Улучшенные вакцины против bordetella pertussis на основе мутантных гликозилтрансфераз lps

Изобретение относится к области биотехнологии и иммунологии. Представлена клетка-хозяин Bordetella pertussis, Bordetella bronchiseptica или Bordetella parapertussis, которая используется в качестве адъюванта или для профилактики или лечения коклюша, имеющая сниженную активность эндогенной гликозилтрансферазы с по меньшей мере 98% идентичностью с аминокислотной последовательностью SEQ ID NO: 2 по сравнению с активностью гликозилтрансферазы соответствующего родительского штамма, где сниженная активность достигается применением инактивирующего вектора, который вызывает инактивацию экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, или приводит к сниженному уровню экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, слиянием последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, со слабым или индуцибельным промотором. Раскрыт препарат, состоящий из LPS из указанной клетки-хозяина с увеличенной заменой гексозамином 1' или 4' фосфатных групп части LPS, относящейся к липиду А, по сравнению с препаратом LPS из соответствующего родительского штамма, и посредством чего LPS характеризуется получением по меньшей мере 8 ионов в ESI-MS спектре, где препарат используется в качестве адъюванта или для профилактики или лечения коклюша. Предложено применение указанных клетки-хозяина или препарата LPS для получения лекарственного средства для профилактики и/или лечения коклюша, или получения лекарственного средства для иммунизации млекопитающего, где клетка-хозяин или LPS используются в качестве адъюванта. Описана фармацевтическая композиция, используемая в качестве адъюванта или для профилактики или лечения инфекции Bordetella, содержащая указанную клетку-хозяина или указанный препарат LPS в эффективном количестве и фармацевтически приемлемый носитель. Изобретение позволяет получить фармацевтический препарат клеток Bordetella или LPS, обладающий повышенной иммуногенностью по сравнению с препаратом из соответствующего родительского штамма Bordetella. 9 н. и 3 з.п. ф-лы, 7 ил., 3 табл., 1 пр.

 

Область, к которой относится изобретение

Изобретение относится к улучшенной вакцине против коклюша, содержащей мутантные штаммы Bordetella pertussis с модифицированной молекулой LPS и/или молекулами LPS, полученными из этих мутантных штаммов. Эти мутантные штаммы и/или получаемые молекулы LPS могут быть дополнительно использованы в качестве адъюванта.

Предпосылки к созданию изобретения

LPS представляет собой амфифильную молекулу, расположенную на внешней стороне наружной мембраны грамотрицательных бактерий. LPS обладает как эндотоксической активностью, так и адъювантной активностью. Оба свойства основаны на распознавании его рецепторным комплексом TLR4/MD-2 хозяина (обзор представлен у Pålsson-McDermott и O'Neill, 2004; O'Neill, 2006). LPS состоит из трех различных структурных доменов: липида A, ядра и O-антигена. Липид A функционирует как гидрофобный мембранный якорь и образует биологически активный компонент молекулы (Takada and Kotani, 1989). Область ядра состоит из сложного олигосахарида, который, по сравнению с О-антигеном, демонстрирует только ограниченную структурную вариабельность. В некоторых бактериях, например Enterobacteriaceae, олигосахарид ядра (ядерный OS) можно разделить на внутреннее ядро и внешнее ядро. Внешнее ядро главным образом состоит из гексоз в пиранозной форме, например D-глюкозы, D-галактозы и D-глюкозамина, тогда как внутреннее ядро главным образом состоит из октулозоновых кислот и гептопираноз. У подавляющего большинства грамотрицательных бактерий ядерный домен соединен с доменом липида А особым углеводом, 2-кето-3-дезоксиоктулоновой кислотой (Kdo) (Raetz и Whitfield, 2002). O-антиген содержит наиболее вариабельную часть LPS и придает бактериям специфичность серотипа. О-антиген состоит из повторяющихся сахарных субъединиц одного-восьми сахаров. Каждая О-цепь может содержать вплоть до 50 таких субъединиц. О-антиген участвует в ускользании бактерий от иммунологического надзора, особенно ускользании от сывороточного комплемент-опосредованного лизиса (Raetz and Whitfield, 2002).

