность белка фактора 11 в плазме, измерения уровня фибриногена, вычисления ПВ и АПТВ, определения времени кровотечения и оценки различных гематологических факторов. На день 85, обезьян подвергали эвтаназии путем кровопускания под глубоким наркозом, и брали органы для последующего анализа.

Анализ на РНК

На день 85, из ткани печени экстрагировали РНК для анализа на фактор 11, проводимого с помощью ПЦР в реальном времени, с использованием набора праймеров и зонда LTS00301 (последовательность прямого праймера ACACGCATTAAAAAGAGCAAAGC, представленная здесь как SEQ ID NO:271; последовательность обратного праймера CAGTGTCATGGTAAAATGAAGAATGG, представленная здесь как SEQ ID NO:272; и последовательность зонда TGCAGGCACAGCATCCCAGTGTTCTX, представленная здесь как SEQ ID NO:273). Результаты представлены как процент ингибирования фактора 11 по отношению к PBS-контролю. Как показано в таблице 114, обработка олигонуклеотидами ISIS приводила к значительному снижению уровней мРНК фактора 11 по сравнению с PBS-контролем.

Таблица 114
Ингибирование мРНК фактора 11 в
печени собакоподобных обезьян по сравнению
с PBS-контролем
ISIS № % Ингибирования
416838 37
416850 84
416858 90
416864 44
417002 57

Анализ белка

Пробы плазмы, взятые в различные дни у обезьян всех групп, анализировали с помощью «сэндвич»-ELISA-анализа (Affinity Biologicals Inc.) с использованием аффинно очищенного поликлонального антитела против фактора 11 в качестве антитела для захвата, и конъюгированного с пероксидазой поликлонального антитела против фактора 11 в качестве детектирующего антитела. Плазму обезьян разводили 1:50 для анализа. Пероксидазную активность экспрессировали путем инкубирования с субстратом o-фенилендиамином. Интенсивность окраски количественно оценивали на микропланшет-ридере на 490 нм и выражали как количество, пропорциональное концентрации фактора 11 в образцах.

Результаты, представленные в таблице 115, выражали как процент снижения по отношению к PBS-контролю. Обработка ISIS 416850 и ISIS 416858 приводила к зависимому от времени снижению уровней белка.

Анализ на ПВ и АПТВ

Пробы крови собирали в пробирки, содержащие цитрат натрия. ПВ и АПТВ определяли в дубликате на приборе для оценки свертывания крови ACL 9000 (Instrumentation Laboratory, Italy). Результаты интерполировали на стандартной кривой серийных разведений тестируемой цитратсодержащей плазмы контрольных обезьян и выражали в процентах, отложенных по оси ординат.

Протромбиновое время (ПВ) и активированное парциальное тромбопластиновое время (АПТВ) измеряли с использованием обедненной тромбоцитами плазмы (ОТП), взятой у обезьян, обработанных олигонуклеотидами ISIS. Величины ПВ и АПТВ, представленные в таблицах 116 и 117, были выражены как Международные величины нормализованных отношений (INR). Величины INR для ПВ и АПТВ были определены путем деления величины ПВ и АПТВ для каждой экспериментальной группы на величины ПВ и АПТВ для PBS-обработанной группы. Затем это отношение возводили в степень, равную Международной величине показателя чувствительности (ISI) используемого тканевого фактора. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Как показано в таблице 116, ПВ значительно не увеличивалось у обезьян, обработанных олигонуклеотидами ISIS в соответствии со схемой введения возрастающих доз или со схемой непрерывного введения доз. Однако, АПТВ увеличивалось в зависимости от дозы, как показано в таблице 117. Полученные данные позволяют предположить, что снижение уровня фактора 11 под действием антисмысловых олигонуклеотидов влияет на путь контактной активации, но не на внешний путь свертывания крови. Поэтому, антисмысловые олигонуклеотиды, снижающие уровни фактора 11, могут быть использованы для ингибирования образования тромбов или сгустков крови, ассоциированного с патологическими изменениями стенок сосудов, но не с повреждением ткани.

Анализ на активность белка

Пробы крови брали в различные промежутки времени и измеряли уровень профермента фактора 11 в анализе на F11, проводимом исходя из времени свертывания крови. Время свертывания крови определяли в дубликате на полуавтоматическом приборе для оценки свертывания крови ST4 (Diagnostica Stago, NJ). 30 мкл обработанной цитратом пробы плазмы, разведенной 1/20 в буфере HEPES-NaCl с BSA, инкубировали с 30 мкл реагента для оценки АПТВ (Automated aPTT, Organon Technika, NC) и 30 мкл обработанной цитратом плазмы, дефицитной по фактору 11 (George King Bio-Medical Inc.) при 37°C в течение 5 минут с последующим добавлением 30 мкл 25 мМ CaCl2 для инициации свертывания крови. Результаты интерполировали на стандартной кривой серийных разведений обработанной цитратом контрольной плазмы.

