Способ секвенирования днк и устройство для его осуществления (варианты)



Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)
Способ секвенирования днк и устройство для его осуществления (варианты)

 


Владельцы патента RU 2539038:

Общество с ограниченной ответственностью "ГАММА" (RU)

Группа изобретений относится к области генной инженерии. Копии секвенируемой молекулы ДНК помещают в четыре раствора, каждый из которых характеризуется сниженной концентрацией одного из нуклеотидов, по сравнению с остальными тремя нуклеотидами, во время проведения полимеризации ДНК в каждом из растворов регистрируют факты выделения ионов с помощью сенсоров на основе МДП-структур. Измеряют промежутки времени между моментами выделения ионов и по наличию большего промежутка времени делают вывод о присоединении нуклеотида с пониженной концентрацией и далее определяют расположение данного нуклеотида в секвенируемой ДНК. Определение момента присоединения нуклеотида к растущей цепи ДНК за счет измерения сигнала от каждого сенсора проводят в режиме стохастического резонанса. Режим стохастического резонанса обеспечивают за счет выбора рабочей точки МДП-структуры посередине участка бистабильности, а также за счет ввода сигнала шума от дополнительного генератора шума на катод МДП-структуры. Использование изобретений позволяет повысить точность регистрации момента присоединения очередного нуклеотида при полимеризации ДНК. 4 н.п. ф-лы, 9 ил.

 

Изобретение относится к области генной инженерии и может быть использовано при секвенировании ДНК.

Уровень техники

Генетическая информация зашифрована в геноме организма в виде последовательности нуклеотидов в молекулах ДНК. Расшифровка генетической информации позволяет определить генетические заболевания и особенности организма, что широко используется при лечении, в криминалистике и других приложениях. Быстрыми темпами растет потребность в недорогих геномных секвенаторах.

Известны флуоресцентные секвенаторы фирм Illumna и Life Technologies, стоимость которых измеряется сотнями тысяч долларов. Для решения задач медицины будущего требуются быстрые и дешевые секвенаторы. Известны пиросеквенаторы компании Roche, но сейчас их быстро заменяют полупроводниковые секвенаторы фирмы IonTorrent.

Секвенаторы фирмы IonTorrent состоят из трех подсистем: вычислительной, детектирующей и жидкостной. Жидкостная подсистема подает в проточную ячейку, содержащую микрочип с иммобилизированными фрагментами ДНК, поочередно растворы дезоксинуклеотидтрифосфатов (дАТФ, дТТФ, дЦТФ, дГТФ), чередуя их с промывочным буферным раствором. Детекторная подсистема, основу которой составляют размещенные на микрочипе сенсоры на основе ион-чувствительных полевых транзисторов (ISFET), считывает информацию и передает ее в вычислительную систему [1]. Жидкостная система подачи реагентов содержит управляемые многоходовые краны, через которые, в том числе, подаются растворы дорогих дезоксинуклеотидтрифосфатов, что повышает стоимость секвенирования.

Известен секвенатор, содержащий четыре ячейки, в котором факт подключения нуклеотида определяют с помощью детектора силы движения растущей цепи ДНК [2]. В качестве детектора используют атомно-силовой микроскоп (АСМ), с помощью которого факт перемещения ДНК измеряется за счет движения кантилевера АСМ.

Наиболее близким аналогом является заявка на изобретение [3], в которой описан секвенатор, содержащий четыре измерительных ячейки на основе полых волокон с гранулами, на которых иммобилизованы молекулы ДНК. В данном устройстве момент полимеризации нуклеотида определяют по акустическому сигналу, возникающему при перемещении ДНК. К недостатку данной схемы можно отнести недостаточно высокую точность и сложность регистрации аккустических сигналов и программ для обработки сигналов.

Задачей заявляемого технического решения является создание способа и устройства секвенирования ДНК, обеспечивающих высокие точность и производительность процедуры секвенирования при низких затратах и относительно невысокой стоимости аппаратного обеспечения, что позволяет сделать устройство секвенирования ДНК доступным для большинства молекулярно-генетических лабораторий.

Технический результат, достигаемый при использовании заявляемого изобретения, заключается в повышении точности регистрации момента присоединения очередного нуклеотида при полимеризации ДНК за счет повышения отношения сигнал/шум при фиксации момента присоединения нуклеотида. Технический результат достигается за счет применения явления стохастического резонанса, реализуемого в бистабильной полупроводниковой схеме каждого сенсора при одновременной подаче на нее напряжения шума и слабого сигнала, соответствующего выделению иона водорода в раствор при разделении зарядов в момент присоединения нуклеотида при полимеризации ДНК.

Технический результат также достигается за счет подачи слабого сигнала, поступающего с сенсора, на вход электронной схемы, имеющей область бистабильности и в которой может быть сформирован стохастический резонанс, при этом повышается отношение сигнал/шум при подаче на электронную схему слабого сигнала и шума.

Перечень фигур

Фиг.1 Сенсор потенциала с МДП-диодом, имеющим область бистабильности на своей вольт-амперной характеристике (ВАХ).

Фиг.2 Добавление раствора с ДНК полимеразой к подготовленному раствору для проведения реакции полимеризациии фрагментов ДНК.

Фиг.3а Вольт-амперная характеристика бистабильной полупроводниковой структуры "металл-диэлектрик-полупроводник".

Фиг.3б Вольт-амперная характеристика электронной схемы, обладающей областью бистабильности на ВАХ.

Фиг.4 Функциональная схема, обеспечивающая условия возникновения стохастического резонанса в МДП-диоде.

Фиг.5 Функциональная схема, обеспечивающая условия возникновения стохастического резонанса в МДП-диоде, включенном последовательно с измерительной ячейкой, в которой проводится реакция полимеризации ДНК.

Фиг.6 Функциональная схема, обеспечивающая условия возникновения стохастического резонанса в МДП-диоде, в котором рабочий раствор контактирует со слоем диэлектрика.

Фиг.7 Функциональная схема, обеспечивающая условия возникновения стохастического резонанса в электронной схеме с областью бистабильности на ВАХ, включенной последовательно с измерительной ячейкой, в которой проводится реакция полимеризации ДНК.

Фиг.8 На верхнем графике представлена модель входного сигнала амплитудой 100 мВ. На среднем графике приведена сумма входного сигнала и шума, которые подаются на вход схемы с бистабильным участком на ВАХ, реализующей явление стохастического резонанса. На нижнем графике представлен выходной сигнал.

