Рекомбинантная плазмидная днк pet40cmap/mbl-t, кодирующая гибридный бифункциональный полипептид cmap/mbl-t со свойствами высокоактивной щелочной фосфатазы cmap и маннан-связывающего лектина с-типа mbl-t, рекомбинантный штамм e.coli rosetta(de3)/pet40cmap/mbl-t - продуцент гибридного бифункционального полипептида cmap/mbl-t и способ его получения



Рекомбинантная плазмидная днк pet40cmap/mbl-t, кодирующая гибридный бифункциональный полипептид cmap/mbl-t со свойствами высокоактивной щелочной фосфатазы cmap и маннан-связывающего лектина с-типа mbl-t, рекомбинантный штамм e.coli rosetta(de3)/pet40cmap/mbl-t - продуцент гибридного бифункционального полипептида cmap/mbl-t и способ его получения
Рекомбинантная плазмидная днк pet40cmap/mbl-t, кодирующая гибридный бифункциональный полипептид cmap/mbl-t со свойствами высокоактивной щелочной фосфатазы cmap и маннан-связывающего лектина с-типа mbl-t, рекомбинантный штамм e.coli rosetta(de3)/pet40cmap/mbl-t - продуцент гибридного бифункционального полипептида cmap/mbl-t и способ его получения
Рекомбинантная плазмидная днк pet40cmap/mbl-t, кодирующая гибридный бифункциональный полипептид cmap/mbl-t со свойствами высокоактивной щелочной фосфатазы cmap и маннан-связывающего лектина с-типа mbl-t, рекомбинантный штамм e.coli rosetta(de3)/pet40cmap/mbl-t - продуцент гибридного бифункционального полипептида cmap/mbl-t и способ его получения
Рекомбинантная плазмидная днк pet40cmap/mbl-t, кодирующая гибридный бифункциональный полипептид cmap/mbl-t со свойствами высокоактивной щелочной фосфатазы cmap и маннан-связывающего лектина с-типа mbl-t, рекомбинантный штамм e.coli rosetta(de3)/pet40cmap/mbl-t - продуцент гибридного бифункционального полипептида cmap/mbl-t и способ его получения
Рекомбинантная плазмидная днк pet40cmap/mbl-t, кодирующая гибридный бифункциональный полипептид cmap/mbl-t со свойствами высокоактивной щелочной фосфатазы cmap и маннан-связывающего лектина с-типа mbl-t, рекомбинантный штамм e.coli rosetta(de3)/pet40cmap/mbl-t - продуцент гибридного бифункционального полипептида cmap/mbl-t и способ его получения

 


Владельцы патента RU 2538169:

Федеральное государственное бюджетное учреждение науки Тихоокеанский институт биоорганической химии им. Г.Б. Елякова Дальневосточного отделения Российской академии наук (ТИБОХ ДВО РАН) (RU)

Изобретение относится к биотехнологии и представляет собой плазмиду pET40CmAP/MBL-T, определяющую синтез гибридного бифункционального полипептида CmAP/MBL-T со свойствами высокоактивной щелочной фосфатазы морской бактерии Cobetia marina (CmAP) и маннан-связывающего лектина С-типа дальневосточного трепанга Apostichopus japonicus (MBL-T). Плазмида включает NcoI/SalI - фрагмент плазмиды рЕТ-40b(+) (Novagen) и фрагмент ДНК размером 2034 пар оснований, который является химерным геном, кодирующим структурные гены щелочной фосфатазы CmAP и маннан-связывающего лектина С-типа MBL-T, соединенных между собой полинуклеотидом, кодирующим аминокислотную последовательность линкера (G)4S(G)4S(G)4SEL. Описан рекомбинантный штамм E.coli Rosetta(DE3)/pET40CmAP/MBL-T, трансформированный указанной плазмидой, - продуцент гибридного бифункционального белка CmAP/MBL-T. Предложен также способ получения гибридного бифункционального белка CmAP/MBL-T c использованием заявленного штамма. Изобретение позволяет получать высокоочищенный препарат гибридного белка CmAP/MBL-T со свойствами рекомбинантной высокоактивной щелочной фосфатазы CmAP и высокоспецифичного маннан-связывающего лектина С-типа MBL-T по отношению к углеводным компонентам гликопротеинов раковых клеток шейки матки и может быть использован для высокочувствительного лектин-иммунноферментного метода ранней дифференциальной диагностики рака шейки матки.3 н.п. ф-лы, 2 ил., 3 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии, и позволяет получать микробиологическим синтезом по оптимизированной технологии новый гибридный бифункциональный полипептид CmAP/MBL-T со свойствами высокоактивной щелочной фосфатазы морской бактерии и высокоспецифичного к цервикальным онкомаркерам маннан-связывающего лектина С-типа дальневосточного трепанга, который может быть использован для ранней дифференциальной диагностики рака шейки матки, а также для исследования механизмов канцерогенеза в практической онкологии.

