Способы получения клеток, проявляющих фенотипическую пластичность



Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность
Способы получения клеток, проявляющих фенотипическую пластичность

 


Владельцы патента RU 2536941:

СТЕФЕН САНИГ РЕСЕРЧ ИНСТИТЬЮТ ЛТД. (AU)

Изобретение относится к молекулярной биологии и клеточным технологиям. Предложен способ получения клетки с заданным фенотипом, где указанный способ включает стадии гибридизации первой стволовой клетки или клетки, происходящей из некоммитированной клетки-предшественника, второй клетки, происходящей из общей лимфоидной клетки-предшественника, и третьей клетки, происходящей из общей лимфоидной клетки-предшественника, с получением гибридной клетки, которая проявляет фенотипическую пластичность, и воздействия на указанную гибридную клетку условий, выбранных из группы, состоящей из тимической стромальной клетки, цитокина, фактора роста, иммуноглобулина, лиганда рецептора или их комбинации так, чтобы указанная гибридная клетка стала указанной клеткой с фенотипом В-клетки, Т-клетки, миелоидной клетки или дедифференцированного фенотипа относительно указанной гибридной клетки. Благодаря увеличению функциональной стабильности гибридных клеток и увеличению их фенотипической пластичности и эффективности трансдифференцировки изобретение может быть использовано для формирования тканей в медицине. 36 з.п. ф-лы, 33 ил., 11 табл., 7 пр.

 

ТЕХНИЧЕСКАЯ ОБЛАСТЬ

Настоящее изобретение относится к дифференцировке клеток и, в частности, к гибридным клеткам, которые проявляют фенотипическую пластичность, и к способам получения этих клеток. Также изобретение относится к способам получения конкретных клеток с желаемым фенотипом. Кроме того, изобретение относится к способам получения гибридных клеток, способных дифференцироваться в состояние более раннего предшественника. Кроме того, изобретение относится к применению гибридных клеток в ряде применений, например, для получения тканей.

УРОВЕНЬ ТЕХНИКИ

Никакое обсуждение уровня техники на протяжении описания не следует считать допущением того, что такой уровень техники широко известен или составляет часть общей информации в данной области.

Сообщения о способности стволовых клеток регенерировать ткани организма и об уникальной пластичности клеточной категории стволовых клеток открыли возможность для направленной репарации тканей. Гемопоэтические стволовые клетки (HSC) проявляют как способность к самообновлению, так и потенциал к преобразованию в ряд специализированных типов кровяных клеток (ростков) под действием конкретного микроокружения. Процесс дифференцировки различных клеток крови, т.е. гемопоэз, обеспечивает ценную модель для исследования того, каким образом устанавливаются и выполняются генетические программы у позвоночных, а также каким образом гомеостаз образования крови изменяется при лейкозе. Недавние открытия не только указывают на то, как этого можно достигнуть, но также показывают необычайную пластичность тканевых стволовых клеток in vivo.

Гемопоэз обычно изображают иерархическим образом, где HSC сначала дают начало предкам, а затем предшественникам с различной способностью к дифференцировке по пути нескольких или одного ростка. Исследования пластичности клеток, коммитированных в конкретный росток, открыли, что процесс переключения между ростками требует трансформации и/или экспрессии онкогенов. Более того, когда наблюдали признаки переключения между ростками, было выявлено, что оно происходило только в небольшом проценте клеток (Klinken et al., Cell 53: 857-867, 1988; Graf et al., Blood 99: 3089-3101, 2002).

В частности, эксперименты с трансформированной вирусом Абельсона клеточной линией пре-B-лимфомы, обработанной 5-азацитидином, привели к подгруппе клеток, проявляющих подобные макрофагам свойства, включая способность прикрепляться к пластмассе, а также фагоцитарную и эстеразную активность (Boyd et al., Nature 297:691-693, 1982). Более поздние эксперименты продемонстрировали, что одновременная экспрессия онкогенов E-myc и v-raf в клеточных линиях B-лимфом и предлейкозных клетках B-ростка костного мозга могут приводить к их превращению в макрофаги. Эти трансфицированные подобные макрофагам клетки обладали множеством миеломоноцитарных маркеров, таких как колониестимулирующий рецептор-1, и экспрессировали лизоцим, но также сохраняли признаки исходных клеток, такие как реаранжировка иммуноглобулинов. В дополнение к преобразованию в макрофаги также было описано преобразование клеток B-ростка в гранулоциты при трансфекции гена max (Lindeman et al., Immunity 1: 517-527, 1994). Существенно, что только у очень небольших фракций клеток, экспрессирующих трансгены, в действительности происходило переключение ростка, указывая на то, что преобразование из одного ростка в другой является комплексным процессом, который не полностью понятен (Klinken et al., Cell 53: 857-867, 1988; Borzello et al., Mol. Cell Biol. 10:2703-2714, 1990).

Альтернативный экспериментальный подход для исследования пластичности гемопоэтического ростка вовлекал получение мышей с нокаутом. В частности, клетки B-ростка, происходящие из мышей с нокаутом Pax-5, обладали характеристиками пре-B-клеток, такими как экспрессия B220, AA4.1, SL-цепи и c-Kit (низкая), но не CD19. Эти клетки также обладали характеристиками плюрипотентных стволовых клеток, таких как постоянное самообновление на стромальных клетках в присутствии интерлейкина 7 (IL-7), хоминг в костный мозг после трансплантации, и способность к дифференцировке в большинство типов гемопоэтических клеток как in vivo, так и in vitro. Например, при трансплантации мышам с нокаутом RAG2 эти клетки дифференцируются в T-клетки (Ro link et al., Nature 401: 556-562, 1999). При выращивании в присутствии различных цитокинов или факторов роста они дифференцировались в ряд других типов клеток. Например, обработка IL-2 приводила к преобразованию в естественные киллерные клетки (NK-клетки), обработка CSF-1 и гранулолцитарно-макрофагальным колониестимулирующим фактором (GM-CSF) приводила к преобразованию в дендритные клетки, обработка CSF-1 приводила к преобразованию в макрофаги, и обработка IL-3, IL-6, фактором стволовых клеток (SCF) и гранулоцитарным колониестимулирующим фактором (G-CSF) приводила к преобразованию в нейтрофилы (Nutt et al., Nature 401: 556-562, 1999).

Хотя оказалось, что пластичность была продемонстрирована для клеток, происходящих из мышей с нокаутом Pax-5, клетки, проявляющие фенотип, сравнимый с пре-B-клетками с нокаутом Pax-5, наиболее вероятно, не существуют у животных дикого типа, поскольку культура пре-B-клеток из мышей дикого типа является проблематичной (Kee et al., Curr. Opin. Immunol. 13: 180-185, 2001).

Другие исследования с использованием трансгенных мышей, в которых исследуется пластичность общих лимфоидных предшественников (CLP), показали, что CPL из трансгенной линии мышей, эктопически экспрессирующей β-цепь рецептора IL-2 человека при культивировании на стромальных клетках в присутствии IL-7, дифференцировались в B-клетки и NK-клетки. Когда в культуру добавляли IL-2, они образовывали гранулоциты и макрофаги. Однако эти результаты нельзя было повторить для контрольных CLP, выращенных в тех же условиях (Kondo et al., Nature 407: 383-386, 2000). Таким образом, результаты этих исследований, по-видимому, указывают на то, что индукция пластичности клеток требует экспрессии генов, в норме не экспрессирующихся коммитированными клетками.

Клетки, проявляющие фенотипическую пластичность, подробно описанные в экспериментах, упомянутых выше, либо происходили из лимфом мыши, либо представляли собой клетки, трансформированные онкогеном, или они были изменены мутациями. Существуют ограниченные данные в отношении пластичности нормальных B-клеток. В одном наборе экспериментов описано преобразование положительных по CD19, DJ-реаранжировке и отрицательных по B220 B-клеток из костного мозга взрослых мышей в прикрепляющиеся подобные макрофагам клетки при культивировании с IL-3, IL-6 и GM-CF. Однако не было возможно достигнуть преобразования в NK- или T-клетки (Montecino-Rodriguez et al., Nat. Immunol. 2: 83-88, 2001).

Доступны очень ограниченные данные по обратной трансформации из миелоидного ростка в B-лимфоидный росток. Проведенные эксперименты первоначально касались вынужденной экспрессии ранних специфичных для B-ростка факторов транскрипции, кодируемых геном E2A, EBF и RAG. Например, вынужденная экспрессия E2A вызывала утрату клетками свойств прикрепления, подавление экспрессии Mac-1 и c-fms, и индукцию ряда специфичных для B-ростка генов, включая способность образовывать κ-цепь в ответ на митогены (Kee et al., J. Exp. Med. 188: 699-713, 1998). Тот факт, что эти клетки не приобретали полный фенотип B-ростка, указывает на то, что комбинация экспрессии генов E2A, EBF и RAG не является достаточной для описания ростка и что должны быть вовлечены дополнительные гены (Romanow et al., Mol. Cell, 5: 343-353, 2000).

Также существуют примеры возможного преобразования между T-ростком и макрофагами. Подгруппа очищенных про-T-клеток при культивировании в кондиционированной среде из тимусной стромальной клеточной линии образовывала функциональные макрофаги. То же преобразование наблюдали в присутствии комбинации IL-6, IL-7 и макрофагального колониестимулирующего фактора (M-CSF; CSF-1), но со значительно более низкой частотой (Lee et al., J. Immunol. 166: 5964-5989, 2001).

В большинстве случае описанная трансдифференцировка, вероятно, отражает пластичность в миелоидно-эритроидном сегменте. Большинство экспериментов в этой области основаны на вынужденной экспрессии факторов транскрипции. Большинство воспроизводимых и предсказуемых экспериментальных систем, вовлекающих прямую дифференцировку культивируемых клеточных линий из одного ростка в другой, основаны на трансформации эритроидно-мегакариоцитарных предшественников птиц вирусом лейкоза, кодирующим Myb-Ets. Эти клетки E26-MEP экспрессируют ряд поверхностных маркеров мегакариоцитов и стволовых клеток, таких как MEP21/тромбомуцин/PCLP1 и GPIIaIIb/CD41 (Graf et al., Cell 70:201-213, 1992; McNagny et al., J. Cell. Biol. 138: 1395-14-7, 1997), а также GATA-1 и FOG-1, но не поверхностные маркеры миеломоноцитарных клеток и не PU.1, C/EBPα и C/EBPβ или их низкие уровни. Если v-Ets инактивирован в этих клетках, они дифференцируются в эритроидные клетки (Golay et al., Cell 55: 1147-1 158, 1987; Rossi et al., Curr. Biol. 6: 866-872, 1988). Альтернативно инактивация Myb приводит к преобразованию этих клеток в тромбоциты (Frampton et al., EMBO J. 14: 2866-2875, 1995). Путем индукции онкогенов каскадов ras ретровирусной трансформацией или активирующей протеинкиназой C (PKC), клетки можно коммитировать, чтобы они стали либо эозинофилами, либо миелобластами, в зависимости от силы сигнала (Graf et al., Cell 70:201-213, 1992; Rossi et al., EMBO J. 15: 1894-1901, 1996). Широко признано, что поддержание мультипотентного или дифференцированного состояния является результатом непрерывного процесса и что активация или подавление одного (или нескольких) ядерных регуляторов может привести к дифференцировке, переключению между ростками и дедифференцировке (Orkin, Nature Rev. Genet. 1: 57-64, 2000). В этом контексте исследование ядерных факторов транскрипции, экспрессия которых ограничена конкретными ростками, представляет особый интерес, поскольку они устанавливают программы экспрессии генов, присущие диверсификации клеток. В то время как факторы роста являются важными для поддержания гемопоэза, жизнеспособности клеток и пролиферации, они не обязательно являются полезными для каскада дифференцировки (Sokolovsky et al., Proc. Natl. Acad. Sci. USA 95: 6573-6575, 1998; Stoffel et al., Proc Natl. Acad. Sci. USA 96: 698-702, 1999).

Комплексность дифференцировки ростка далее была проиллюстрирована в исследованиях, которые указывают на то, что концентрация или уровень, при которых данный фактор экспрессируется, могут влиять на направление дифференцировки ростка. В частности, в трансформированной системе предшественников из курицы (Kulessa et al., Genes Dev. 9: 1250-1262, 1995), продукт ростка коррелировал с уровнем экспрессии GATA-1. При низких уровнях он давал эозинофилы, и при высоких он продуцировал эритроидные и мегакариоцитарные клетки. Недавно также было открыто, что высокие уровни PU.1 способствуют развитию макрофагов, в то время как при низких уровнях образуются B-клетки (DeKoter et al., Science 288: 146-149, 2000).

Также недавно было обнаружено, что HSC обладают примечательной способностью давать различные типы тканей. Таким образом, способность контролировать или индуцировать пластичность клеток потенциально имеет множество ценных применений. Например, с использованием высоко очищенных HSC достигали функционального исправления в печени дефицита тирозинкиназы FAH. Гепатоциты происходят из эндодермы, таким образом, оказалось, что HSC мезодермального происхождения способны превращаться в эндодермальное производное (Lagasse et al., Nature Med, 6: 1229-1234, 2000). Другой ряд экспериментов указывает на еще большую пластичность HSC, где единичная стволовая клетка, происходящая из костного мозга, продемонстрировала низкий уровень вклада в различные эпителиальные ткани во многих органах, даже несмотря на то, что не представлены данные о функциональной способности этих клеток (Krause et al., Cell 105: 369-377, 2001). Недавние эксперименты со взрослыми стволовыми клетками, происходящими из обогащенных популяций костного мозга, далее указали на способность к восстановлению мышечных клеток после инфаркта миокарда (Orlic et al., Ann. NY Acad. Sci. 938: 221-230, 2001; Orlic et al., Nature 410: 701-705, 2001; Jackson et al., J. Clin. Invest. 107: 1395-1402, 2001).

Исследования, подробно описанные выше, отчетливо указывают на то, что понимание пластичности и способность вносить пластичность в клетки имеют потенциально ценные применения, например, в регенерации тканей.

Также существуют накапливающиеся данные о том, что кроветворные клетки могут ретро- или дедифференцироваться в состояние более раннего предшественника. Например, миеломоноцитарные клетки курицы, трансформированные чувствительным к температуре (ts) мутантом v-myb, проявляют незрелый фенотип, напоминающий миелобласты, при пермиссивных температурах. Однако при непермиссивных температурах они переключаются на прикрепляющиеся фагоцитарные подобные макрофагам клетки и прекращают делиться. Эксперименты по мониторингу показали, что этот процесс был обратим, причем большинство прикрепляющихся клеток приобретали обратно морфологию бластов и повторно входили в клеточный цикл в пределах 2-3 суток после переключения на пермиссивную температуру (Beug et al., Genes Dev. 1: 277-286, 1987).

До настоящего времени большинство исследований по изучению трансдифференцировки проводили с клетками не человека, поскольку не существует воспроизводимой и стабильной модели, которая позволяет получение функционально дифференцированных миелоидных или лимфоидных клеток из популяции клеток путем манипулирования с их окружением.

В настоящее время все исследования по трансдифференцировке в гемопоэтическом ростке проводили в моделях на животных, требующих трансплантации живому хозяину. Более того, ни одна из этих модельных систем не продемонстрировала высокую частоту клеток, которые переключаются на различные ростки, таким образом ограничивая эффективность исследований in vitro и in vivo. Наиболее существенно, эти модели часто вовлекают использование клеточных фенотипов, которые не существуют в природе, таких как клетки из трансгенных животных или искусственно трансформированные клетки.

Существует ограниченное количество данных или отсутствуют доступные данные в отношении трансдиффенцировки зрелых эффекторных клеток. Это является результатом отсутствия клеточной системы или модели на животных, которая включает маркеры зрелых фенотипов B-клеток, T-клеток и миелоидных клеток, в частности маркеры, такие как CD19, CD4 или CD3 и CD15. Большинство экспериментов с трансдифференцировкой B-ростка вовлекают пре-B-клетки с очень низкой частотой превращения в зрелые положительные по CD19 клетки. В то время как преобразования между B-ростком и миелоидным, и T-лимфоидным и миелоидным ростками достигали с ограниченным успехом, не наблюдали преобразования между B и T-лимфоидными ростками.

Задачей настоящего изобретения является преодоление или уменьшение по меньшей мере одного из недостатков уровня техники, или предоставление пригодной альтернативы.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Главным образом, считают, что многократно слитые клетки являются нестабильными, и что чем больше клеток вовлечено в слияние, тем большей является нестабильность полученной гибридной клетки. Неожиданно в настоящем изобретении гибридные клетки, полученные слиянием нескольких клеток, например трех клеток, проявляют функциональную стабильность. В частности, было открыто, что клетки, происходящие из различных ростков, можно подвергать соматическому слиянию или гибридизовать с образованием по существу стабильных химерных/гибридных клеток. Более конкретно, настоящее изобретение относится к химерным/гибридным клеткам перекрестного происхождения, полученным гибридизацией по меньшей мере трех родительских клеток, приводящей к тройному гибриду, где по меньшей мере две родительские клетки происходят из различных ростков и где в гибридизацию не включена клетка миеломы.

Также неожиданно было открыто, что стабильные химерные/гибридные клетки по изобретению проявляют фенотипическую пластичность, которая позволяет их преобразование в клетку желаемого фенотипа, такого как фенотип желаемого ростка, путем обработки заданным экзогенным фактором или факторами. Эти факторы могут включать цитокин, фактор роста, иммуноглобулин, лиганд рецептора, клетку, такую как стромальная клетка, или их комбинации.

Ранее известные способы изменения клеточного фенотипа вовлекали трансформацию клеток, например, путем изменения экспрессии онкогена или выделения клеток из трансгенных животных. Эти способы являются технически сложными и приводят к неэффективным результатам, которые обычно включают низкие уровни клеточной фенотипической пластичности. Более того, эти известные способы нельзя применять в полной мере для клеток человека.

Настоящее изобретение относится к существенным преимуществам над ранее известными способами ввиду предоставления стабильной клеточной системы, позволяющей эффективную трансдифференцировку или дедифференцировку. Более того, настоящее изобретение позволяет трансдифференцировку или дедифференцировку клеток человека.

В одном варианте осуществления настоящее изобретение относится к предоставлению простой и универсальной модельной системы для исследования процесса клеточной дифференцировки, например дифференцировки клеток крови, т.е. гемопоэза. Также настоящее изобретение относится к предоставлению ценной модели для исследования того, каким образом у позвоночных устанавливаются и выполняются генетические программы. Также настоящее изобретение относится к обеспечению понимания образования клеточных новообразований, например того, как гомеостаз образования крови изменяется при лейкозах.

В альтернативном варианте осуществления настоящее изобретение также относится к получению клеток, которые проявляют фенотипическую пластичность, которую можно использовать в таких применениях, как получение определенных клеток или тканей для лечения заболевания.

Настоящее изобретение может олицетворять исследование модельной системы процесса дифференцировки. Также возможны ситуации, где может быть преимущественной способность дифференцировать или дедифференцировать определенные клетки из зрелых клеток. Например, у некоторых пациентов отсутствует способность продуцировать достаточно клеток с конкретным фенотипом вследствие мутации в некоторой точке каскада дифференцировки. Например, они могут иметь пре-B-клетки, но не зрелые B-клетки. Выделение пре-B-клеток из таких пациентов и преобразование их в B-клетки не может помочь. Однако с использованием изобретения их другие зрелые типы клеток без мутации можно трансдифференцировать в B-клетки.

В определенных вариантах осуществления изобретение относится к созданию гемопоэтической системы трансдифференцировки (HTS), которая позволяет получение B-клеток, T-клеток или миеломоноцитарных клеток, при необходимости.

В одном варианте осуществления тригибридную клетку, проявляющую клеточную пластичность, можно получать путем гибридизации одного миеломоноцитарного предшественника (либо бессмертного, либо первичного), одной B-клетки (либо бессмертной, либо первичной) и одной T-клетки (либо бессмертной, либо первичной), где указанная гибридная клетка экспрессирует определенные маркеры CD из всех типов клеток, использованных в гибридизации, например CD15, CD19, CD4. Однако квалифицированному специалисту будет понятно, что настоящее изобретение не ограничивается гибридными клетками, экспрессирующими эти конкретные маркеры.

В конкретных вариантах осуществления гибридные клетки по изобретению можно получать гибридизацией, например:

одного общего миеломоноцитарного предшественника K562 (CD72+CD15+) и одной первичной B-клетки (CD19) и одной T-клетки (CD4)-KBT;

одного общего миеломоноцитарного предшественника K562 и бессмертной B-клетки WIL2NS и бессмертной T-клетки MOLT4-KMW; или

одного общего миеломоноцитарного предшественника, происходящего из первичной CD34+CD15+ клетки костного мозга, одной бессмертной B-клетки WIL2NS и одной первичной T-клетки - WTM.

В особенно предпочтительном варианте осуществления гибридные клетки по изобретению можно дифференцировать в B-, T- или миеломоноцитарную клетку, при необходимости, либо путем воздействия на нее различных факторов, таких как цитокин, фактор роста, иммуноглобулин, лиганд рецептора, клетка, такая как стромальная клетка, или их комбинации, либо путем дальнейшей ее гибридизации с желаемым типом клеток. В другом варианте осуществления гибридную клетку по изобретению можно дедифференцировать путем дальнейшей гибридизации ее с другой клеткой, такой как клетка-предшественник, такая как клетка, которая экспрессирует, например, CD34.

Согласно первому аспекту настоящее изобретение относится к способу получения клетки с заданным фенотипом, причем указанный способ включает стадии гибридизации: первой клетки, где указанная первая клетка представляет собой стволовую клетку, или клетку, происходящую из некоммитированной клетки-предшественника; второй клетки, происходящей из общей лимфоидной клетки-предшественника; и третьей клетки, происходящей из общей лимфоидной клетки-предшественника, для получения гибридной клетки и воздействия на указанную гибридную клетку определенной окружающей среды, так чтобы указанный гибрид становился указанной клеткой с заданным фенотипом.

В одном варианте осуществления заданный фенотип представляет собой B-клетку, T-клетку или миелоидную клетку. В альтернативном варианте осуществления заданный фенотип представляет собой дедифференцированный фенотип относительно гибридной клетки. Дедифференцированный фенотип включает, например, экспрессию одного или нескольких из CD34, или CD10, или Pax-5, или λ-like.

В определенных вариантах осуществления первая клетка представляет собой клетку, происходящую из общей миелоидной клетки-предшественника, вторая клетка представляет собой клетку, происходящую из B-лимфоидного ростка, и третья клетка представляет собой клетку, происходящую из T-лимфоидного ростка.

Предпочтительно клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой миеломоноцитарную клетку-предшественника, моноцит, макрофаг, эозинофил, нейтрофил, дендритную клетку или базофил. По существу, очевидно, что изобретение относится к способу получения клетки с заданным фенотипом, включающему стадию гибридизации миеломоноцитарной клетки-предшественника, моноцита, макрофага, эозинофила, нейтрофила, дендритной клетки или базофила, B-лимфоидной клетки и T-лимфоидной клетки.

Предпочтительно клетка, происходящая из общей миелоидной клетки-предшественника, экспонирует по меньшей мере один из следующих антигенов CD: CD16, CD15 или CD14. По существу, очевидно, что изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника, которая экспонирует по меньшей мере один из следующих антигенов CD: CD16, CD15 или CD14, B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой моноцит. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию моноцита, B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой первичного миеломоноцитарного предшественника. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию первичного миеломоноцитарного предшественника, B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой иммортализованную клетку. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию иммортализованной клетки, выбранной из миеломоноцитарного предшественника, моноцита, макрофага, эозинофила, нейтрофила, дендритной клетки или базофила, B-лимфоидной клетки и T-лимфоидной клетки.