Описание

Существующие методики секвенирования имеют такие недостатки, как высокую стоимость секвенаторов и реактивов, сложность и длительность процедур подготовки образцов, низкую скорость процедуры секвенирования. Заявляемый способ, который выполнен с возможностью повышения точности секвенирования, реализуют в виде следующей последовательности действий:

1. Проводят копирование фрагментов секвенируемой ДНК с помощью стандартной полимеразной цепной реакции (далее - ПЦР).

2. Подготавливают четыре вида растворов для полимеризации фрагментов ДНК (по числу видов нуклеотидов: аденина, тимина, гуанина, цитозина), при этом каждый раствор содержит, как минимум, все четыре вида нуклеотидов, причем концентрация одного из нуклеотидов меньше концентрации трех других. Когда в каком-либо из растворов концентрация какого-либо вида нуклеотида понижена, то в трех остальных растворах концентрация этого вида нуклеотидов имеет нормальное значение. Таким образом, в каждом из подготавливаемых четырех растворов понижена концентрация либо нуклеотида аденина, либо тимина, либо гуанина, или же цитозина.

3. Секвенируемые фрагменты ДНК при помощи жидкостной системы, состоящей из автоматизированной пипетки, или из микрофлюидной системы, помещают на поверхность четырех полупроводниковых сенсоров - структур «металл-диэлектрик-полупроводник», на поверхность диэлектрического слоя, с иммобилизацией на нем или без иммобилизации, в заранее нанесенные растворы четырех видов, для проведения реакции полимеризации ДНК.

4. При помощи жидкостной системы, описанной выше, в раствор добавляют молекулы ДНК полимеразы.

5. Проводят рабочий цикл секвенирования фрагмента ДНК. При этом осуществляют детектирование момента присоединения нуклеотида к растущей цепи ДНК за счет измерения сигнала от каждого сенсора, выполненного на МДП-диоде с возможностью регистрации или изменения концентрации ионов водорода, или изменения количества электронов на полимеризуемом фрагменте ДНК в растворе полимеризации, в режиме стохастического резонанса. Режим стохастического резонанса обеспечивают выбором рабочей точки МДП-структуры сенсора посередине участка бистабильности и вводом сигнала шума от генератора шума на катод МДП-диода.

6. Регистрируют четыре сигнала с выходов усилителей МДП-сенсоров, размещенных на четырех матрицах, и проводят обработку данных с помощью компьютера. При этом определяют моменты задержки сигнала при включении каждого вида нуклеотида в молекулу ДНК на каждой отдельной сенсоре.

7. Восстанавливают последовательность нуклеотидов в секвенируемой ДНК путем совмещения полученных данных о расположении нуклеотидов с пониженной концентрацией, в каждом из четырех растворов каждого сенсора на четырех матрицах.

Регистрацию факта разделения зарядов, в частности регистрацию выделения иона водорода в раствор при присоединении ДНК полимеразой очередного нуклеотида осуществляют посредством измерения проводимости раствора при проведении в нем реакции полимеризации ДНК. Регистрацию факта выделения иона водорода в раствор осуществляют с помощью полупроводникового сенсора, представляющего собой МДП-диод, при этом могут быть использованы два варианта сенсора - сенсор потенциала и сенсор тока.

При использовании сенсора потенциала раствор для реакции полимеризации ДНК вместе с молекулой полимеразы ДНК и секвенируемой молекулой ДНК при помощи жидкостной системы, описанной выше, помещают на поверхность сенсора (фиг.1). Затем в раствор добавляют молекулы ДНК полимеразы (фиг.2). Слой диэлектрика в этой структуре имеет малую толщину (сотни ангстрем), в результате чего через него может возникать туннельный ток носителей заряда, или же идти токоперенос по другим известным механизмам [4]. Выделяемый в ходе реакции полимеризации ДНК свободный ион водорода действием своего заряда меняет электрическое поле в диэлектрике, что в конечном итоге меняет величину эмиссии электронов в диэлектрик из металла и как результат - изменяет величину общего тока через МДП-диод.

При использовании сенсора тока (см. фиг.5 и фиг.6), свободный ион водорода также меняет электрическое поле в диэлектрике, управляя эмиссией электронов из катода в диэлектрик через раствор, что также изменяет величину общего тока через МДП-диод.

В зависимости от установленной в секвенаторе модификации матрицы сенсоров потенциала или матрицы сенсоров тока выполняют следующую процедуру. Сначала, если это предусмотрено модификацией сенсора, на поверхности каждого из четырех МДП-диодов (матрицы сенсоров) при помощи жидкостной системы, описанной выше, размещают по капле раствора, содержащего все реагенты, необходимые для проведения процедуры иммобилизации фрагментов ДНК на поверхность МДП-диода. Этим обеспечивается возможность фрагментам ДНК иммобилизоваться на поверхность МДП-диода до начала реакции полимеризации ДНК. Далее, на поверхности каждого из четырех МДП-диодов (матрицы сенсоров) добавляют по капле раствора, содержащего все реагенты, необходимые для проведения процедуры полимеризации секвенируемых фрагментов ДНК, за исключением молекул полимеразы ДНК. Для начала процесса полимеризации секвенируемых фрагментов ДНК, во все четыре капли на поверхности МДП-диодов, асинхронно по времени (т.е. не требуется синхронизация процессов во времени), при помощи жидкостной системы, описанной выше, вводят раствор, содержащий молекулы полимеразы ДНК. Через некоторое время, определяемое диффузией молекул полимеразы ДНК, реакции полимеризации фрагментов ДНК начнутся во всех четырех растворах; при этом четыре сигнала-циклограммы от четырех МДП-диодов, отображают факты регистрации разделения зарядов во времени, в частности, выделения ионов водорода в раствор (или увеличение отрицательного заряда на полимеризуемых фрагментах ДНК), при каждом акте встраивания полимеразой ДНК комплементарного нуклеотида в секвенируемый фрагмент ДНК. Регистрация фактов разделения зарядов производится, в частности, измерением изменения проводимости раствора или измерением изменения потенциала на слое диэлектрика сенсора, с использованием явления стохастического резонанса, что обеспечивает большую точность в измерении интервалов времени между регистрируемыми фактами разделения зарядов, в частности выбросов ионов водорода в раствор в ходе реакции полимеризации ДНК, против способа измерения этих интервалов времени в заявке-прототипе [3].

Записанные, например, в память компьютера, четыре сигнала-циклограммы (по одному от каждой из четырех МДП-диодов) будут иметь различия в виде задержек (отсутствия изменения сигнала) в те моменты времени, когда молекула полимеразы ДНК в соответствующем растворе, дойдя до того основания фрагмента ДНК, концентрация комплементарного нуклеотида которого в растворе понижена, будет ожидать его подхода из раствора, для встраивания во фрагмент ДНК.

Реконструкцию информационной последовательности секвенируемой ДНК по наблюдаемым задержкам в ходе реакции полимеризации фрагментов ДНК осуществляют следующим образом.