В отличие от LPS Bordetella bronchiseptica и Bordetella parapertussis, LPS Bordetella pertussis никогда не содержит О-антигенный домен (Peppler, 1984; Di Fabio et al., 1992). Следовательно, LPS B. pertussis зачастую называют липоолигосахаридом. B. pertussis продуцирует две доминантные формы LPS, LPS группы А и группы В (Peppler, 1984). LPS группы В состоит из липида А и олигосахарида ядра, состоящего из 9 углеводов (Caroff et al., 2000). Добавление концевого трисахарида, состоящего из N-ацетилглюкозамина, 2,3-диацетамидо-2,3-дидезоксиманнуроновой кислоты и 2-ацетамидо-4-N-метил-2,4-дидезоксифукозы к LPS группы В образует LPS, называемый группой А.

У Escherichia coli и Salmonella enterica серовар Typhimurium, генный кластер биосинтеза ядерного OS состоит из трех оперонов, обозначенных gmhD, waaQ, и WaaA опероны. Оперон gmhD состоит из четырех генов, gmhD и waaFCL, которые вовлечены в синтез внутреннего ядра (Schnaitman и Klena, 1993). Гены gmhD, waaF, и waaC кодируют белки, вовлеченные в биосинтез и трансфер гептоз I и II к Kdo2-липид A (Schnaitman и Klena, 1993), тогда как продукт гена waaL представляет собой лигазу, которая вовлечена в присоединение O-антигена (MacLachlan et al., 1991). Оперон waaQ является самым большим из трех оперонов и кодирует белки, которые вовлечены в биосинтез наружного ядра и в модификацию/декорацию ядерного OS. Количество и типы генов, находящихся в опероне waaQ, отличаются в штаммах, что объясняет штамм-специфичные различия в структуре ядра (Heinrichs et al., 1998). Оперон waaA зачастую кодирует только один белок, KdtA. Только в E. coli K-12 присутствует дополнительная, не относящаяся к LPS открытая рамка считывания (ORF) (Raetz и Whitfield, 2002). Ген kdtA Enterobacteriaceae кодирует бифункциональную Kdo трансферазу, которая добавляет два остатка Kdo в биосинтез Kdo2-липид A (Clementz and Raetz, 1991).

Хотя ядерный OS Bordetella и E. coli демонстрирует некоторое сходство, точный состав и конфигурация остатков проявляют заметные отличия. Например, ядерный OS Bordetella содержит только остаток Kdo, вместо двух или трех остатков, которые обнаруживаются у большинства других грамотрицательных бактерий, в том числе E. coli. Недавно это было показано благодаря функционированию Bordetella KdtA как монофункциональной, а не бифункциональной Kdo трансферазы (Isobe et al., 1999). Ферменты, ответственные за синтез оставшейся части ядерного OS Bordetella, в настоящее время неизвестны, и ожидается их дальнейшая идентификация.

Хотя липид A в основном рассматривается в качестве основной детерминанты для биологической активности LPS через активацию рецепторного комплекса TLR4/MD-2, область олигосахарида также может играть важную роль во взаимодействии с антиген-презентирующими клетками (APC). Рецепторы, вовлеченные в этот тип распознавания LPS, включают рецептор комплемента CR3 и фагоцитарный рецептор SR-A (van Amersfoort et al., 2003; Plüddemann et al., 2006).

Некоторые вакцины Bordetella pertussis уже применялись. Введение цельноклеточных коклюшных вакцин (wP) в 1940-х и 1950-х годах и позднее бесклеточных коклюшных вакцин (aP) в 1980-х и 1990-х, привело к постепенному снижению заболеваемости коклюшем и снижению распространения этого заболевания и смертности от этого заболевания до низких уровней. Несмотря на обширную зону вакцинации, заболевание коклюшем остается эндемическим и продолжает демонстрировать циклический характер с пиками заболеваемости каждые 2-5 лет. За последние два десятилетия некоторые страны, в том числе Нидерланды, испытали повышение числа сообщенных случаев коклюша. Интересно то, что в некоторых областях также наблюдалось изменение в распределении по возрасту. Тогда как в эру пре-вакцинации и ранней вакцинации о случаях коклюша преимущественно сообщалось у маленьких детей, в последние годы увеличивающуюся долю случаев составляли взрослые и подростки. Было предложено несколько причин возрождения описанных случаев коклюша, в том числе: (1) генетические изменения циркулирующих штаммов B. Pertussis, которые снижают эффективность вакцин, (2) сниженная эффективность коклюшевых вакцин, (3) снижение иммунитета, (4) увеличение сообщений о случаях коклюша, и (5) улучшение диагностики заболевания коклюшем.