В другом варианте осуществления клетка, происходящая из общей миелоидной клетки-предшественника, происходят из селезенки, периферической крови, пуповинной крови или костного мозга. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника, происходящей из селезенки, периферической крови, пуповинной крови или костного мозга, B-лимфоидной клетки и T-лимфоидной клетки.

В другом варианте осуществления клетка, происходящая из B-лимфоидного ростка, представляет собой пре-B-клетку, незрелую B-клетку, наивную B-клетку, активированную B-клетку или эффекторную B-клетку. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки, выбранной из пре-B-клетки, незрелой B-клетки, наивной B-клетки, активированной B-клетки или эффекторной B-клетки и T-лимфоидной клетки.

В одном варианте осуществления эффекторная B-клетка представляет собой обученную антигеном B-клетку или плазматическую клетку. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, обученной антигеном B-клетки или плазматической клетки и T-лимфоидной клетки.

В одном варианте осуществления клетка, происходящая из B-лимфоидного ростка, экспонирует по меньшей мере один из следующих антигенов CD: CD19, CD20, CD72 или CD5. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки, которая экспонирует по меньшей мере один из следующих антигенов CD: CD19, CD20, CD72 или CD5, и T-лимфоидной клетки.

В одном варианте осуществления клетка, происходящая из T-лимфоидного ростка, представляет собой пре-T-клетку, незрелую T-клетку, наивную T-клетку, активированную T-клетку или эффекторную T-клетку. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки и двух T-лимфоидных клеток, выбранных из пре-T-клетки, незрелой T-клетки, наивной T-клетки, активированной T-клетки или эффекторной T-клетки.

В одном варианте осуществления указанная клетка, происходящая из T-лимфоидного ростка, экспонирует по меньшей мере один из следующих антигенов CD: CD3, CD4, CD5 или CD8. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки и двух T-лимфоидных клеток, выбранных из T-клеток, которые экспонируют по меньшей мере один из следующих антигенов CD: CD3, CD4, CD5 или CD8.

В одном варианте осуществления клетка, происходящая из B-лимфоидного ростка, представляет собой иммортализованную клетку. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, бессмертной B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления клетка, происходящая из T-лимфоидного ростка, представляет собой иммортализованную клетку. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и бессмертной T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из B-лимфоидного ростка, происходит из лимфоидной ткани. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки, происходящей из лимфоидной ткани, и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из T-лимфоидного ростка, происходит из лимфоидной ткани. По существу, изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и T-лимфоидной клетки, происходящих из лимфоидной ткани.

Когда B- или T-лимфоидные клетки, включенные в гибридные клетки по изобретению, происходят из лимфоидной ткани, указанная лимфоидная ткань предпочтительно выбрана из периферической крови, пуповинной крови, селезенки, костного мозга, тимуса, миндалевидных желез, аденоидов и регионарных лимфатических узлов.

В одном варианте осуществления по меньшей мере одна из клеток, включенная в способ по изобретению, представляет собой клетку человека. Также будет очевидно, что способ по изобретению может включать клетки, отличные от клетки человека, например клетку мыши.

В одном варианте осуществления клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой клетку K562. По существу, будет понятно, что изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию клетки K562, B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления вторая клетка или третья клетка представляет собой клетку WIL2-NS или клетку MOLT4 соответственно. По существу, будет понятно, что изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, клетки WIL2-NS и T-лимфоидной клетки. Также изобретение относится к способу получения клетки с заданным фенотипом, включающему гибридизацию общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и клетки MOLT4.

В одном варианте осуществления первая клетка представляет собой клетку K562, вторая клетка представляет собой клетку WIL2-NS и третья клетка представляет собой клетку MOLT4.

В другом варианте осуществления первая клетка представляет собой клетку K562, вторая клетка представляет собой первичную B-клетку и третья клетка представляет собой первичную T-клетку.

В другом варианте осуществления первая клетка представляет собой первичный моноцит человека, вторая клетка представляет собой клетку WIL2-NS и третья клетка представляет собой первичную T-клетку.

В другом варианте осуществления первая клетка представляет собой первичного миеломоноцитарного предшественника человека, вторая клетка представляет собой клетку WIL2-NS и третья клетка представляет собой первичную T-клетку человека.

В другом варианте осуществления первая клетка представляет собой клетку K562, вторая клетка представляет собой клетку WIL2-NS и третья клетка представляет собой первичную T-клетку.

В другом варианте осуществления указанная клетка представляет собой первичный моноцит мыши, вторая клетка представляет собой клетку SP2 и третья клетка представляет собой первичную T-клетку мыши.

В определенных вариантах осуществления B-клетка и T-клетка экспрессируют CD5. В альтернативных вариантах осуществления B-клетка экспрессирует CD20 и CD72 и указанная T-клетка экспрессирует CD4 и CD8.

В определенных вариантах осуществления гибридная клетка, полученная способом по изобретению, далее гибридизована с другой клеткой. При этом другая клетка может представлять собой, например, стволовую клетку или клетку-предшественника.

В определенных вариантах осуществления заданная окружающая среда включает тимическую стромальную клетку, цитокин, фактор роста, иммуноглобулин, лиганд рецептора или их комбинацию. По существу, будет понятно, что способ по изобретению относится к гибридизации: трех клеток, как описано выше, например, первой клетки, где указанная первая клетка представляет собой клетку, происходящую из некоммитированной клетки-предшественника; вторую клетку, происходящую из общей лимфоидной клетки-предшественника; и третью клетку, происходящую из общей лимфоидной клетки-предшественника, с получением гибридной клетки и воздействию на указанную гибридную клетку тимическими стромальными клетками, цитокином, фактором роста, иммуноглобулином, лигандом рецептора или их комбинацией, так чтобы указанная гибридная клетка стала указанной клеткой с заданным фенотипом.

В определенных вариантах осуществления цитокин или фактор роста, включенные в заданное окружение, выбраны из группы, состоящей из IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL-1-бета, IL-7, IL-23, TGF-бета, M-CSF, GM-CSF и IFN-гамма.

В определенных вариантах осуществления иммуноглобулин выбран из группы, состоящей из антитела против IL-4, антитела против IFN-гамма и антитела против CD3/CD28.

В определенных вариантах осуществления лиганд рецептора представляет собой лиганд Fit3 или лиганд CD40.

В другом аспекте изобретение относится к способу получения гибридной клетки согласно изобретению, где указанный способ включает стадию гибридизации: первой клетки, где указанная первая клетка представляет собой стволовую клетку или клетку, происходящую из некоммитированной клетки-предшественника; второй клетки, происходящей из общей лимфоидной клетки-предшественника; и третьей клетки, происходящей из общей лимфоидной клетки-предшественника, и где указанная первая клетка не является клеткой миеломы.

В одном варианте осуществления способа по изобретению указанная вторая клетка представляет собой клетку, происходящую из B-лимфоидного ростка, и указанная третья клетка представляет собой клетку, происходящую из B-лимфоидного ростка.

В другом варианте осуществления способа по изобретению указанная вторая клетка представляет собой клетку, происходящую из B-лимфоидного ростка, и указанная третья клетка представляет собой клетку, происходящую из T-лимфоидного ростка.

Предпочтительно указанная первая клетка представляет собой клетку, происходящую из общей миелоидной клетки-предшественника. По существу, очевидно, что изобретение относится к способу получения гибридной клетки гибридизацией общей миелоидной клетки-предшественника или стволовой клетки и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки гибридизацией общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и T-лимфоидной клетки.

Предпочтительно указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой миеломоноцитарную клетку-предшественника, моноцит, макрофаг, эозинофил, нейтрофил, дендритную клетку или базофил. По существу, очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации миеломоноцитарной клетки-предшественника, моноцита, макрофага, эозинофила, нейтрофила, дендритной клетки или базофила и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки гибридизацией миеломоноцитарной клетки-предшественника, моноцита, макрофага, эозинофила, нейтрофила, дендритной клетки или базофила, B-лимфоидной клетки и T-лимфоидной клетки.

Предпочтительно указная клетка, происходящая из общей миелоидной клетки-предшественника, экспонирует по меньшей мере один из следующих антигенов CD: CD16, CD15 или CD14. По существу, очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника, которая экспонирует по меньшей мере один из следующих антигенов CD: CD16, CD15 или CD14, и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника, которая экспонирует по меньшей мере один из следующих антигенов CD: CD16, CD15 или CD14, B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой моноцит. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации моноцита и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки путем гибридизации моноцита, B-лимфоидной клетки и T-лимфоидной клетки.

В другом варианте осуществления указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой первичную миеломоноцитарную клетку-предшественника. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации первичной миеломоноцитарной клетки-предшественника и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки путем гибридизации первичной миеломоноцитарной клетки-предшественника, B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой иммортализованную клетку. По существу, очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации иммортализованной клетки, выбранной из миеломоноцитарной клетки-предшественника, моноцита, макрофага, эозинофила, нейтрофила, дендритной клетки или базофила, и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки путем гибридизации иммортализованной клетки, выбранной из миеломоноцитарной клетки-предшественника, моноцита, макрофага, эозинофила, нейтрофила, дендритной клетки или базофила, B-лимфоидной клетки и T-лимфоидной клетки.

В другом варианте осуществления указанная клетка, происходящая из общей миелоидной клетки-предшественника, происходит из селезенки, периферической крови, пуповинной крови или костного мозга. По существу, очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника, происходящей из селезенки, периферической крови, пуповинной крови или костного мозга, и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника, происходящей из селезенки, периферической крови, пуповинной крови или костного мозга, B-лимфоидной клетки и T-лимфоидной клетки.

В другом варианте осуществления указанная клетка, происходящая из B-лимфоидного ростка, представляет собой пре-B-клетку, незрелую B-клетку, наивную B-клетку, активированную B-клетку или эффекторную B-клетку. По существу, очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки и двух B-лимфоидных клеток, выбранных из пре-B-клетки, незрелой B-клетки, наивной B-клетки, активированной B-клетки или эффекторной B-клетки. Также изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки, выбранной из пре-B-клетки, незрелой B-клетки, наивной B-клетки, активированной B-клетки или эффекторной B-клетки и T-лимфоидной клетки.

В одном варианте осуществления указанная эффекторная B-клетка представляет собой обученную антигеном B-клетку или плазматическую клетку. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки и двух B-лимфоидных клеток, выбранных из обученной антигеном B-клетки или плазматической клетки. Также изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, обученной антигеном B-клетки или плазматической клетки и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из B-лимфоидного ростка, экспонирует по меньшей мере один из следующих антигенов CD: CD19, CD20, CD72 или CD5. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки и двух B-лимфоидных клеток, которые экспонируют по меньшей мере один из следующих антигенов CD: CD19, CD20, CD72 или CD5. Также изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки, которая экспонирует по меньшей мере один из следующих антигенов CD: CD19, CD20, CD72 или CD5, и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из T-лимфоидного ростка, представляет собой пре-T-клетку, незрелую T-клетку, наивную T-клетку, активированную T-клетку или эффекторную T-клетку. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и T-лимфоидной клетки, выбранной из пре-T-клетки, незрелой T-клетки, наивной T-клетки, активированной T-клетки или эффекторной T-клетки.

В одном варианте осуществления указанная клетка, происходящая из T-лимфоидного ростка, экспонирует по меньшей мере один из следующих антигенов CD: CD3, CD4, CD5 или CD8. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и T-лимфоидной клетки, которая экспонирует по меньшей мере один из следующих антигенов CD: CD3, CD4, CD5 или CD8.

В одном варианте осуществления указанная клетка, происходящая из B-лимфоидного ростка, представляет собой иммортализованную клетку. По существу, изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки и двух B-лимфоидных клеток, по меньшей мере одна из которых может быть бессмертной клеткой. Также изобретение относится к гибридной клетке, полученной гибридизацией общей миелоидной клетки-предшественника или стволовой клетки, бессмертной B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из T-лимфоидного ростка, представляет собой иммортализованную клетку. По существу, изобретение относится к гибридной клетке, полученной гибридизацией общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и бессмертной T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из B-лимфоидного ростка, происходит из лимфоидной ткани. По существу, изобретение относится к гибридной клетке, полученной гибридизацией общей миелоидной клетки-предшественника или стволовой клетки и двух B-лимфоидных клеток, происходящих из лимфоидной ткани. Также изобретение относится к гибридной клетке, полученной гибридизацией общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки, происходящей из лимфоидной ткани, и T-лимфоидной клетки.

В одном варианте осуществления указанная клетка, происходящая из T-лимфоидного ростка, происходит из лимфоидной ткани. По существу, изобретение относится к гибридной клетке, полученной гибридизацией общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и T-лимфоидной клетки, происходящей из лимфоидной ткани.

Когда B- или T-лимфоидные клетки, вовлеченные в способ получения гибридной клетки по изобретению, происходят из лимфоидной ткани, указанная лимфоидная ткань предпочтительно выбрана из периферической крови, пуповинной крови, селезенки, костного мозга, тимуса, миндалевидных желез, аденоидов и регионарного лимфатического узла.

В одном варианте осуществления по меньшей мере одна из клеток, вовлеченных в способ получения гибридной клетки по изобретению, представляет собой клетку человека. Также будет очевидно, что способ получения гибридной клетки по изобретению может включать клетку, отличную от клетки человека, например клетку мыши.

В одном варианте осуществления указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой клетку K562. По существу, будет очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации клетки K562 и двух B-лимфоидных клеток. Также изобретение относится к способу получения гибридной клетки путем гибридизации клетки K562, бессмертной B-лимфоидной клетки и T-лимфоидной клетки.

В одном варианте осуществления указанная вторая клетка или указанная третья клетка представляет собой клетку WIL2NS или клетку MOLT4 соответственно. По существу, будет очевидно, что изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, клетки WIL2NS и T-лимфоидной клетки. Также изобретение относится к способу получения гибридной клетки путем гибридизации общей миелоидной клетки-предшественника или стволовой клетки, B-лимфоидной клетки и клетки MOLT4.

В одном варианте осуществления указанная первая клетка представляет собой клетку K562, указанная вторая клетка представляет собой клетку WIL2NS и указанная третья клетка представляет собой клетку MOLT4.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой клетку K562, указанная вторая клетка представляет собой первичную B-клетку и указанная третья клетка представляет собой первичную T-клетку.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой первичный моноцит человека, указанная вторая клетка представляет собой клетку WIL2NS и указанная третья клетка представляет собой первичную T-клетку.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой первичный миеломоноцитарный предшественник человека, указанная вторая клетка представляет собой клетку WIL2NS и указанная третья клетка представляет собой первичную T-клетку человека.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой клетку K562, указанная вторая клетка представляет собой клетку WIL2NS и указанная третья клетка представляет собой первичную T-клетку.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой первичный моноцит, указанная вторая клетка представляет собой клетку WIL2NS и указанная третья клетка представляет собой клетку WIL2NS.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой первичный моноцит мыши, указанная вторая клетка представляет собой клетку SP2 и указанная третья клетка представляет собой первичную T-клетку мыши.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой первичный моноцит мыши, указанная вторая клетка представляет собой клетку SP2 и указанная третья клетка представляет собой клетку SP2.

В другом варианте осуществления способа по изобретению указанная первая клетка представляет собой первичный моноцит человека или мыши, указанная вторая клетка представляет собой клетку WIL2-NS и указанная третья клетка представляет собой клетку SP2.

В одном варианте осуществления гибридная клетка по изобретению экспрессирует желаемый белок. В одном варианте осуществления указанный белок представляет собой эндогенный белок. В другом варианте осуществления указанный белок представляет собой рекомбинантный белок. Предпочтительно указанный белок представляет собой цитокин, например колониестимулирующий фактор или интерлейкин. В одном варианте осуществления указанный белок представляет собой GM-CSF. В другом варианте осуществления указанный белок представляет собой интерлейкин 2. В другом варианте осуществления указанный белок представляет собой рецептор или его фрагмент. В другом варианте осуществления указанный белок представляет собой растворимый рецептор.

В одном варианте осуществления указанный белок представляет собой альфа-цепь рецептора IL-4 человека. В другом варианте осуществления указанный белок представляет собой IgM. В другом варианте осуществления указанный белок представляет собой IgG. В другом варианте осуществления указанный белок представляет собой CD54.

В одном варианте осуществления указанную гибридизацию, используемую для получения гибридной клетки по изобретению, осуществляют с помощью электрических средств. В другом варианте осуществления указанную гибридизацию для получения гибридной клетки по изобретению осуществляют химическими средствами.

В одном варианте осуществления гибридная клетка по изобретению далее гибридизована с клеткой, которая экспрессирует представляющий интерес белок.

В одном варианте осуществления указанную гибридизацию, используемую для получения гибридной клетки по изобретению, осуществляют путем гибридизации трех отдельных клеток.

В другом варианте осуществления указанную гибридизацию, используемую для получения гибридной клетки по изобретению, проводят с использованием трех популяций клеток, где каждая популяция включает множество идентичных типов клеток или фенотипов.

В одном варианте осуществления указанная гибридная клетка по изобретению обогащена маркером, определяющим конкретный тип клеток, для обеспечения экспрессии белка, обладающего желаемой посттрансляционной модификацией или желаемой функциональностью.

ОПРЕДЕЛЕНИЯ

В контексте настоящего изобретения слова "содержит", "содержащий" и т.п. следует истолковывать в их включающем, а не в их исключающем значении, т.е. в значении "включая, но не ограничиваясь ими".

Гибридная клетка

Гибридная клетка представляет собой клетку, которая содержит компоненты более чем из одного генома (отличную от зигот и их производных). Она представляет собой клетку, которую конструируют гибридизацией соматических клеток (или гибридизацией целых клеток), например двух или более биологических клеток (родительских клеток). Родительские клетки можно получать либо из одного и того же ростка (или вида), либо из различных ростков (или видов). Гибридную клетку, полученную из одного ростка и вида, называют аутогибридом, в то время как клетку из различных ростков называют гетерогибридом.

Химерная клетка

Химерная клетка представляет собой искусственно полученную гибридную клетку с геномом, происходящим из двух или более различных видов.

Гибридная клетка перекрестного происхождения

Гибридная клетка перекрестного происхождения представляет собой искусственно полученную гибридную клетку с геномом, происходящим из двух или более клеток, происходящих из различных клеточных ростков. Кроветворные клетки, например, подразделяются на два основных ростка: лимфоидные (T-клетки, B-клетки и NK-клетки) и миелоидные (моноциты и макрофаги, нейтрофилы, базофилы и эозинофилы, эритроциты, мегакариоциты/тромбоциты, дендритные клетки).

Тригибридная клетка

Тригибридная клетка представляет собой искусственно продуцированную гибридную клетку с геномом, происходящим из трех клеток.

Стабильный

При указании на клетку термин "стабильный" обозначает способность клетки демонстрировать постоянство данного параметра роста или продуктивности или постоянство характеристик продукта клеточной линии при увеличении номера поколения. При использовании в отношении стабильного трансфектанта он обозначает клеточную линию, которая экспрессирует трансген на относительно постоянном уровне по существу неограниченно долго.

Гибридизация соматических клеток

В контексте настоящей заявки термин "гибридизация соматических клеток" относится к способу, в котором образуется одна жизнеспособная клетка из двух или более диплоидных (не гаметических) клеток (родительских клеток) таким образом, чтобы индуцировался тесный контакт плазматических мембран клеток, одновременно индуцировалось обратимое разрушение плазматических мембран родительских клеток в точке контакта и структуры или органеллы каждой родительской клетки объединялись в оболочке вновь образованной единичной клетки. Вновь образованную единичную клетку называют гибридизованной клеткой или гибридной клеткой.

Стволовая клетка

Термин "стволовая клетка" относится к неспециализированной клетке со способностью к делению митозом и к развитию в ряд различных типов клеток. Стволовые клетки могут включать эмбриональные стволовые клетки, "взрослые" стволовые клетки, происходящие из пуповинной крови, или стволовые клетки, происходящие от взрослых. Стволовые клетки включают клетки, которые обладают неограниченной способностью к дифференцировке во все типы клеток, т.е. тотипотентные клетки. Стволовые клети также могут включать клетки, которые ограничены по их способности дифференцироваться в специализированные клетки, например плюрипотентные, мультипотентные, олигопотентные или унипотентные стволовые клетки.

Иммортализованная клетка

Термин "иммортализованная клетка" относится к клетке, которая обладает способностью к неограниченному росту. Будет очевидно, что иммортализованная клетка может происходить из злокачественной опухоли in vivo или эмбриона. Альтернативно иммортализованная клетка может быть получена путем проведения действия над клеткой, которое индуцирует способность к неограниченному росту. Эти действия могут включать, например, процессы трансформации in vitro, например введение вирусных генов, таких как гены вируса Эпштейна-Барр (EBV), ген T-антигена вируса обезьян 40 (SV40), E1A и E1B аденовируса и E6 и E7 папилломавируса человека (HPV). Альтернативно иммортализованная клетка может быть получена из клетки путем экспрессии белка теломеразной обратной транскриптазы (TERT) или другими способами. Иммортализованные клетки также могут происходить из клеток, в которых экспрессия онкогена была модифицирована. Иммортализованные клетки могут быть получены любым действием, которое индуцирует способность к неограниченному росту, включая, но не ограничиваясь ими, воздействие УФ или спонтанную трансформацию, в случае которой механизм бессмертия неизвестен.

Миеломная клетка

Термин "миеломная клетка" относится к злокачественному развитию плазматической клетки.

Гибридома

Термин "гибридома" относится к клетке, которая получена гибридизацией миеломной клетки и B-клетки, происходящей из селезенки иммунизированного животного. Гибридомы представляют собой иммортализованные клетки со способностью продуцировать моноклональные антитела.

Фенотип

Термин "фенотип" относится к физическим характеристикам или морфологии клетки. Например, он может относиться к конкретному клеточному ростку, например лимфоидному или миелоидному ростку. Альтернативно термин "фенотип" может относиться к экспрессии одной или нескольких молекул, например, на поверхности клетки, таких как маркеры CD или молекулы внутри клетки, такие как факторы транскрипции.

Некоммитированная клетка-предшественник

"Некоммитированная клетка-предшественник" представляет собой раннего потомка стволовой клетки, который может дифференцироваться только в ограниченные типы клеток без коммитирования в какой-либо конкретный росток, но более не может самообновляться.

Общая миелоидная клетка-предшественник

Общая миелоидная клетка-предшественник представляет собой потомка гемопоэтической стволовой клетки, ограниченного миелоидным ростком и способного давать начало предшественникам либо мегакарицитов/эритроцитов, либо гранулоцитов/макрофагов, но не лимфоидных клеток.

Клетка, происходящая из B-лимфоидного ростка

Клетка, происходящая из B-лимфоидного ростка, представляет собой клетку, происходящую из общего лимфоидного предшественника после его коммитирования в B-росток для превращения в любой тип B-клеток.

Клетка, происходящая из T-лимфоидного ростка

Клетка, происходящая из T-лимфоидного ростка, представляет собой любую клетку, происходящую из общего лимфоидного предшественника после его коммитирования в T-росток для превращения в любой тип T-клеток.

Гранулоцитарно-макрофагальная клетка-предшественник

Гранулоцитарно-макрофагальная клетка-предшественник представляет собой клетку-предшественника, происходящую из общей миелоидной клетки-предшественника и коммитированную в гранулоцитарный и моноцитарный ростки, но не в мегакариоцитарный и эритроидный ростки.

Мегакариоцитарно-эритроидная клетка-предшественник

Мегакариоцитарно-эритроидная клетка-предшественник представляет собой клетку-предшественника, происходящую из общей миелоидной клетки-предшественника и коммитированную в мегакариоцитарный и эритроидный ростки, но не в гранулоцитарный и моноцитарный ростки.

Пре-B-клетка

Пре-B-клетка представляет собой развивающуюся B-клетку на стадии, когда тяжелая цепь мембраносвязанного IgM экспрессируется с суррогатной легкой цепью.