После записи реализаций изменения проводимости по времени всех четырех растворов проводят сравнение реализаций путем выравнивания начала реализаций между собой и обнаружения моментов задержек в появлении сигналов изменения проводимости того или иного раствора. Указанные задержки (или же фазы отсутствия) изменения сигнала проводимости данного раствора будут указывать на наличие в данном месте в информационной последовательности секвенируемой ДНК того нуклеотида, концентрация которого существенно понижена по сравнению с остальными в данном растворе. Для повышения достоверности реконструкции ДНК-последовательности указанный опыт необходимо повторить с кратностью, пропорциональной требуемой степени достоверности результата секвенирования. При этом для анализа результатов могут быть использованы методы накопления и мажорирования сигналов, развитые в соответствующих разделах статистической радиофизики [5-6]. Кратность опытов, обеспечивающих ту же достоверность результата секвенирования ДНК, существенно снижается благодаря применению явления стохастического резонанса при регистрации фактов разделения зарядов, в частности, при измерении проводимости раствора каждой МДП-структурой. Таким образом, повышается производительность процедуры секвенирования ДНК при том же алгоритме секвенирования, что и в прототипе, за счет способа и устройства более точного (чем в прототипе) измерения интервалов времени между регистрируемыми фактами встраивания полимеразой ДНК комплементарных нуклеотидов, сопровождающимися разделением зарядов, в частности выбросом иона водорода в раствор.

Устройство секвенирования

Один из вариантов устройства для секвенирования ДНК (структурная схема сенсора приведена на фиг.4) содержит жидкостную систему, компьютерную систему обработки результатов секвенирования и систему детекции на основе МДП-диодов, чувствительных или к выбросам ионов водорода в раствор, или к увеличению количества электронов на полимеризируемом, иммобилизованном фрагменте ДНК. Система детекции может содержать четыре сенсора или содержать четыре планарные матрицы, на поверхности которых размещено от 1 до N сенсоров, и дополнительно содержит источник напряжения смещения и генератор шума. В качестве сенсора используют структуру с возможностью формирования режима стохастического резонанса, которая выполнена на основе МДП-диода, позволяющего обеспечить работу сенсора посередине участка бистабильности на его ВАХ за счет смещения рабочей точки МДП-диода, для чего один выход источника смещения подключен к катоду МДП-диода, а другой выход подключен к генератору шума. При этом анод МДП-диода является выходом сенсора и подключен к одному из N входов усилителя напряжения, выход которого подключен ко входу аналого-цифрового преобразователя, связанного со входом компьютерной системы. МДП-диод состоит из многослойной конструкции, включающей соединенный с анодом первый металлический контакт, который размещен на нижнем слое p-Si, верхняя поверхность которого соединена с нижней поверхностью слоя n-Si, который в свою очередь защищен слоем диэлектрика, например, SiO2, на верхней поверхности которого образована рабочая зона для иммобилизации фрагментов ДНК и второй металлический слой, соединенный с катодом МДП-диода.

Другой вариант устройства для секвенирования ДНК (структурная схема сенсора приведена на фиг.5) содержит жидкостную систему, компьютерную систему обработки измеренных данных и получения результатов секвенирования и систему детекции на основе МДП-сенсоров, чувствительных к выбросам ионов водорода в раствор. Система детекции может содержать четыре сенсора или содержать четыре планарные матрицы, на поверхности которых размещено от 1 до N сенсоров, и дополнительно содержит источник напряжения смещения и генератор шума. При этом в качестве сенсора используют структуру с возможностью формирования режима стохастического резонанса, которая выполнена на основе МДП-диода, позволяющего обеспечить работу сенсора посередине участка бистабильности на его ВАХ за счет смещения рабочей точки МДП-диода, для чего один вывод источника смещения подключен к катоду устройства, а другой вывод подключен к генератору шума, при этом анод МДП-диода является выходом сенсора и подключен к одному из N входов усилителя тока, выход которого подключен ко входу аналого-цифрового преобразователя, связанного со входом компьютерной системы, при этом МДП-диод состоит из многослойной конструкции, включающей соединенный с анодом первый металлический контакт, который размещен на нижнем слое p-Si, верхняя поверхность которого соединена с нижней поверхностью слоя n-Si, верхняя поверхность которого покрыта слоем диэлектрика, который выбирают из группы, состоящей из SiO2, нитрида кремния Si3N4, оксида тантала Ta2O5, алмазоподобной пленки, на верхней поверхности которого образована рабочая зона для иммобилизации фрагментов ДНК, или для формирования ячейки, в которой фрагменты ДНК могут быть не иммобилизованы.

Третий вариант устройства для секвенирования ДНК (структурная схема сенсора приведена на фиг. 7) содержит сенсоры в форме измерительных ячеек, изготовленных из диэлектрического материала, и имеющих два проводящих электрода. Сенсоры конструктивно имеют контакт с раствором для полимеризации ДНК и электронную схему, обладающую областью бистабильности на ВАХ. В зависимости от особенностей реализации электронной схемы, область бистабильности на ВАХ может быть симметричной относительно начала координат "напряжение-ток", при этом источник напряжения смещения может не использоваться. Кроме того, электронная схема, обладающая областью бистабильности на ВАХ, может быть конструктивно вынесена за пределы измерительной ячейки, изготовлена конструктивно в виде отдельного экранированного модуля и электрически соединена с электродами измерительной ячейки при помощи экранированных кабелей (см. фиг. 7). В этом варианте устройство для секвенирования ДНК, содержащее жидкостную систему, компьютерную систему обработки измеренных данных и получения результатов секвенирования и систему детекции на основе сенсоров, чувствительных к выбросам ионов водорода в раствор характеризуется тем, что система детекции содержит четыре сенсора и дополнительно содержит четыре электронных узла, а также источник напряжения смещения и генератор шума. В качестве сенсора используют измерительную ячейку, один из электродов которой подключен ко входу электронного узла, обладающего вольт-амперной характеристикой с областью бистабильности, с возможностью формирования режима стохастического резонанса. Выход электронного узла подключен ко входу усилителя, выход которого подключен к одному из входов аналого-цифрового преобразователя, связанного со входом компьютерной системы, при этом другой электрод ячейки через источник смещения подключен к генератору шума.