Результаты представлены в таблице 118 как процент ингибирования активности фактора 11 по отношению к PBS-контролю. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Анализ на фибриноген

Приготавливали образцы, содержащие девять частей свежей плазмы обезьян на одну часть тринатрийцитрата. Эти образцы оценивали на содержание фибриногена на приборе для оценки свертывания крови ACL 9000 (Instrumentation Laboratory, Italy). Результаты, представленные в таблице 119, выражены в мг/дл. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Анализ на кровотечение

В различные дни во время обработки проводили анализ на кровотечение с помощью устройства Surgicutt Jr. (ITC, New Jersey). Обезьян помещали на станок для обезьян так, чтобы их конечности находились в неподвижном положении. Конечности слегка выбривали, и на верхней конечности закрепляли сфигмоманометр. Манжету сфигмоманометра раздували до 40 мм рт.ст. и такое давление поддерживали во время всей процедуры. Разрезаемый участок на верхней конечности обрабатывали антисептическим тампоном и с помощью устройства Surgicutt Jr делали разрез на латеральной поверхности, волярной поверхности предплечья, параллельно и на 5 см ниже складки передней части локтя. Точное время разреза фиксировали секундомером. Через каждые 30 секунд, кровь из разреза удаляли с помощью промокательной бумаги, не дотрагиваясь до разреза, так, чтобы не нарушить процесс образования тромбоцитарной пробки. Кровь удаляли через каждые 30 минут до тех пор, пока на бумаге не оставалось пятен. Затем секундомер останавливали и определяли время кровотечения. Затем с конечности животного снимали сфигмоманометр, и участок разреза обрабатывали антисептическим тампоном, после чего рану закрывали повязкой. Результаты, представленные в таблице Х, выражены в секундах. Полученные результаты представлены в таблице 120. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Эти данные позволяют предположить, что геморрагическая активность рассматриваемых здесь соединений является низкой.

Анализ на агрегацию тромбоцитов

Агрегацию тромбоцитов инициировали путем добавления 1 ммоль/л АДФ и/или 3 мкг коллагена (в зависимости от дня сбора как показано в таблице 121) в пробы плазмы, и эти пробы оставляли на 10 минут. Агрегацию охарактеризовывали путем регистрации изменения электрического сопротивления или импеданса, и изменения кривой первого порядка агрегации тромбоцитов после изменения их формы. Тест на агрегацию проводили два раза для каждой пробы в каждый день сбора, и брали среднюю величину. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Масса тела и органов

Массу тела определяли один раз в неделю во время введения доз. Результаты измерений для каждой группы представлены в таблице 122 и выражены в граммах. Результаты показали, что обработка антисмысловыми олигонуклеотидами не приводит к каким-либо негативным изменениям состояния здоровья животных, но может приводить к значительному изменению массы тела по сравнению с PBS-контролем. После того, как животные были подвергнуты эвтаназии, была измерена масса их органов, а затем у них брали почки и селезенку, и измеряли их массу. Результаты, представленные в таблице 123, также указывали на отсутствие какого-либо значительного изменения массы органов по сравнению с PBS-контролем, за исключением животных, обработанных олигонуклеотидом ISIS 416858, у которых наблюдалось увеличение массы селезенки. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации трансаминаз в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Затем измеряли концентрации ALT (аланинтрансаминазы) и AST (аспартаттрансаминазы) в плазме, и полученные результаты представлены в МЕ/л в таблицах 124 и 125. Антисмысловые олигонуклеотиды, которые не давали более чем 7- кратное увеличение уровней ALT/AST по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Также измеряли уровни билирубина в плазме, и полученные результаты представлены в мг/дл в таблице 126. Антисмысловые олигонуклеотиды, которые не давали более чем 2-кратное увеличение уровней билирубина по сравнению с контрольными уровнями, отбирали для дальнейших исследований. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек брали образцы мочи. Затем, после обработки антисмысловыми олигонуклеотидами измеряли отношение количества белка к количеству креатинина в моче в образцах мочи, и полученные результаты представлены в таблице 127. Антисмысловые олигонуклеотиды, которые не давали более чем 5-кратное увеличение отношения белок/креатинин в моче по сравнению с PBS-контролем, отбирали для дальнейших исследований.