Данные об углеводной специфичности пектинов и их способности выявлять углеводные детерминанты в составе гликоконъюгатов опухолевых клеток, особенно метастазирующих, нашли широкое применение в онкологии. Лектины используются как инструмент исследования перерождения нормальных клеток в злокачественные [1-3]. Полученная информация, в свою очередь, является составной частью изучения механизма канцерогенеза. Наиболее интересными с этой точки зрения являются пектины с высоконаправленной углеводной специфичностью. Нами было показано, что к числу таких пектинов относится маннан-связывающий лектин С-типа дальневосточного трепанга Apostichopus japonicus (MBL-T) [4]. Лектин MBL-T не взаимодействует с компонентами сыворотки крови здорового человека, что является крайне важным при использовании в различных диагностических исследованиях, в частности, с применением методов иммуноцитохимии, что позволяет избежать ложно-положительных результатов и получать достоверную информацию о структурных изменениях углеводных цепей гликоконъюгатов, сопровождающих патологические изменения. Результаты исследований углеводного профиля гликоконъюгатов пектинами находят практическое применение при разработке методов диагностики рака [5-7].

Использование пектинов для диагностики рака реализуется по двум основным направлениям. Первое направление осуществляется при выявлении пектинами углеводных детерминант исследуемых маркеров в сыворотке крови на твердой фазе или в геле (лектин-ферментные, лектин-иммуноферментные, лектин-иммунные методы), и второе направление заключается во взаимодействии лектинов с соответствующими лигандами, экспрессированными на поверхности клеток, получаемых путем смывов, выделением из крови, а также на срезах биопсийного материала.

Классическим примером перспективности использования лектинов в диагностике служит коммерческий набор японской фирмы WAKO, позволяющий проводить раннюю и дифференциальную диагностику рака печени, цирроза печени и беременности. В основе метода заложена способность лектинов LCA-A (Lens culinaris agglutinin A - лектин, выделенный из бобов чечевицы) и РНА-Е4 (phaseolus vulgaris isolectin E-4 - лектин, выделенный из бобов фасоли обыкновенной) выявлять углеводные изоформы альфа-фетопротеинов (АФП) в сыворотке крови. Метод обладает высокой чувствительностью и информативен даже при концентрации АФП 5 нг/мл. Объем исследуемого образца - 3 мкл, срок проведения анализа - 3 часа, количество одновременно анализируемых проб - 10. Метод позволяет за 2-3 месяца до появления первых клинических симптомов выявлять рецидивы роста опухоли вследствие его высокой чувствительности.

Уникальность углеводной специфичности лектина дальневосточного трепанга MBL-T и перспективность его использования как диагностического маркера подтверждается результатами экспериментов по взаимодействию с раковоэмбриональными антигенами. Лектин трепанга показал способность взаимодействовать с такими маркерами опухолевого роста, как альфа-фетопротеин, раковоэмбриональный антиген, эмбриональный альфа-1-кислый гликопротеин, эмбриональный альфа-2-глобулин.

На основе наличия у лектина MBL-T уникального углевод-распознающего домена, определяющего его способность распознавать микрогетерогенность гликоконъюгатов раковых и нормальных клеток, заявителем разработан новый метод диагностики рака шейки матки [8].

Определение концентрации пектин-связанных структур в эпителиальном секрете является принципиально новым подходом при выявлении злокачественных новообразований. Однако и такой анализ требует повышения эффективности наряду с простотой выполнения метода. Это возможно при использовании методов генной инженерии. Методами молекулярного клонирования установлена структура лектина дальневосточного трепанга MBL-T [GenBank, код доступа ААТ42221] и щелочной фосфатазы морской бактерии CmAP [GenBank, код доступа ABD92772]. Известен 3 способ получения высокоактивной рекомбинантной щелочной фосфатазы морской бактерии CmAP [9].

Задача изобретения - конструирование рекомбинантного штамма-продуцента Escherichia coli, несущего такую экспрессирующую конструкцию (плазмиду), которая позволит нарабатывать целевой высокоочищенный недеградированный гибридный бифункциональный полипептид CmAP/MBL-T в препаративных количествах, при сохранении как иммуногенных свойств высокоспецифичного лектина дальневосточного трепанга MBL-T, так и ферментативных свойств высокоактивной щелочной фосфатазы морской бактерии CmAP, используемой для цветной визуализации лектин-связанных комплексов в лектин-иммуноферментном методе ранней диагностики рака шейки матки.

Поставленная задача решена путем конструирования рекомбинантной плазмидной ДНК pET40CmAP/MBL-T, кодирующей химерный полипептид CmAP/MBL-Т, и рекомбинантного штамма E.coli Rosetta(DE3)/pET40CmAP/MBL-T, обеспечивающие индуцируемый синтез с высоким и стабильным выходом активного растворимого бифункционального белка CmAP/MBL-T, обладающего свойствами высокоактивной щелочной фосфатазы морской бактерии CmAP и высокочувствительного маннан-связывающего лектина С-типа дальневосточного трепанга MBL-T.

Технический результат заявленного изобретения - получение активного гибридного бифункционального полипептида CmAP/MBL-T со свойствами высокоактивной щелочной фосфатазы CmAP и высокочувствительного маннан-связывающего лектина С-типа дальневосточного трепанга MBL-T с высоким выходом и уровнем очистки.

Плазмида pET40CmAP/MBL-T имеет 8194 пар оснований (п.о.) и характеризуется наличием NcoI/SalI-фрагмента плазмиды pET-40b(+) (Novagen) и последовательности фрагмента ДНК размером 2034 п.о., содержащего химерный ген, начинающий трансляцию со щелочной фосфатазы CmAP (N-конец) и заканчивающийся маннан-связывающим лектином С-типа MBL-T с С-концевой части молекулы рекомбинантного белка, соединенным со щелочной фосфатазой гибким линкером (G)4S(G)4S(G)4SEL.