Незрелая B-клетка

Незрелая B-клетка относится к развивающейся B-клетке в костном мозге, где на стадии рекомбинации локусов антитела происходит реаранжировка VJ на L-цепях и реаранжировка VDJ на H-цепях и происходит экспрессия рецептора IgM.

Наивная B-клетка

Наивная B-клетка представляет собой зрелую B-клетку, которая дифференцировалась и созрела в костном мозге путем случайной реаранжировки генов ее поверхностного иммуноглобулина, но еще не встретила распознаваемый ею антиген на периферии.

Активированная B-клетка

Активированная B-клетка представляет собой тип зрелой B-клетки, которая встретила распознаваемый ею антиген на периферии путем распознавания антигена через BCR, что приводит к комбинации клональной пролиферации и терминальной дифференцировке в плазматические клетки T-зависимым или независимым образом.

Эффекторная B-клетка

Эффекторная B-клетка часто является синонимом секретирующей антитело плазматической клетке - типу короткоживущей B-клетки, которая секретирует антитела, специфичные к конкретному антигену, а также множество цитокинов для привлечения других клеток иммунной системы.

B-клетка памяти

B-клетки памяти представляют собой длительно живущие B-клетки, образованные из активированных B-клеток, которые являются специфичными к антигену, встреченному в ходе первичного иммунного ответа, и способны к быстрому ответу после второго воздействия того же антигена.

Плазматическая клетка

Плазматическая клетка представляет собой конечную постмитотическую короткоживущую клетку иммунной системы, которая дифференцируется из B-клетки при стимуляции CD4+-лимфоцитом (Th-клетки) и секретирует большое количество антител.

Пластичность

Термин "пластичность" относится к способности клетки с данным генотипом изменять свой фенотип, причем это изменение может происходить в ответ на изменения окружающей среды.

Пре-T-клетка

Пре-T-клетка представляет собой развивающуюся T-клетку на стадии, когда VbDbJb является полным и бета-цепь TCR экспрессируется в двойной отрицательной (CD4-CD8-) T-клетке (CD3+).

Незрелая T-клетка

Незрелая T-клетка представляет собой развивающуюся T-клетку, которая мигрировала из костного мозга в тимус, но не завершила реаранжировку ее TCR или селекцию по ее связывающей способности TCR в отношении собственных пептидов, представленных в контексте собственных молекул основного комплекса гистосовместимости (MHC), или претерпела коммитирование в T-киллерные или T-хелперные ростки, которые строго коррелируют со специфичностью TCR клеток в отношении молекул MHC класса I или II соответственно. Коммитирование ростка фенотипически выражается в утрате экспрессии одной из корецепторных молекул, CD8 или CD4.

Наивная T-клетка

Наивная T-клетка представляет собой зрелую T-клетку, которая дифференцировалась в костном мозге, а затем претерпела положительный и отрицательный процессы центральной селекции в тимусе с реаранжировкой ее TCR и утратой одной из корецепторных молекул, но еще не встретила распознаваемый ею антиген на периферии.

Активированная T-клетка

Активированная T-клетка представляет собой T-клетку, которая, путем встречи как TCR, так и CD28, на клеточной поверхности с пептидом основного комплекса гистосовместимости (комплекс пептид: MHC) и представителями семейства B7 на антигенпредставляющих клетках соответственно, становится антигенспецифической эффекторной T-клеткой.

Эффекторная T-клетка

Эффекторная T-клетка представляет собой тип короткоживущего T-лимфоцита, который способен немедленно отвечать при контакте с клетками, несущими соответствующий для этой клетки комплекс пептид:MHC.

Трансдифференцировка

Термин "трансдифференцировка" относится к процессу, который происходит, когда нестволовая клетка конкретного типа трансформируется в отличающийся тип или когда уже дифференцированная стволовая клетка образует клетки вне ее уже коммитированного каскада дифференцировки.

КРАТКОЕ ОПИСАНИЕ ФИГУР

Фигура 1. Идентификация и очистка сортировкой клеток CD71+ K562.

Фигура 2. Профили FACS для положительных по CD15 и CD71 клеток K562; (a) приблизительно 18% исходной обогащенной по CD71 клеточной популяции K562 были положительными по CD15 (область R1) и (b) повторный анализ положительных по CD15 клеток K562 после двух месяцев в культуре.

Фигура 3. Сортировка CD34+ и CD34+CD15+ клеток из обогащенных по CD34+ мононуклеарных клеток AML после 48 часов в культуре.

Фигура 4. Профиль FACS для мононуклеарных клеток пуповинной крови, окрашенных антителом мыши против CD19 человека и антителом мыши против CD5 человека.

Фигура 5. Профиль FACS для мононуклеарных клеток пуповинной крови, окрашенных антителом мыши против CD3 человека и антителом мыши против CD5 человека.

Фигура 6. Профиль FACS для мононуклеарных клеток костного мозга, окрашенных антителом мыши против CD20 человека и антителом мыши против CD72 человека.

Фигура 7. Типичный профиль FACS для тонзиллярных мононуклеарных клеток, окрашенных по CD3 и CD54.

Фигура 8. Присутствие положительных по IgM и IgG культивируемых лимфоцитов; (A) После 5 суток в культуре 18% CD19+ клеток были положительными по IgM и только 1% имели поддающийся детекции IgG на поверхности и (B) через 10 суток процент положительных по IgM лимфоцитов снижался до только 2%, в то время как процент положительных по IgG клеток возрастал до 15%.

Фигура 9. Профили FACS для экспрессии CD на клетках HTS-KMW и сортирующие области для различных фенотипических клеточных популяций.

Фигура 10. Экспрессия CD4 и CD19 на первичных смешанных лимфоцитах селезенки, популяции, отсортированные по CD4 и CD19 и полученная клеточная линия HTS-KBT; (a) экспрессия CD4 и CD19 на первичных лимфоцитах селезенки (b) профиль чистоты отсортированных CD19+ клеток (98,1%); (c) профиль чистоты отсортированных CD4+ клеток (96,8%); (d) коэкспрессия CD19, и CD4 на клетках HTS-KBT. Более 99% клеточной популяции HTS-KBT коэкспрессируют маркеры как B-клеток, так и T-клеток.

Фигура 11. Экспрессия CD19, CD3 и CD5 на линии HTS-KBTAE, происходящей из одной бессмертной миелоидной и двух первичных обученных антигеном лимфоидных клеток: (a) экспрессия CD19 и CD5 на клеточной поверхности HTS-KBTAE; (b) экспрессия CD3 и CD5 на клетках HTS-KBTAE.

Фигура 12. Поверхностная экспрессия CD4, CD8, CD72 и CD20 на клетках HTS-KBTDP, происходящих из одной бессмертной миелоидной и двух первичных лимфоидных клетках, происходящих из костного мозга и тимуса: (a) экспрессия CD4 и CD8 на поверхности HTS-KBTDP, (b) экспрессия CD4 и CD72 на поверхности HTS-KBTDP, (c) экспрессия CD20 и CD8 на поверхности HTS-KBTDP.

Фигура 13. Экспрессия CD на поверхности клеток HTS-WTM, происходящих из миеломоноцитарных клеток-предшественников; (A) трехцветное окрашивание на CD19, CD4 и CD15 и (B) трехцветное окрашивание на CD34 и CD15, происходящие из миеломоноцитарного предшественника и CD4, происходящий из эффекторной T-клетки.

Фигура 14. Типичный профиль окрашивания на CD4, CD19 и CD15 в культурах HTS-KMW.6, HTS-WTM.6 и HTS-WTM.12 после 8 суток в окружающей среде, обеспечивающей фенотип CD4, где 100% клеток сохраняли CD4 в качестве единственного маркера на их клеточной поверхности (положительные только по CD4 клетки). На фигуре не представлено, что в культуре HTS-KMW.1 единичные CD4+ клетки соответствовали 49% исходной популяции, состоящий из 100% тройных положительных CD15+CD19+CD4+ клеток; в HTS-KBT они достигали 50% исходной 100% двойной положительной CD19+CD4+ популяции; в HTS-KBTAE.1, они достигали 61% из 100% тройной положительной CD3+CD19+CD5+ популяции; в HTS-KBTAE.4 они достигали 74% из начальных 100% CD3+ клеток; в HTS-WTM.1 они достигали 82% из 100% тройной положительной CD15+CD19+CD4+ популяции; и в HTS-WTM.7, 71% клеток становились положительными только по CD4 клетками из 100% тройной положительной по фенотипу CD15+CD34+CD4+ популяции.

Фигура 15. Типичный профиль окрашивания на CD8, CD19 и CD15 в культуре HTS-KBTDP.12, где 100% клеток, положительно окрашенных только по CD8 после воздействия в течение 14 дней окружающей среды, обеспечивающей CD8+. На фигуре не представлено, что в KBTAE.1 количество положительных только по CD8 клеток достигало 53% из 100% тройной положительной CD3+CD19+CD5+ популяции; в KBTAE.4, они достигали 61% из 100% положительной только по CD3+ популяции; в HTS-KBTDP.1 и в HTS-KBTDP.4 A эти числа составляли 72% и 86% из 100% CD4+CD8+CD20+CD72+ и CD4+CD8+CD20-CD7- популяций соответственно.

Фигура 16. Внутриклеточная продукция IL-2 человека и IFN-γ человека в положительных только по CD8 клетках в культурах HTS-KBTAE.4 (A) и HTS-KBTDP.12 (B). В то время как обе культуры содержали клетки, продуцирующие IL-2, IFN-γ или оба из них, культура HTS-KBTDP.12 имела широкий диапазон уровней продукции для IL-2; в противоположность этому культура HTS-KBTAE.4 проявляла более широкий диапазон концентраций IFN-γ.

Фигура 17. Типичные профили внутриклеточного перфорина и гранзима A в положительных только по CD8 клетках культур HTS-KBTAE.4 (A) и HTS-KBTDP.12 (B).

Фигура 18. Типичное окрашивание культуры HTS-KBTAE.6 антителами против CD19, против CD4 и против CD15 после 7 суток в окружающей среде, стимулирующей B-лимфоидные клетки.

Фигура 19. Прикрепляющаяся морфология клеток, полученных из культуры HTS после 8 суток в пермиссивной для макрофагов среде для роста.

Фигура 20. Профиль экспрессии CD19, CD15 и CD4 на клетках HTS-WTM.4 после 8 суток в пермиссивной для макрофагов среде для роста, демонстрирующий небольшой процент клеток, все еще положительных по CD4, и 7% клеток, сохраняющих миеломоноцитарный маркер CD15 на поверхности при полной утрате экспрессии CD19.

Фигура 21. Экспрессия подобных макрофагальным маркеров на поверхности клеток HTS-WTM.4 после 8 часов в пермиссивной для макрофагов среде для роста.

Фигура 22. Фагоцитоз 1000-нм микросферы положительными по CD64 макрофагами, происходящими из культуры HTS-WTM.4, после 8 суток в пермиссивной для макрофагов окружающей среде.

Фигура 23. Продукция оксида азота стимулированными LPS клетками HTS-WTM.4 после 8 суток в пермиссивной для макрофагов среде для роста.

Фигура 24. Типичные профили экспрессии CD3 и CD54 CD19+ B-лимфоцитами, полученными трансдифференцировкой HTS-KBTAE.6 в T-клетки соматической гибридизацией клеток с первичными CD54+ T-клетками человека. На фигуре 24A представлена утрата экспрессии CD19 такими клетками с одновременным приобретением экспрессии CD3, в то время как на фигуре 24B подтверждается экспрессия CD54 положительными по CD3 T-клетками.

Фигура 25. Типичный профиль трансдифференцировки CD3+ клеток HTS-KBTAE.4 после соматической гибридизации с CD40-активированными положительными по IgM B-клетками, демонстрирующий утрату экспрессии CD3 и приобретение поверхностного IgM.

Фигура 26. Транскрипты ОТ-ПЦР для ранних маркеров развития B-клеток в культурах HTS-WTM 1 и 7, инициированных из 100% гомогенной культуры CD19+ клеток и демонстрирующих признаки дедифференцировки по сравнению с HTS-KMW.1. Присутствие транскриптов Pax-5 и λ-like отдельно с активацией CD10 в обеих HTS-WTM и появление CD34 в HTS-WTM.7 указывает на дедифференцировку зрелых B-клеток в B-клетки более ранних стадий в ответ на изменение условий окружающей среды.

Фигура 27. Система для манипулирования/доставки единичных клеток.

Фигура 28. Стеклянная микропипетка.

Фигура 29. Микроэлектрод.

Фигура 30. Два параллельных микроэлектрода.

Фигура 31. Два микроэлектрода в лунке планшета для культивирования тканей.

Фигура 32. Вид сверху лунки, содержащей 3 клетки между 2 микроэлектродами.

Фигура 33. Вид сбоку лунки, представленной на фигуре 32.

ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Предпочтительный вариант осуществления изобретения далее описан с помощью следующих неограничивающих примеров, ссылаясь на прилагаемые фигуры.

ПРИМЕР 1

1. Селекция клеток, манипулирование с клетками и клонирование единичных клеток

В следующих примерах описано получение клеток, включая селекцию и выделение (или сортировку) клеточных линий млекопитающих и первичных клеток, использованных для создания HTS. Выбор конкретного способа селекции для получения чистой популяции клеток с конкретными характеристиками или применение конкретного маркера (или маркеров) для выделения клеток с конкретным фенотипом, никоим образом не являются ограничивающими, а скорее показательными. Для обеспечения сходных результатов можно использовать другие клеточные маркеры или способы сортировки.

1.1. Селекция клеток из бессмертных клеточных линий человека

Все бессмертные клеточные линии (см. ниже) выращивали в суспензионной культуре в стандартных (нормальных) условиях в инкубаторе с CO2 при 37°С в увлажненной атмосфере с 5% CO2 с использованием модифицированной RPMI 1640 (среда Roswell Park Memorial Institute) с NaHCO3 (JRH Biosciences), 20 мМ Hepes (Sigma), 4 мМ L-глутамином (Sigma) и дополненной 10% эмбриональной телячьей сывороткой, FCS, (JRH Biosciences). Если нет иных указаний, среда для культивирования тканей (среда TC), описанная в настоящем документе, представляет собой стандартную среду для культивирования всех бессмертных клеточных линий, первичных клеток злокачественной опухоли, первичных культур клеток и установленных тригибридных клеточных линий по настоящему изобретению. Как правило, все клеточные линии, первичные злокачественные клетки и использованные первичные клетки культивировали в среде без антибиотиков. Однако, когда возникало подозрение о высоком риске бактериальной и/или грибковой контаминации, в стандартную среду включали 2% раствор пенициллина (5000 единиц)/стрептомицина (5 мг) (Sigma).

Клеточные линии человека, использованные в этом изобретении, являются следующими:

Линия общих миелоидных предшественников K562 (клеточная линия, происходящая из хронического миелогенного лейкоза человека),

T-лимфоидный росток MOLT4 (T-лимфобласты человека), и

B-лимфоидный росток WIL2NS (B-лимфобласты человека).

1.1.1. Система для доставки единичных клеток

Выделение или сортировка клеток, манипулирование клетками и клонирование отдельных клеток являются необходимыми процессами для этого изобретения. В этом примере авторы настоящего изобретения описывают систему для доставки единичных клеток, которая была создана для манипулирования и/или клонирования представляющей интерес единичной клетки. Система для доставки клетки (фигура 27) состоит, главным образом, из стеклянной микропипетки, 1-мл шприца и одномерного крупного манипулятора. На фигуре 28 представлена стеклянная L-образная микропипетка, использованная для отбора единичной представляющей интерес клетки. Пипетка была изготовлена из капиллярной трубки для определения гематокрита длиной 75 миллиметров (мм), с наружным и внутренним диаметром 1,5 мм и 1,10 мм соответственно. С использованием нагревания один конец трубки вытягивали, так чтобы получить конец (1) с внутренним диаметром приблизительно 250-300 микрометров (мкм) и стенкой конца толщиной приблизительно 30 мкм. Другой конец микропипетки оставляли немодифицированным (2). В системе для доставки клеток (фигура 27), шприц (4) помещали на крупный манипулятор, который, в свою очередь, помещали на магнитный штатив (16). Система действует так, чтобы поршень (6) шприца можно было приводить в действие очень медленно, как вперед, так и назад, относительно шприца. Для манипулирования представляющей интерес единичной клеткой шприц должен быть соединен с немодифицированным концом микропипетки (2), как показано на фигуре, с использованием гибкой трубки медицинской категории (3). Перед любым манипулированием клетками систему для доставки единичной клетки необходимо стерилизовать путем промывания несколько раз струей 70% спирта и в конце заполнять без пузырьков воздуха соответствующей средой или раствором для культивирования ткани в зависимости от того, что требуется.

1.1.2. Клонирование единичной клетки

Клоны клеток из каждой клеточной линии получали клонированием единичных клеток. Ниже описан способ клонирования или манипулирования единичной клеткой для любых биологических клеток, например клеток клеточной линии K562, использованной в этом изобретении.

5 мкл суспензии клеток K562 отбирали из их культуры на log-фазе и помещали в лунку 96-луночного планшета для культивирования тканей (планшет TC, Becton and Dickinson или BD), которая содержала 150 мкл среды TC. Лунка была обозначена как "лунка для хранения клеток". Планшет помещали на XY-предметный столик инвертационного микроскопа (Axiovert 40C, Carl Zeiss). Перед процессом манипулирования/клонирования единичной клетки, микропипетку (фигура 28) полностью заполняли средой TC без пузырей воздуха. Микропипетку, трубки и шприц системы для доставки единичных клеток (фигура 27) помещали на одномерный крупный манипулятор (5) (Narishege). Верхушку микропипетки (1) располагали так, чтобы верхушка была расположена в центре оптического поля зрения микроскопа. Для манипулирования и клонирования единичной клетки K562 микропипетку помещали в лунку для хранения клеток. Путем очень медленного смещения поршня шприца в направлении всасывания, единичную клетку K562 помещали в микропипетку. Микропипетку извлекали из лунки для хранения клеток. Затем путем латерального смещения предметного столика микроскопа от лунки для хранения клеток в соседнюю лунку, обозначенную как "лунка для клонирования", и путем последующего помещения микропипетки в эту лунку для клонирования, единичную клетку в микропипетке осторожно высвобождали из микропипетки. Этого достигали путем очень медленного смещения поршня шприца в направлении высвобождения. Способ извлечения единичной клетки из лунки для хранения клеток и помещения единичной клетки в лунку для клонирования повторяли несколько раз до тех пор, пока не получали 60 клонов единичных клеток на планшет TC. Планшет для клонирования инкубировали в увлажненном инкубаторе (Thermoline Scientific), действующем при 37°C с 5% CO2, в течение 10 суток. Среду в каждой лунке для клонирования регулярно пополняли свежей средой TC в ходе периода инкубации. Пролиферацию клеток каждого клона из каждой лунки для клонирования регистрировали каждые 24 часа. В конце периода инкубации получали ряд клонов клеток K562. Клон с наиболее высокой скоростью пролиферации или наиболее высоким уровнем представляющего интерес маркера, который экспрессировался на клеточной поверхности, например рецептора трансферрина CD71 на клетках K562, отбирали для установления HTS или дальнейших экспериментов.

1.1.3. Сортировка CD71 + клеток

В качестве примера, представленный ниже способ описывает селекцию и сортировку положительных по CD71 клеток миеломоноцитарного ростка из клеточной линии K562 с использованием сортера для активированной флуоресценцией сортировки клеток (FACS).

Для этой цели 1×105 клеток K562, суспендированных в 100 мкл фосфатно-солевого буфера (Dulbeco PBS), содержавшего 2% бычий сывороточный альбумин, BSA, (Sigma) инкубировали в темноте с 20 мкл либо конъюгированного с фикоэритрином (PE) антитела против CD71 (BD Pharmingen), либо конъюгированного с PE изотипического контрольного антитела IgG2a,κ (BD Pharmingen) в течение 30 минут при комнатной температуре. Инкубируемую смесь разбавляли 1 мл PBS и окрашенные клетки собирали центрифугированием при 300 g в течение 10 минут. После дополнительного промывания 1 мл PBS окрашенные клетки суспендировали в 1 мл PBS и сразу анализировали с использованием FACS (BD FACSCalibur). На фигуре 1 представлены профили CD71+ клеток клеточной линии K562. Положительные по CD71+ клетки ограничивали и отсортировывали (фигура 1a). Приблизительно 65% исходной популяции K562 были положительными по CD71. Отсортированные клетки центрифугировали при 300 g в течение 10 минут и суспендировали в 1 мл PBS для дальнейших экспериментов. 100 мл суспендированных отсортированных по CD71+ клеток собирали для анализа чистоты, как показано на фигуре 1b. Была получена 99% чистота отсортированных по CD71+ клеток. После сортировки клеток CD71+ клетки клеточной линии K562 либо использовали для дальнейших экспериментов, либо помещали в культуру в стандартных условиях культивирования и обозначали как обогащенные по CD71 клетки K562. Ту же методику использовали для получения обогащенных по CD71 культур WIL2NS и обогащенных по CD71 культур MOLT4.

1.2 Выделение миеломоноцитарных клеток

Миеломоноцитарные клетки-предшественники можно получать из любых бессмертных миеломоноцитарных клеточных линий или из первичных гемопоэтических тканей, таких как костный мозг. Ниже приведены примеры выделения миеломоноцитарных клеток-предшественников из миелоидной клеточной линии человека K562 и из образцов костного мозга.

1.2.1 Селекция миеломоноцитарных клеток из культуры CD71 + K562

Для обеспечения миеломоноцитарного фенотипа клеток в эксперименте по гибридизации клеток, CD71+ клетки K562 далее обогащали CD15+ клетками с использованием анализа FACS и последующей сортировки.

Обогащенные по CD71 клетки K562, описанные в разделе 1.1.3, метили конъюгированным с PE антителом против CD71 человека и конъюгированным с FITC антителом против CD15 человека (BD Pharmingen). 1×105 промытых обогащенных по CD71 клеток K562, суспендированных в 100 мкл PBS, содержащем 2% BSA, инкубировали в темноте с 20 мкл либо антитела против CD71 человека-PE и антитела против CD15 человека-FITC, либо с отрицательными изотипическими контрольными антителами или меченными FITC и PE отрицательными изотипическими контрольными антителами, в течение 30 минут при комнатной температуре. Инкубационную смесь разбавляли 1 мл PBS и окрашенные клетки собирали центрифугированием при 300 g в течение 10 минут. После дополнительного промывания 1 мл PBS окрашенные клетки суспендировали в 1 мл PBS и сразу анализировали с использованием FACSCalibur (BD).

Типичный профиль FACS представлен на фигуре 2a. После культивирования в течение 5 месяцев 99% обогащенных по CD71 клеток K562 оставались положительными по CD71, из которых приблизительно 18% экспрессировали поверхностный CD15. Клетки, положительные как по CD71, так и по CD15, ограничивали (фигура 2a) и отсортировывали. Отсортированные клетки собирали центрифугированием при 300 g в течение 10 минут и суспендировали в 1 мл PBS для дальнейших экспериментов. 100 мкл суспендированных CD71+CD15+ отсортированных клеток собирали для анализа чистоты. После культивирования в течение двух месяцев отсортированные клетки повторно анализировали в отношении коэкспрессии CD71 и CD15 (фигура 2b). Результаты указывают на то, что приблизительно 98% очищенных клеток сохраняли как CD71, так и CD15. Было открыто, что некоторые из клеток, которые ранее экспрессировали как CD71, так и CD15, на поверхности, утратили их экспрессию CD15 (фигура 2b), что указывает на то, что коммитирование в миеломоноцитарный росток в клетках K562 является нестабильным и обратимым.

1.2. Селекция некоммитированных и миеломоноцитарных клеток-предшественников из первичных клеток

В качестве примера в способе ниже описана селекция некоммитированных клеток или клеток миелогенного ростка из образцов костного мозга, полученных от пациентов с острым миелогенным лейкозом (AML). Тот же способ также можно применять для селекции клеток других ростков из образцов костного мозга при соответствующих гематологических злокачественных опухолях.