В зависимости от решаемых задач, в секвенаторе может применяться одна из двух модификаций сенсоров на МДП-диоде: сенсор потенциала (см. фиг. 4) или сенсор тока (см. фиг.5, фиг.6). Матричные сенсоры выполняют в секвенаторе съемными и взаимозаменяемыми. При этом в зависимости от модификации сенсора его выполняют или с технологически легко изготавливаемым слоем диэлектрика, например, окисла кремния [7], или используют модификацию сенсора со слоем диэлектрического алмазоподобного материала [8] в качестве диэлектрика. При применении первой модификации сенсора фрагменты ДНК не иммобилизуются на поверхности диэлектрика сенсора. Вторая модификация сенсоров применяется с иммобилизованными фрагментами ДНК на поверхности диэлектрика, т.к. из уровня техники известно [9], что чувствительность сенсора с алмазоподобным диэлектриком примерно в 30 раз выше чувствительности аналогичного сенсора с окислом кремния, к изменению величины отрицательного заряда на иммобилизованных фрагментах ДНК, находящихся в слое Дебая (двойной электрический слой). При этом увеличение отрицательного заряда фрагмента ДНК на один электрон происходит в результате каждого акта присоединения полимеразой ДНК комплементарного нуклеотида к одноцепочечному фрагменту ДНК в ходе его полимеризации (происходит разделение зарядов - ион водорода выделяется в раствор, а электрон фиксируется на фрагменте ДНК).

Полупроводниковые сенсоры идентичны по характеристикам и используются для детекции фактов разделения зарядов, в частности для детекции выделения ионов водорода в раствор при полимеризации ДНК. Сенсор представляет собой полупроводниковый прибор, изготовленный на основе подложки из кремния, например, p-типа. По одной из известных технологий (диффузии, сплавления, эпитаксии, ионного легирования, ионной имплантации или другой) [10] изготавливают p-n переход; p-n переходом называют область на границе двух полупроводников, обладающих различными типами проводимости, толщина p-n перехода имеет величину от 10 нм до 1 мкм, на который по одной из известных технологий [10] наносят диэлектрическую пленку, например, окисла кремния толщиной до 1 нм. Таким образом, сенсор представляет собой многослойную структуру, состоящую из технологически соединенных слоев кремния p-типа, кремния n-типа и окисла, в качестве которого может быть выбран или окисел кремния, или нитрид кремния Si3N4, или оксид тантала Ta2O5, или алмазоподобная пленка [11,12]. Далее, со стороны подложки и со стороны диэлектрического слоя одним из известных способов [10] наносят металлические электроды-контакты (золото, алюминий), как это показано на фиг.2, фиг.5, фиг.6. Для обеспечения защиты металлических контактов МДП-диода от действия раствора, на него, в области расположения контактов, наносится защитная пленка, например, из полимерного водостойкого материала.

Для увеличения производительности процедуры секвенирования ДНК сенсоры объединяют в матрицы, в частности, в едином цикле последовательных технологических операций при изготовлении матрицы. Сенсоры функционируют независимо друг от друга, имея только общую схему подачи питающих токов и напряжений, общую коммутационную схему вывода полезного сигнала от каждого сенсора на внешние контакты матрицы. Пример матричной организации зарядочувствительных ячеек, в которых регистрируют выделение ионов водорода в раствор в результате встраивания комплементарного нуклеотида в одноцепочечный фрагмент ДНК, но делают это общепринятым способом измерения pH раствора, т.е. путем измерения концентрации ионов водорода в растворе потенциометрическим способом при помощи полевого транзистора, изготовленного по стандартной КМОП технологии, приведен в патенте США №8540865 [13].

Для выделения и регистрации слабого сигнала, получаемого для увеличения отношения сигнал/шум, используют явление стохастического резонанса. Из уровня техники известно, что стохастический резонанс реализуют в бистабильной полупроводниковой структуре при одновременном действии на нее напряжения шума и слабого сигнала. При этом на выходе бистабильной структуры происходит увеличение отношения сигнал/шум. Указанное явление наблюдается в различных системах биологической, физической, электронной природы и описано в литературе [14] и в патенте [15]. В частности, известно применение генератора шума в бистабильной полупроводниковой схеме для реализации стохастического резонанса в натурном радиотехническом эксперименте [16]. Применяемая для реализации явления стохастического резонанса полупроводниковая схема должна иметь область бистабильности по току на ВАХ, например такую, как показано на фиг.3а для МДП-диода.

В качестве бистабильной полупроводниковой структуры может быть применена, например, МДП-структура, описание которой приведено ниже. Для задания рабочего режима стохастического резонанса рабочая точка на ВАХ МДП-структуры должна размещаться посередине участка с бистабильностью. Указанное размещение рабочей точки осуществляется путем подачи на катод МДП-диода (имеющую ВАХ, как показано на фиг.3) постоянного отрицательного напряжения смещения от источника постоянного напряжения. Для обеспечения условия возникновения стохастического резонанса используется генератор напряжения шума, выполненный по одной из известных схем, например, [17-24], выходной сигнал которого преобразуется в аналоговый при помощи цифроаналогового преобразователя, включенный последовательно с МДП-диодом (фиг.4).

Генератор напряжения шума может быть представлен внешним устройством или же может быть изготовлен по известной интегральной технологии, например, КМОП, при производстве МДП-структуры, в ее составе.

Механизм возникновения токовой бистабильности в МДП-диоде на кремниевой подложке (в подложку из кремния p-типа локально имплантируют n-область, получая диодную структуру с p-n переходом) состоит в возникновении специфической положительной обратной связи между потоками дырок и электронов, текущих через структуру диода, образованного p-n переходом и диэлектрическим слоем. Отметим, что в общем, указанный механизм близок к таковому в тиристоре (динисторе), или в триггере на двух биполярных транзисторах [4, 24-25].

При подаче на электрод (катод) МДП-диода некоторого напряжения относительно анода, из материала (металла) полевого электрода начинается процесс токопереноса (электронный ток) через тонкий диэлектрический слой. Отметим, что к одному из наиболее распространенных механизмов такого токопереноса относят туннелирование электронов [26] (что возможно при достаточно малой толщине диэлектрика, обычно порядка сотен ангстрем). Однако конкретный вид механизма токопереноса не оказывает значительного влияния на возникновение положительной обратной связи по току носителей заряда [27].

Электроны, пройдя через диэлектрический слой, смещают потенциальный барьер встроенного в подложку p-n перехода, а сам p-n переход оказывается смещенным в прямом направлении. В результате уменьшения потенциального барьера из p-слоя начинается эмиссия дырок, что еще больше открывает p-n переход. Дырки, частично рекомбинировав в n-слое, накапливаются на границе раздела «полупроводник n-типа - диэлектрик», в результате чего увеличивается падение напряжения на диэлектрике. В свою очередь, указанное падение напряжения на диэлектрике еще больше увеличивает эмиссию электронов из металла катода в диэлектрик. Таким образом, в МДП-диоде реализуется положительная обратная связь по току. В пределе, при малом значении сопротивления внешней цепи, происходит инверсия проводимости в подложке, и вся структура МДП-диода лавинообразно переключается в состояние с низким внутренним сопротивлением (иначе говоря, в МДП-диоде реализуется режим обратимого пробоя). При уменьшении напряжение на МДП-диоде происходит постепенное уменьшение эмиссии носителей из катода, что приводит к переходу МДП-диода в состояние с низкой проводимостью (обратное переключение).