На фигуре 1 представлена физическая карта плазмиды pET40CmAP/MBL-T и область плазмиды, ответственная за экспрессию гибридного белка CmAP/MBL-T. Нуклеотидная последовательность фрагмента плазмиды pET40CmAP/MBL-T, фланкированная сайтами NcoI и SalI, содержит последовательность структурного гена CwAP, соответствующую открытой рамке считывания для белка СтАР, последовательность соединяющего линкера (G)4S(G)4S(G)4SEL и последовательность структурного гена MBL-Т, соответствующую открытой рамке считывания для белка MBL-T (SEQ ID N1).

Рекомбинантный штамм E.coli Rosetta(DE3)/pET40CmAP/MBL-T получен трансформацией клеток E.coli Rosetta(DE3) (Novagen) плазмидой pET40CwAP/MBL-T с использованием традиционной генно-инженерной технологии [10].

Рекомбинантный штамм E.coli Rosetta(DE3)/pET40CmAP/MBL-T характеризуется следующими признаками.

Культурально-морфологические признаки.

Клетки штамма образуют крупные круглые с ровными краями, выпуклые колонии до 5 мм в диаметре, поверхность колоний гладкая, консистенция слизистая. Пигмент не накапливается. Грамотрицательны, спор не образуют, капсулы не имеют. Колонии хорошо растут на простых питательных средах (LB). При росте в жидких средах образуют интенсивную ровную муть.

Физико-биологические признаки.

Рекомбинантный штамм E.coli Rosetta(DE3)/pET40CmAP/MBL-T видотипичен по своим биохимическим свойствам. Штамм не обладает желатиназной активностью, не ферментирует лизин; расщепляет глюкозу, лактозу, маннит, сахарозу до кислоты и газа. Имеет мутацию в гене lac, обеспечивающую контроль уровня экспрессии, а также трансляцию редких кодонов. Оптимальной для роста является температура 37°С, а для продукции белка CmAP/MBL-T -16°С.

Устойчивость к антибиотикам.

Клетки штамма характеризуются устойчивостью к хлорамфениколу (34 мкг/мл) и канамицину (25 мкг/мл).

Патогенность и токсичность.

Рекомбинантный штамм E.coli Rosetta(DE3)/pET400CmAP/MBL-T не патогенен и не токсичен для теплокровных животных.

Штамм хранится обычным способом в суспензии с глицерином (30%) при -20°С.

Заявляемый способ получения гибридного бифункционального белка CmAP/MBL-T заключается в культивировании клеток штамма E.coli Rosetta(DE3)/pET40CmAP/MBL-T в жидкой питательной среде LB в течение 12 ч при 16°С, затем бактериальные клетки осаждают центрифугированием, суспензию клеток дезинтегрируют в буфере, далее экстракт центрифугируют, затем надосадочную жидкость помещают на колонку с ионообменной смолой, далее элюируют белок, затем белковый элюат помещают на колонку с металлоаффинной смолой, далее активные фракции концентрируют на ионообменной смоле и выделяют целевой продукт гель-фильтрацией.

Выход рекомбинантного гибридного бифункционального белка CmAP/MBL-T в результате применения описанного способа составляет не менее 10 мг рекомбинантного белка с 1 л культуры с удельной активностью щелочной фосфатазы не менее 10000 ед/мг белка и иммуногенными свойствами маннан-связывающего лектина С-типа, характерными для природного аналога MBL-T [4, 8].

Рекомбинантный гибридный бифункциональный белок CmAP/MBL-T имеет молекулярную массу 105,5 кДа, включая плазмидный шаперон DsbC с молекулярной массой 32,5 кДа, широкий диапазон значений температуры (25-37°С) и рН (7,5-9,5) для проявления фосфатазной активности и аффинных свойств лектина в присутствии 2 мМ ионов Са2+. Плазмидный шаперон Dsb не дает существенного вклада в функциональную способность обоих частей химеры CmAP/MBL-T, поэтому этап его удаления из рекомбинантного белка с помощью энтерокиназы по предусмотренному генетической конструкцией сайту рестрикции не обязателен.

Рекомбинантный гибридный бифункциональный полипептид CmAP/MBL-T успешно использован в доклинических испытаниях способности связывания лектинового компонента химеры с муцином, раковоэмбриональным антигеном (РЭА), а также другими онкомаркерами методом лектин-иммуноферментного анализа. Использование маннан-связывающего лектина в составе гибридного бифункционального полипептида CmAP/MBL-T с активностью щелочной фосфатазы позволяет сократить стадии и время иммуноферментного анализа, которые раньше требовались для получения конъюгатов лектина и фермента.

На фиг.2 представлены результаты иммуно-ферментного анализа (ИФА), проведенного на микропланшете, сенсибилизированном муцином, с применением гибридного бифункционального полипептида CmAP/MBL-T, полученного от разных колоний трансгенного штамма E.coli Rosetta(DE3)/pET40 CmAP/MBL-T. Уровень аффинности рекомбинантного гибридного бифункционального полипептида CmAP/MBL-T определяли по концентрации пектин-связанных комплексов с муцином (по оси X). Визуализацию лектин-связанных комплексов осуществляли методом измерения фосфатазной активности рекомбинантного гибридного бифункционального полипептида CmAP/MBL-T (по оси Y).