От пациентов с AML получали материал, собираемый аспирацией костного мозга, после получения информированного согласия. Образцы получали от пациентов, у которых диагноз AML был поставлен до проведения экспериментов. Мононуклеарные клетки AML выделяли с использованием той же процедуры центрифугирования в градиенте плотности, которая описана в разделе 1.3.1, и CD34+ клетки из образцов отсортировывали или выделяли с использованием FACS.

Для окрашивания или мечения мононуклеарных клеток, полученных выше, 10 мкл антитела мыши против CD34 человека-PE (BD Pharmingen) или изотипического контрольного антитела-PE (BD Pharmingen) добавляли к 100 мкл данной аликвоты из 1×106 мононуклеарных клеток в среде для окрашивания (PBS+5%BSA). Для данной аликвоты смесь для окрашивания инкубировали в течение 30 минут на льду. К клеточному осадку добавляли 10 мл ледяной среды для окрашивания и центрифугировали ее в течение 7 мин при 350 g и 4°С. Супернатанты аспирировали, а затем клеточный осадок ресуспендировали путем постукивания по пробирке, в которую был добавлен сравнимый объем ледяной среды для окрашивания. Окрашенные клетки центрифугировали и промывали еще один раз в ледяной среде для окрашивания. Меченые клетки суспендировали в среде для окрашивания и использовали в FACS. После установки соответствующих сортирующих областей для популяции CD34+ клеток клеточные фракции собирали. CD34+ клетки либо сразу использовали, либо помещали в культуру для обогащения миеломоноцитарными клетками.

Для обогащения культур 40×103 клеток обогащенных по CD34+ высевали в 12-луночные планшеты, предварительно покрытые синтетическим внеклеточным матриксом. Клетки размножали в полной среде TC, дополненной 57 мМ β-меркаптоэтанолом (Sigma), 1 мМ гидрокортизоном и 20 нг/мл интерлейкина-3 (IL-3) человека и колониестимулирующего фактора (G-CSF) человека. После культивирования в течение 48 часов клетки далее отбирали по экспрессии CD15 с использованием FACS.

Для флуоресцентного окрашивания клеток использовали антитело мыши против CD15 человека-FITC (BD Pharmingen) и антитело мыши против CD34 человека-PE (BD Pharmingen) и также использовали способ окрашивания клеток, сходный со способом, описанным ранее в этом разделе. Окрашенные образцы анализировали с использованием FACS. После установки соответствующих сортирующих областей для положительной по CD34 и CD15 популяции клеток (CD34+CD15+) или для положительной по CD34 и отрицательной по CD15 популяции клеток (CD34+CD15-), фракции собирали.

Типичный профиль экспрессии и сортирующие области для CD34+ клеток и для экспрессии CD15 на клетках AML после культивирования в течение 48 часов представлен на фигуре 3. Приблизительно 54% протестированных мононуклеарных клеток были положительными по CD15 при сохранении их экспрессии CD34, в то время как остальная часть популяции клеток сохраняла ее экспрессию CD34 без коммитирования в миеломоноцитарный росток. CD34+CD15+ клетки использовали в экспериментах для создания системы для трансдифференцировки, в то время как некоммитированные CD34+ клетки использовали для экспериментов по дедифференцировке.

1.3. Выделение лимфоцитов

Для установления системы для трансдифференцировки лимфоциты можно получать либо из любого типа специфических бессмертных клеток, либо из первичных лимфоцитов. Получение B- и T-лимфоцитов, происходящих из бессмертных клеточных линий WIL2NS и MOLT4, соответственно, описано в разделе 1.1.3. Первичные лимфоциты можно выделять из любых лимфоидных тканей, таких как периферическая кровь, пуповинная кровь, селезенка, костный мозг, тимус, миндалевидные железы и регионарные лимфатические узлы. В качестве первой стадии все лимфоидные ткани обрабатывали для выделения мононуклеарных клеток.

1.3.1. Выделение мононуклеарных клеток человека из костного мозга, периферической крови или пуповинной крови

Образцы периферической крови собирали от здоровых индивидуумов после получения информированного согласия. Каждый образец крови собирали в гепаринизированные пробирки (Vacutainer, BD), объединяли и разбавляли в RPMI 1640.

Материал, собираемый аспирированием костного мозга человека, получали от двух пациентов, которым проводили биопсию костного мозга и которые имели нормальный костный мозг без каких-либо гематологических нарушений. Образцы разбавляли RPMI 1640 в соотношении 1:3.

Образцы пуповинной крови человека получали после нормальных своевременных вагинальных родов после получения информированного согласия. В каждом случае пуповинную кровь собирали с помощью гепаринизированного 60-мл шприца после рождения младенца и перевязки пуповины перед изгнанием плаценты. Каждый образец разбавляли в RPMI 1640.

Мононуклеарные клетки периферической крови (PBMC), мононуклеарные клетки костного мозга (BMMC) и мононуклеарные клетки пуповинной крови (UCBMC) получали центрифугированием в градиенте плотности Ficoll-Paque (Amersham Pharmacia). В кратком изложении 10 мл Ficoll-Paque наслаивали под 20 мл суспензии клеток с использованием трубки с канюлей, присоединенной к 20-мл шприцу. Клетки образца центрифугировали при 1700 об/мин (700 g) в течение 40 минут при 4°С. Клетки на межфазной границе собирали и промывали 50 мл RPMI 1640 центрифугированием при 2000 об/мин (1000 g) в течение 10 минут. Супернатант удаляли и осажденные клетки ресуспендировали в 40 мл RPMI 1640 и центрифугировали при 1300 об/мин (400 g) в течение 10 минут. Эритроциты и тромбоциты удаляли лизисом с помощью 0,83% (масс./об.) NH4Cl и второго центрифугирования в Ficoll-Paque, разбавленном PBS в соотношении 1:2 соответственно.

Выделенные мононуклеарные клетки использовали для культивирования или анализа и сортировки на определенные клеточные фракции с помощью FACS.

1.3.2. Выделение мононуклеарных клеток человека из солидных лимфоидных тканей

Представленный ниже способ описывает методику, использованную в этом изобретении для выделения мононуклеарных клеток из селезенки. Тот же способ можно использовать для выделения мононуклеарных клеток из тимуса, миндалевидных желез или регионарных лимфатических узлов. Также приведен способ окрашивания и сортировки клеток.

Образцы селезенки получали от доноров трансплантатов органов согласно национальным этическим нормам. Блоки селезенки, каждый приблизительно 2×2×3 см, держали при 4°C в RPMI 1640 до выделения спленоцитов. Каждый блок нарезали на небольшие фрагменты через решетку стерильного сита с использованием поршня шприца. Затем клетки ферментативно диссоциировали путем расщепления 20 Е/мл коллагеназы типа VII (Sigma) и 20 Е/мл ДНКазы (Sigma) в полной среде в течение 30 минут при комнатной температуре. Клеточные агрегаты далее диссоциировали добавлением ЭДТА до 10 мМ и встряхиванием в течение 5 минут при комнатной температуре. Затем спленоциты промывали два раза полной средой для остановки ферментативного расщепления и ресуспендировали в RPMI 1640. Эти условия не влияли на поверхностную экспрессию молекул по сравнению с неферментативными способами диссоциации (Mcllroy et al., 1995). Мононуклеарные клетки селезенки выделяли из этих суспензий спленоцитов центрифугированием в градиенте плотности, как описано в разделе 1.3.1, за исключением удаления эритроцитов. Мононуклеарные клетки селезенки ресуспендировали в RPMI 1640 и концентрацию клеток доводили до 1×106 клеток на мл. Жизнеспособность клеток была выше 98% при определении по исключению трипанового синего.

1.3.3. Выделение зрелых B-клеток и хелперных T-клеток из селезенок и периферической крови человека

Образцы тканей первоначально обрабатывали для экстракции популяции мононуклеарных клеток, как описано в разделе 1.3.1 и разделе 1.3.2. Затем проводили флуоресцентное окрашивание клеток в пределах 4 часов после выделения популяции мононуклеарных клеток. Клетки суспендировали в полной среде в стандартных условиях культивирования (см. раздел 1.1) до окрашивания.

Ниже приведены примеры окрашивания и сортировки B- и T-клеток из первичных клеток. Обычно селекция B-клеток и хелперных T-клеток была основана на поверхностной экспрессии CD19 и CD4 соответственно.

В кратком изложении 10 мкл каждого из конъюгированного с FITC антитела мыши против CD19 человека (BD Pharmingen) и конъюгированного с PE антитела мыши против CD4 человека (BD Pharmingen) или соответствующего изотипического контроля добавляли к 100-мкл аликвоте мононуклеарных клеток в среде для окрашивания (PBS+5%BSA), содержащей 1×105 клеток на аликвоту. Для данной аликвоты популяции мононуклеарных клеток смесь для окрашивания инкубировали в течение 30 минут на льду. К смеси для окрашивания добавляли 10 мл ледяной среды для окрашивания и ее центрифугировали в течение 7 минут при 350g и 4°С. Супернатант аспирировали, а затем клеточный осадок ресуспендировали путем постукивания по пробирке, в которую был добавлен сравнимый объем ледяной среды для окрашивания. Окрашенные клетки центрифугировали и промывали еще один раз в ледяной среде для окрашивания. Этот процесс повторяли для других аликвот. Окрашенные клетки анализировали с использованием FACS. Для каждого образца анализировали по меньшей мере 20000 событий ограничения в области. После установки соответствующих сортирующих областей для популяции положительных CD19 B-клеток (CD19+CD4-) или для популяции положительных по CD4 T-клеток (CD4+CD19-) фракции собирали. 1 мл каждой фракции собирали для анализа чистоты и остальную часть фракции ресуспендировали в полной среде для дальнейших экспериментов.

Небольшое количество клеток (≤5×105 клеток) отсортировывали непосредственно в микроцентрифужные пробирки с соответствующими адапторами. Перед сортировкой в пробирки для выделения добавляли небольшой объем (от 0,1 до 0,2 мл) дополненной RPMI 1640 для смешивания с сортируемым образцом и увеличения жизнеспособности отсортированных клеток. После сортировки, при условии допустимого количества выделенных клеток, 20 мкл каждого образца отсортированных клеток разбавляли 1:10 средой для окрашивания для повторного анализа в целях проверки их чистоты. Приемлемая чистота составляла ≥95%. Добавляли следующие от 20 до 40 мкл FCS на мл отсортированного образца, а затем проводили центрифугирование в течение 7 мин при 350 g, 4°С. Затем клетки ресуспендировали в стандартной среде для культивирования тканей. Если было доступно достаточное количество клеток, их подсчитывали для определения выхода.

Профиль FACS для образцов селезенки, меченных антителом против CD19 человека-FITC и антителом против CD4 человека-PE, представлен на фигуре 10a, в то время как профили анализа чистоты для отсортированных CD19+ B-клеток и CD4+ T-клеток представлены на фигурах 10b и 10с. Чистота клеток во фракциях превышала 98% для CD19+-клеток и 96% для CD4+-клеток.

Профили сортировки и чистоты для клеток CD19+ и CD4+ из периферической крови были по существу сходными с профилями из образцов селезенки, только были получены меньшие количества каждой из клеточных популяций.

1.3.4. Выделение положительных по CD5 (обученных антигеном) B-клеток и отрицательных по CD5 (наивных) B-клеток из пуповинной крови человека

Из образцов пуповинной крови получали мононуклеарные клетки, как описано в разделе 1.3.1. Флуоресцентное окрашивание клеток с последующей сортировкой клеток проводили в пределах 4 часов после выделения популяции мононуклеарных клеток. В этом конкретном примере проводили сортировку отрицательных по CD5 (наивных) B-клеток и положительных по CD5 (обученных антигеном) B-клеток из пуповинной крови человека, с использованием антитела мыши против CD5 человека-FITC (BD Pharmingen), антитела мыши против CD19 человека-PE (BD Pharmingen) или соответствующего изотипического контроля согласно способу, описанному выше (раздел 1.3.3).

Окрашенные образцы анализировали с использованием FACS. Для каждого образца анализировали по меньшей мере 20000 событий ограничения в области. После установки соответствующих сортирующих областей для популяции отрицательных по CD5 B-клеток (CD19+CD5-) или популяции положительных по CD5 B-клеток (CD19+CD5+) был собран ряд фракций. На фигуре 4 представлен типичный профиль образцов, окрашенных антителом мыши против CD19 человека и антителом мыши против CD5 человека.

Процент B-клеток в образце находился в диапазоне от 4 до 19,2% и процент CD5+ B-клеток находился в диапазоне от 0,8 до 7,2% всех циркулирующих лимфоцитов.

1.3.5. Выделение положительных по CD5 (обученных антигеном) T-клеток и отрицательных по CD5 (наивных) T-клеток из пуповинной крови человека

Мононуклеарные клетки экстрагировали из образцов пуповинной крови с использованием способа, сходного со способом, описанным в разделе 1.3.1. Флуоресцентное окрашивание клеток с последующей сортировкой клеток проводили в пределах 4 часов после выделения популяции мононуклеарных клеток. В этом конкретном примере сортировку положительных по CD5 (обученных антигеном) T-клеток и отрицательных по CD5 (наивных) T-клеток из пуповинной крови человека проводили с использованием антитела мыши против CD5 человека-FITC (BD Pharmingen), антитела мыши против CD3 человека-PE (BD Pharmingen) или соответствующего изотипического контроля согласно способу, описанному ранее (раздел 1.3.3). Окрашенные клетки анализировали с использованием FACS. Анализировали по меньшей мере 20000 событий ограничения в области. Сортировочные области устанавливали для сбора фракций, содержащих либо отрицательные по CD5 T-клетки (CD3+CD5-), либо положительные по CD5 T-клетки (CD3+CD5+). На фигуре 5 представлен типичный профиль образцов, окрашенных антителом мыши против CD3 человека и антителом мыши против CD5 человека.

Фактически использовали тот же способ выделения и анализа отсортированных популяций, который описан в разделе 1.3.3.

Процент T-клеток в образцах находился в диапазоне от 1,7 до 13,5% и процент CD5+ T-клеток находился в диапазоне от 0,4 до 1,3% от всех циркулирующих лимфоцитов.

1.3.6. Выделение ранних B-клеток, активированных и покоящихся B-клеток на основе экспрессии CD20 и CD72 из популяции мононуклеарных клеток костного мозга человека

Мононуклеарные клетки экстрагировали из костного мозга с использованием способа, описанного ранее (раздел 1.3.1). Флуоресцентное окрашивание клеток с последующей сортировкой клеток проводили в пределах 4 часов после выделения популяции мононуклеарных клеток. Окрашивание и сортировка активированных B-клеток описаны ранее в разделе 1.3.3. Конкретно, использовали 10 мкл антитела мыши против CD72 человека-FITC (BD Pharmingen) и 20 мкл антитела мыши против CD20 человека-PE (BD Pharmingen) или соответствующего изотипического контроля (антитела мыши IgG2b,κ-PE). Окрашенные клетки анализировали с использованием FACS. Сортирующие области были установлены для сбора фракций, содержащих либо положительную по CD20 популяцию, включающую пре-B-клетки, покоящиеся и активированные B-клетки, фолликулярные дендритные клетки (CD20+CD72-) либо положительную по CD72 популяцию, включающую ранние B-клетки (CD20-CD72+) или активированные B-клетки (CD20+CD72+). На фигуре 7 представлен типичный профиль образцов, окрашенных антителом мыши против CD20 человека и антителом мыши против CD72 человека.

Для выделения и анализа отсортированных клеток фактически применяли тот же способ, который описан в разделе 1.3.3.

Как правило, приблизительно 10-15% популяции мононуклеарных клеток костного мозга были положительными как по CD20, так и по CD72; 9-12% клеток были положительными по CD20, но отрицательными по CD72; и приблизительно 8% были положительными только по CD72.

1.3.7. Выделение субпопуляций тимоцитов сортировкой с помощью магнитных гранул

С использованием набора MACS CD4 Multisort kit (Miltenyi Biotec GmbH), клеточные популяции CD4-CD8- двойных отрицательных тимоцитов, CD4+CD8+ двойных положительных тимоцитов и положительных только по CD4+ и CD8+ тимоцитов отсортировывали согласно инструкциям изготовителя. В кратком изложении тимоциты, собранные с использованием способа, сходного со способом, описанным в разделе 1.3.2, инкубировали с CD4-микрогранулами CD4 Multisort в течение 30 минут. После промывания 5 мМ ЭДТА и 0,5% BSA в PBS меченые клетки разделяли на магнитных колонках. Отобранные положительной селекцией тимоциты, которые оставались на магнитной колонке, содержали положительные только по CD4+ и CD4+CD8+ двойные положительные популяции клеток, в то время как истощенная по CD4 популяция клеток, которая проходила через колонку, содержала положительные только по CD8+ и CD4-CD8- двойные отрицательные клетки. Для удаления микрогранул из отобранных положительной селекцией по CD4 клеточных популяций клетки инкубировали с реагентом для высвобождения MACS Multisort. Через 20 минут расщепление останавливали и клетки метили в течение 30 минут CD8-микрогранулами. Двойные положительные CD4+CD8+ тимоциты получали положительной селекцией, в то время как в истощенной клеточной популяции были выявлены положительные только по CD4+ клетки. Клеточную популяцию, истощенную по CD4, инкубировали в течение 30 с CD8-микрогранулами. После нанесения меченых клеток на магнитную колонку положительные только по CD8+ клетки можно было отделить от CD4-CD8- двойных отрицательных тимоцитов. Чистоту четырех различных субпопуляций тимоцитов оценивали проточно-цитометрическим анализом. Принимаемая чистота составляла более 95%.

1.3.8. Выделение CD54 + T-клеток из миндалевидных желез человека.

Мононуклеарные клетки экстрагировали из миндалевидных желез человека с использованием способа, описанного в разделе 1.3.2. Флуоресцентное окрашивание клеток с последующей сортировкой клеток проводили в пределах 4 часов после выделения популяции мононуклеарных клеток. CD54+ (внутриклеточная молекула адгезии-1 или ICAM-1) T-клетки экстрагировали из популяции мононуклеарных клеток миндалевидных желез с использованием антитела мыши против CD3 человека-PE (BD Pharmingen) и антитела мыши против CD54 человека-FITC (BD Pharmingen) или соответствующего изотипического контроля и отбирали с использованием способа окрашивания/сортировки клеток, как описано в разделе 1.3.5. Окрашенные клетки анализировали с использованием FACS. Сортирующие области были установлены для сбора фракций, содержащих либо CD3+ T-клетки (т.е. CD3+CD54- клетки), либо активированные CD54+ T-клетки (т.е. CD3+CD54+ клетки). На фигуре 7 показан профиль FACS для образцов, окрашенных антителом мыши против CD3 человека и антителом мыши против CD54 человека. Клетки CD3+ использовали для создания HTS, в то время как CD54+ активированные T-клетки использовали для экспериментов по трансдифференцировке.

Результаты показали, что, хотя T-клетки составляли большинство (82%) мононуклеарных клеток, выделенных из миндалевидных желез, только 9% представляли собой CD54+ T-клетки.

1.4. Получение и селекция лимфоцитов человека, секретирующих IgM и IgG

Очищенные B-клетки (см. раздел 1.3.3.) высевали в количестве 3,75x105 клеток/мл в лунки 96-луночных круглодонных планшетов (Corning), покрытых антителом мыши против CD154 человека (BD Pharmingen). Клетки культивировали в полной среде RPMI 1640, дополненной 10% инактивированной нагреванием эмбриональной телячьей сывороткой, FBS, со сверхнизким содержанием IgG (Gibco/BRL) и 100 Е/мл интерлейкина 4 (IL-4) человека (R&D systems) и 50 нг/мл интерлейкина 10 человека (IL10), добавленного после 3 суток в культуре. Культуры пополняли, заменяя половину культуральной среды каждые от 2 до 3 суток. Жизнеспособность клеток оценивали в трех экземплярах по исключению трипанового синего с использованием гемоцитометра. На 5 сутки и 10 сутки культивированные лимфоциты собирали, промывали два раза PBS и анализировали посредством FACS с использованием антитела мыши против CD19 человека-PE, антитела мыши против IgM человека-FITC или антитела мыши против IgG человека-FITC (все от BD Pharmingen). Все окрашивания проводили с помощью 1 мкг каждого антитела на 1x106 клеток при 4°C. Во всех анализах более 95% клеток были двойными отрицательными с маркерами, установленными согласно окрашиванию совпадающим по изотипу отрицательным контролем. Области, содержащие погибшие клетки и дебрис, исключали из анализа. Все анализы проводили путем ограничения в области от 5000 до 10000 живых клеток.

Типичные профили положительных по IgM и IgG клеток в культивированных лимфоцитах представлены на фигуре 8. После 5 суток в культуре 18% CD19+ клеток были положительными по IgM и только 1% имел поддающийся детекции IgG на поверхности, в то время как после 10 суток процент положительных по IgM лимфоцитов снижался до только 2%, в то время как процент положительных по IgG клеток возрастал до 15%. После установки соответствующих областей положительные по IgM и положительные IgG фракции отсортировывали.

Концентрации IgM и IgG в культуре определяли с помощью стандартного ELISA с использованием 96-луночных планшетов для ELISA и абсорбированных на пластмассу подвергнутых аффинной очистке антител козы к μ- и γ-цепям человека. Связанные антитела выявляли с помощью конъюгированных с HRP антител овцы против Ig человека. Все антитела были от Sigma. В качестве субстрата использовали ABTS и оптическую плотность измеряли при 405 нм. В таблице 1 обобщенно представлены уровни IgM и IgG, выявленных в культуре B-лимфоцитов через 5 и 10 суток.

Таблица 1
Продукция IgM и IgG в культуре первичных B-лимфоцитов
Время в культуре IgM (нг/106 клеток) IgG (нг/106 клеток)
5 суток 2,480±182 850±92
10 суток 1,215±260 1,914±101

Продукция IgM снижалась после 5 суток в культуре, в то время как продукция IgG увеличивалась.

ПРИМЕР 2

2. Гибридизация соматических клеток

В данной области хорошо известно несколько способов соматической гибридизации клеток. Они включают, но не ограничиваются ими, например, биологический способ с использованием фузагенного вируса, такого как вирус Сендай (Kohler and Milstein, 1975), химический способ с использованием полиэтиленгликоля (PEG) (Wojciezsyn, et al., 1983) и электрический способ с использованием электрических полей (Neil and Zimmermann, 1993). Каждый способ может индуцировать или вызывать обратимую проницаемость плазматических мембран и гибридизацию.

Независимо от способов гибридизации клеток, упомянутых выше, для обеспечения гибридизации клеток требуется, в принципе, две обязательные стадии. Во-первых, плазматические мембраны клеток, подлежащих гибридизации, необходимо привести в плотный контакт клеточных мембран. Во-вторых, можно одновременно индуцировать обратимое разрушение плазматических мембран в точке контакта.

Для электрического способа гибридизации клеток представляющие интерес клетки можно приводить в тесный контакт клеточных мембран с использованием электрического поля с переменным током (поле AC) с соответствующей частотой поля, а затем индуцировать из гибридизацию при воздействии на них короткого электрического импульса одновременно с полем AC.

В качестве другого выбора электрическая гибридизация клеток вовлекает следующие физические явления; диэлектрофорез (DEP) и электрическое разрушение плазматических мембран.