Определение концентрации олигонуклеотидов

Была измерена концентрация полноразмерного олигонуклеотида, а также было определено время разложения олигонуклеотидов и время их выведения из печени и почек. Применяемый метод представляет собой модификацию опубликованных ранее методов (Leeds et al., 1996; Geary et al., 1999), которая состоит из стадии экстракции фенолом-хлороформом (жидким фенолом - жидким хлороформом) и стадии твердофазной экстракции. Перед экстракцией добавляли внутренний стандарт (ISIS 355868, 27-мерный фосфортиоатный олигонуклеотид, модифицированный 2′-O-метоксиэтилом, GCGTTTGCTCTTCTTCTTGCGTTTTTT и обозначенный здесь как SEQ ID NO:270). Концентрации в образцах ткани вычисляли с помощью калибровочных кривых, где наименьший предел количественной оценки (LLOQ) составляет приблизительно 1,14 мкг/г. Затем определяли время полужизни с помощью программы WinNonlin (PHARSIGHT). Результаты представлены в таблицах 128 и 129 и выражены в мкг/г ткани печени или почек.

Анализ крови

Кровь, которую брали у обезьян всех групп, посылали в Корейский Институт токсикологических исследований (KIT) для анализов на HCT, MCV, MCH и MCHC, а также для определения числа различных клеток крови, таких как WBC (нейтрофилы, лимфоциты, моноциты, эозинофилы, базофилы, ретикулоциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 130-143. Антисмысловые олигонуклеотиды, которые не давали более чем 50% снижение числа тромбоцитов и более чем 3-кратное увеличение числа моноцитов, отбирали для дальнейших исследований. Олигонуклеотид ISIS 416850, вводимый в соответствии со схемой непрерывного введения доз, отличался от других олигонуклеотидов, обозначенных звездочкой (*).

Анализы на цитокины и хемокины

Пробы крови, взятые у групп обезьян, обработанных PBS, ISIS 416850 и ISIS 416858 в соответствии со схемой увеличения доз, посылали в Институт Pierce Biotechnology (Woburn, MA) для измерения уровней хемокинов и цитокинов. Уровни IL-1β, IL-6, IFN-γ и TNF-α измеряли с использованием соответствующих антител приматов, а уровни IL-8, MIP-1α, MCP-1, MIP-1β и RANTES измеряли с использованием соответствующих перекрестно реагирующих человеческих антител. Измерения проводили за 14 дней до начала обработки и на день 85, когда обезьянам делали эвтаназию. Результаты представлены в таблицах 144 и 145.

Пример 46

Фармакологический эффект обработки антисмысловыми олигонуклеотидами, нацеленными на человеческий фактор 11, у собакоподобных обезьян

Несколько антисмысловых олигонуклеотидов, выбранных в исследованиях на их переносимость грызунами (примеры 41-44), тестировали у собакоподобных обезьян для определения фармакологических эффектов, относительной эффективности по отношению к активности фактора 11, и переносимости этих олигонуклеотидов собакоподобными обезьянами, используемыми в качестве моделей. Антисмысловые олигонуклеотиды также сравнивали с олигонуклеотидами ISIS 416850 и ISIS 416858, выбранными в проведенных ранее исследованиях на обезьянах (пример 45). Все олигонуклеотиды ISIS, используемые в данном исследовании, были нацелены на мРНК человеческого фактора 11 и также вступали в полную перекрестную реакцию с генной последовательностью макак-резусов (см. таблицы 44 и 46). Было высказано предположение, что олигонуклеотиды ISIS макак-резуса также вступают в полную перекрестную реакцию с генной последовательностью собакоподобных обезьян. Во время проведения исследования, геномная последовательность собакоподобных обезьян отсутствовала в базе данных Национального центра биотехнологической информации (NCBI), а поэтому перекрестная реакция с генной последовательностью собакоподобных обезьян не могла быть подтверждена.

Обработка

Группам обезьян, каждая из которых включала два самца и две самки обезьян, подкожно инъецировали 25 мг/кг ISIS 416850, ISIS 449709, ISIS 445522, ISIS 449710, ISIS 449707, ISIS 449711, ISIS 449708, 416858 и ISIS 445531. Антисмысловой олигонуклеотид вводили обезьянам в дозе 25 мг/кг три раза в неделю в течение 1-ой недели и 25 мг/кг два раза в неделю в течение 2-8 недель. Контрольной группе, состоящей из двух самцов и двух самок обезьян, подкожно инъецировали PBS в соответствии с той же самой схемой введения доз. Массу тела измеряли за 14 и 7 дней до начала обработки, а затем еженедельно в течение всего периода обработки. Пробы крови брали за 14 и 7 дней до начала обработки, а затем несколько раз в течение всей процедуры введения доз для измерения ПВ и АПТВ и определения различных гематологических факторов. На день 55, обезьян подвергали эвтаназии путем кровопускания под глубоким наркозом, и брали органы для последующего анализа.