Существенными преимуществами заявляемого способа получения гибридного бифункционального полипептида CmAP/MBL-T являются:

использование рекомбинантного штамма-продуцента E.coli Rosetta(DE3)/pET40CmAP/MBL-T, что позволяет получать при биосинтезе большое количество высокоактивного бифункционального гибридного белка CmAP/MBL-T;

использование несложной трехстадийной хроматографической очистки рекомбинантного белка, что позволяет получить чистый гибридный полипептид CmAP/MBL-T за короткое время и с малыми потерями.

Способ получения функционально-активного гибридного полипептида CmAP/MBL-T на основе использования химерного гена, кодирующего щелочную фосфатазу морской бактерии CmAP и маннан-связывающий лектин С-типа дальневосточного трепанга MBL-T, иллюстрируется следующими примерами.

Пример 1. Конструирование плазмиды pET40CmAP/MBL-T.

Рекомбинантную плазмиду pET40CmAP/MBL-T, содержащую химерный ген, кодирующий полноразмерную щелочную фосфатазу CmAP и полноразмерный маннан-связывающий лектин С-типа MBL-T, соединяющиеся через гибкий линкер (G)4S(G)4S(G)4SEL, фланкированный сайтами рестрикции NcoI и SalI, конструируют на основе коммерческой плазмиды pET-40b(+) (Novagen).

Фрагмент ДНК, содержащий химерный ген гибридного полипептида CwAP/MBL-Т, получают в два этапа. На первом этапе проводят полимеразную цепную реакцию с использованием плазмиды 40Pho в качестве матрицы для получения гена щелочной фосфатазы СтАР и праймеров X-PhoN_F и Pho40X-SacI-R, где X-PhoN_F - праймер, специфичный по отношению к N-концевой последовательности CmAP, включающий сайт для рестриктазы NcoI; Pho40X-SacI-R - обратный праймер, специфичный по отношению к С-концевой последовательности CmAP, включающий полинуклеотид, кодирующий линкер (G)4S(G)4S(G)4SEL и сайт рестрикции SacI:

X-PhoN_F: 5'-TATTCCATGGCAGAGATCAAGAATGTCATTCTGAT-3'

Pho40X-SacI-R: -5'-TTAAGAGCTCAGAACCACCACCACCAGAACCACCACCACCAGAACCACCACCACC CTTCGCTACCACTGTCTTCAGATACTGTCCT-3'.

Данную реакцию проводят в следующих условиях: 10х Encycio буфер, 50х смесь полимераз Encyclo («Encyclo PCR kit», Евроген, Москва), 50х смесь dNTP (10 mM каждого), смесь праймеров (5 µМ каждого), 20 нг ДНК. Процесс амплификации состоит из следующих стадий: 30 циклов ПЦР (15 с - 95°С, 1 мин 30 с - 72°С) и инкубация 10 мин при 72°С. После амплификации ПЦР-продукт очищают электрофоретически в 1% агарозном геле. Фрагмент (1 мкг) обрабатывают рестриктазами NcoI и SacI в оптимальном буфере (Fermentas) в течение 3 часов, затем ферменты удаляют из реакционной среды по стандартной методике фенолом (1:1) [10]. В водную фракцию, содержащую фрагмент, добавляют 1/10 объема 0,3 М ацетата Na, pH 5,2 и 1/2 объема изопропанолового спирта и оставляют на -20°С в течение 30 мин. Затем центрифугируют при 14000 об/мин в течение 20 мин, осадок промывают 75% этанолом и высушивают при комнатной температуре. Осадок растворяют в 20 мкл деионизованной воды.

2 мкг плазмидной ДНК рЕТ-40b(+) обрабатывают рестриктазами NcoI и SacI в соответствии с методикой, описанной выше, и из полученного гидролизата выделяют векторную часть плазмиды в 1% геле легкоплавкой агарозы.

Полученный фрагмент гена CmAP и векторную часть плазмиды рЕТ-40b(+) сшивают при помощи лигазной реакции в 50 мкл буфера для лигирования согласно инструкции (Fermentas). 10 мкл реакционной смеси используют для трансформации компетентных клеток E.coli Rosetta(DE3). Трансформанты высевают на LB-агар, содержащий 25 мкг/мл канамицина. После инкубирования в течение 16 ч при 37°С клоны отсевают, выделяют плазмидную ДНК и анализируют на наличие мутаций при помощи автоматического секвенирования. Отбирают плазмидную ДНК pET40CmAP, содержащую последовательность CmAP с линкером (G)4S(G)4S(G)4SEL на С-концевой части.