Диэлектрофорез (Pohl, 1978) представляет собой явление, которое охарактеризовывает движение диэлектрических частиц, таких как биологические клетки, когда они суспендированы в соответствующем растворе и подвергаются действию неравномерного электрического поля AC с соответствующей частотой. Документировано, что движение клеток может быть описано как (i) перенос или миграция диэлектрических частиц, например при частотах поля между 0,5-2,0 МегаГерц (МГц) для клеток Sp2, суспендированных в 100 мМ сорбите (Mahaworasilpa, 1992) и (ii) вращение диэлектрических частиц (Mahaworasilpa, 1992), например при частотах поля между 2-10 килоГерц (кГц) для клеток Sp2, суспендированных в 100 мМ сорбите. Неравномерное поле можно получать путем применения электрического поля между парой электродов, например электрических цилиндрических проводов, которые могут быть расположены в нескольких конфигурациях. Наиболее широко используемая конфигурация представляет собой параллельную конфигурацию электродов (фигура 30). В присутствии неравномерного поля DEP может вызывать привлечение диэлектрическими частицами (т.е. биологическими клетками) друг друга и одновременную миграцию в направлении областей наиболее интенсивного поля. В результате оно формирует цепь или нить из клеток, и, в свою очередь, это индуцирует хороший контакт клеточных мембран. Очевидно, что взаимное привлечение клеток обеспечивается, строго когда клетки суспендируют в растворах с умеренно низкой электрической проводимостью.

Электрическое разрушение мембран клеток можно индуцировать, когда на клетки, суспендированные в пригодном растворе для гибридизации, воздействуют электрическим импульсом с соответствующей амплитудой и длительностью (Zimmermann, 1982). Широко используют диапазон длительностей импульса, например прямоугольные импульсы от 1 до 200 микросекунд (мкс), в зависимости от типов клеток, подлежащих гибридизации.

2.1. Электрическая система для гибридизации клеток

В определенных вариантах осуществления этого изобретения для создания гибридизованных клеток, таких как трансдифферинцирующиеся клетки, можно использовать электрический способ.

2.1.1. Система манипулирования клетками

Для манипулирования отдельными представляющими интерес клетками во всех случаях для этого изобретения перед гибридизацией клеток использовали систему для манипуляции/доставки единичных клеток, описанную выше (раздел 1.1.1).

2.1.2. Микроэлектроды

В этом изобретении использовали два L-образных микроэлектрода. На фигуре 29 представлен микроэлектрод, который был изготовлен из непокрытого никелевого сплава диаметром 128 мкм (7). Стержень микроэлектрода был заключен в капиллярную трубку для определения гематокрита с наружным диаметром 1,5 мм. L-образная секция микроэлектрода имела такую конфигурацию, чтобы обеспечивать постоянную площадь поверхности как горизонтальной, так и вертикальной секций электрода, подлежащих воздействию среды или соответствующего раствора (Mahaworasilpa, 1992). Перед процессом гибридизации два микроэлектрода устанавливали на два тонких микроманипулятора, по одному на каждый микроэлектрод. Эти микроэлектроды располагали так, чтобы обеспечить параллельную конфигурацию каждого электрода (фигура 30). Каждый тонкий микроманипулятор имел гидравлический привод и обеспечивал движение с точностью до 0,5 мкм в направлении X, Y или Z.

2.1.3. Клеточная камера и конфигурация

На фигуре 31 представлены два параллельных электрода в лунке стандартного 96-луночного планшета TC с плоским дном, лунка служит в качестве камеры для гибридизации клеток в определенных вариантах осуществления этого изобретение. Для проведения гибридизации клеток микроэлектроды погружали в соответствующую среду (11), содержавшуюся в лунке (12) стандартного 96-луночного планшета для культивирования тканей. На фигуре 32 и фигуре 33 показан вид сверху и вид сбоку параллельной конфигурации электродов соответственно, где, например, три предварительно отобранных клетки, подлежащих гибридизации, помещены между параллельными электродами таким образом, чтобы можно было индуцировать их выстраивание в линию или образование цепи клеток в присутствии соответствующего электрического поля AC.

ПРИМЕР 3

3. Примеры установления систем гемопоэтической трансдифференцировки электрическим способом гибридизации клеток

В следующих разделах предоставлены примеры создания систем гемопоэтической трансдифференцировки (HTS), получаемых гибридизацей клеток либо из различных ростков или типов клеток, либо из одинаковых ростков/или типов клеток, но различных фенотипов. Каждую стабильную систему подвергали анализу для подтверждения того, что она одновременно обладала фенотипическими характеристиками родительских клеток. Подтверждение было основано на анализе специфичных для ростков клеточных маркеров, внутриклеточной экспрессии специфичных для ростков маркеров, присутствии транскриптов РНК специфичных для ростков маркеров и/или секреции специфичных для ростка белков. Представленные ниже примеры иллюстрируют наиболее типичные фенотипические характеристики систем трансдифференцировки. Однако эти примеры никоим образом не ограничиваются конкретным выбранным маркером.

3.1. HTS, происходящая из одного бессмертного миеломоноцитарного предшественника, одного бессмертного B-лимфоцита и одного бессмертного T-лимфоцита - HTS-KMW.

В качестве примера, этот тип HTS получали гибридизацией одной бессмертной миеломоноцитарной клетки-предшественника K562, одной бессмертной T-лимофидной клетки MOLT4 и одной бессмертной B-лимфоидной клетки WIL2NS. Полученную таким образом HTS обозначали как система HTS-KMW (с последующим серийным номером). Следующие стадии способа установления HTS-KMW, растворы (среды для гибридизации, культивирования и выделения) и параметры, использованные для этого изобретения, описаны ниже.

3.1.1. Получение клеток для HTS-KMW

Клеточные линии K562, WIL2NS и MOLT4 культивировали в стандартной среде авторов изобретения TC (см. раздел 1.1) и инкубировали в инкубаторе с увлажнением при 37°С, 5% CO2. В качестве обычной процедуры каждую линию пассировали каждые 3 суток. Перед гибридизацией клеток получали стабильный клон каждого типа клеток, который имел наиболее высокую скорость пролиферации, с использованием способа, описанного в разделе 1.1.2. В некоторых экспериментах использовали обогащенные по CD71+ популяции клеток, полученные, как описано в разделе 1.1.3. Также в некоторых случаях в экспериментах использовали CD15+ клетки обогащенной по CD71+ популяции K562 (раздел 1.1.3.1).

3.1.2. Протокол гибридизации клеток для установления HTS-KMW

Несколько лунок 96-луночного планшета TC использовали в качестве лунок для гибридизации клеток. Каждую лунку заполняли приблизительно 150 мкл среды для гибридизации, которая состояла из 240 мМ сорбита (Sigma), 2,0 мМ KH2PO4 (Sigma), 0,4 мМ CaCl2 (Sigma), 0,2 мМ Mg(C2H3O2)2 (Sigma) и 0,2 мМ Ca(C2H3O2)2 (Sigma), дополненной 0,2% бычьим сывороточным альбумином, BSA (Sigma). Перед электрической гибридизацией клеток клетки предварительно отобранного клона каждого типа клеток промывали один раз в среде для гибридизации в течение нескольких минут и переносили в лунку, содержавшую свежую среду для гибридизации. Лунку обозначали как лунка для предгибридизации. Перед процессом гибридизации клеток единичную и промытую клетку каждого отобранного клона подвергали манипулированию согласно разделу 1.1.1, так чтобы только три клетки, по одной из каждого отобранного клона, были расположены между парой идентичных параллельных электродов, которые были погружены на дно лунки (как показано на фигуре 33). Расстояние между электродами устанавливали на 400 микрометров (например, 400 мкм).

Для обеспечения электрической гибридизации клеток, во-первых, применяли поле с переменным током (AC) с частотой 0,8 МГц и силой поля приблизительно 50-60 киловольт на метр (например 50-60 кВ/м) между электродами в течение нескольких секунд, до тех пор, пока не индуцировалось привлечение трех клеток друг к другу с помощью диэлектрофореза, DEP, и они не образовывали нить из клеток. Этот процесс приводил к тому, что между клетками устанавливался хороший контакт клеточных мембран. Клетки располагали так, чтобы клетка K562 была в середине линии клеток (14) (см. фигуру 32 или 33). Затем применяли два электрических прямоугольных импульса с интервалом 3 секунды между импульсами, одновременно с полем AC. Каждый использованный импульс имел интенсивность приблизительно 170 кВ/м и длительность импульса 75 микросекунд (например, 75 мкс). По окончании второго прямоугольного импульса поле AC поддерживали постоянным в течение других 5 секунд, что приводило к гибридизации клеток в единую тригибридную клетку. Для определенных вариантов осуществления этого изобретения наблюдали, что гибридизация трех клеток может происходить не одновременно, т.е. часто сначала происходила гибридизация двух из трех клеток с последующей гибридизацией третьей клетки. В некоторых случаях для достижения полной трехклеточной гибридизации требовался дополнительный прямоугольный импульс. Затем вновь полученную тригибридную трансдифференцирующуюся клетку переносили из лунки для гибридизации в лунку для выделения, которая была расположена в ряду, отличающемся от лунок для гибридизации. Каждая лунка для выделения содержала 150 мкл стандартной среды TC (см. раздел 1.1). Каждую вновь полученную трансдифференцирующуюся клетку инкубировали, по одной трансдифференцирующейся клетке на лунку для выделения, в инкубаторе с увлажнением, действующем при 37°C и с 5% содержанием CO2 в течение семи суток. Было выявлено, что большинство трансдифференцирующихся тригибридных клеток делятся в пределах 36 часов после события гибридизации клеток. В конце периода инкубации среду в каждой из лунок для выделения соответствующим образом пополняли свежей стандартной средой. Это стимулировало пролиферацию клеток каждого трансдифференцирующегося тригибридного клона. Через двое или трое суток делящиеся или выжившие клетки из каждой лунки для выделения идентифицировали и высевали в лунки стандартного 24-луночного планшета TC, что приводило к появлению ряда трансдифференцирующихся тригибридных клонов. Каждый трансдифференцирующийся тригибридный клон культивировали в 24-луночном планшете в течение другой недели, а затем переносили в 25-см2 колбу TC, содержавшую 10 миллилитров (мл) стандартной культуральной среды авторов изобретения (см. раздел 1.1) и обозначенную соответствующим образом для дальнейшего анализа. Весь процесс электрической гибридизации клеток и выделения трансдифференцирующегося тригибрида повторяли несколько раз для получения партии стабильных трансдифференцирующихся тригибридных клеток.

3.1.3. Профиль маркеров ростков на HTS-KMW

Пример проверки коэкспрессии специфичных для ростка маркеров на установленной клеточной линии HTS-KMW приведен ниже.

После установления клеточной линии HTS-KMW перекрестного происхождения в нормальных условиях культивирования в течение 6 месяцев, популяцию клеток HTS-KMW анализировали в отношении экспрессии специфических маркеров CD миелодиного, B- и T-ростков.

Использовали трехцветный анализ FACS для проверки коэкспрессии следующих маркеров CD: CD19, происходящий из WIL2NS, CD15, происходящий из K562, и CD4, происходящий из MOLT4.

В кратком изложении 100 мкл клеток HTS-KMW в концентрации 1×106 клеток/мл в PBS, содержавшем 5% BSA, суспендировали в 100 мкл PBS и инкубировали в течение 30 мин при 4°С с 0,5 мг/100 мл антитела мыши против CD15 человека-PerCP, 0,25 мг/100 мл антитела мыши против CD4 человека-PE и 1,0 мг/100 мл антитела мыши против CD19 человека-FITC или соответствующего изотипического контроля. Все антитела мыши против белков человека приобретали от BD Pharmingen. После тщательного промывания PBS меченые клетки анализировали с использованием проточного цитометра FACSCalibur и программного обеспечения CellQuest Pro.

На фигуре 9 представлен типичный профиль FACS клеток HTS-KMW, который указывает на то, что клетки HTS-KMW, где специфичные для ростка характеристики являются результатом бессмертных фенотипов, содержат гетерогенные популяции клеток смешанных фенотипов, причем миелоидный является преобладающим. Однако 62% клеток HTS-KMW обладали миелоидными и T-лимфоидными фенотипами и 28% HTS-KMW клеток проявляли T- и B-лимфоидные фенотипы.

3.1.4. Выделение различных фенотипических популяций из HTS-KMW

Клетки HTS-KMW далее сортировали на шесть различных фенотипических популяций, в частности: (1) CD15+CD19+CD4+; (2) CD15+CD19+CD4-; (3) CD15+CD19-CD4+; (4) CD15-CD19+CD4+; (5) CD15-CD19+CD4-; (6) CD15-CD19-CD4+.

Сортирующие области были установлены так, как показано на фигуре 9. Сортирующие области для различных популяций клеток были определены следующим образом: (1) популяция клеток CD15+CD19+CD4+, обозначенная как HTS-KMW.1 и подсчитываемая в обеих из областей R3 и R6; (2) популяция клеток CD15+CD19+CD4-, обозначенная как HTS-KMW.2 и подсчитываемая в обеих из областей R5 и R2; (3) популяция клеток CD15+CD19-CD4+, обозначенная как HTS-KMW.3 и подсчитываемая в обеих из областей R6 и R1; (4) популяция клеток CD15-CD19+CD4+, обозначенная как HTS-KMW.4 и подсчитываемая в обеих из областей R4 и R3; (5) популяция клеток CD15-CD19+CD4-, обозначенная как HTS-KMW.5 и подсчитываемая в обеих из областей R7 и R2; (6) популяция клеток CD15-CD19-CD4+, обозначенная как HTS-KMW.6 и подсчитываемая в обеих из областей R4 и R1. Отсортированные популяции клеток переносили в свежую культуральную среду и выращивали в качестве отдельных культур в нормальных условиях культивирования. Чистоту каждой популяции проверяли сразу после сортировки с приемлемой чистотой 98%.

3.2. HTS, происходящая из одного бессмертного миеломоноцитарного предшественника, одного первичного B-лимфоцита и одного первичного T-лимфоцита - HTS-KBT

В качестве примера этот тип HTS получали гибридизацией соматических клеток между одной бессмертной миелодиной клеткой, происходящей из клеточной линии K562, одной первичной B-клеткой человека и одной первичной T-клеткой человека. Этот тип HTS был обозначен как HTS-KBT с последующим серийным номером.

3.2.1. Получение клеток для установления HTS-KBT

Получение клеток K562 перед созданием HTS-KBT описано выше (раздел 1.1.3). Первичные клетки, использованные для создания HTS-KBT, включали (i) зрелые B-клетки (CD19+), происходящие из селезенки, периферической крови или пуповинной крови; ранние B-клетки (CD20~CD72+), происходящие из костного мозга; активированные B-клетки (CD20+CD72+), происходящие из костного мозга; обученные антигеном B-клетки (CD19+CD5+), происходящие из пуповинной крови и (ii) хелперные T-клетки (CD4+), происходящие из селезенки и периферической крови; обученные антигеном T-клетки (CD3+CD5+), происходящие из пуповинной крови; CD3+ T-клетки из пуповинной крови; а также двойные положительные T-клетки (CD4+CD8+), происходящие из тимуса. Выделение различных лимфоидных клеток из различных лимфоидных тканей описано выше в разделе 1.3.

3.2.2. Протокол гибридизации клеток для установления HTS-KBT

Протокол гибридизации клеток для установления HTS-KBT сходен с протоколом, использованным для установления HTS-KMW (раздел 3.1.2), за исключением того, что среда и электрические поля AC и импульсы отличались. Среда для гибридизации, использованная в этих экспериментах, состояла из 230 мМ сорбита, 1,8 мМ KH2PO4, 0,5 мМ CaCl2, 0,2 мМ Mg(C2H3O2)2 и 0,3 мМ Ca(C2H3O2)2, дополненных 0,2% BSA. Поле AC с параметрами 0,5 МГц и 65-75 кВ/м применяли одновременно с последовательностью из трех прямоугольных импульсов с интервалом 3 секунды, каждый из которых имел длительность импульса 100 мкс и силу 175-185 кВ/м. Поле AC включали постоянно в течение других 5 с после окончания третьего прямоугольного импульса, что приводило к гибридизации клеток с получением тригибридной клетки перекрестного происхождения. Протоколы для инкубации и выделения тригибрида HTS для каждой вновь образованной трансдифференцирующейся тригибридной клетки описаны выше (раздел 3.1.2).

3.2.3. Профиль маркеров ростков у HTS-KBT

Примеры подтверждения коэкспрессии специфичных для ростков маркеров на установленных клетках HTS-KBT приведены ниже.

3.2.3.1. Профиль маркеров для HTS-KBT, установленной из одной бессмертной миелоидной клетки, одной первичной зрелой B-клетки и одной первичной эффекторной T-хелперной клетки

После установления клеточной линии HTS-KBT, например, в нормальных условиях культивирования в течение нескольких месяцев клеточную линию анализировали в отношении экспрессии специфичных для ростка маркеров CD. Клетки клеточной линии HTS-KBT метили антителами мыши против CD19 и CD4 человека с использованием тех же протоколов, которые описаны для получения клеток перед гибридизацией (раздел 1.3.3). На фигуре 10(d) представлены профили FACS (метки CD19 и CD4) для клеточной линии HTS-KBT, установленной из одной бессмертной миеломоноцитарной клетки и 2 первичных клеток. Как правило, более 99% клеток в таком стабильном тригибриде перекрестного происхождения экспрессировали маркеры CD как для B-клеток, так и для T-клеток с плотностью, сходной с плотностью исходных первичных клеток.

3.2.3.2. Профиль маркеров для HTS-KBT, установленная из одной бессмертной миелоидной клетки и двух первичных обученных антигеном лимфоидных клеток (B- и T-клетки)

В другом варианте осуществления была установлена клеточная линия HTS-KBT, полученная гибридизацией клетки K562, одной обученной антигеном B-клетки и одной обученной антигеном T-клетки. Этот вариант HTS-KBT был обозначен как HTS-KBTAE. Клетки анализировали в отношении коэкспрессии CD19, CD3 и CD5 с использованием FACS.

В кратком изложении клетки метили антителом мыши против CD5 человека-FITC и антителом мыши против CD19 человека-PE или антителом мыши против CD4 человека-PE с использованием того же протокола, что и для получения клеток перед гибридизацией клеток (раздел 1.3.3.). На фигуре 11 представлены профили FACS для клеток такой клеточной линии HTS-KBTAE. Результаты показывают, что 5-10% популяции клеток HTS-KBTAE сохраняли их память о воздействии антигена путем поддержания экспрессии на клеточной поверхности молекулы CD5, оставаясь положительными по CD3 или/и CD19. Также по меньшей мере 83% отрицательной по CD5 популяции клеток коэкспрессировали маркеры как B-ростка (CD19), так и T-ростка (CD3).

3.2.3.3. Выделение различных фенотипических популяций из HTS-KBT AE

Клетки HTS-KBTAE далее сортировали на шесть различных фенотипических популяций, в частности: (1) CD3+CD19+CD5+; (2) CD3+CD19+CD5-; (3) CD3+CD19-CD5+; (4) CD3+CD19-CD5-; (5) CD3-CD19+CD5+; (6) CD3-CD19+CD5-.

Сортирующие области были установлены так, как показано на фигуре 9. Сортирующие области для различных популяций клеток были определены следующим образом: (1) популяция клеток CD3+CD19+CD5+, обозначенная как HTS-KBTAE.1 и подсчитываемая в обеих из областей R2 и R4; (2) популяция клеток CD3+CD19+CD5-, обозначенная как HTS-KBTAE.2 и подсчитываемая в обеих из областей R1 и R3; (3) популяция клеток CD3+CD19-CD5+, обозначенная как HTS-KBTAE.3 и подсчитываемая в области R4, но не в области R2; (4) популяция клеток CD3+CD19-CD5-, обозначенная как HTS-KBTAE.4 и подсчитываемая в области R3, но не в области R1; (5) популяция клеток CD3-CD19+CD5+, обозначенная как HTS-KBTAE.5 и подсчитываемая в области R2, но не в области R4; (6) популяция клеток CD15-CD19+CD4-, обозначенная как HTS-KBTAE.6 и подсчитываемая в области R1, но не в области R3. Отсортированные популяции клеток переносили в свежую культуральную среду и выращивали в качестве отдельных культур в нормальных условиях культивирования. Чистоту каждой популяции проверяли сразу после сортировки с приемлемой чистотой 98%.

3.2.3.4. Профиль маркеров для HTS-KBT, установленной из одной бессмертной миелоидной клетки, активированной B-клетки и одной первичной двойной положительной некоммитированной эффекторной T-клетки

В другом варианте осуществления устанавливали клеточную линию HTS-KBT, полученную гибридизацией клеток: одной клетки K562, одной T-клетки (двойная положительная по CD4+ и CD8+), выделенной из тимуса, и одной активированной B-клетки (CD20+ и CD72+), выделенной из костного мозга. Этот вариант HTS-KBT был обозначен как HTS-KBTDP. Клетки анализировали в отношении коэкспрессии CD4, CD8, CD20 и CD72 на клеточной поверхности.

В кратком изложении клетки HTS-KBTDP метили любой из комбинаций антитела мыши против CD4 человека-PE и антитела мыши против CD72 человека-FITC, или антитела мыши против CD20 человека-PE и антитела мыши против CD8 человека-FITC, или антитела мыши против CD4 человека-PE и антитела мыши против CD8 человека-FITC с использованием того же протокола, который описан для выделения первичных лимфоцитов (раздел 1.3). На фигуре 12 представлены профили FACS для таких клеток HTS-KBTDP.

Результаты (см. фигуру 12) показали, что 99% клеток HTS-KBTDP экспрессировали либо CD4, либо CD8, происходящие из двойных положительных T-клеток на их поверхности, где 66-71% клеток были положительными по CD4 и 88-89% клеток были положительными по CD8. В 60% этих клеток экспрессия CD4 и CD8 была одновременной. Являясь положительными по CD4, происходящему из двойных положительных тимоцитов, 61% клеток также были положительными по CD72, происходящему из активированных B-клеток костного мозга. Однако 94% популяции HTS-KBTDP экспрессировали CD72 на их поверхности. С другой стороны, 31% положительных по CD8 клеток коэкспрессировали CD20. Общее количество положительных по CD20 клеток составляло 39%.

3.2.3.5 Выделение различных фенотипических популяций из HTS-KBT DP

Клетки HTS-KBTDP далее сортировали на пятнадцать различных фенотипических популяций, в частности: (1) CD4+CD8+CD20+CD72+; (2) CD4+CD8+CD20+CD72-; (3) CD4+CD8+CD20-CD72+; (4) CD4+CD8+CD20-CD72-; (5) CD4+CD8-CD20+CD72+; (6) CD4+CD8-CD20+CD72-; (7) CD4+CD8-CD20-CD72+; (8) CD4+CD8-CD20-CD72-; (9) CD4-CD8+CD20+CD72+; (10) CD4-CD8+CD20+CD72-; (11) CD4-CD8+CD20-CD72+; (12) CD4-CD8+CD20-CD72-; (13) CD4-CD8-CD20+CD72+; (14) CD4-CD8-CD20+CD72-; (15) CD4-CD8-CD20-CD72+.