Анализ на РНК

На день 55, из ткани печени экстрагировали РНК для анализа на фактор 11, проводимого с помощью ПЦР в реальном времени, с использованием набора праймеров и зонда LTS00301. Результаты представлены как процент ингибирования фактора 11 по отношению к PBS-контролю. Как показано в таблице 146, обработка олигонуклеотидами ISIS 416850, ISIS 449709, ISIS 445522, ISIS 449710, ISIS 449707, ISIS 449708, 416858 и ISIS 445531 приводила к значительному снижению уровней мРНК фактора 11 по сравнению с PBS-контролем.

Анализ белка

Пробы плазмы, взятые в различные дни у обезьян всех групп, анализировали с помощью «сэндвич»-ELISA-анализа (Affinity Biologicals Inc.) с использованием аффинно очищенного поликлонального антитела против фактора 11 в качестве антитела для захвата, и конъюгированного с пероксидазой поликлонального антитела против фактора 11 в качестве детектирующего антитела. Плазму обезьян разводили 1:50 для анализа. Пероксидазную активность экспрессировали путем инкубирования с субстратом o-фенилендиамином. Интенсивность окраски количественно оценивали на микропланшет-ридере на 490 нм и выражали как количество, пропорциональное концентрации фактора 11 в образцах.

Результаты, представленные в таблице 147, выражали как процент снижения по отношению к PBS-контролю. Обработка ISIS 416850, ISIS 449709, ISIS 445522 и ISIS 416858 приводила к зависимому от времени снижению уровней белка.

Анализ на ПВ и АПТВ

ПВ и АПТВ измеряли с использованием обедненной тромбоцитами плазмы (ОТП), взятой у мышей, обработанных олигонуклеотидами ISIS. Величины ПВ и АПТВ, представленные в таблицах 148 и 149, были выражены как Международные величины нормализованных отношений (INR). Величины INR для ПВ и АПТВ были определены путем деления величины ПВ и АПТВ для каждой экспериментальной группы на величины ПВ и АПТВ для PBS-обработанной группы. Затем это отношение возводили в степень, равную Международной величине показателя чувствительности (ISI) используемого тканевого фактора. Как показано в таблице 148, PT значительно не увеличивалось у мышей, обработанных олигонуклеотидами ISIS. Однако, АПТВ значительно увеличивалось у групп, обработанных олигонуклеотидами ISIS 416850, ISIS 445522 и ISIS 416858, как показано в таблице 149. Полученные данные позволяют предположить, что снижение уровня фактора 11 под действием антисмысловых олигонуклеотидов влияет на путь контактной активации, но не на внешний путь свертывания крови. Поэтому, эти антисмысловые олигонуклеотиды ISIS, снижающие уровни фактора 11, могут быть использованы для ингибирования образования тромбов или сгустков крови, ассоциированного с патологическими изменениями стенок сосудов, но не с повреждением ткани.

Масса тела и органов

Массы тела животных каждой группы представлены в таблице 150 и выражены в граммах. Результаты показали, что обработка антисмысловыми олигонуклеотидами не приводит к каким-либо негативным изменениям состояния здоровья животных, но может приводить к значительному изменению массы тела по сравнению с PBS-контролем. После эвтаназии животных на день 55, измеряли массу органов, а затем у них брали печень, почки и селезенку. Результаты, представленные в таблице 150 и выраженные в процентах по массе тела, также указывали на отсутствие какого-либо значительного изменения массы органов по сравнению с PBS-контролем, за исключением животных, обработанных олигонуклеотидом ISIS 449711, у которых наблюдалось увеличение массы селезенки.

Функция печени

Для оценки влияния олигонуклеотидов ISIS на функцию печени измеряли концентрации ALT и AST в плазме на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY). Затем измеряли концентрации аланинтрансаминазы (ALT) и аспартаттрансаминазы (AST) в плазме, и полученные результаты представлены в МЕ/л в таблицах 152 и 153. Также измеряли уровни билирубина в плазме, и результаты, представленные в таблице 154, выражали в мг/дл. Как показано в таблицах 152-154, какого-либо заметного увеличения уровней метаболических маркеров в печени после обработки антисмысловыми олигонуклеотидами не наблюдалось.