На втором этапе проводят амплификацию гена MBL-T с использованием к-ДНК дальневосточного трепанга и пары праймеров Lect-X-dir и Lect-X-rev, несущими сайты для рестриктаз SacI и SalI:

Lect-X-dir: 5'-AGCTGAGCTCTGTCTGACGGCTTGTCCGGAGTTTTG-3

Lect-X-rev: 5'-CAGTGTCGACCTCCAAATGATACTCGATACAGGGAAG-3'

Для создания конструкции pET40CmAP/MBL-T полученный ген маннан-связывающего пектина С-типа MBL-T и 2 мкг плазмидной ДНК pET40CmAP обрабатывают рестриктазами SacI и SalI в соответствии с методикой, описанной выше, и очищают в 1% геле легкоплавкой агарозы. Очищенные ПЦР-фрагменты MBL-T и векторную часть плазмиды pET40CmAP сшивают при помощи лигазной реакции в 50 мкл буфера для лигирования согласно инструкции (Fermentas). 10 мкл реакционной смеси используют для трансформации компетентных клеток E.coli Rosetta(DE3). Трансформанты высевают на LB-агар, содержащий 25 мкг/мл канамицина. После инкубирования в течение 16 ч при 37°С клоны отсевают, выделяют плазмидную ДНК и анализируют на наличие мутаций при помощи автоматического секвенирования. Отбирают ДНК, содержащую необходимые последовательности генов CmAP и MBL-T, представляющую собой плазмиду pET40CmAP/MBL-T размером 8194 п.о. (фиг.1).

Пример 2. Получение рекомбинантного штамма E.coli Rosetta(DE3)/pET40CmAP/MBL-T - продуцента гибридного бифункционального полипептида CmAP/MBL-T.

Рекомбинантный штамм-продуцент E.coli Rosetta(DE3)/pET40CmAP/MBL-T получают путем трансформации клеток штамма E.coli Rosetta(DE3) рекомбинантной плазмидой pET40CmAP/MBL-T. Ночную культуру (0,5 мл LB) рекомбинантного штамма-продуцента гибридного бифункционального полипептида CmAP/MBL-T выращивают в литровой колбе в жидкой среде LB, содержащей на литр 10 г бакто-триптона, 5 г бакто-дрожжевого экстракта и 10 г NaCl, 25 мг/мл канамицина, рН 7,7, на шейкере при 200 об/мин при температуре 37°С в течение 2 часов до оптической плотности 0,6-0,8 (OD600), затем добавляют индуктор экспрессии IPTG до конечной концентрации 0,2 мМ и инкубируют далее при 16°С в течение 12 часов.

Для определения продуктивности штамма клеточные водные экстракты анализируют электрофорезом в 12,5% полиакриламидном геле с додецилсульфатом натрия. Гель окрашивают Кумасси R-250 по стандартной методике и определяют относительное количество белка в полосе целевого продукта. Содержание рекомбинантного белка в растворимой клеточной фракции составляет не менее 30% от всех белков этой фракции.

Пример 3. Выделение и характеристика гибридного бифункционального полипептида CmAP/MBL-T.

Рекомбинантный штамм-продуцент гибридного бифункционального полипептида CmAP/MBL-T - E.coli Rosetta(DE3)/pET40CmAP/MBL-T инкубируют в литровой колбе в жидкой среде LB, содержащей на литр 10 г бакто-триптона, 5 г бакто-дрожжевого экстракта и 10 г NaCl, 0,5 мМ IPTG, 25 мг/мл канамицина, рН 7,7, на шейкере при 200 об/мин в течение 12 часов при 16°С. Бактериальные клетки осаждают на проточной центрифуге при 5000 об/мин в течение 10 мин. Суспензию клеток дезинтегрируют в 20 мл буфера А (0,05 М трис-HCl, рН 8,6, 0.01% NaN3) в течение 5×30 с, охлаждая во льду. Затем центрифугируют при 10000 об/мин в течение 30 мин. Надосадочную жидкость собирают и помещают на колонку с ДЕАЕ-52-целлюлозой (Whatman). Элюцию белка проводят градиентом концентрации NaCl (0,05 М-0,380 М) в буфере А. Активные фракции собирают и помещают на колонку с металлоаффинной смолой (Qiagen), предварительно уравновешенную буфером А. Элюцию белка проводят буфером В (50 мМ Tris-HCl, рН 8,6, 50 мМ EDTA, 0,01% NaN3). Активные фракции собирают, обессоливают и концентрируют на колонке с ДЕАЕ-Toyopearl 650М (Тоуо Soda), затем инкубируют с энтерокиназой (Invitrogen) при комнатной температуре в течение 12 часов. Затем раствор белка наносят на колонку для гель-фильтрации с Superdex 200 (Sigma). Выход рекомбинантного белка составляет 10 мг с 1 литра культуры.

Полученный рекомбинантный полипептид определяют по первым 10 аминокислотам на автоматическом секвенаторе. Проведенное секвенирование препарата рекомбинантного белка, выделенного из клеток штамма E.coli Rosetta(DE3)/pET40CmAP/MBL-T, выявило аминокислотную последовательность А1а-Glu-Ile-Lys-Asn-Val-Ile-Leu-Met-Ile, соответствующую первым 10 аминокислотам щелочной фосфатазы CmAP, являющейся N-концевой составляющей химерного белка CmAP/MBL-T.

Ферментативную функциональность гибридного полипептида CmAP/MBL-T проверяют по активности щелочной фосфатазы, которую определяют по расщеплению паранитрофенилфосфата (п-НФФ). Стандартная инкубационная смесь в объеме 500 мкл содержит 15 мМ п-НФФ, 1 М диэтаноламина (ДЭА), рН 10,3 и фермент либо 2 мМ п-НФФ, 0,1 М трис-HCl, 0.2 М KCl, рН 9,5-10,0. После 30 мин инкубации при 37°С реакцию останавливают добавлением 2 мл 0,5 М NaOH. Количество образовавшегося в процессе ферментативной реакции п-нитрофенола (п-НФ) определяют спектрофотометрически при 400 нм. За единицу активности щелочной фосфатазы принимают количество фермента, катализирующего освобождение 1 мкМ п-НФ (ε400 нм = 18600) в течение 1 мин инкубации. Удельную активность выражают в единицах активности фермента на 1 мг белка. Концентрацию белка в растворе определяют по методу Брэдфорда.