Указанные процессы приводят к формированию области отрицательной дифференциальной проводимости на ВАХ МДП-диода. Указанная область соответствует участку с бистабильностью, который может быть использован для реализации режима стохастического резонанса в МДП-диоде.

Для реализации режима стохастического резонанса, во-первых, обеспечивают режим МДП-диода по постоянному току, для чего на катод МДП-диода (см. схему на фиг.4) подают постоянное напряжение смещения. Его величину выбирают такой, чтобы падение напряжения на МДП-диоде соответствовало середине участка с бистабильностью на ВАХ МДП-диода. Во-вторых, к МДП-диоду прилагают напряжение шума со средней амплитудой, равной ширине участка бистабильности на ВАХ МДП-диода. Напряжение смещения и напряжение шума суммируют со слабым усиливаемым сигналом, который формируется МДП-структурой чувствительной, в зависимости от конструкции, или к ионам водорода в растворе, или к электронам на полимеризируемом, иммобилизованном фрагменте ДНК.

Введение слабого сигнала может осуществляться в виде сигнала тока или напряжения. В первом случае, малое изменение потенциала (напряжения) будет происходить в рабочем растворе, соприкасающемся непосредственно со слоем диэлектрика МДП-структуры, в результате появления свободного иона водорода (см. структуру МДП-диода на фиг.4).

Во втором случае, схема будет реагировать на малые изменения тока проводимости раствора при реакции полимеризации фрагмента ДНК, и в этом случае МДП-диод должен быть включен последовательно с измерительной ячейкой, в которой проводится эта реакция (см. структуру МДП-диода на фиг.5 и фиг.6).

Конструкции МДП-диода на фиг.5 и фиг.6 отличаются тем, что для обеспечения защиты тонкого слоя диэлектрика от разрушения, его покрывают слоем металла или механически прочным слоем алмазоподобного материала (фиг.5), последний материал может быть нанесен непосредственно на слой n-Si (вместо SiO2), что делает сенсор более технологически сложным, но дает возможность применять такой сенсор многократно.

Из уровня науки и техники известно применение кремниевых структур "металл-диэлектрик-полупроводник" с бистабильной ВАХ в качестве устройств функциональной электроники, таких как элементы памяти - триггеры, управляемые напряжением генераторы, оптические сенсоры [17-18, 28-31]. Однако применение таких структур для построения узлов секвенаторов ДНК не было обнаружено.

Рассмотрим динамику поведения тока через МДП-диод в случае отсутствия или наличия слабого сигнала. В случае отсутствия слабого сигнала, под действием напряжения шума, приложенного к МДП-диоду, будет происходить непрерывное переключение МДП-диода между состояниями с низкой и высокой проводимостью на области бистабильности ВАХ. Указанное переключение будет иметь случайный характер (оба состояния будут равновероятны), а средний ток через диод будет соответствовать величине тока в середине области бистабильности.

В случае действия в схеме слабого усиливаемого сигнала статистика переключений будет меняться, в результате чего МДП-диод будет пребывать преимущественно в том состоянии, которое совпадает с направлением изменения слабого сигнала (т.е. если, например, слабый сигнал уменьшается по модулю, то преимущественным будет состояние с низкой проводимостью МДП-диода, и наоборот).

Соответствующие изменения тока во внешней цепи МДП-диода могут быть усилены преобразователем «ток-напряжение», а затем подвергнуты фильтрации для выделения огибающей, соответствующей изменению слабого сигнала от выделения ионов водорода в процессе реакции полимеризации фрагмента ДНК. Процесс фильтрации при этом может быть реализован аналоговым образом, например, с помощью пассивных или активных фильтров, либо в цифровом виде после выполнения оцифровки сигнала в АЦП. Усиленный и отфильтрованный сигнал будет содержать информацию о динамике выделения ионов водорода в ходе реакции полимеризации фрагмента ДНК, что можно использовать для измерения временных интервалов между отдельными актами присоединения комплементарных нуклеотидов.

Для оценки возможности повышения величины соотношения сигнал/шум на основе применения электронной схемы, разработанной в соответствии с устройством для обнаружения момента присоединения нуклеотида к растущей цепи ДНК согласно заявляемому изобретению, было выполнено компьютерное моделирование.

Для моделирования программная модель учитывала суммарное воздействие входного сигнала от сенсора, сигнала шума и особенности их взаимовлияния с учетом бистабильной характеристики ВАХ электронной схемы (фиг.3б). Для ВАХ электронной схемы, изображенной на фиг.3б, напряжение смещения имеет положительную полярность. На модели этот процесс показан в упрощенном виде: во входной сигнал без шума, но малой амплитуды, добавляется шум с диапазоном напряжений шумовых флуктуаций, равным величине области бистабильности; при этом выходной сигнал получается в виде, аналогичном тому, который будет присутствовать на входе реального устройства. Были проверены различные соотношения уровней сигналов друг относительно друга и выявлено, что даже при соотношении сигнал/шум, равном 1/10, на выходе электронной схемы, работающей в режиме стохастического резонанса, присутствует сигнал с отношением сигнал/шум более единицы.

На фиг.8 изображены три графика сигналов, полученных в ходе моделирования электронной схемы. Верхний график представляет модель входного сигнала (последовательность трапециевидных импульсов) амплитудой 100 мВ. На среднем графике изображена сумма входного сигнала и шума, которые подаются на вход схемы с бистабильным участком на ВАХ, реализующей явление стохастического резонанса. На нижнем графике представлен выходной сигнал.

Как можно видеть, выходной сигнал на нижнем графике фиг.8 содержит полезный сигнал, что соответствует усилению отношения сигнал/шум, т.к. среднее напряжение шума, приложенное к бистабильной структуре было равно 1,0 В. На среднем графике амплитуду суммы входного сигнала и шума можно оценить величиной немного большей, чем 1 В, т.е. шум превышает полезный сигнал (100 мВ) на порядок, и тем не менее на выходе появляется полезный сигнал.

На изготовленном устройстве выходной сигнал с сенсора представляет собой зашумленный сигнал с отношением сигнал/шум не более чем 1/10, далее добавляется шум с диапазоном средних значения напряжения шумовых флуктуаций, равного величине области бистабильности, и на выходе, после фильтрации, получают полезный сигнал.