Функция почек

Для оценки влияния олигонуклеотидов ISIS на функцию почек брали образцы мочи в различные дни. Затем измеряли уровни BUN в различные периоды времени на автоматическом анализаторе, применяемом в методах медицинской химии (Hitachi Olympus AU400e, Melville, NY), и полученные результаты представлены в таблице 155. После обработки антисмысловыми олигонуклеотидами на день 49 также вычисляли отношение белок/креатинин в образцах мочи, и полученные результаты представлены в таблице 156. Как показано в таблицах 155 и 156, какого-либо заметного увеличения уровней метаболических маркеров в почках после обработки антисмысловыми олигонуклеотидами не наблюдалось.

Анализ крови

Кровь, которую брали у обезьян всех групп в различные дни, посылали в Корейский Институт токсикологических исследований (KIT) для анализов на HCT, MCV, MCH и MCHC, а также для определения числа различных клеток крови, таких как WBC (нейтрофилы и моноциты), эритроциты (RBC) и тромбоциты, и для определения общего содержания гемоглобина. Результаты представлены в таблицах 157-166.

1. Модифицированный олигонуклеотид, состоящий из 14-30 связанных нуклеозидов, где нуклеотидная последовательность модифицированного олигонуклеотида по меньшей мере на 90% комплементарна части последовательности SEQ ID NO:1 или SEQ ID NO:2, имеющей ту же длину, и где олигонуклеотид способен ингибировать экспрессию фактора 11.

2. Олигонуклеотид по п.1, где нуклеотидная последовательность модифицированного олигонуклеотида по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% комплементарна части последовательности SEQ ID NO:1 или SEQ ID NO:2, имеющей ту же длину.

3. Олигонуклеотид по п.1 или 2, содержащий нуклеотидную последовательность, содержащую часть из по меньшей мере 8 смежных нуклеотидных оснований, комплементарную части последовательности SEQ ID NO:1 или SEQ ID NO:2, имеющей ту же длину.

4. Олигонуклеотид по п.3, содержащий нуклеотидную последовательность, содержащую часть из по меньшей мере 8 смежных нуклеотидных оснований, комплементарную части последовательности нуклеотидных оснований 1275-1318 SEQ ID NO:1, имеющей ту же длину.

5. Олигонуклеотид по п.1 или 2, имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований любой из последовательностей SEQ ID NO:223, 217, 15-216, 218-222 или 224-269.

6. Олигонуклеотид по п.5, который содержит нуклеотидную последовательность любой из последовательностей SEQ ID NO:223, 217, 15-216, 218-222 или 224-269.

7. Олигонуклеотид по п.5, который состоит из нуклеотидной последовательности любой из последовательностей SEQ ID NO:223, 217, 15-216, 218-222 или 224-269.

8. Олигонуклеотид по п.1 или 2, имеющий:
(i) нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований последовательности SEQ ID NO: 223, 217, 51, 52, 53, 114, 115, 213, 214, 215, 216, 218, 219, 220, 221, 222, 224, 225, 226, 227, 228, 229, 230, 231, 232, 242, 243, 245, 246, 247, 248, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268 или 269;
(ii) нуклеотидную последовательность, состоящую из любой из последовательности SEQ ID NO:223, 217, 51, 52, 53, 114, 115, 213, 214, 215, 216, 218, 219, 220, 221, 222, 224, 225, 226, 227, 228, 229, 230, 231, 232, 242, 243, 245, 246, 247, 248, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268 или 269;
(iii) нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований последовательности SEQ ID NO:223, 217, 51, 52, 53, 114, 115, 213, 214, 215, 216, 218, 219, 220, 221, 222, 224, 225, 226, 227, 228, 229, 230, 231 или 232; или
(iv) нуклеотидную последовательность, состоящую из любой из последовательности SEQ ID NO:223, 217, 51, 52, 53, 114, 115, 213, 214, 215, 216, 218, 219, 220, 221, 222, 224, 225, 226, 227, 228, 229, 230, 231 или 232.

9. Олигонуклеотид по п.1, имеющий нуклеотидную последовательность, содержащую по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, по меньшей мере 14, по меньшей мере 16, по меньшей мере 18 или 20 смежных нуклеотидных оснований последовательности SEQ ID NO:223 или 217.

10. Олигонуклеотид по п.9, который содержит нуклеотидную последовательность SEQ ID NO:223 или 217.

11. Олигонуклеотид по п.9, который состоит из нуклеотидной последовательности SEQ ID NO:223 или 217.