Лектинную функциональность гибридного полипептида CmAP/MBL-T проверяют по уровню аффинности к муцину. На сенсибилизированный муцином полистирольный микропланшет вносят раствор (0,0015-0,1 мг/мл) гибридного полипептида CmAP/MBL-T и инкубируют 1,5 часа при комнатной температуре. Лектин-связанные комплексы отмывают буфером 10 мм трис-HCl, рН 9,0, 0,15 М NaCl, 0,05% Тритон Х-100, 20 мМ CaCl2 по 200 мкл в каждую лунку не менее 10 раз. Затем в лунки микропланшета добавляют буфер для активности щелочной фосфатазы с субстратом, как описано выше, для визуализации связавшихся комплексов (фиг.2).

Полученные данные по характеристике и функциональной активности продукта экспрессии искусственного химерного гена гибридного бифункционального полипептида CmAP/MBL-T в клетках рекомбинантного штамма E.coli Rosetta(DE3)/pET40CmAP/MBL-T свидетельствуют о соответствии исследуемого полипептида его природному аналогу - пектину MBL-T, применяемому в лектин-иммуноферментном методе ранней дифференциальной диагностики рака шейки матки [8].

Как следует из приведенных примеров, заявляемая группа изобретений позволяет получать активный рекомбинантный гибридный бифункциональный полипептид CmAP/MBL-T со свойствами высокоактивной щелочной фосфатазы морской бактерии CmAP и высокоспецифичного маннан-связывающего лектина дальневосточного трепанга С-типа MBL-T с высоким выходом при относительно простой и надежной технологии.

Заявленное изобретение позволяет:

- с помощью использования рекомбинантного штамма-продуцента E.coli Rosetta(DE3)/pET40CmAP/MBL-T получать путем биосинтеза большое количество активного гибридного бифункционального полипептида CmAP/MBL-T;

- использование ионообменной, металлоаффинной и гель-фильтрационной хроматографий при очистке рекомбинантного белка из водного экстракта клеток рекомбинантного штамма-продуцента позволяет получать гибридный бифункциональный полипептид CmAP/MBL-T с чистотой более 98% в качестве аналога маннан-связывающего лектина С-типа MBL-T, конъюгированного с ферментом, применяемого для проведения иммуноферментного анализа.

Литература

1. Чиссов В.И., Старинский В.В., Сотникова Е.Н. Ранняя диагностика онкологических заболеваний. М.: 1994. С.193.

2. Davina J.H.М., Stadhouders А.М., van Haelst U.J.G.М., Lamers G.E.М., Kenemans P. Concanavalin A Peroxidase labeling in cervical exfoliative cytopathology. Gynecologic Oncology, 1985. - Vol.22. - I.2. - P.212-223.

3. Reddi A. L., Sankaranarayanan K., Arulraj H. S., Devaraj N., Devaraj Enzime-linked PNA lectin-binding assay of serum T-antigen in patient with SCC of the uterine cervix. Cancer letters - 2000. - Vol.149, - P.207-211.

4. A.A. Bulgakov, M.G. Eliseikina, I.Yu. Petrova, E.L. Nazarenko, S.N. Kovalchuk Isolation and properties of a mannan-bind ing lectin from the holothurian Apostichopus japonicus. Glycobiology 2007, V.17, №12, P.1284-1298.

5. Aoyagi Y., Suzuki Y., Isemura М., Nomoto М., Sekini C., Igarashi K., Ichida F. The fucosylation of alfa-fetoprotein and its usefulness in the early diagnosis of hepatocellular carcinoma. Cancer, 1988. - Vol.61. - N.4. P.769-774.

6. 24. Yuan C.C, Wang P.H., Ng H.T., Tsai L.C., Juang C.M., Chiu L.M. Both TPA and SCC-Ag levels are prognostic even in high-risk stage Ib-IIa cervical carcinoma as determined by a stratification analysis. Eur. J. Gynaecol Oncol. 2002; 23(1):17-20.

7. Chi-Mou Juang M.D., Peng-Hui Wang M.D., Ming-Shien Yen M.D., Chiung-Ru Lai M.D., Heung-Tat Ng M.D. and Chiou-Chung Yuan M.D. Application of Tumor Markers CEA, TPA, and SCC-Ag in Patients with Low-Risk FIGO Stage IB and IIA Squamous Cell Carcinoma of the Uterine Cervix. Gynecologic Oncology. 2000; 76(1):103-106.

8. RU 2343485 C1, 10.01.2009.

9. RU 2447151 C1, 10.04.2012.

10. Sambrook J., Fritsch E.F., Maniatis Т. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY, 1989.

Перечень нуклеотидных и аминокислотных последовательностей приведен в конце описания.