Таким образом, все еще остается необходимость в новых вакцинах против Bordetella pertussis, у которых отсутствуют недостатки существующих вакцин.

Описание изобретения

Настоящее изобретение основано на гипотезе, что мутантные штаммы B. pertussis с измененной олигосахаридной цепью могут затрагиваться в их взаимодействии с дендритными клетками (DC). Специфическое нацеливание на антиген-презентирующие клетки (APC), такие как DC, могло бы предположительно повлиять на исход иммунной реакции против цельноклеточной коклюшной вакцины. В качестве первого шага в сторону улучшения цельноклеточных вакцин таким путем, авторы изобретения в настоящий момент идентифицировали генный кластер, вовлеченный в биосинтез олигосахарида LPS в B. pertussis. В особенности два гена в этом кластере при инактивации или гиперэкспрессии дают мутантные штаммы, обладающие улучшенными потенциальными возможностями взаимодействовать с DC и активировать их.

Полипептиды

В первом аспекте изобретение относится к двум полипептидам.

Первый полипептид представляет собой деацетилазу полисахаридов и имеет аминокислотную последовательность, по меньшей мере на 50% идентичную аминокислотной последовательности SEQ ID NO:1.

Второй полипептид представляет собой гликозилтрансферазу и имеет аминокислотную последовательность, по меньшей мере на 50% идентичную аминокислотной последовательности SEQ ID NO:2.

Активность деацетилазы полисахаридов относительно полипептида гликозилтрансферазы предпочтительно определяется гиперэкспрессией относительно инактивации соответствующего кодируемого гена в штамме Bordetella pertussis, определенного далее в настоящей заявке, и анализом получаемого LPS. В тех случаях, когда LPS, продуцированный трансформированным штаммом Bordetella pertussis, содержит по меньшей мере детектируемые количества LPS по изобретению, как определено далее в настоящей заявке, говорят, что деацетилаза полисахарида, соответственно полипептиды гликозилтрансферазы являлись активными и функциональными. Детектируемые количества LPS предпочтительно определяются, как описано в примерах: после выделения с помощью экстракции горячим фенолом/водой (Westphal and Jann, 1965), O-дезацетилированием мягким гидролизом (Holst 2000) и анализом с помощью ESI-MS (масс-спектрометрия с ионизацией электрораспылением) в режиме определения отрицательных ионов.

В соответствии с еще более предпочтительным вариантом осуществления, полипептид по меньшей мере на 50%, 55%, 60%, 65%, 70%, 75%, 80% или 85%, еще более предпочтительно по меньшей мере на 90%, 92%, 95%, 97%, 98% или 99% идентичен аминокислотной последовательности SEQ ID NO:1. В наиболее предпочтительном варианте осуществления деацетилаза полисахарида имеет последовательность SEQ ID NO:1. Эта деацетилаза полисахарида происходит из Bordetella pertussis. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO:1, представлена в SEQ ID NO:3.

В соответствии с другим еще более предпочтительным вариантом осуществления, полипептид по меньшей мере на 50%, 55%, 60%, 65%, 70%, 75%, 80% или 85%, еще более предпочтительно по меньшей мере на 90%, 92%, 95%, 97%, 98% или 99% идентичен аминокислотной последовательности SEQ ID NO:2.

В предпочтительном варианте осуществления гликозилтрансфераза имеет SEQ ID NO:2. Эта гликозилтрансфераза происходит из Bordetella pertussis. Последовательность нуклеиновой кислоты, кодирующей аминокислотную последовательность SEQ ID NO:2, представлена в SEQ ID NO:4.