Принципиально важным является то, что на выходе схемы стохастического резонанса присутствует сигнал с отношением сигнал/шум более единицы, который далее подают на аналоговые фильтры для выделения информативной части сигнала, а затем - на АЦП и на вход компьютерной системы.

Литература

1. Rothberg J. et al. Method and apparatus for measuring analytes using large scale FET arrays. US patent №8470164 (06.25.2013).

2. Allen M. Method and apparatus for DNA sequencing using a local sensitive force detector. №6280939 (28.08.2001).

3. Юдаков М.А. и др. Способ секвенирования ДНК. Евразийская заявка №201001513 (30.04.2012).

4. Зи С. Физика полупроводниковых приборов. - М.: Энергия, 1973. - 656 с.

5. Рытов С.М. Введение в статистическую радиофизику. Ч.1. Случайные процессы. - М.: Наука, 1976.

6. Шиховцев И.В., Якубов В.П. Статистическая радиофизика. Курс лекций / Новосиб. гос. ун-т. Новосибирск, 2011. 157 с.

7. Способ получения пленки окисла кремния SiO2. Патент РФ №2372688. http://www.findpatent.ru/patent/237/2372688.html. Christoph E Nebel1, Bohuslav Rezek2, Dongchan Shin1, Hiroshi Uetsuka1 and Nianjun Yang Diamond for bio-sensor applications //J. Phys. D: Appl. Phys. 40 (2007) 6443-6466 doi:10.1088/0022-3727/40/20/S21.

8. Christoph E Nebel1, Bohuslav Rezek2, Dongchan Shin1, Hiroshi Uetsuka1 and Nianjun Yang Diamond for bio-sensor applications // J. Phys. D: Appl. Phys. 40 (2007) 6443-6466 doi:10.1088/0022-3727/40/20/S21.

9. Kawarada H. and Ruslinda A.R. Diamond electrolyte solution gate FETs for DNA and protein sensors using DNA/RNA aptamers // Phys. Status Solidi A 208, No. 9, 2005-2016 (2011) /DOI 10.1002/pssa.201100503.

10. Пирс К.И. др. Технология СБИС: В 2-х кн. Под редакцией С.Зи. Перевод с английского. - М.: Мир: Редакция литературы по новой технике, 1986.

11. Цыганов Д.Л. Осаждение углеродных и алмазоподобных пленок при помощи плазменных струй. Диссертация на соискание кандидата технических наук. 2005. http://www.dissercat.com/content/osazhdenie-uglerodnykh-i-almazopodobnykh-plenok-pri-pomoshchi-plazmennykh-strui.

12. Гальваническая технология получения углеродных наноструктурированных пленок. НПЦ «Квадра», г.Москва, http://npckvadra.ru/wp-content/uploads/2013/04/galv_tehn.pdf.

13. Rothberg J. et al. Патент США №8540865 В2 от. «Method and apparatus for detecting molecular interactions using FET arrays US patent №8540865 (24.09.2013).

14. Анищенко В.С. Стохастический резонанс как индуцированный шумом эффект увеличения степени порядка / Обзоры актуальных проблем / В.С. Анищенко, А.Б. Нейман, Ф. Мосс, Л. Шиманский-Гайер // Успехи физических наук. - 15/01/1999. - T. 169, N 1. - 7-38.

15. PENG R., CHEN H. Optimized Stochastic Resonance Signal Detection Method US patent №8214177 - (03.07.2012).

16. Fauve S., Heslot F. Stochastic resonance in a bistable system. Physics Lett. A 97 (1-2). - 1983. p. 5-7.

17. Ильченко Г.П., Жужа М.А., Яманов И.Л. Функциональные полупроводниковые приборы на основе поверхностно-барьерной неустойчивости тока // Актуальные проблемы твердотельной электроники и микроэлектроники. Таганрог. 1995. С. 68.

18. Сагитов Р.Г., Селезнев В.Н. Бистабильные структуры "металл-изолятор с утечкой - полупроводник" в кн. Электронные процессы в многослойных запоминающих структурах. (Труды ФИАН. т. 184). - М.: Наука. 1987. с.3-23.

19. Ярмолик В.Н. и др. Генератор псевдослучайных последовательностей импульсов Авторское свидетельство СССР №978147 (30.11.1982).

20. Кадиев П.А. и др. ГЕНЕРАТОР ПСЕВДОСЛУЧАЙНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ИМПУЛЬСОВ НА ОДНОРОДНОЙ СРЕДЕ С ПРОГРАММНО МЕНЯЮЩЕЙСЯ СТРУКТУРОЙ. Патент РФ №2331915 (20.08.2008).

21. Авраменко В.С. и др. ГЕНЕРАТОР СЛУЧАЙНОЙ ПОСЛЕДОВАТЕЛЬНОСТИ. Патент РФ №2313125 (20.12.2007).

22. Малышев И.И. и др. ФОРМИРОВАТЕЛЬ М-ПОСЛЕДОВАТЕЛЬНОСТЕЙ. Патент РФ №2419224 (20.05.2011).

23. Тетерич Н.М. Генераторы шума и измерение шумовых характеристик, изд.2, перераб. и доп. - М.: Энергия, 1968.

24. Степаненко И.П. Основы теории транзисторов и транзисторных схем. Изд. 3-е. - М.: Энергия, 1973. - 608 с.

25. Блихер А. Физика тиристоров: Пер. с англ.: Под ред. И.В. Грехова. - Л.: Энергоиздат, 1981.

26. Habib S.E., Simmons J.G. Theory of switching in p-n-insulator (tunnel)-metal devices. PI.-Solid State Electron., 1979, v.22, p.181-192.

27. Фомичева О.Ф., Григорьева В.А., Свердлова А.М. Эффекты переключения в слоистых структурах на основе кремния // Электронная техника. сер. Материалы, вып.9(182), 1983, с.19-25.

28. Федоренко Я.Г. Динамические характеристики кремниевых МДП-структур с p-n переходом в подложке: дисс. к.ф.-м.н., спец. 01.04.10, Саратов, 1998. - 156 с.

29. Мантуров А.О. Математическое моделирование нелинейных эффектов в мультистабильных полупроводниковых системах: дисс. к.ф.-м.н., спец. 05.13.18, Саратов, 2001. - 162 с.

30. Муравский Б.С., Яманов И.Л. Неравновесные электронные процессы в слоистых структурах с поверхностно-барьерным переходом // ФТП, 1987, т.21, в.5, с.961.