1. Плазмида pET40CmAP/MBL-T размером 8194 пар оснований (п.о.), определяющая синтез рекомбинантного гибридного бифункционального полипептида CmAP/MBL-T и характеризующаяся наличием следующих фрагментов: NcoI/SalI-фрагмента плазмиды pET-40b(+) (Novagen) и фрагмента ДНК размером 2034 п.о., содержащего химерный ген, состоящий из структурной части гена щелочной фосфатазы CmAP, включая линкер (G)4S(G)4S(G)4SEL, и структурной части гена маннан-связывающего лектина С-типа MBL-T (SEQ ID N 1).

2. Рекомбинантный штамм E.coli Rosetta(DE3)/pET40CmAP/MBL-T, трансформированный плазмидой pET40CmAP/MBL-T по п.1, - продуцент гибридного бифункционального полипептида CmAP/MBL-T.

3. Способ получения рекомбинантного гибридного бифункционального полипептида CmAP/MBL-T, характеризующийся тем, что штамм-продуцент по п.2 инкубируют в жидкой питательной среде LB в течение 12 ч при 16°С, затем бактериальные клетки осаждают центрифугированием, суспензию клеток дезинтегрируют в буфере, далее экстракт центрифугируют, затем надосадочную жидкость помещают на колонку с ионообменной смолой, далее элюируют белок, затем белковый элюат помещают на колонку с металлоаффинной смолой, далее активные фракции концентрируют на ионообменной смоле и выделяют целевой продукт гель-фильтрацией.



 

Похожие патенты:

Изобретение относится к области биотехнологии и касается способа прогнозирования длины тела человека в рамках русской популяции. Представленный способ основан на исследовании ДНК, в котором с помощью метода ПЦР и при использовании определенных праймеров проводят исследование участков генов амелогенина (AML), используя локусы генов секреторного рецептора гормона роста (GSHR), ко-репрессороподобного лигандзависимого ядерного рецептора (LCORL) и связывающего белка циклин-зависимых киназ (CABLES1) в образцах ДНК мужского пола и генов хейджхок-взаимодействующего белка (HHIP) и ядерного белка с цинковыми пальцами (JAZF1) в образцах ДНК женского пола.

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ селекции эукариотической клетки-хозяина, экспрессирующей желаемый уровень интересующего полипептида, включающий трансфекцию клеток гетерологичной нуклеиновой кислотой, содержащей по меньшей мере одну кассету, содержащую по меньшей мере первый полинуклеотид, кодирующий интересующий полипептид, стоп-кодон, расположенный по направлению экспрессии относительно первого полинуклеотида, второй полинуклеотид, расположенный по направлению экспрессии относительно стоп-кодона, кодирующий иммуноглобулиновый трансмембранный якорный домен, культивирование клеток-хозяев для экспрессии интересующего полипептида так, чтобы по меньшей мере часть рассматриваемого полипептида экспрессировалась в виде слитого полипептида, содержащего иммуноглобулиновый трансмембранный якорный домен, причем такой слитый полипептид экспонируется на поверхности указанной клетки-хозяине, селекцию клетки по наличию или количеству слитого полипептида, экспонируемого на клеточной поверхности.

Изобретение относится к области биохимии, в частности к cпособу получения препаративных количеств вирусного антигена - белка вируса скручивания листьев картофеля (ВСЛК, PLRV), в составе химерных вирусных частиц, имитирующих вирионы ВСЛК, включающий создание рекомбинантной ДНК, содержащей кДНК вируса просветления жилок турнепса (ВПЖТ, TVCV), принадлежащего к тобамовирусам, где кДНК ВПЖТ находится под контролем растительного промотора, на ее конце имеется терминатор транскрипции, а ген белка оболочки ВПЖТ заменен на ген мажорного белка оболочки ВСЛК, включающий создание агробактериального вектора (плазмиды) pCambia 1300, способного встраиваться в геном растения-хозяина и вызывать системную инфекцию, перенос созданной рекомбинантной ДНК в агробактериальный вектор pCambia, трансформацию растения-хозяина Nicotiana benthamian агробактериальным вектором pCambia, размножение химерного вируса, состоящего из РНК вируса, в растении-хозяине Nicotiana benthamian, выделение химерного вируса, содержащего кДНК вируса просветления жилок турнепса (ВПЖТ, TVCV), ген оболочки которого заменен на ген мажорного белка оболочки ВСЛК, из зараженных листьев растения-хозяина Nicotiana benthamian.

Изобретение относится к области биохимии, в частности к способу получения одноцепочечной кольцевой РНК. Способ включает синтез смысловой цепи и антисмысловой цепи, содержащих нуклеотидную последовательность с неспаренными нуклеотидами на 5'-конце и 3'-конце, и одновременно лигирование нуклеотида на 5'-конце нуклеотидной последовательности с неспаренными нуклеотидами в смысловой цепи с нуклеотидом на 3'-конце нуклеотидной последовательности с неспаренными нуклеотидами в антисмысловой цепи и, наоборот, с использованием лигазы.
Изобретение относится к фармацевтической промышленности, а именно к способу получения дрожжевого экстракта, содержащего биологически активную высокополимерную РНК.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к способу идентификации улучшенных вариантов белка. Способ включает тестирование множества вариантов белка с единичными заменами в первом тесте первого свойства и во втором тесте второго свойства.

Изобретение относится к биотехнологии и представляет собой выделенную полинуклеотидную молекулу с функцией rEVE, рекомбинантный вектор экспрессии, экспрессионный шаттл-вектор, клетку-хозяина, а также способы с использованием вышеуказанной выделенной полинуклеотидной молекулы.