Процент идентичности вычисляют как число идентичных аминокислотных остатков между выровненными последовательностями, разделенное на длину выровненных последовательностей минус длина всех разрывов. Выравнивание множества последовательностей проводили с помощью программы оптимального выравнивания DNAman 4.0, используя настройки по умолчанию. Выравнивание обычно проводят между последовательностями, определяемыми их SEQ ID NO или их частями. Предпочтительно, выравнивание проводят, используя последовательности, определяемые их SEQ ID NO.

Специалисту в данной области будет понятно, что полипептиды по настоящему изобретению могли быть получены из других организмов, отличных от Bordetella pertussis, при условии, что они обладают требуемой активностью и идентичностью. В предпочтительном варианте осуществления, каждый полипептид, как определено выше, получен из видов Bordetella, таких как pertussis, bronchiseptica, parapertussis. Наиболее предпочтительно, каждый полипептид, определенный выше, получают из Bordetella pertussis. Один отдельный штамм Bordetella pertussis или несколько различных штаммов Bordetella pertussis могут иметь несколько гомологичных полипептидов в соответствии с настоящим изобретением.

В соответствии с другим предпочтительным вариантом осуществления, полипептид по изобретению представляет собой вариант любой из полипептидных последовательностей, определенных ранее. Вариант полипептида может представлять собой неприродную форму полипептида. Вариант полипептида может отличаться вследствие использованных методов генной инженерии от полипептида, выделенного из природного источника. Вариант может быть создан с помощью сайт-направленного мутагенеза, начиная с аминокислотной последовательности SEQ ID NO:1 или с SEQ ID NO:2 или с последовательности нуклеиновой кислоты, кодирующей аминокислотную последовательность SEQ ID NO:1, которая представляет собой SEQ ID NO:3, или из последовательности нуклеиновой кислоты, кодирующей аминокислотную последовательность SEQ ID NO:2, которая представляет собой SEQ ID NO:4. Предпочтительно, вариант полипептида содержит мутации, которые не изменяют биологическую функцию кодируемого полипептида. Биологическая функция или активность либо деацетилазы полисахарида, либо гликозилтрансферазы уже была определена в настоящем описании.

В другом аспекте настоящего изобретения представлена деацетилаза полисахарида, соответственно гликозилтрансфераза, как определено ранее, обе для применения для производства лекарственного средства. Предпочтительно, указанное лекарственное средство представляет собой вакцину или адъювант, как определено далее в настоящем описании.

Последовательности нуклеиновой кислоты

Во втором аспекте настоящего изобретения представлены две последовательности нуклеиновой кислоты.

Первая последовательность кодирует деацетилазу полисахарида, имеющую аминокислотную последовательность, по меньшей мере на 50% идентичную аминокислотной последовательности SEQ ID NO:1, предпочтительно имеющую аминокислотную последовательность SEQ ID NO:1, и/или происходящую из видов Bordetella, предпочтительно Bordetella pertussis.

Первая последовательность нуклеиновой кислоты предпочтительно представляет собой последовательность нуклеиновой кислоты по меньшей мере на 50% идентичную последовательности нуклеиновой кислоты SEQ ID NO:3. Предпочтительно, идентичность составляет по меньшей мере 55%, более предпочтительно по меньшей мере 60%, более предпочтительно по меньшей мере 65%, более предпочтительно по меньшей мере 70%, более предпочтительно по меньшей мере 75%, более предпочтительно по меньшей мере 80%, более предпочтительно по меньшей мере 85%, более предпочтительно по меньшей мере 90%, более предпочтительно по меньшей мере 95%, еще более предпочтительно по меньшей мере 98% и еще более предпочтительно по меньшей мере 99%. Наиболее предпочтительно, последовательность нуклеиновой кислоты имеет последовательность нуклеиновой кислоты SEQ ID NO:3. SEQ ID NO:3 соответствует NP_8809668.

Вторая последовательность нуклеиновой кислоты кодирует гликозилтрансферазу, имеющую аминокислотную последовательность, по меньшей мере на 50% идентичную аминокислотной последовательности SEQ ID NO:2, предпочтительно имеющую аминокислотную последовательность SEQ ID NO:2 и/или происходящую из видов Bordetella, предпочтительно Bordetella pertussis.