Сортирующие области были установлены, как показано на фигуре 12. Сортирующие области для различных популяций клеток были определены следующим образом: (1) клеточная популяция CD4+CD8+CD20+CD72+, обозначенная как HTS-KBTDP.1 и подсчитываемая во всех трех областях R2, R5 и R8; (2) клеточная популяция CD4+CD8+CD20+CD72-, обозначенная как HTS-KBTDP.2 и подсчитываемая во всех трех областях из R2, R8 и R4; (3) клеточная популяция CD4+CD8+CD20-CD72+, обозначенная как HTS-KBTDP.3 и подсчитываемая во всех трех областях R2, R5 и R9; (4) клеточная популяция CD4+CD8+CD20-CD72-, обозначаемая как HTS-KBTDP.4 и подсчитываемая во всех трех областях из R2, R4 и R9; (5) клеточная популяция CD4+CD8-CD20+CD72+, обозначенная как HTS-KBTDP.5 и подсчитываемая во всех трех областях из R1, R5 и R7; (6) клеточная популяция CD4+CD8-CD20+CD72-, обозначенная как HTS-KBTDP.6 и подсчитываемая во всех трех областях из R1, R4 и R7; (7) клеточная популяция CD4+CD8-CD20-CD72+, обозначенная как HTS-KBTDP.7 и подсчитываемая во всех трех областях из R1, R5 и R12; (8) клеточная популяция CD4+CD8-CD20-CD72-, обозначенная как HTS-KBTDP.8 и подсчитываемая во всех трех областях из R1, R4 и R12; (9) клеточная популяция CD4-CD8+CD20+CD72+, обозначенная как HTS-KBTDP.9 и подсчитываемая во всех трех областях из R3, R6 и R8; (10) клеточная популяция CD4-CD8+CD20+CD72-, обозначенная как HTS-KBTDP.10 и подсчитываемая во всех трех областях из R3, R11 и R8; (11) клеточная популяция CD4-CD8+CD20-CD72+, обозначенная как HTS-KBTDP.11 и подсчитываемая во всех трех областях из R3, R6 и R9; (12) клеточная популяция CD4-CD8+CD20-CD72-, обозначенная как HTS-KBTDP.12 и подсчитываемая во всех трех областях из R3, R11 и R9; (13) клеточная популяция CD4-CD8-CD20+CD72+, обозначенная как HTS-KBTDP.13 и подсчитываемая во всех трех областях из R10, R6 и R7; (14) клеточная популяция CD4-CD8-CD20+CD72-, обозначенная как HTS-KBTDP.14 и подсчитываемая во всех трех областях из R10, R11 и R7; (15) клеточная популяция CD4-CD8-CD20-CD72+, обозначенная как HTS-KBTDP.15 и подсчитываемая во всех трех областях из R10, R6 и R12. Отсортированные клеточные популяции переносили в свежую культуральную среду и выращивали в качестве отдельных культур в нормальных условиях культивирования. Чистоту каждой клеточной популяции проверяли сразу после сортировки с приемлемой чистотой 98%.

3.3 Пример HTS, происходящего из первичного миеломоноцитарного предшественника, бессмертного B-лимфоцита и первичного T-лимфоцита - HTS-WTM

В качестве примера этот тип HTS создавали соматической гибридизацией клеток: одного первичного миелоидного предшественника, происходящего из костного мозга, одной бессмертной B-клетки человека, происходящей из клеточной линии WIL2NS, и одной первичной T-клетки человека. Этот тип HTS был обозначен как HTS-WTM с последующим серийным номером.

3.3.1. Получение клеток для установления HTS-WTM

Получение клеток WIL2NS, использованных для создания HTS-WTM, описано выше в разделе 1.1.3. В этих экспериментах использовали первичные хелперные T-клетки (CD4+), происходящие из селезенки, периферической крови, пуповинной крови и тимуса. Выделение различные первичных лимфоидных клеток из различных лимфоидных тканей описано выше (раздел 1.3). Первичные миелоидные клетки-предшественники происходили из CD34+CD15+ мононуклеарных клеток костного мозга, описанных в разделе 1.2.2.

3.3.2. Протокол гибридизации клеток для установления HTS-WTM

Протокол гибридизации клеток для получения HTS-WTM был сходен с протоколом, использованным для получения HTS-KMW (см. раздел 3.1.2), за исключением того, что среда отличалась. Среда для гибридизации, использованная в этих экспериментах, состояла из 235 мМ сорбита, 1,8 мМ KH2PO4, 0,5 мМ CaCl2, 0,3 мМ Mg(C2H3O2)2, и 0,25 мМ Ca(C2H3O2)2 (Sigma), дополненных 0,3% BSA. Для получения WTM использовали точно такой же протокол электрической гибридизации, как описан в разделе 3.2.2. Протоколы инкубации и выделения тригибридов HTS каждой вновь образованной трансдифференцирующейся гибридной клетки, описаны выше (раздел 3.1.2).

3.3.3. Профиль маркеров ростков для HTS-WTM

Ниже приведены примеры подтверждения коэкспрессии специфичных для ростка маркеров на установившихся клетках HTS-WTM.

3.3.3.1 Профиль маркеров на HTS-WTM, установившихся из одного первичного миелоидного предшественника, одной бессмертной лимфоидной клетки и одной первичной T-клетки

После культивирования клеточной линии HTS-WTM, полученной гибридизацией клеток: одного бессмертного B-лимфоцита, происходящего из клеточной линии WIL2NS, одной первичной T-клетки и одного миеломоноцитарного предшественника, в нормальных условиях (см. раздел 1.1) в течение 6 месяцев, клеточную популяцию HTS-WTM анализировали в отношении экспрессии специфичных для ростка маркеров CD. Анализировали экспрессию поверхностных маркеров CD19 (B-росток), CD4 (T-росток), CD15 (миелоидный росток) и CD34 (клетка-предшественник). В кратком изложении, клетки этой клеточной линии HTS-WMT метили комбинацией антитела мыши против CD19 человека-PE, антитела мыши против CD4 человека-FITC (BD Pharmingen) и антитела мыши против CD15 человека-PerCP или комбинацией антитела мыши против CD34 человека-PE, антитела мыши против CD4 человека-FITC и антитела мыши против CD15 человека-PerCP. Окрашивание клеток проводили согласно протоколам, описанным выше (раздел 1.3.3). Типичные профили экспрессии для клеток HTS-WTM, происходящих из CD34+CD15+ миеломоноцитарной клетки-предшественника, представлены на фигуре 13. Анализ показал, что приблизительно 81% клеток HTS-WTM имели общие фенотипы B-ростка и миеломоноцитарного ростка (CD19+CD15+) и 61% из CD19+ клеток также были положительными по CD4, маркеру T-ростка. 34% CD4+ клеток сохраняли также CD34 на их поверхности и 68% CD34+ клеток экспрессировали CD15. Интересно, что 28% CD34+ клеток не сохраняли экспрессию CD15 даже несмотря на то, что как CD34, так и CD15, происходили из одного и того же источника (миеломоноцитарная клетка-предшественник).

3.3.3.2 Выделение различных фенотипических популяций из HTS-WTM

Клетки HTS-WTM далее сортировали на шесть различных фенотипических популяций, в частности: (1) CD15+CD19+CD4+; (2) CD15+CD19+CD4-; (3) CD15+CD19-CD4+; (4) CD15-CD19+CD4+; (5) CD15-CD19+CD4-; и (6) CD15-CD19-CD4+ на основе экспрессии CD15, CD19 и CD4; или (7) CD15+CD34+CD4+; (8) CD15+34+CD4-; (9) CD15+34-CD4+; (10) CD15-CD34+CD4+; (11) CD15-CD34+CD4-; и (12) CD15-CD34-CD4+ на основе экспрессии CD15, CD34 и CD4.

Сортирующие области были установлены, как показано на фигуре 13(A) и 13(B). Сортирующие области для различных популяций клеток на основе экспрессии CD15, CD19 и CD4 определялись следующим образом: (1) клеточная популяция CD15+CD19+CD4+, обозначенная как HTS-WTM.1 и подсчитываемая в обеих из областей R3 и R6; (2) клеточная популяция CD15+CD19+CD4-, обозначенная как HTS-WTM.2 и подсчитываемая в обеих из областей R6 и R1; (3) клеточная популяция CD15+CD19-CD4+, обозначенная как HTS-WTM.3 и подсчитываемая в обеих из областей R5 и R2; (4) клеточная популяция CD15+CD19-CD4-, обозначенная как HTS-WTM.4 и подсчитываемая в области R5, но не в областях R1, R2 и R3; (5) клеточная популяция CD15-CD19+CD4+, обозначенная как HTS-WTM.5 и подсчитываемая в обеих из областей R3 и R4, но не в областях R5 и R6; (6) клеточная популяция CD15-CD19-CD4+, обозначенная как HTS-WTM.6 и посчитываемая в области R2, но не в областях R4, R5 и R6. Отсортированные клеточные популяции переносили в свежую культуральную среду и выращивали в качестве отдельных культур в нормальных условиях культивирования. Чистоту каждой клеточной популяции проверяли сразу после сортировки с приемлемой чистотой 98%.

На фигуре 13B представлены сортирующие области для различных популяций клеток на основе экспрессии CD15, CD34 и CD4. Области были определены следующим образом: (7) клеточная популяция CD15+CD34+CD4+, обозначенная как HTS-WTM.7 и подсчитываемая в обеих из областей R3 и R6; (8) клеточная популяция CD15+34+CD4-, обозначенная как HTS-WRM.8 и подсчитываемая в обеих из областей R1 и R6; (9) клеточная популяция CD15+34-CD4+, обозначаемая как HTS-WTM.9 и подсчитываемая в обеих из областей R2 и R5; (10) клеточная популяция CD15-CD34+CD4+, обозначенная как HTS-WTM.10 и подсчитываемая в обеих из областей R3 и R4; (11) клеточная популяция CD15-CD34+CD4-, обозначенная как HTS-WTM.11 и подсчитываемая в обеих из областей R1 и R4; и (12) клеточная популяция CD15-CD34-CD4+, обозначенная как HTS-WTM.12 и подсчитываемая в области R2, но не в областях R2 и не в областях R4, R5 и R6. Отсортированные клеточные популяции переносили в свежую культуральную среду и выращивали в качестве отдельных культур в нормальных условиях культивирования. Чистоту каждой клеточной популяции проверяли сразу после сортировки с приемлемой чистотой 98%.

ПРИМЕР 4

4. Трансдифференцировка клеток HTS в различные клеточные фенотипы путем изменения условий окружающей среды

В этом примере показаны некоторые из возможных моделей трансдифференцировки клеток в различные фенотипы путем воздействия на данную HTS пермиссивной для клеточного ростка или стимулирующей клеточный росток окружающей среды. Каждый пример никоим образом не ограничен условиями, приведенными здесь.

4.1. Трансдифференцировка клеток HTS в CD4 + T-клетки

Клетки HTS, происходящие из следующих субпопуляций клеток: HTS-KMW.1, HTS-KMW.6, HTS-KBT, HTS-KBTAE.1, HTS-KBTAE.4, HTS-WTM.1, HTS-WTM.6, HTS-WTM.7 и HTS-WTM.12, и полученные, как описано в разделе 3.1.4, разделе 3.2.3.1, разделе 3.2.3.3 и разделе 3.3.3.2, а также контрольные культуры клеток K562, MOLT4 и WIL2NS переносили в свежую культуральную среду и концентрацию клеток доводили до 250000-500000 клеток на мл. Клеточную культуру дополняли 10 Е/мл IL-2 человека (BD Biosciences), 10 нг/мл IL-1-бета человека (BD Biosciences), 10 нг/мл IL-23 человека (R&D Systems), 1 мкг/мл активирующих гранул с антителом против IL-4, 1 мкг/мл активирующих гранул с антителом против IFN-γ и с антителом против CD3/CD28 в соотношении 1 гранула на клетку (Invitrogen) и высевали в U-образные 96-луночные планшеты в количестве 200 мкл на лунку (Corning). Добавляли возрастающие концентрации TGF-бета, составляющие 0,1, 1 и 10 нг/мл, в серии из четырех лунок. Культуральную среду заменяли свежей средой, содержащей все цитокины и антитела на 3 и 5 сутки. На 8 сутки клетки окрашивали антителом против CD4, антителом против CD19 и антителом против CD15 и анализировали проточной цитометрией, как описано в разделе 1.3.3. Перед окрашиванием клетки активировали в течение 5 часов с помощью 50 нг/мл PMA, 500 нг/мл иономицина и 1x BD GoldgiStop.

Затем клетки метили антителами мыши против CD4 человека-PE, против CD19 человека-FITC и против CD15-PerCp, как описано в разделе 3.1.3. На фигуре 14 представлен типичный профиль тройного окрашивания на CD4, CD19 и CD15 в культурах, где 100% клеток экспрессировали только CD4 на поверхности после индуцированной дифференцировки в направлении CD4+ клеток. В культуре HTS-KMW.1, единичные CD4+ клетки достигали 49% от всей клеточной популяции, инициированной из чистой популяции тройных положительных (CD15+CD19+CD4+) клеток. В HTS-KBT они достигали 50% из исходной 100% двойной положительной (CD19+CD4+) популяции; 61% в HTS-KBTAE.1 из 100% тройной положительной (CD3+CD19+CD5+) популяции; 74% в HTS-KBTAE.4 из исходных 100% CD3+ клеток; 82% в HTS-WTM.1 из 100% тройной положительной (CD15+CD19+CD4+) популяции; и 71% в HTS-WTM.7 становились положительными только по CD4 клетками из 100% тройной положительной популяции с фенотипом CD15+CD34+CD4+. Во всех контрольных культурах клеток K562, MOLT4 и W1L2NS сохранялся неизмененным их профиль экспрессии маркеров.

4.1.1 Охарактеризация CD4 + T-клеток, образованных из HTS

Положительные только по CD4+ клетки, полученные из культур HTS, индуцированных в направлении CD4+ T-клеток, отсортировывали для дальнейшего анализа экспрессии маркеров и функциональной характеризации. Приемлемая чистота составляла 98% от всей популяции CD4+ T-клеток.

4.1.1.1 Фенотипический профиль CD4 + клеток, образованных из культур HTS

Положительные только по CD4 клетки, происходящие из пермиссивных для T-лимфоцитов культур HTS, далее анализировали в отношении экспрессии следующих молекул на поверхности клеток, экспрессируемых исключительно на поверхности CD4+ T-клеток или важных для функции CD8+ T-клеток: TCRαβ - T-клеточный рецептор; CD25 - рецептор IL-2-альфа, экспрессируемый активированными T-клетками и в комбинации с CD4, обозначает регуляторную подгруппу CD4+ T-клеток; CD27 - вовлеченный в костимуляцию T-клеток; CD28 - указывающий на активацию наивных T-клеток; CD62L - экспрессируемый на наивных T-клетках и T-клетках памяти и вовлеченный в хоминг; CD69 - молекула передачи сигнала на активированных T-клетках; CD95 - активируемый при активации; и CD45RO - указывающий на активированные T-клетки или T-клетки памяти. Экспрессию каждого маркера оценивали в комбинации с CD4. Для этой цели клетки окрашивали антителом мыши против CD4 человека-PE в комбинации любым из антитела мыши против CD25 человека-FITC, антитела мыши против CD27 человека-FITC, антитела мыши против CD62L человека-FITC, антитела мыши против CD69 человека-FITC, антитела мыши против CD95 человека-FITC или антитела мыши против CD45RO человека-FITC, следуя по существу тому же протоколу, который описан в разделе 1.3.3. В таблице 2 обобщенно представлен фенотипический профиль CD4+ T-лимфоцитов, происходящих из различных культур HTS.

В то время как все клетки из различных культур экспрессировали зрелую форму TCR на их поверхности, профиль экспрессии CD показал различные подгруппы CD4+, образовавшиеся в культурах HTS. Клетки показали различную способность к хомингу, о чем свидетельствовала экспрессия CD62L, которая значительно коррелировала с уровнем экспрессии различных активационных молекул. Можно было получить не только подгруппу активированных T-хелперных клеток, но также подгруппу CD4+CD25+ регуляторных T-клеток, в частности, в культурах HTS-WTM, происходящих из первичных миеломоноцитарных клеток-предшественников.

Таблица 2
Фенотипический профиль CD4 + клеток, образовавшихся из пермиссивных для T-клеток культур HTS
Культура HTS % только CD4+ % CD4+ клеток, экспрессирующих
TCRαβ CD25 CD27 CD28 CD62L CD69 CD95 CD45OR
KMW.1 49 100 <1 5 6 <1 7 21 7
KMW.6 100 100 <1 9 12 <1 14 24 10
KBT 50 100 5 21 19 8 10 11 8
KBTAE.1 61 100 25 57 43 23 62 43 53
KBTAE.4 74 100 40 61 57 31 68 56 50
WTM.1 82 100 10 19 23 12 21 24 13
WTM.6 100 100 18 41 44 18 26 20 12
WTM.7 71 100 48 12 25 47 15 6 6
WTM.12 100 100 62 38 51 64 17 21 14

4.1.1.2 Продукция цитокинов CD4 + клетками, образованными из культур HTS

Положительные только по CD4+ клетки, образовавшиеся из пермиссивной для T-клеток культуры HTS, далее анализировали в отношении продукции IL-2, IL-4, IL-8, IL-10, IFN-γ и TNF-α после поликлональной активации 10 нг/мл липополисахарида (LPS) в течение 4 суток. Клетки высевали в количестве 200000 клеток в 200 мкл полной среды на лунку 96-луночных планшетов с плоским дном. Супернатанты удаляли и анализировали с помощью соответствующего набора для ELISA (все были приобретены от Invitrogen). В таблице 3 представлен типичный профиль продукции цитокинов в поликлонально стимулированных CD4+ клеток, происходящих из культур HTS.

Таблица 3
Концентрация различных цитокинов в супернатантах CD4 + клеток, образовавшихся из культур HTS в окружающей среде, стимулирующей T-лимфоидные клетки
Культура HTS Концентрация цитокинов в культурах HTS/нг/мл культуры
IL-2 IL-4 IL-8 IL10 IFN-γ TNF-α
KMW.1 14,5 68,9 12,3 19,4 0,72 12,8
KMW.6 38,9 72,3 11,9 21,5 0,98 18,3
KBT 21,4 69,7 23,9 29,7 1,01 8,7
KBTAE.1 18,3 62,3 28,7 56,3 2,46 5,9
KBTAE.4 16,1 74,3 22,4 62,1 3,11 10,1
WTM.1 42,7 45,1 44,1 39,8 1,98 1,05
WTM.6 41,8 44,8 45,8 41,2 2,33 1,46
WTM.7 45,4 49,8 40,1 35,2 3,25 4,3
WTM.12 46,1 50,4 39,8 35,8 4,2 5,8

Профили цитокинов вновь подтверждают присутствие различных подгрупп T-клеток в CD4+ клетках, образовавшихся из культур HTS в пермиссивной для T-клеток окружающей среде, варьирующих от доминирующего воспалительного до доминирующего регуляторного профиля.

4.2. Трансдифференцировка клеток HTS в цитотоксические CD8 + T-клетки

Клетки, происходящие из следующих популяций HTS: HTS-KBTAE.1 и HTS-KBTAE.4, описанных в разделе 3.2.3.3; HTS-KBTDP.1, HTS-KBTDP.4 и HTS-KBTDP.12, описанных в разделе 3.2.3.5, а также контрольную культуру K562 использовали для дифференцировки в цитотоксические CD8+ T-лимфоциты.

Для этой цели контрольные клетки K562 и клетки, происходящие из каждой популяции HTS, высевали в количестве 100000 клеток на лунку в 24-луночные планшеты, покрытые монослоем стромальных клеток тимуса человека. Стромальные клетки тимуса человека получали из измельченного небольшого фрагмента тимуса, расщепленного до суспензии отдельных клеток путем инкубации в с 0,5 мг/мл коллагеназы и 2 Е/мл ДНК-азы I при 37°С в течение 60 минут при частом встряхивании. Клеточную суспензию промывали один раз культуральной средой (RPMI 1640, 10% FCS, 10 МЕ/мл пенициллина, 10 пг/мл стрептомицина и 1 ммоль/л L-глутамина). Культуры стромы тимуса устанавливали с использованием либо свежих, либо замороженных клеток в планшетах с 24-чашками в количестве 106 клеток на лунку в 2 мл культуральной среды. Через 2 суток неприкрепляющиеся клетки удаляли промыванием 3 раза культуральной средой. Затем монослой поддерживали в культуральной среде, которую заменяли по меньшей мере два раза в неделю. Культуры HTS также дополняли 1% не незаменимыми аминокислотами, 10 нг/мл IL-7 человека и 100 Е/мл IL-2 человека (BD Bioscience). Культуральную среду заменяли свежей средой, содержащей цитокины, на 5 и 10 сутки.

На 14 сутки клетки HTS анализировали в отношении экспрессии CD8, CD19 и CD15. Для этой цели клетки затем метили антителами мыши против CD8 человека-PE, против CD19 человека-FITC и против CD15 человека-PerCp, как описано в разделе 1.3.3. На фигуре 15 показан типичный профиль маркера ростка в культуре HTS KBTDP.12, где 100% клеток обладали положительным только по одному маркеру (CD8+) фенотипом после индуцированной дифференцировки в направлении CD8+ клеток. В KBTAE.1 количество положительных только по CD8 клеток достигала 53% из 100% тройной положительной CD3+CD19+CD5+ популяции, где в KBTAE.4 такое количество составляло 61% из 100% только CD3+ популяции. В HTS-KBTDP.1 и в HTS-KBTDP.4, проценты только CD8+ клеток достигали 72% и 86% из 100% CD4+CD8+CD20+CD72+ и CD4+CD8+CD20-CD71- популяций соответственно. В контрольных культурах K562 изменений не наблюдали.

4.2.1 Охарактеризация CD8 + клеток, образованных из культур HTS

Положительные только по CD8+ клетки, образовавшиеся из культур HTS, индуцированных в направлении цитотоксических T-клеток, отсортировывали для дальнейшего анализа экспрессии маркеров и функциональной характеризации.

4.2.1.1 Фенотипический профиль CD8 + клеток, образованных из культур HTS

Положительные только по CD8 клетки, происходящие из пермиссивных для T-лимфоцитов культур HTS, далее анализировали в отношении экспрессии следующих молекул на клеточной поверхности, либо исключительно экспрессированных на поверхности цитотоксических T-клеток, либо важных для функций CD8+ T-клеток: TCRαβ - T-клеточный рецептор; CD8α и CD8β, где подавление β-цепи указывает на предшествующее воздействие антигена; CD27 - вовлеченный в костимуляцию T-клеток; CD28 - указывающий на активацию наивных T-клеток; CD62L - экспрессируемый на наивных T-клетках и T-клетках памяти и вовлеченный в хоминг; CD69 - молекула передачи сигнала на активированных T-клетках; CD95 - активируемый при активации; и CD45RO - указывающий на активированные T-клетки или T-клетки памяти. Сначала клетки метили антителом против CD8α человека-PE (BD Pharmingen) и антителом против CD8β человека-FITC (BD Pharmingen), по существу, следуя тому же протоколу, который описан в разделе 1.3.3. При последующих окрашиваниях антителом использовали против CD8β-FITC в комбинации с антителом против TCRαβ человека-FITC, антителом против CD27 человека-FITC, антителом против CD28 человека-FITC, антителом против CD62L человека-FITC, антителом против CD95 человека-FITC или антителом против CD45RO человека-FITC (все от BD Pharmingen). В таблице 4 обобщенно представлен фенотипический профиль CD8+ T-лимфоцитов, образованных из различных культур HTS.

Таблица 4
Фенотипический профиль CD8 + клеток, образовавшихся из пермиссивных для T-клеток культур HTS
Культура HTS % только CD8+ % CD8+ клеток, экспрессирующих
TCRαβ CD27 CD28 CD62L CD95 CD45OR CD8α CD8β
KBTAE.1 53 100 51 41 22 45 52 100 100
KBTAE.4 61 100 64 52 28 53 49 100 100
KBTDP.1 74 100 71 30 8 29 11 100 100
KBTDP.4 86 100 68 28 10 32 16 100 100
KBTDP.12 100 100 75 32 8 36 12 100 100

Определение профиля маркеров показала, что все клетки в различных популяциях были единообразными в отношении экспрессии TCRαβ отдельно с обеими цепями α и β для CD8. Однако клеточные популяции показали не только гетерогенную экспрессию других маркеров, но также различную степень экспрессии маркеров, вовлеченных в активацию, хоминг и память.