31. Карева Г.Г., Векслер М.И. Электрофизические явления в структуре металл/наноокисел/p+ -кремний при трансформации ее в резонансно-туннельный диод: - Физика и техника полупроводников, 2013, том 47, вып. 8, с.1087-1093

1. Способ секвенирования ДНК, включающий:
А) обеспечение устройства, содержащего жидкостную систему, компьютерную систему обработки детектируемых сигналов и получения результатов секвенирования и систему детекции на основе четырех сенсоров, где на рабочей поверхности каждого сенсора иммобилизуют множество фрагментов ДНК, или обеспечивают наличие фрагментов ДНК в растворе, при этом в качестве сенсора используют МДП-диод, чувствительный к ионам водорода в растворе, при этом копии секвенируемых фрагментов ДНК помещают в четыре раствора, каждый из которых характеризуется пониженной концентрацией одного из видов нуклеотидов, по сравнению с остальными тремя видами нуклеотидов, таким образом, что каждый вид нуклеотидов имеет пониженную концентрацию только в одном растворе, подаваемом на соответствующий сенсор;
Б) введение полимеразы ДНК в контакт с секвенируемыми фрагментами ДНК;
В) измерение момента присоединения полимеразой ДНК нуклеотида к растущей цепи ДНК за счет получения сигнала от каждого сенсора, регистрирующего сигнал от появления ионов водорода в растворе, в режиме стохастического резонанса, который обеспечивают выбором рабочей точки МДП-диода посередине участка бистабильности при дополнительном воздействии сигнала шума на сигнал сенсора;
Г) получение четырех сигналов, по одному сигналу с выходов усилителей каждого из четырех сенсоров, и проведение обработки данных с помощью компьютера для определения интервала времени перед встраиванием каждого нуклеотида в молекулу ДНК, при этом по наличию большего интервала времени делают вывод о присоединении нуклеотида с пониженной концентрацией в растворе и определяют расположение данного нуклеотида в секвенируемой ДНК, при этом последовательность нуклеотидов в секвенируемой ДНК восстанавливают путем совмещения полученных данных о расположении нуклеотидов с пониженной концентрацией в каждом из четырех растворов.

2. Устройство для секвенирования ДНК, содержащее жидкостную систему, компьютерную систему обработки измеренных данных и получения результатов секвенирования, систему детекции на основе МДП-сенсоров, чувствительных к выбросам ионов водорода в раствор, характеризующееся тем, что система детекции содержит четыре сенсора и дополнительно содержит источник напряжения смещения и генератор шума, при этом в качестве сенсора используют структуру с возможностью формирования режима стохастического резонанса, которая выполнена на основе МДП-диода, позволяющего обеспечить работу сенсора посередине участка бистабильности на его ВАХ за счет смещения рабочей точки МДП-диода, для чего один вывод источника смещения подключен к катоду сенсора, а другой вывод подключен к генератору шума, при этом анод МДП-диода является выходом сенсора и подключен ко входу усилителя напряжения, выход которого подключен ко входу аналого-цифрового преобразователя, связанного со входом компьютерной системы, где МДП-диод состоит из многослойной конструкции, включающей соединенный с анодом первый металлический контакт, который размещен на нижнем слое p-Si, верхняя поверхность которого соединена с нижней поверхностью слоя n-Si, который, в свою очередь, защищен слоем SiO2, на верхней поверхности которого образована рабочая зона или для иммобилизации фрагментов ДНК, или для формирования ячейки, в которой фрагменты ДНК могут быть не иммобилизованы, и второй металлический слой, соединенный с катодом МДП-диода.

3. Устройство для секвенирования ДНК, содержащее жидкостную систему, компьютерную систему обработки измеренных данных и получения результатов секвенирования и систему детекции на основе МДП-сенсоров, чувствительных к выбросам ионов водорода в раствор, характеризующееся тем, что система детекции содержит четыре сенсора и дополнительно содержит источник напряжения смещения и генератор шума, где в качестве сенсора используют структуру с возможностью формирования режима стохастического резонанса, которая выполнена на основе МДП-диода, позволяющего обеспечить работу сенсора посередине участка бистабильности на его ВАХ за счет смещения рабочей точки МДП-диода, для чего один вывод источника смещения подключен к катоду устройства, а другой вывод подключен к генератору шума, при этом анод МДП-диода является выходом сенсора и подключен ко входу усилителя тока, выход которого подключен к одному из входов аналого-цифрового преобразователя, связанного со входом компьютерной системы, при этом МДП-диод состоит из многослойной конструкции, включающей соединенный с анодом первый металлический контакт, который размещен на нижнем слое p-Si, верхняя поверхность которого соединена с нижней поверхностью слоя n-Si, верхняя поверхность которого покрыта слоем диэлектрика, который выбирают из группы, состоящей из SiO2, нитрида кремния Si3N4, оксида тантала Ta2O5, алмазоподобной пленки, на верхней поверхности которого образована рабочая зона для иммобилизации фрагментов ДНК, или для формирования ячейки, в которой фрагменты ДНК могут быть не иммобилизованы.

4. Устройство для секвенирования ДНК, содержащее жидкостную систему, компьютерную систему обработки измеренных данных и получения результатов секвенирования, систему детекции на основе сенсоров, чувствительных к выбросам ионов водорода в раствор, характеризующееся тем, что система детекции содержит четыре сенсора и дополнительно содержит четыре электронных блока, а также источник напряжения смещения и генератор шума, где в качестве сенсора используют измерительную ячейку, один из электродов которой подключен ко входу электронного блока, имеющего вольт-амперную характеристику с областью бистабильности, с возможностью формирования режима стохастического резонанса, выход блока подключен ко входу усилителя, выход которого подключен к одному из входов аналого-цифрового преобразователя, выход которого связан со входом компьютерной системы, при этом другой электрод ячейки, через источник напряжения смещения, подключен к генератору шума.



 

Похожие патенты:

Изобретение относится к области молекулярной биологии, биохимии, иммунологии и генетической инженерии. Предложена композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце.

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов. Набор состоит из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, элюирующего буфера на основе раствора 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8 и 80% этилового спирта в качестве отмывочного буфера.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.

Изобретение относится к биотехнологии и представляет собой способ спектрального анализа флуоресцентных свойств нуклеотидных последовательностей ДНК. Предложенное изобретение может быть использовано для генетической диагностики, исследования митогенетического излучения клеток, исследования кодирования наследственной и пролиферативной информации.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.

Изобретение относится к области молекулярной биологии и биотехнологии и касается сухой смеси для амплификации нуклеиновой кислоты и способа ее получения. Охарактеризованная смесь содержит термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты и второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Tannerella forsythensis методом полимеразной цепной реакции.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра.