12. Олигонуклеотид по п.1, где модифицированный олигонуклеотид состоит из 15-30, 18-24, 19-22 или 20 смежных нуклеозидов.

13. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, состоящий из одноцепочечного модифицированного олигонуклеотида.

14. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, где по меньшей мере одной межнуклеозидной связью является модифицированная межнуклеозидная связь.

15. Олигонуклеотид по п.14, где каждая межнуклеозидная связь представляет собой фосфортиоатную межнуклеозидную связь.

16. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, где по меньшей мере один нуклеозид содержит модифицированный сахар.

17. Олигонуклеотид по п.16, где по меньшей мере одним модифицированным сахаром является бициклический сахар.

18. Олигонуклеотид по п.17, где каждый из по меньшей мере одного бициклического сахара содержит 4′-(СН2)n-O-2′-мостик, где n равно 1 или 2.

19. Олигонуклеотид по п.17, где каждый из по меньшей мере одного бициклического сахара содержит 4′-CH(CH3)-O-2′-мостик.

20. Олигонуклеотид по п.16, где по меньшей мере один модифицированный сахар содержит 2′-O-метоксиэтильную группу.

21. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, содержащий по меньшей мере один модифицированный тетрагидропираном нуклеозид, в котором фуранозное кольцо заменено тетрагидропирановым кольцом.

22. Олигонуклеотид по п.21, где каждый из по меньшей мере одного нуклеозида, модифицированного тетрагидропираном, имеет структуру:

где Bx представляет собой необязательно защищенную гетероциклическую основную группу.

23. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, где по меньшей мере один нуклеозид включает модифицированное нуклеотидное основание.

24. Олигонуклеотид по п.23, где указанное модифицированное нуклеотидное основание представляет собой 5-метилцитозин.

25. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, где модифицированный олигонуклеотид включает:
гэп-сегмент, состоящий из связанных дезоксинуклеозидов;
5′-сегмент-крыло, состоящий из связанных нуклеозидов;
3′-сегмент-крыло, состоящий из связанных нуклеозидов,
где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами и где каждый нуклеозид каждого сегмента-крыла содержит модифицированный сахар.

26. Олигонуклеотид по п.25, где указанный модифицированный олигонуклеотид включает:
гэп-сегмент, состоящий из десяти связанных дезоксинуклеозидов;
5′-сегмент-крыло, состоящий из пяти связанных нуклеозидов;
3′-сегмент-крыло, состоящий из пяти связанных нуклеозидов,
где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами и где каждый нуклеозид каждого сегмента-крыла содержит 2′-O-метоксиэтилированный сахар; и каждая межнуклеозидная связь представляет собой фосфортиоатную связь.

27. Олигонуклеотид по п.25, где каждый цитозин представляет собой 5-метилцитозин.

28. Олигонуклеотид по любому из пп.1, 2, 4, 5, 6 и 9-12, где модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов.

29. Олигонуклеотид по п.1, где модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов и имеет нуклеотидную последовательность, содержащую 20 смежных нуклеотидных оснований SEQ ID NO:223, и где модифицированный олигонуклеотид включает:
гэп-сегмент, состоящий из десяти связанных дезоксинуклеозидов;
5′-сегмент-крыло, состоящий из пяти связанных нуклеозидов;
3′-сегмент-крыло, состоящий из пяти связанных нуклеозидов,
где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами и где каждый нуклеозид каждого сегмента-крыла содержит 2′-O-метоксиэтилированный сахар; каждой межнуклеозидной связью является фосфортиоатная связь, и каждый цитозин представляет собой 5-метилцитозин.

30. Олигонуклеотид по п.1, где модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов и имеет нуклеотидную последовательность, содержащую 20 смежных нуклеотидных оснований SEQ ID NO:217, и где модифицированный олигонуклеотид включает:
гэп-сегмент, состоящий из десяти связанных дезоксинуклеозидов;
5′-сегмент-крыло, состоящий из пяти связанных нуклеозидов;
3′-сегмент-крыло, состоящий из пяти связанных нуклеозидов,
где указанный гэп-сегмент расположен непосредственно между 5′-сегментом-крылом и 3′-сегментом-крылом и является смежным с этими сегментами и где каждый нуклеозид каждого сегмента-крыла содержит 2′-O-метоксиэтилированный сахар; каждой межнуклеозидной связью является фосфортиоатная связь, и каждый цитозин представляет собой 5-метилцитозин.

31. Олигонуклеотид по любому из пп.1-30 для применения в терапии.

32. Олигонуклеотид по п.31 для применения в лечении или предупреждении тромбоэмболического осложнения у животного.