4.2.1.2 Продукция цитокинов CD8 + клетками, образованными из культур HTS

Положительные только по CD8 клетки, образовавшиеся из культур HTS, анализировали в отношении внутриклеточной продукции IFN-γ и IL-2. Для этой цели положительные только по CD8 клетки, происходящие из культур HTS, в условиях образования T-лимфоидных клеток стимулировали форболовым сложным эфиром (PMA) в концентрации 50 нг/мл и ионамицином в концентрации 500 нг/мл в стандартных условиях культивирования. Через 1 час добавляли 200 нг/мл брефелдина A и клетки инкубировали в стандартных условиях культивирования в течение дополнительных 3 часов. После промывания клетки фиксировали в 4% параформальдегиде в течение 15 минут при 20°С. После трех циклов промывания увеличивали проницаемость клеток с помощью сапонина и окрашивали их антителом против IL-2-PE (Pharmingen), антителом против IFN-γ-FITC или изотипическим контролем. На фигуре 16 представлены типичные профили внутриклеточных IL-2 и IFN-γ в положительных только по CD8 клетках культур HTS-KBTAE.4 и HTS-KBTDP.12. В то время как обе культуры содержали клетки, продуцирующие IL-2, IFN-γ или оба из них, культура HTS-KBTDP.12 имела широкий диапазон уровней продукции для IL-2 в противоположность культуре HTS-KBTAE.4, имеющей более широкий диапазон концентраций IFN-γ.

4.2.1.3 Цитотоксические эффекторные функции CD8 + клеток, образованных из культур HTS

Продукция внутриклеточных цитотоксических гранул является основной эффекторной функцией, указывающей на терминально дифференцированные T-клетки. Для детекции внутриклеточных цитотоксических гранул, положительные только по CD8 клетки из культур HTS в пермиссивных для T-лимфоцитов условиях фиксировали 4% параформальдегидом в течение 15 минут при 20°С. После промывания увеличивали проницаемость клеток с помощью сапонина и окрашивали их антителом против перфорина-PE (BD Pharmingen) и антителом против гранзима A-FITC или изотипическим контролем. На фигуре 17 представлены типичные профили внутриклеточного перфорина и гранзима A в положительных только по CD8 клетках культур HTS-KBTAE.4 и HTS-KBTDP.12. Обе культуры содержали клетки, положительные либо по перфорину, либо по гранзиму A, либо по обоим из них, указывая на функционально дифференцированные цитотоксические T-клетки. Приблизительно 40% положительных только по CD8 клеток в обеих культурах приобрели такой фенотип.

4.3. Трансдифференцировка клеток HTS в B-лимфоциты из HTS

Клетки, происходящие из следующих популяций HTS: HTS-KMW.1 и HTS-KMW.5, описанных в разделе 3.1.4; HTS-KBT, описанной в разделе 3.2.3.1; HTS-KBTAE.1 и HTS-KBTAE.6, описанные в разделе 3.2.3.3; HTS-KBTDP.1 и HTS-KBTDP.13, описанные в разделе 3.2.3.5; HTS-WTM.1 и HTS-WTM.7, описанные в разделе 3.3.4, а также контрольные культуры K562, MOLT4 и WIL2NS, использовали для дифференцировки B-лимфоцитов в присутствии клеточной линии стромы костного мозга HS-5. Клеточную линию HS-5 стандартным образом поддерживали в модифицированной способом Дульбекко среде Игла (DMEM), дополненной 4 мМ L-глутамином, 1,5 г/л бикарбоната натрия и 10% (об./об.) FCS. За одни или двое суток до экспериментов по дифференцировке клетки HS-5 высевали в планшеты с 24 ячейками в количестве 60000 клеток на ячейку в 1 мл культуральной среды или в 96-луночные планшеты с плоским дном в количестве 6000 на лунку в 100 мкл культуральной среды. Кокультуры для дифференцировки B-лимфоцитов инициировали удалением среды для роста HS-5 и посевом отобранных популяций клеток HTS в планшеты с 24 ячейками в количестве от 1000 до 40000 на ячейку в 1 мл и в 96-луночные планшеты в количестве 100 клеток на лунку в 100 мкл. Стандартная культуральная среда была дополнена добавками для стимуляции B-лимфоидного ростка, в частности, растворимым CD40L в концентрации 4 нг/мл (Invitrogen), IL-4 человека в концентрации 10 нг/мл (Invitrogen), IL-5 человека в концентрации 5 нг/мл (Invitrogen), IL-6 человека в концентрации 10 нг/мл (Invitrogen), IL-10 человека в концентрации 10 нг/мл (Invitrogen), IL-2 человека в концентрации 5 нг/мл (Invitrogen), IL-7 человека в концентрации 20 нг/мл (Invitrogen), Flt3-лигандом в концентрации 20 нг/мл (Invitrogen), происходящим из стволовых клеток фактором в концентрации 20 нг/мл (BD Bioscience), IL-3 человека в концентрации 10 нг/мл (Invitrogen) и mAb-агонистом против CD40 в концентрации 5 мкг/мл (клон HM40-3, BD Bioscience). Культуральную среду заменяли на 5 и 7 сутки свежей средой, дополненной добавками для стимуляции B-лимфоидного ростка. Не прикрепляющиеся клетки из HTS-KMW.1, HTS-KMW.5, HTS-KBT, HTS-WTM.1, HTS-WTM.7 и контрольных культур K562, MOLT4 и WIL2NS собирали и окрашивали антителом мыши против CD4-FITC, антителом мыши против CD19-PE и антителом мыши против CD15-PerCP и анализировали проточной цитометрией, как описано в разделе 1.3.3. На фигуре 18 представлен типичный профиль окрашивания культуры HTS-KBTAE.6 со 100% только CD19+ клеток после индуцированной дифференцировки в направлении B-лимфоцитов. В случае HTS-KBTAE.1 и HTS-KBTAE.6, не прикрепляющиеся клетки окрашивали антителом против CD3 человека-FITC вместо антитела против CD4-FITC. Для культур HTS-KBTDP.1 и HTS-KBTDP.13 использовали антитело против CD20 человека-PE вместо антитела против CD19-PE.

4.3.1 Охарактеризация CD19 + клеток, образованных из культур HTS

Положительные только по CD19 клетки, происходящие из B-лимфоидных культур HTS, отсортировывали и далее анализировали в отношении B-клеточных маркеров, присутствия специфических для B-клеток транскриптов и функциональных характеристик, таких как секреция иммуноглобулинов и дифференцировка в плазматические клетки.

4.3.1.1 Поверхностная экспрессия других B-клеточных маркеров

CD19+ клетки, происходящие из стимулированных в B-лимфоидные клетки культур HTS, далее анализировали в отношении экспрессии следующих молекул на клеточной поверхности, либо исключительно экспрессируемых на поверхности B-клеток, либо важных для функций B-клеток: CD1c - молекулы MHC класса I, ассоциированные с β2-микроглобулином, которые имеют специализированную роль в представлении антигенов; CD10 - цинковая металлопротеиназа, вовлеченная в развитие B-клеток; CD20 - молекула активации B-клеток; CD22 - молекула адгезии, экспрессируемая на зрелых B-клетках, которая отвечает за взаимодействие B-клеток с моноцитами и T-клетками; CD38 - активация клеток; CD40 - дифференцировка и костимуляция B-клеток, вовлечен в переключение изотипов спасение B-клеток от апоптоза; поверхностные IgM и IgG.

Для этой цели CD19+ клетки, происходящие из стимулированных в B-лимфоидные клетки культур HTS, метили антителом мыши против CD1c человека-PE, антителом мыши против CD10 человека-FITC, антителом мыши против CD20 человека-PE, антителом мыши против CD22 человека-FITC, антителом мыши против CD38 человека-FITC, антителом мыши против CD40 человека-FITC, антителом мыши против IgG человека-PE и антителом мыши против IgM человека-PE (BD Pharmingen). Следовали по существу тому же протоколу, который описан в разделе 1.3.3 для всех маркеров. В таблице 5 обобщенно представлен фенотипический профиль B-лимфоцитов, происходящих из различных культур HTS.

Таблица 5
Фенотипический анализ CD19 + клеток, образованных из HTS в стимулирующей
B-лимфоидные клетки окружающей среде
Культура HTS % только CD19+ % CD19+ клеток, экспрессирующих
CD1c CD10 CD20 CD22 CD38 CD40 IgM IgG
KMW.1 55 100 <1 4 3 100 <1 100 <1
KMW.5 100 100 <1 7 6 100 <1 100 <1
KBT 96 100 5 9 9 100 4 100 <1
KBTAE.1 99 100 3 7 16 100 6 100 <1
KBTAE.6 100 100 2 4 13 100 7 100 <1
WTM.1 84 93 28 3 4 100 <1 70 <1
WTM.7 68 91 31 5 9 100 <1 68 <1

Не наблюдали новой экспрессии, активации или подавления маркеров в контрольных культурах K562, WIL2NS и MOLT4.

Когда популяции HTS-KBTAE, происходящие первоначально из CD5+ B-клеток, культивировали в окружающей среде, стимулирующей B-лимфоидные клетки, было выявлено больше активированных CD20+, больше зрелых CD22+ и CD40+ клеток. Учитывая, что эти культуры также содержали больше положительных по IgG клеток после стимуляции LPS (таблица 6), результаты указывают на способность этих конкретных популяций дифференцироваться в функциональные B-клетки и плазматические клетки.

Появление CD10 на клеточной поверхности маркера пре-B-клеток в сочетании с исчезновением экспрессии IgM на поверхности клеток, в частности в культуре HTS-WTM; отчетливо указывает на дедифференцировку CD19+ клеток в более незрелые пре-B-клетки.

4.3.1.2 Способность дифференцироваться в плазматические клетки

На 14 сутки культуры подвергали воздействию 3,5 мг/мл липополисахарида (Sigma) для активации B-лимфоцитов и индукции образования плазматических клеток. Секретируемые IgM и IgG подвергали количественной оценке во всех HTS-B-лимфоидных культурах с помощью стандартного ELISA с использованием 96-луночных планшетов для ELISA и абсорбированных на пластмассу подвергнутых аффинной очистки антител козы к μ- и γ-цепям человека. Связанные антитела выявляли с помощью конъюгированных с HRP антител овцы против Ig человека. Все использованные антитела были от Sigma. В качестве субстрата использовали ABTS и оптическую плотность измеряли при 405 нм. В таблице 6 представлены изменения фенотипического профиля CD19+ клеток после воздействия LPS и в таблице 7 обобщенно представлены уровни IgM и IgG, выявленные в культуре B-лимфоцитов через 7 суток и 17 суток.

Таблица 6
Фенотипический анализ CD19 + B-клеток после стимуляции LPS
Культура HTS % только CD19+ % CD19+ клеток, экспрессирующих
CD1c CD10 CD20 CD22 CD38 CD40 IgM IgG
KMW.1 58 100 <1 4 3 100 <1 100 <1
KMW.5 100 100 <1 7 6 100 <1 100 <1
KBT 89 100 5 12 11 100 4 91 4
KBTAE.1 94 100 3 15 20 100 23 88 8
KBTAE.6 80 100 2 24 38 100 25 89 7
WTM.1 82 92 15 6 8 100 2 82 <1
WTM.7 69 89 28 8 11 100 5 70 2

Уменьшение количеств только CD19+ клеток в культурах HTS-KBT может быть свойственно дальнейшей дифференцировке в плазматические клетки, поскольку количество CD11+ клеток возрастало, что сопровождалось увеличением CD40+ положительных клеток, а также несущих IgG клеток. Количества менее зрелых CD10+ пре-B-клеток в культурах WTM также снижалось при увеличении количества CD40+ и CD22+ положительных клеток.

Результаты ELISA подтверждают, что существует степень прогрессирования из зрелых B-клеток в плазматические клетки в стимулированных LPS культурах, в частности в культурах HTS-KBT, где IgG был выявлен впервые.

Таблица 7
Концентрация IgM и IgG в супернатантах культур HTS в окружающей среде, стимулирующей B-лимфоидные клетки
Культура HTS Концентрация Ig в культурах HTS, нг/мл
День 7 День 17 День 7 День 17
KMW.1 28 159 0 0
KMW.5 40 210 0 0
KBT 15 238 0 28
KBTAE.1 60 410 0 43
KBTAE.6 68 361 0 39
WTM.1 20 164 0 0
WTM.7 15 158 0 10

4.4. Трансдифференцировка клеток HTS в макрофаги

Клетки HTS, происходящие из следующей субпопуляции HTS-WTM.4 и описанные в разделе 3.3, а также контрольную культуру WIL2NS переносили в свежую культуральную среду и концентрацию клеток доводили до 100000-200000 клеток на мл. Клеточную культуру дополняли 50 нг/мл IL-7 человека (Invitorgen), 50 нг/мл IL-6 человека (Invitrogen), 10 нг/мл IL3 человека (Invitrogen), 100 нг/мл M-CSF человека (BD Biosciences), 30 нг/мл GM-CSF человека (BD Biosciences) и 50 нг/мл FIt3L (Invitrogen) и высевали в планшеты с 24 ячейками с плоским дном в количестве 1 мл на лунку. Культуру дополняли свежей культуральной средой каждые 3-4 сутки путем замены половины культуральной среды свежей средой. На фигуре 19 показана морфология культуры HTS после 8 суток, где клетки приобретали характеристики ростка, свойственные прикрепляющимся клеткам.

Затем клетки метили антителом мыши против CD4 человека, против CD19 человека и против CD15 человека, как описано в разделе 1.3.3. На фигуре 20 показано, что большинство клеток утрачивают экспрессию всех маркеров после нахождения в пермиссивной для макрофагов культуре в течение 8 суток, за исключением CD15, где приблизительно 7% клеток оставались положительными по маркерам миеломоноцитарного ростка. Только 2% клеток были положительными по CD4, и не было положительных по CD19 клеток. В это же время в контрольной культуре WIL2NS не наблюдали изменений.

4.4.1 Охарактеризация макрофагов, образованных из HTS

Образованные из HTS макрофаги подвергали анализу в отношении экспрессии других маркеров макрофагального ростка, а также функциональных характеристик.

4.4.1.1 Экспрессия других макрофагальных маркеров

Поскольку отсутствует единичный маркер, характеризующий исключительно макрофаги человека, образованные из HTS прикрепляющиеся клетки также далее анализировали в отношении экспрессии CD11b, CD86, CD64, CD14 и CD115, которые являются характерными для макрофагального ростка. Для этой цели прикрепляющиеся клетки, происходящие из стимулированных в направлении макрофагов культур HTS, метили антителами против CD11b человека-PE, CD86 человека-F1TC, CD64 человека-FITC, CD14 человека-PE и CD115 человека-PE (BD Pharmingen). По существу, следовали тому же протоколу, который описан в разделе 1.3.3 для всех маркеров, за исключением CD115-PE. Связывание M-CSF с его рецептором CD115 может приводить к интернализации рецептора и, таким образом, снижать интенсивность поверхностного окрашивания. Таким образом, перед окрашиванием антителом против CD115-PE клетки фиксировали и увеличивали их проницаемость с помощью набора Cytofix/Cytoperm (BD Biosciences), так чтобы можно было оценить поверхностный и внутриклеточный CD115. Пять отдельных культур анализировали в отношении экспрессии макрофагподобных факторов на клеточной поверхности после 8 суток в пермиссивной для макрофагов среде. На фигуре 21 обобщенно представлено распределение макрофагподобных маркеров CD (среднее значение + SD) на клетках HTS, где приблизительно 96% клеток были положительными по CD11b, 95% клеток были положительными по CD64, 61% клеток были положительными по CD86, 56% клеток были положительными по CD14 и 42% клеток были положительными по CD115. Учитывая, что некоторые из этих маркеров могут экспрессироваться на различных уровнях на гранулоцитах и дендритных клетках (DC), проводили дополнительное окрашивание на CD1a, CD83, CD15 и CD3 человека с использованием протокола, описанного в разделе 1.3.3. Наблюдали от небольшого (CD15) окрашивания до его отсутствия. Эти результаты показывают, что клетки HTS при переносе в пермиссивную для макрофагов среду приобретают поверхностные молекулы, важные для функций макрофагов, таких как адгезия (CD11b), рост (CD115, который является рецептором для M-CSF), фагоцитоз (CD86) и иммунный фагоцитоз (CD64, который является рецептором для IgG).

4.4.1.2 Функциональная характеризация макрофагов, образованных из HTS

Для оценки функциональных характеристик макрофаги, образованные из HTS, далее анализировали в отношении способности к фагоцитозу и продукции оксида азота (NO).

Способность к фагоцитозу оценивали проточной цитометрией по способности к фагоцитозу флуоресцентных микросфер (Molecular Probes). После 8 суток в пермиссивной для макрофагов среде клетки HTS инкубировали в количестве 1000000 клеток на мл в 24-луночных планшетах в течение 18 часов с 5 мкг/мл LPS (Sigma) и карбоксилированными 40-нм и 1000-нм полистироловыми микросферами с флуоресцентными фикоэритриновыми (PE) метками. Клетки собирали и инкубировали на льду в течение 45 минут с конъюгированными с FITC антителами против CD64 человека в холодном 2% (масс./об.) BSA/PBS, промывали два раза и анализировали проточной цитометрией. Оценивали двойные положительные клетки. На фигуре 22 представлен типичный профиль активности фагоцитоза в стимулированных в направлении макрофагов клетках HTS. Приблизительно 94% клеток проявляли способность к фагоцитозу небольших и крупных гранул.

Продукцию NO оценивали культивированием стимулированных в направлении макрофагов клеток HTS с 10 нг/мл LPS, 100 Е/мл интерферона-γ человека (IFN-γ) или обоих из них в 96-луночном планшете с плоским дном в количестве 200000 клеток на лунку в общем объеме 200 мкл. После стимуляции в течение ночи 50 мкл бесклеточного супернатанта инкубировали с 50 мкл реагента Griess (1% сульфаниламид, 0,1% нафтилендиаминдигидрохлорид, 2,5% H3PO4) при комнатной температуре в течение 5 минут и измеряли поглощение при 550 нм в устройстве для считывания планшетов. Концентрацию NO определяли с помощью линейно-регрессионного анализа стандартной кривой для нитрита натрия. Как показано на фигуре 23, после воздействия стимулирующей в направлении макрофагов среды клетки HST продуцировали оксид азота в ответ на стимуляцию с помощью LPS и IFN.

ПРИМЕР 5

5. Трансдифференцировка клеток HTS в различные клеточные фенотипы путем гибридизации с клетками зрелого фенотипа

Для дальнейшей демонстрации универсальности HTS и независимости от используемого механизма трансдифференцировки клетки HTS гибридизовали со зрелой эффекторной T- или B-клеткой. Ту же стратегию также можно использовать для трансдифференцировки клеток отличающегося фенотипа.

5.1 Трансдифференцировка клеток HTS в положительные по CD4 T-клетки гибридизацией с первичной CD54 + T-клеткой

B-клетки, происходящие из субпопуляций HTS, использовали для трансдифференцировки в CD54+ T-клетки путем электрической гибридизации клеток. В частности, в этом конкретном примере для трансдифференцировки использовали клетки, происходящие из HTS-KMW.5 (только CD19+ клетки), описанные в разделе 3.1.4, HTS-KBTAE.6 (только CD19+ клетки), описанные в разделе 3.2.3.3 и HTS-KBTDP.13 (CD20+CD72+ клетки), описанные в разделе 3.2.3.5. Первичные положительные по CD54 человека T-клетки, выделенные, как описано в разделе 1.3.8, использовали в качестве источника CD54+ T-клеток. Процедура гибридизации была по существу такой же, как использовали для создания соответствующей HTS (см. раздел 3.1.2). После того как полученные гибриды стали стабильными, их поддерживали в качестве клеточной линии в стандартных условиях культивирования (см. раздел 1.1) и анализировали в отношении экспрессии поверхностных маркеров, следуя протоколу, описанному в разделе 1.3.3. Все субпопуляции B-клеток, трансдифференцированные таким образом, утрачивают их CD19+ и становятся CD3+ клетками, на что указывает иллюстративный пример на фигуре 24A. Кроме того, их анализировали в отношении экспрессии CD54. В кратком изложении 1×105 клеток на аликвоты объемом 100 мкл метили антителом мыши против CD54 человека-FITC и антителом мыши против C3 человека-PE, следуя тому же протоколу, который описан в разделе 1.3.8 (выделение CD54+ T-клеток). Количество клеток, положительных по CD54, находилось в диапазоне от 42 до 85%, как представлено на фигуре 24(B).

5.2 Трансдифференцировка клеток HTS в положительные по CD19 B-клетки гибридизацией с первичными секретирующими Ig B-клетками

T-клетки, происходящие из следующих субпопуляций HTS, использовали для трансдифференцировки в клетки, секретирующие иммуноглобулин (Ig). Для этой цели использовали клетки HTS-KMW.6 (только CD4+ популяция), описанные в разделе 3.1.4, HTS-KBTAE.4 (только CD3+ популяция), описанные в разделе 3.2.3.3, HTS-KBTDP.4 (популяция CD4+CD8+), описанные в разделе 3.2.3.5. В качестве источника первичных секретирующих Ig B-клеток использовали первичные CD40-активированные положительные либо по IgM, либо по IgG, B-клетки, выделенные, как описано в разделе 1.4. Процедура электрической гибридизации клеток была по существу такой же, как процедура, использованная для создания соответствующей HTS, как описано в разделе 3.1.2. После того как полученные гибриды стали стабильными, их поддерживали и анализировали в отношении экспрессии CD19, CD40 и поверхностного Ig. Все субпопуляции HTS, трансдифференцированные таким путем, утрачивали их экспрессию T-клеточных маркеров (CD3, CD4, и CD8) и становились положительными по CD19, CD40 и sIg клетками. На фигуре 25 представлен типичный пример трансдифференцирующихся CD3+ HTS-KBTAE.4 клеток после гибридизации с CD40-активированными положительными по IgM B-клетками, демонстрирующими утрату экспрессии CD3 и приобретение поверхностного IgM.

Супернатанты B-трансдифференцированных T-клеточных культур анализировали в отношении присутствия IgM или IgG с помощью ELISA, описанного выше (см. раздел 1.4). Клетки высевали в круглодонные 96-луночные планшеты в количестве 1×105 клеток на лунку и культивировали в стандартных условиях в течение 24 часов. Результаты обобщенно представлены в таблице 8. Каждая величина приведена в качестве среднего значения ±SD для трех независимых измерений.

Таблица 8
Продукция IgM и IgG человека HTS-T-клетками после трансдифференцировки в B-клетки
Культура HTS Продукция IgM после гибридизации с продуцирующей IgM B-клеткой (нг/мл) Продукция IgG после гибридизации с продуцирующей IgG B-клеткой (нг/мл)
HTS-KMW.4 31±12,3 10±1,9
HTS-KBTAE.4 18±5,1 21±3,7
HTS-KBTDP.4 38±7,5 24±4,3

ПРИМЕР 6

6. Дедифференцировка зрелых B-лимфоцитов, происходящих из клеток HTS, под действием изменения условий окружающей среды

CD19+ клетки, происходящие из HTS-WTM.1 и HTS-WTM.7, и культивированные в стимулирующей B-лимфоидные клетки окружающей среде, как описано в разделе 4.3.1.1, продемонстрировали признак дедифференцировки в менее зрелые типы B-клеток при исследовании в отношении экспрессии других B-лимфоидных маркеров, особенно активации CD10 и подавления поверхностной экспрессии IgM (см. раздел 4.3.1.1). Для подтверждения того, что в этих культурах начался процесс дедифференцировки, клетки помещали в окружающую среду, стимулирующую гемопоэтические стволовые клетки, описанную в разделе 7.1 и после 5 суток в такой культуре их также проверяли в отношении присутствия транскрипта других ранних B-клеточных маркеров, таких как Pax-5, λ-like и CD34.