Изобретение относится к медицине и биологии и предназначено для использования при проведении ПЦР-исследований. Устройство для полимеразной цепной реакции содержит, по крайней мере, четыре части, каждая из которых имеет две плоские, параллельные поверхности, перпендикулярные общей оси, и отверстия.

Изобретение относится к области биохимии. Предложен олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом ПЦР с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена SOWgp82 С. posadasii. Зонд имеет структуру 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3', где ROX - флуоресцентный краситель карбокси-Х-родамин, BHQ2 - гаситель флуоресценции. Изобретение позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать ДНК С. posadasii в чистой культуре и биологическом материале. 1 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии. Описан способ предсказания ответа субъекта на терапевтическое средство для лечения ревматоидного артрита (RA). Также представлен способ предсказания, будет ли субъект с RA отвечать на лечение антагонистом В-клеток. Кроме того, представлен способ предсказания того, будет ли субъект с ревматоидным артритом эффективно отвечать на лечение антагонистом В-клеток, и способ выбора терапии пациента или субпопуляции пациентов с ревматоидным артритом. Все способы включают измерение в биологическом образце, полученном от субъекта, экспрессии одного гена или их комбинации или экспрессии одного белка или их комбинации, кодируемой одним геном или их комбинацией, где один ген или их комбинация выбраны из любого из CXCL13, FcRH5 и sFcRH5. Изобретение расширяет диагностические возможности в отношении RA. 4 н. и 16 з.п. ф-лы, 14 ил., 13 табл.

Группа изобретений относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека. Группа изобретений представлена набором дифференцирующих олигонуклеотидных зондов, биочипом, содержащим эти зонды, и способом применения биочипа для анализа. Биочип обеспечивает возможность определения 10 гаплогрупп Y-хромосомы человека. Определение гаплогруппы осуществляется посредством генотипирования Y-хромосомы по 10 маркерам: М130 (С), М145 (DE), P257 (G), Мб9 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R) с использованием биочипа, на котором иммобилизованы олигонуклеотиды, последовательность которых определена в табл.1. Структура дифференцирующих олигонуклеотидов, используемых в каждом изобретении группы, позволяет обеспечить их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. 3 н.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии, а именно к способу пренатальной и постнатальной ДНК-диагностики синдрома Дауна, Эдвардса и Патау, мутации delF508 в гене муковисцидоза и резус-фактора плода методом количественной флюоресцентной полимеразной цепной реакции. Способ включает выделение ДНК из анализируемого материала сорбентом Nucleos набора DIAtom DNA Prep 100. Проводят элюацию ДНК дистиллированной стерильной водой. Осуществляют две мультиплексные амплификации с использованием набора флюоресцентно-меченых праймеров - первая на 4 локуса 21-й хромосомы, а именно D21S1435, D21S1411, D21S11 и IFNAR, на мутацию delF508 в гене муковисцидоза и на участок 10 экзона гена RhD, вторая - на 4 локуса 13 хромосомы, а именно D13S628, D13S634, D13S742, D13S305, и 4 локуса 18 хромосомы, а именно D18S386, D18S391, D18S535, D18S978. Смешивают полученные ПЦР-продукты в одной лунке. Проводят детекцию методом капиллярного электрофореза в полиакриламидном геле. Изобретение позволяет с высокой точностью диагностировать наличие синдромов Патау, Эдвардса и Дауна, мутации delF508 в гене муковисцидоза и резус принадлежности плода. 1 з.п. ф-лы, 4 ил., 1 табл., 4 пр.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a. Способ с помощью ПЦР-РВ проводят при следующем температурном режиме: 1) 5 мин предварительной денатурации кДНК при 94°С; 2) 5 циклов реакции (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 15 сек); 3) 35 циклов реакции с детекцией на стадии отжига праймеров (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 20 сек). Учет результатов реакции проводят, анализируя кривые накопления флуоресцентного сигнала для каждой пробы. Представлен нуклеотидный состав указанных праймеров и зонда: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'. Изобретение позволяет сократить время проведения исследования, а также осуществлять не только качественный, но и количественный анализ содержания НК в образцах. 3 н.п. ф-лы, 4 табл., 6 пр.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного. Представленное изобретение может быть использовано при получении безопасных фармацевтических продуктов, терапевтически эффективных при применении у человека. 14 з.п. ф-лы, 10 ил., 11 табл., 6 пр.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека. Указанный набор содержит прямой праймер 5'-ATCCWCTTGADAACGGTRAACC-3', обратный праймер 5'-RGGRATAAAGAGMGAGCYCAA-3' и флуоресцентно-меченый ДНК-зонд 5'-Cy5-CGCCGTGGCTCCTGCTC-BHQ2-3'. Изобретение обеспечивает надежную и достоверную детекцию бокавируса человека в клинических образцах и других биологических материалах методом ПЦР. 2 ил., 3 табл.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека. Указанный набор содержит две пары олигонуклеотидных праймеров и два флуоресцентно-меченых ДНК-зонда, а именно внешний прямой праймер 5'-AGRCARCARAGTTAYTCYATYATGTC-3', внешний обратный праймер 5'-AATTTATTATWGGTTYMCCYTTTACATA-3', прямой праймер 5'-GACACHATGAAYAGYTTRACATTACC-3', обратный праймер 5'-AAATGTYTTTATDATYCCRCGATTT-3', зонды 5'-FAM-TCTCTAGGAGCCATTGTGTCATGCTATGG-BHQ1-3' и 5'-FAM-TCTCTWGGAGCYATAGTGTCATGYTATGG-BHQ1-3'. Изобретение обеспечивает надежную и достоверную детекцию респираторно-синцитиального вируса человека в клинических образцах и других биологических материалах методом ПЦР. 1 ил., 5 табл.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита. Изобретение позволяет повысить чувствительность и точность детектирования единичных молекул. 4 н. и 19 з.п. ф-лы, 6 ил., 4 пр.

Изобретение относится к области биохимии, в частности к набору реагентов и способу для выявления ДНК возбудителей чумы, сибирской язвы и туляремии. Набор содержит шесть видоспецифичных олигонуклеотидных праймеров и три зонда, комплементарных фрагментам ДНК генов Yersinia pestis, Bacillus anthracis и Francisella tularensis. ДНК-мишенями для специфической амплификации являются фрагмент хромосомного гена уро2088 метилтрансферазы Yersinia pestis, фрагмент хромосомного гена sspE Bacillus anthracis и фрагмент хромосомной ДНК элемента вставки ISFtu5 Francisella tularensis. Изобретение позволяет быстро и высокоспецифично выявлять штаммы видов Y. pestis, B. anthracis и F. tularensis, независимо от плазмидного профиля штаммов. 2 н.п. ф-лы, 3 ил., 5 табл., 2 пр.
Наверх