33. Олигонуклеотид по п.32, где указанное тромбоэмболическое осложнение выбрано из тромбоза глубокой вены, эмболии легких, инфаркта миокарда и инсульта.

34. Олигонуклеотид по п.31 для применения в лечении нарушения свертывания крови у животного.

35. Олигонуклеотид по любому из пп.32-34, где животное является человеком.

36. Олигонуклеотид по любому из пп.1-30 для применения при лечении тромбоэмболических осложнений путем совместного введения с любым препаратом, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана и LOVENOX.

37. Олигонуклеотид по любому из пп.31-34, где олигонуклеотид предназначен для совместного введения с любым препаратом, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана, LOVENOX и ингибитора фактора Xa.

38. Олигонуклеотид по любому из пп.31-34, где олигонуклеотид предназначен для одновременного введения с любым препаратом, выбранным из группы, состоящей из аспирина, клопидогреля, дипиридамола, гепарина, лепирудина, тиклопидина, варфарина, апиксабана, ривароксабана, LOVENOX и ингибитора фактора Xa.

39. Олигонуклеотид по любому из пп.31-34, где олигонуклеотид предназначен для совместного введения с антитромбоцитарной терапией.

40. Олигонуклеотид по п.39, где антитромбоцитарная терапия выбрана из ингибитора аденозиндифосфатного (АДФ) рецептора, НСПВС, ингибитора фосфодиэстеразы, ингибитора гликопротеина IIB/IIIA или ингибитора поглощения аденозина или их комбинаций.

41. Олигонуклеотид по п.40, где НСПВС представляет собой аспирин, напроксен или их комбинацию.

42. Олигонуклеотид по п.40, где ингибитор рецептора АДФ/Р2Y12 представляет собой тиенопиридин.

43. Композиция для ингибирования экспрессии фактора 11 у животного, включающая эффективное количество олигонуклеотида по любому из пп.1-30 или его соли и фармацевтически приемлемый носитель или разбавитель.

44. Композиция по п.43, где животное является человеком.

45. Композиция по п.43, где олигонуклеотид предназначен для совместного введения с антитромбоцитарной терапией.

46. Композиция по п.45, где антитромбоцитарная терапия выбрана из ингибитора аденозиндифосфатного (АДФ) рецептора, НСПВС, ингибитора фосфодиэстеразы, ингибитора гликопротеина IIB/IIIA или ингибитора поглощения аденозина или их комбинаций.

47. Композиция по п.46, где НСПВС представляет собой аспирин, напроксен или их комбинацию.

48. Композиция по п.46, где ингибитор рецептора АДФ/Р2Y12 представляет собой тиенопиридин.

49. Способ лечения или предупреждения тромбоэмболического осложнения у животного, включающий введение животному, нуждающемуся в этом, олигонуклеотида по любому из пп.1-30 или композиции по п.43 в эффективном количестве.

50. Способ по п.49, где указанное тромбоэмболическое осложнение выбрано из тромбоза глубокой вены, эмболии легких, инфаркта миокарда и инсульта.

51. Способ лечения нарушения свертывания крови у животного, включающий введение животному, нуждающемуся в этом, олигонуклеотида по любому из пп.1-30 или композиции по п.43 в эффективном количестве.

52. Способ ингибирования экспрессии фактора 11 у животного, включающий введение указанному животному терапевтически эффективного количества олигонуклеотида по любому из пп.1-30 или композиции по п.43.

53. Способ по любому из пп.49-52, где животное является человеком.

54. Способ по любому из пп.49-52, где олигонуклеотид предназначен для совместного введения с антитромбоцитарной терапией.

55. Способ по п.54, где антитромбоцитарная терапия выбрана из ингибитора аденозиндифосфатного (АДФ) рецептора, НСПВС, ингибитора фосфодиэстеразы, ингибитора гликопротеина IIB/IIIA или ингибитора поглощения аденозина или их комбинаций.

56. Способ по п.55, где НСПВС представляет собой аспирин, напроксен или их комбинацию.

57. Способ по п.55, где ингибитор рецептора АДФ/P2Y12 представляет собой тиенопиридин.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению G-CSF, и может быть использовано для продуцирования G-CSF в клетках Е.coli. Для эффективной продукции белка в клетках Е.coli оптимизируют последовательность ДНК, кодирующую G-CSF.

Изобретение относится к биотехнологии, в частности к генно-инженерному получению белков человека, и может быть использовано для получения эпидермального фактора роста человека (чЭФР) в клетках бактерий в виде гибридного белка с глутатион-3-трансферазой.