В кратком изложении, тотальную РНК получали из культивируемых клеток с использованием набора RNeasy kit (RNeasy Mini kit, Qiagen). Синтез кДНК проводили с помощью набора cDNA-Kit (Amersham Pharmacia) согласно протоколу изготовителя и ПЦР проводили, по существу как описано Sewing et al. Реакционную смесь для ПЦР анализировали с помощью агарозного (2%) гель-электрофореза и визуализировали окрашивание бромидом этидия. Олигонуклеотидные праймеры имели следующие последовательности: β2-микроглобулин человека: смысловой, 5'ACCCCCACTGAAAAAGATGA3' (SEQ ID NO: 1), и антисмысловой, 5'ATCTTCAAACCTCCATGATG3' (SEQ ID NO: 2), при 54°С

CD34: смысловой, 5'CTCTTCTGTCCAGTCACAGACC3' (SEQ ID NO: 3) и антисмысловой, 5'GAATAGCTCTGGTGGCTTGCAA3' (SEQ ID NO: 4) при 64°С;

CD10: смысловой, 5'CTGTGACAATGATCGCACTCTATG3' (SEQ ID NO: 5) и антисмысловой, 5'GATTCCAGTGCATTCATAGTAATCTC3' (SEQ ID NO: 6), при 65°С;

λ-like: смысловой, 5'ATGCATGCGGCCGCGGCATGTGTTTGGCAGC3'(SEQ ID NO: 7) и антисмысловой,

5'ATCCGCGGCCGCATCGATAGGTCACCGTCAAGATT3' (SEQ ID NO: 8) при 67°С;

Pax-5: смысловой, 5'GCAGGACAGGACATGGAGGA3' (SEQ ID NO: 9) и антисмысловой 5'ATCCTGTTGATGGAACTGACGC3' (SEQ ID NO: 10) при 64°С;

CD19: смысловой, 5'TCACCGTGGCAACCTGACCATG3' (SEQ ID NO: 11) и антисмысловой 5'GAGACAGCACGTTCCCGTTACTG3' (SEQ ID NO: 12) при 67°С;

VH-консенсусная-Cμ: смысловой, 5'GACACGGCCGTGTATTACTG3' (SEQ ID NO: 13) и антисмысловой, 5'ATCCGCGGCCGCGGAATTCTCACACAGGAGACGA3' (SEQ ID NO: 14) при 60°С;

Vk-консенсусная: смысловой, 5'ATGACCCAGTCTCCATCCTCCCTG3'(SEQ ID NO: 15) и антисмысловой, 5'ATGCGGCCGCGGGAAGATGAAGACAGATG3' (SEQ ID NO: 16) при 67°С.

На фигуре 26 показано, что культуры HTS-WTM в действительности продемонстрировали транскрипты раннего развития B-клеток, такие как Pax-5 и λ-like по сравнению с культурами HTS-KMW.1, которые не содержали такие транскрипты. Кроме того, CD34 также транскрибируется в культурах HTS-WTM.7. Этот результат отчетливо указывает на дедифференцировку зрелых CD19+ клеток в B-клетки ранней стадии в ответ на изменение условий окружающей среды.

ПРИМЕР 7

7. Дедифференцировка зрелых клеток различных фенотипов, происходящих из клеток HTS, посредством соматической гибридизации клеток

Чтобы далее продемонстрировать пластичность HTS, фенотипически отличающиеся субпопуляции, происходящие из различных культур HTS, подвергали дедифференцировке путем соматической гибридизации с первичными гемопоэтическим стволовыми клетками. CD34+ стволовые клетки костного мозга отбирали, как описано в разделе 1.2.2. По существу, использовали тот же протокол гибридизации соматических клеток, который описан в разделе 3.1.2.

7.1 Дедифференцировка B-клеток, трансдифференцированных из культур HTS

В этом конкретном примере использовали B-клетки, происходящие из культур KBTAE.6 и KMW.5, выращенные в стимулирующей B-лимфоидные клетки окружающей среде. Культуры были отобраны вследствие их чистоты, поскольку 100% клеток в обеих культурах были положительными по CD19+. Профиль экспрессии маркеров в этих культурах HTS после воздействия стимулирующей B-лимфоидные клетки окружающей среды обобщенно представлен в таблице 5 (см. раздел 4.3.1.1). KMW.5 соответствует случаю, где все три клетки, использованные для создания HTS, имели бессмертный фенотип, в то время как KBTAE.6 происходили из бессмертного миелоидного предшественника и первичных B- и T-лимфоцитов. После гибридизации со CD34+ стволовой клеткой, происходящей из костного мозга, культуры HTS выращивали в стандартной среде, дополненной IL-6 человека в концентрации 20 нг/мл, SCF человека в концентрации 300 нг/мл, лигандом fms-подобной тирозинкиназы 3 человека (hFLT3L) в концентрации 100 нг/мл, тромбопоэтином человека (hTPO) в концентрации 20 нг/мл и IL-3 человека в концентрации 60 нг/мл. После культивирования в течение 1 месяца клеточные популяции анализировали в отношении экспрессии ассоциированных с B-лимфоцитами маркеров, описанных в разделе 4.3.1.1, а также CD34 и CD130. Клетки метили теми же антителами мыши, которые описаны в разделе 1.2.2, а также антителом мыши против CD34 человека-PE и антителом мыши против CD130 человека-FITC с использованием того же протокола, который описан для выделения CD34+ клеток из костного мозга (см. раздел 1.2.). В таблице 9 обобщенно представлен профиль CD после инициации дедифференцировки.

Таблица 9
Фенотипический профиль клеток, дедифференцированных из B-лимфоцитов, происходящих
из культур HTS (%)
Культура HTS CD34+ CD38+ CD130+ CD19+ CD1c+ CD10+ CD20+ CD22+ CD40+ IgM IgG
KMW.5 95 100 100 10 11 83 0 0 0 8 0
KBTAE.6 67 100 100 30 29 54 0 0 0 24 0

В обеих культурах большинство клеток утрачивали их опознавательные маркеры B-клеточного ростка, такие как поверхностный Ig и CD19, при одновременном повышении экспрессии CD10 и приобретении CD34.

7.2 Дедифференцировка CD4 + T-клеток, трансдифференцированных из культур HTS

В этом конкретном примере использовали CD4+ T-клетки, происходящие из культуры KMW.6, выращенной в стимулирующей T-лимфоидные клетки окружающей среде. Культуры были отобраны по их чистоте, поскольку 100% всех клеток были положительными по CD4+. Профиль экспрессии маркеров в этой культуре HTS после воздействия стимулирующей T-лимфоидные клетки окружающей среды, обобщенно представлен в таблице 2 (см. раздел 4.1.1.1). После гибридизации с CD34+ стволовой клеткой, происходящей из костного мозга, культуры HTS выращивали в культуральной среде, дополненной различными цитокинами, стимулирующими рост гемопоэтических стволовых клеток (HSC) (см. раздел 7.1). После 1 месяца в окружающей среде HSC, клетки анализировали в отношении экспрессии маркеров, ассоциированных с CD4+ T-клетками, описанных в разделе 4.1.1.1, а также CD34 и CD130. В таблице 10 ниже представлен профиль экспрессии CD на поверхности дифференцированных CD4+ клеток.

Большинство клеток утрачивали экспрессию CD4 и TCR при одновременном увеличении экспрессии CD25 и приобретении экспрессии CD34.

7.3 Дедифференцировка CD8 + T-клеток, трансдифференцированных из культур HTS

В этом конкретном примере использовали CD8+ T-клетки, происходящее из культуры KBTDP.12, выращенной в стимулирующей T-лимфоидные клетки окружающей среде. Культуры были выбраны вследствие их чистоты, поскольку 100% всех клеток были положительными по CD8+. Профиль экспрессии маркеров в этой культуре HTS после воздействия стимулирующей T-лимфоидные клетки окружающей среды, обобщенно представлен в таблице 4 (см. раздел 4.2.1.1). После гибридизации со CD34+ стволовой клеткой, происходящей из костного мозга, культуру HTS выращивали в стандартной культуральной среде, дополненной различными цитокинами, стимулирующими рост гемопоэтических стволовых клеток (HSC) (см. раздел 7.1). После 1 месяца в окружающей среде HSC клетки анализировали в отношении экспрессии ассоциированных с CD8+ T-клетками маркеров, описанных в разделе 4.2.1.1, а также CD34 и CD130. В таблице 11 ниже представлен профиль экспрессии CD на поверхности дедифференцированных CD8+ клеток.

Практически все клетки утратили их экспрессию CD8 и TCR при одновременном приобретении экспрессии CD34.

Хотя изобретение описано с помощью конкретных примеров, специалистам в данной области будет понятно, что изобретение может быть осуществлено во множестве других форм, в соответствии с широкими принципами и сущностью изобретения, описанного в настоящем документе.

Ссылки:

Beug et al., Genes Dev 1:277-286, 1987.

Borzello et al., Mol. Cell Biol. 10:2703-2714, 1990.

Boyd et al., Nature 297:691-693, 1982.

DeKoter et al., Science 288: 146-149, 2000.

Frampton et al., EMBO J. 14: 2866-2875, 1995.

Golay et al., Cell 55: 1147-1158, 1987.

Graf et al. Cell 70:201-213, 1992.

Graf et al., Blood 99: 3089-3101, 2002.

Jackson et al., J Clin. Invest. 107: 1395-1402, 2001.

Kee et al., Curr. Opin. Immunol. 13: 180-185, 2001.

Kee et al., J. Exp. Med. 188: 699-713, 1998.

Klinken et al., Cell 53: 857-867, 1988.

Klinken et al., Cell 53: 857-867, 1988.

Kohler and Milstein, C. Nature, 256, 495-497, 1975.

Kondo et al., Nature 407: 383-386, 2000.

Krause et al., Cell 105: 369-377, 2001.

Kulessa et al., Genes Dev. 9: 1250-1262, 1995.

Lagasse et al., Nature Med. 6: 1229-1234, 2000.

Lee et al., J. Immunol. 166: 5964-5989, 2001.

Lindeman et al., Immunity 1: 517-527, 1994.

Mahaworasilpa, Cell Electro-Dynamics: The mechanics of living cells in intense alternating electric fields. PhD Thesis, University of New South Wales, Sydney, Australia, 1992.

Mahaworasilpa et al., Biochim. Biophys. Acta. 1193:118-126, 1994.

McIlroy et al., J. Virol. 69:4737-4745, 1995.

McNagny et al., J. Cell. Biol. 138:1395-14-7, 1997.

Montecino-Rodriguez et al., Nat. Immunol. 2: 83-88, 2001.

Neil, and Zimmermann, U Electro, Meth. Enzymol 220, 174, 1993.

Nutt et al., Nature 401: 556-562, 1999.

Orkin, Nature Rev. Genet.1: 57-64, 2000.

Orlic et al., Ann. NY Acad. Sci. 938:221-230, 2001.

Orlic et al., Nature 410: 701-705, 2001.

Pohl, Dielectrophoresis, Cambridge University Press, London 1978.

Rolink et al., Nature 401:556-562, 1999.

Romanow et al., Mol. Cell 5: 343-353, 2000.

Rossi et al., Curr Biol. 6: 866-872, 1988.

Rossi et al., EMBO J. 15: 1894-1901, 1996.

Sokolovsky M et al., Proc Natl. Acad. Sci. USA 95: 6573-6575, 1998.

Stoffel et al., Proc Natl. Acad. Sci. USA 96: 698-702, 1999.

Wojciezsyn et al., J. Cell. Biol. 96: 151-159, 1983.

Zimmermann, Biochim. Biophys. Acta. 694: 227-277, 1982.

1. Способ получения клетки с заданным фенотипом, где указанный способ включает стадии гибридизации:
первой клетки, где указанная первая клетка представляет собой стволовую клетку или клетку, происходящую из некоммитированной клетки-предшественника;
второй клетки, происходящей из общей лимфоидной клетки-предшественника; и
третьей клетки, происходящей из общей лимфоидной клетки-предшественника,
с получением гибридной клетки, которая проявляет фенотипическую пластичность, и воздействия на указанную гибридную клетку заданных условий окружающей среды, выбранных из группы, состоящей из тимической стромальной клетки, цитокина, фактора роста, иммуноглобулина, лиганда рецептора или их комбинации так, чтобы указанная гибридная клетка стала указанной клеткой с заданным фенотипом, где указанный заданный фенотип представляет собой В-клетку, Т-клетку, миелоидную клетку или дедифференцированный фенотип относительно указанной гибридной клетки.

2. Способ по п.1, где указанный дедифференцированный фенотип включает экспрессию по меньшей мере одного из CD34 или CD10 или Pax-5 или λ-like.

3. Способ по п.1 или п.2, где указанная вторая клетка представляет собой клетку, происходящую из В-лимфоидного ростка, и указанная третья клетка представляет собой клетку, происходящую из Т-лимфоидного ростка.

4. Способ по п.1, где указанная первая клетка представляет собой клетку, происходящую из общей миелоидной клетки-предшественника.

5. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой миеломоноцитарного предшественника, моноцит, макрофаг, эозинофил, нейтрофил, дендритную клетку или базофил.

6. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, экспонирует по меньшей мере один из следующих антигенов CD: CD16, CD15 или CD14.

7. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой моноцит.

8. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой первичного миеломоноцитарного предшественника.

9. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой иммортализованную клетку.

10. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, происходит из селезенки, периферической крови, пуповинной крови или костного мозга.

11. Способ по п.3, где указанная клетка, происходящая из В-лимфоидного ростка, представляет собой пре-В-клетку, незрелую В-клетку, наивную В-клетку, активированную В-клетку или эффекторную В-клетку.

12. Способ по п.11, где указанная эффекторная В-клетка представляет собой обученную антигеном В-клетку или плазматическую клетку.

13. Способ по п.3, где указанная клетка, происходящая из В-лимфоидного ростка, экспонирует по меньшей мере один из следующих антигеном CD: CD19, CD20, CD72 или CD5.

14. Способ по п.3, где указанная клетка, происходящая из Т-лимфоидного ростка, представляет собой пре-Т-клетку, незрелую Т-клетку, наивную Т-клетку, активированную Т-клетку или эффекторную Т-клетку.

15. Способ по п.3, где указанная клетка, происходящая из Т-лимфоидного ростка, экспонирует по меньшей мере один из следующих антигенов CD: CD3, CD4, CD5 или CD8.

16. Способ по п.3, где указанная клетка, происходящая из В-лимфоидного ростка, представляет собой иммортализованную клетку.

17. Способ по п.3, где указанная клетка, происходящая из Т-лимфоидного ростка, представляет собой иммортализованную клетку.

18. Способ по п.3, где указанная клетка, происходящая из В-лимфоидного ростка, происходит из лимфоидной ткани.

19. Способ по п.3, где указанная клетка, происходящая из Т-лимфоидного ростка, происходит из лимфоидной ткани.

20. Способ по п.18, где указанная лимфоидная ткань выбрана из периферической крови, пуповинной крови, селезенки, костного мозга, тимуса, миндалевидных желез, аденоидов и регионарного лимфатического узла.

21. Способ по п.1, где по меньшей мере одна из клеток представляет собой клетку человека.

22. Способ по п.1, где по меньшей мере одна из клеток представляет собой клетку мыши.

23. Способ по п.4, где указанная клетка, происходящая из общей миелоидной клетки-предшественника, представляет собой клетку К562.

24. Способ по п.1, где указанная вторая клетка или указанная третья клетка представляет собой клетку WIL2NS или клетку MOLT4.

25. Способ по п.3, где указанная клетка, происходящая из В-лимфоидного ростка, представляет собой клетку WIL2NS.

26. Способ по п.3, где указанная клетка, происходящая из указанного Т-лимфоидного ростка, представляет собой клетку MOLT4.

27. Способ по п.1, где указанная первая клетка представляет собой клетку К562, указанная вторая клетка представляет собой клетку WIL2NS, и указанная третья клетка представляет собой клетку MOLT4.

28. Способ по п.1, где указанная первая клетка представляет собой клетку К562, указанная вторая клетка представляет собой первичную В-клетку, и указанная третья клетка представляет собой первичную Т-клетку.

29. Способ по п.28, где указанная В-клетка и указанная Т-клетка экспрессируют CD5.

30. Способ по п.28, где указанная В-клетка экспрессирует CD20 и CD72 и указанная Т-клетка экспрессирует CD4 и CD8.

31. Способ по п.1, где указанная первая клетка представляет собой первичный моноцит человека, указанная вторая клетка представляет собой клетку WIL2NS, и указанная третья клетка представляет собой первичную Т-клетку.

32. Способ по п.1, где указанная первая клетка представляет собой первичного миеломоноцитарного предшественника человека, указанная вторая клетка представляет собой клетку WIL2NS, и указанная третья клетка представляет собой первичную Т-клетку человека.

33. Способ по п.1, где указанная первая клетка представляет собой клетку К562, указанная вторая клетка представляет собой клетку WIL2NS, и указанная третья клетка представляет собой первичную Т-клетку.

34. Способ по п.1, где указанная гибридная клетка, кроме того, гибридизована со стволовой клеткой.

35. Способ по п.1, где указанный цитокин или фактор роста выбран из группы, состоящей из IL-2, IL-4, IL-5, IL-6, IL-10, IL-1-бета, IL-7, IL-23, TGF-β, M-CSF, GM-CSF и IFN-γ.

36. Способ по п.1, где указанный иммуноглобулин выбран из группы, состоящей из антитела против IL-4, антитела против IFN-гамма и антитела против CD3/CD28.

37. Способ по п.1, где указанный лиганд рецептора представляет собой лиганд Flt3 или лиганд CD40.



 

Похожие патенты:

Изобретение относится к области биотехнологии и генной инженерии. Предложена трансгенная зародышевая клетка не являющегося человеком позвоночного.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложены варианты нуклеиновых кислот, каждый из которых кодирует аминокислотную последовательность тяжелой цепи иммуноглобулина IgG1.

Изобретение относится к области биохимии, в частности к полипептиду, несущему эпитоп BNP(1-32) человека, для получения лигандов, направленных против BNP(1-32) человека или proBNP(1-108) человека, где указанный полипептид имеет формулу a 1 − R 1 − X 1 − F G R K M D R − X 2 − R 2 − a 2 .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител (МКА) к V антигену Yersinia pestis. .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител (МКА) к V антигену Yersinia pestis. .

Изобретение относится к области медицины и может быть использовано при патоморфологической диагностике остеопороза по костным биоптатам. .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность.
Изобретение относится к биотехнологии и иммунологии и касается получения моноклональных антител (МкАт) к рекомбинантному эритропоэтину (ЭПО) человека с помощью гибридных культивируемых клеток (гибридом) животных.

Изобретение относится к области медицины, биотехнологии и генетической инженерии. Предложена тригибридная клетка для экспрессии белков, полученная путем гибридизации первой клетки, представляющей собой стволовую клетку или клетку, происходящую из некоммитированной клетки-предшественника, второй клетки, происходящей из общей лимфоидной клетки-предшественника, и третьей клетки, происходящей из общей лимфоидной клетки-предшественника, где указанная первая клетка не является клеткой миеломы, а также способ её получения и способ получения белков с её использованием. Благодаря увеличению стабильности белков, полученных с помощью данной тригибридной клетки, и увеличению эффективности продукции терапевтических белков изобретение применимо для экспрессии белков, пригодных при ряде диагностических, профилактических, терапевтических и/или исследовательских применений. 3 н. и 61 з.п. ф-лы, 62 ил., 9 табл., 12 пр.

Изобретение относится к области биохимии, в частности к композициям для интенсивной продукции целевого белка в эукариотических клетках, включающим ДНК-вектор со вставкой гена целевого белка и агонист клеточных рецепторов. Также изобретение относится к способам увеличения продукции целевого белка, кодируемого трансгеном, в эукариотических клетках с использованием вышеуказанных композиций. Изобретение позволяет эффективно увеличивать продукцию целевого белка в эукариотических клетках. 4 н. и 24 з.п. ф-лы, 4 ил., 7 табл., 10 пр.

Настоящее изобретение относится к биотехнологии и представляет собой α1,6-глюкан-содержащее соединение Helicobacter pylori. Настоящее изобретение также раскрывает конъюгат для индукции иммунного ответа против H.pylori, содержащий указанное соединение, конъюгированное с белком-носителем. Также настоящее изобретение раскрывает иммуногенную композицию, применение указанной композиции и способ индукции иммунного ответа против H.pylori с использованием указанной композиции. Настоящее изобретение раскрывает также иммунную антисыворотку для нейтрализации H.pylori у млекопитающего, которую получают путем иммунизации указанного млекопитающего иммуногенной композицией, содержащей указанную иммуногенную композицию. Настоящее изобретение раскрывает антитело, распознающее указанное α1,6-глюкан-содержащее соединение H.pylori, применение указанного антитела и способ индукции комплемент-опосредованного бактериолиза штаммов H.pylori, экспрессирующих α1,6-глюкан с использованием указанного антитела. Настоящее изобретение позволяет повысить эффективность иммуногенных композиций против H.pylori. 9 н. и 18 з.п. ф-лы, 8 ил., 21 табл., 11 пр.

Изобретение относится к области биохимии, в частности к антителу или его функциональному фрагменту, направленным против эпитопа стафилококка золотистого, а также к их применению для обнаружения стафилококка золотистого. Раскрыта линия клеток гибридомы, которая продуцирует вышеуказанное антитело, где линия клеток гибридомы является клеточной линией, хранящейся в DSMZ под инвентарным номером DSM АСС2987. Также изобретение относится к способу лечения или профилактики, который содержит введение вышеуказанного антитела или его функционального фрагмента человеку или животному, где лечение является лечением инфекции человека или животного, где инфекция вызвана стафилококком золотистым, и где профилактика является профилактикой такой инфекции, вызванной стафилококком золотистым. Изобретение позволяет эффективно лечить инфекцию человека, вызванную стафилококком золотистым. 4 н. и 16 з.п. ф-лы, 7 ил., 1 табл.

Изобретение относится к биотехнологии и касается штамма клеток CHO-IL7/13. Охарактеризованный штамм получен трансфекцией клеток CHOdhfr плазмидой pIPvES-DHFR/IL7, содержащей ген интерлейкина-7 человека. Плазмида pIPvES-DHFR/IL7 была синтезирована амплифицированием кДНК интерлейкина-7 человека с помощью праймеров: ecoIL CCTGAATTCCACCATGTTCCATGTTTCTTTTAG, содержащего сайт рестрикции EcoRI и последовательность Козак, и bamIL CCAGGATCCTCAGTGTTCTTTAGTGCCCATC, содержащего сайт рестрикции BamHI, с последующим клонированием по данным сайтам рестрикции в вектор pIRES-DHFR. Предложенный штамм обладает более высокой продуцирующей способностью рекомбинантного интерлейкина-7 человека и может быть использован для лечения ряда патологических состояний, связанных с низким содержанием В- и Т-лимфоцитов. 4 ил., 3 пр.

Изобретение относится к области биохимии. Заявлен штамм гибридных клеток животных Mus. musculus 3F11 - продуцент моноклональных антител к ботулиническому токсину типа В. Штамм депонирован в государственную коллекцию патогенных микроорганизмов и клеточных культур федерального бюджетного учреждения науки государственного научного центра прикладной микробиологии и биотехнологии (ФБУН ГНЦ МПБ), коллекционный номер - Н-45. Изобретение позволяет получить высокоспецифичные моноклональные антитела к ботулиническому нейротоксину типа В, пригодные для конструирования на их основе тест-систем для выявления возбудителя ботулизма. 6 ил., 2 табл., 8 пр.

Изобретение относится к области биохимии. Заявлен штамм гибридных клеток животных Mus musculus 1G7 - продуцент моноклональных антител к ботулиническому токсину типа В. Штамм депонирован в государственную коллекцию патогенных микроорганизмов и клеточных культур федерального бюджетного учреждения науки государственного научного центра прикладной микробиологии и биотехнологии (ФБУН ГНЦ МПБ), коллекционный номер - Н-46. Изобретение позволяет получить высокоспецифичные моноклональные антитела к ботулиническому нейротоксину типа В, пригодные для конструирования на их основе тест-систем для выявления возбудителя ботулизма. 6 ил., 2 табл., 8 пр.
Наверх