Изобретение относится к области биотехнологии. Способ мультиплексной детекции представителей родов Aeromonas и Flavobacterium предусматривает постановку ПЦР в один этап с использованием двух пар синтезированных праймеров к участкам гена малой субъединицы рибосомальной РНК (16S rRNA) в режиме реального времени к участку гена малой субъединицы рРНК Aeromonas: А1 - 5'-TTCGGGCCTTGCGCGATTGG-3' и А2 - 5'-CGTGCTGGCAACAAAGGACAG-3', обеспечивающие амплификацию фрагмента размером 920 п.н.

Изобретение относится к области биотехнологии и сельского хозяйства. В способе растения обрабатывают раствором биологически активного вещества, в качестве которого используют 24-эпибрассинолид.

Изобретение относится к области биотехнологии и касается рекомбинантной плазмидной ДНК pPA-OPRFI, кодирующей гибридный рекомбинантный белок F-I наружной мембраны Pseudomonas aeruginosa, штамма бактерий E.coli PA-OPRFI, продуцента такого гибридного белка и способа получения указанного рекомбинантного белка.

Группа изобретений относится к продуцирующему янтарную кислоту мутантному микроорганизму, который способен использовать одновременно сахарозу и глицерин в качестве источников углерода.

Настоящее изобретение относится к биохимии и представляет собой способ получения цистеина, включающий культивирование рекомбинантного микроорганизма, в котором снижена активность эндогенной фосфосеринфосфатазы (SerB), для продукции О-фосфосерина (OPS) и введение во взаимодействие полученной культуры, содержащей OPS, или OPS, выделенной из культуры, с сульфидом в присутствии О-фосфосеринсульфгидрилазы (OPSS) или микроорганизма, экспрессирующего OPSS, для получения цистеина, причем рекомбинантный микроорганизм представляет собой рекомбинантную бактерию.

Изобретение относится к области биотехнологии. Представлены вариантные белки лизофосфолипид-ацилтрансферазы, катализирующие реакцию превращения 18:3(n-6)-PL в 18:3(n-6)-CoA и/или DGLA-CoA в DGLA-PL, имеющие аминокислотные последовательности, по меньшей мере на 95% идентичные SEQ ID NO:2 и 7, представленным в описании.

Изобретение относится к биохимии, в частности к способу получения продукта реакции, катализируемой нитрилазой, слитой с транспортным доменом аутотранспортера, где способ включает стадии (i) обеспечения грамотрицательной бактерии, содержащей указанную нитрилазу, расположенную на его поверхности, и/или мембранного препарата указанной грамотрицательной бактерии, и (ii) приведения грамотрицательной бактерии и/или ее мембранного препарата в контакт с одним или более субстратами нитрилазы в условиях, совместимых с активностью нитрилазы.

Представленные решения касаются способа генерирования заквасочной культуры, заквасочной культуры и способа ферментации с использованием такой заквасочной культуры.

Изобретение относится к биотехнологии и представляет собой мутантный бактериальный белок-экспортер аминокислоты YddG. Изобретение относится также к бактерии рода Escherichia, продуцирующей ароматическую аминокислоту, при этом бактерия содержит ДНК, которая кодирует мутантный белок-экспортер аминокислоты YddG.

Изобретение относится к биотехнологии и представляет собой рекомбинантный штамм бактерий Escherichia coli N41 (pBpuN4/MR), который получен путем трансформации штамма Escherichia coli ER2267 плазмидой pBpuN4/MR N41, полученной на основе плазмиды pUC19 и содержащей ген, кодирующий ДНК-метилтрансферазу M.BpuN4I, метилирующую один из цитозинов в положении С5 в последовательности 5'-GGNNCC-3', и ген рестриктазы BpuN4I.

Группа изобретений относится к биотехнологии. Рекомбинантная плазмидная ДНК pPA-OPRF-ETA размером 8007 пар оснований кодирует синтез рекомбинантного белка OprF-ETA Pseudomonas aeruginosa.

Изобретение относится к области молекулярной биологии, биохимии и генной инженерии. Предложены нуклеиновая кислота, характеризующаяся нуклеотидной последовательностью, кодирующей белок, который состоит из аминокислотной последовательности с делецией, заменой или добавлением одной или более аминокислот в аминокислотной последовательности SEQ ID NO: 2 или SEQ ID NO: 7 и обладает активностью фосфатазы фосфатидной кислоты, соответствующий белок, рекомбинантный вектор, клетка для экспрессии белка и способ получения композиции жирной кислоты.

Группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии и представляет собой рекомбинантную плазмиду pESAT6-CFP10-DBD, рекомбинантный штамм Escherichia coli M15 [pREP4, pESAT6-CFP10-DBD], способ получения, иммобилизации, концентрирования и очистки рекомбинантного белка ESAT6-CFP10-DBD на декстране, рекомбинантный белок ESAT6-CFP10-DBD с молекулярной массой 26,4 кДа, иммуногенную композицию, содержащую белок ESAT6-CFP10-DBD, иммобилизованный на декстране, специфически активирующую Т-лимфоциты, синтезирующие ИФН-гамма при стимуляции антигенами микобактерий. Изобретение позволяет получить высокий уровень экспрессии белка, который эффективно индуцирует иммунный ответ на антиген микобактерий. 5 н.п. ф-лы, 2 ил., 1 табл., 5 пр.
Наверх