Изобретение относится к области генной инженерии, конкретно к созданию мутеинов рецептора фактора роста фибробластов (FGFR), и может быть использовано в медицине. Полипептид мутеина кислотной зоны внеклеточного домена (ECD) рецептора FGFR4 представляет собой химеру кислотной зоны FGFR4 ECD или вариант длинного кислотного бокса FGFR4 и имеет большее количество кислотных остатков в линкерной зоне D1-D2, чем FGFR4 ECD дикого типа.

Изобретение относится к области биотехнологии, конкретно к вакцинации с использованием нуклеиновых кислот, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, а именно к получению генно-модифицированных клеточных линий, и может быть использовано в медицине для иммунотерапии и иммунопрофилактики у пациентов со злокачественными новообразованиями.

Изобретение относится к генетической инженерии и может быть использовано для получения рекомбинантного полипептида гранулоцитарного колониестимулирующего фактора человека.

Изобретение относится к области экспериментальной медицины и может быть использовано для создания нового антидиабетического препарата. .

Изобретение относится к биотехнологии, в частности к генетической инженерии и может быть использовано для получения гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека.

Изобретение относится к новым соединениям общей формулы [1] или их фармацевтически приемлемым солям, которые обладают свойствами ингибитора активности JAK2 тирозинкиназы.

Изобретение относится к медицине, конкретно к фармакологии. Предложено применение секоизоларицирезинола в качестве гемореологического, антитромбоцитарного и эндотелийпротекторного средства.

Изобретение относится к медицине, а именно к неврологии и кардиологии, и касается лечения или профилактики тромбоза. Для этого осуществляют введение этексилата дабигатрана в дозе от 150 до 300 мг дважды в сутки.

Изобретение относится к способу получения суспензии полиморфной формы I соли метансульфоновой кислоты и этексилата дабигатрана формулы I Способ характеризуется тем, что полиморфную форму I метансульфоната этексилата дабигатрана с температурой плавления tпл.
Изобретение относится к медицине и предназначено для профилактики тромбозов у больных с сердечно-сосудистыми заболеваниями и хронической болью. Назначают препарат теноксикам в дозе 20 мг по 1 таблетке в сутки в период обострения болевого синдрома.

Изобретение относится к соединению со структурой формулы (I) или к его фармацевтически приемлемой соли, где R представляет собой цианогруппу. Изобретение также относится к способу получения указанного соединения и к фармацевтической композиции против агрегации тромбоцитов на основе этого соединения.

Изобретение относится к соединениям или их фармацевтически приемлемым солям, где соединение имеет формулу I-а, в которой R1 и R3 отсутствуют, m представляет собой целое число от 1 до 2, n представляет собой целое число от 1 до 3, A представляет собой , B представляет собой или , где X2 представляет собой O или S, R4a отсутствует, R4b выбирают из группы, состоящей из: , , , , и ; Rk выбирают из C1-6алкила и C1-6галогеналкила, L и E являются такими, как указано в п.1 формулы изобретения; или соединение является таким, как указано в b) п.1 формулы изобретения.

Настоящее изобретение относится к биотехнологии и представляет собой полипептидную конструкцию для лечения, профилактики и облегчения нарушений, связанных с адгезией тромбоцитов и опосредованной тромбоцитами агрегацией или ее дисфункцией, которая включает одно или более однодоменных антител, направленных против фактора фон Виллебранда (vWF), и одно или более однодоменных антител, направленных против сывороточного альбумина (SA).

Изобретение относится к химии серосодержащих и терпеновых соединений, а именно к 2-({[(1S,2R,5S)-6,6-диметилбицикло[3.1.1]гепт-2-ил]метил}сульфинил)этановой кислоте структурной формулы I: Технический результат: получено новое соединение, которое может быть использовано в медицине в качестве средства, обладающего антиагрегационным действием, для консервации препаратов крови и профилактики тромбозов.
Изобретение относится к области медицины, конкретно к фармацевтической композиции, обладающей противотромботическим, тромболитическим, иммуномодулирующим, противовоспалительным действиями, нормализующей липидный и углеводный обмен, конкретно к фармацевтической композиции на основе субстанции «пиявит» (далее пиявит), изготовленной из лиофилизированной медицинской пиявки.
Изобретение относиться к области ветеринарии. Способ заключается в применении стельным коровам за 30 дней до отела иммуностимулятора «Риботан» внутримышечно в дозе 10 мл на животное однократно в сочетании с углеводно-минеральной добавкой «Фелуцен» ежедневно с кормом из расчета 50 г на животное.
Наверх