Вторая последовательность нуклеиновой кислоты предпочтительно представляет собой последовательность нуклеиновой кислоты, по меньшей мере на 50% идентичную последовательности нуклеиновой кислоты SEQ ID NO:4. Предпочтительно, идентичность составляет по меньшей мере 55%, более предпочтительно по меньшей мере 60%, более предпочтительно по меньшей мере 65%, более предпочтительно по меньшей мере 70%, более предпочтительно по меньшей мере 75%, более предпочтительно по меньшей мере 80%, более предпочтительно по меньшей мере 85%, более предпочтительно по меньшей мере 90%, еще более предпочтительно по меньшей мере 95%, еще более предпочтительно по меньшей мере 98% и еще более предпочтительно по меньшей мере 99%. Наиболее предпочтительно, последовательность нуклеиновой кислоты имеет последовательность нуклеиновой кислоты SEQ ID NO:4. SEQ ID NO:4 соответствует NP_8809669.

Процент идентичности определяли путем вычисления отношения числа идентичных нуклеотидов в последовательности, разделенного на длину всех нуклеотидов минус длина всех разрывов. Выравнивание множественных последовательностей ДНК проводили, с помощью DNAman version 4.0, используя программу Optimal Alignment (Full Alignment). Минимальная длина релевантной последовательности ДНК, демонстрирующей 50% или более высокий уровень идентичности, должна быть 40 нуклеотидов или длиннее. Выравнивание обычно проводят между последовательностями, определяемыми их SEQ ID NO или их частей. Предпочтительно, выравнивание проводят, используя последовательности, определяемые их SEQ ID NO.

В соответствии с другим предпочтительным вариантом осуществления, последовательность нуклеиновой кислоты по изобретению представляет собой вариант любой из последовательностей нуклеиновой кислоты, определенной выше. Варианты последовательности нуклеиновой кислоты могут быть использованы для получения вариантов полипептида, определенных ранее. Вариант нуклеиновой кислоты может представлять собой фрагмент любой из последовательностей нуклеиновой кислоты, определенных выше. Вариант нуклеиновой кислоты также может представлять собой последовательность нуклеиновой кислоты, которая отличается от SEQ ID NO:3 или SEQ ID NO:4 вследствие вырожденности генетического кода. Вариант нуклеиновой кислоты также может представлять собой аллельный вариант SEQ ID NO:3 или SEQ ID NO:4. Аллельный вариант означает любую из двух или более альтернативных форм гена, занимающего один и тот же хромосомный локус. Предпочтительный вариант нуклеиновой кислоты представляет собой последовательность нуклеиновой кислоты, которая содержит молчащую мутацию (мутации). Альтернативно или в сочетании, вариант нуклеиновой кислоты также может быть получен путем введения нуклеотидных замен, которые не дают начало другой аминокислотной последовательности полипептида, кодируемого последовательностью нуклеиновой кислоты, но которая соответствует частоте использования кодона организмом-хозяином, предназначенным для получения полипептида по настоящему изобретению. В соответствии с предпочтительным вариантом осуществления, вариант нуклеиновой кислоты кодирует полипептид, все еще проявляющий свою биологическую функцию, определенную ранее в настоящем описании. Более предпочтительно, вариант последовательности нуклеиновой кислоты кодирует полипептид, проявляющий активность деацетилазы полисахарида или гликозилтрансферазы соответственно. Последовательности нуклеиновой кислоты, кодирующие такой полипептид, могут быть выделены из любого микроорганизма.

Все эти варианты могут быть получены, используя методики, известные специалисту, такие как скрининг библиотеки гибридизацией (методики саузерн-блоттинга) в условиях гибридизации от низких к средним и к высоким в отношении последовательности нуклеиновой кислоты SEQ ID NO:3 или SEQ ID NO:4 или ее варианта, которая может быть использована для создания зонда. Условия строгости от низким к средним и к высоким означают прегибридизацию и гибридизацию при 42°C в 5X SSPE, 0,3% SDS, 200 пг/мл расщепленной и денатурированной ДНК спермы лосося, и либо 25%, 35% или 50% формамида для низкой-средней-высокой строгости соответственно. Затем, реакцию гибридизации промывают три раза в течение 30 минут каждый, используя 2XSSC, 0,2% SDS и либо 55°C, 65°C или 75°C для низкой-средней-высокой строгости.

Информация о последовательностях, представленная в настоящем описании, не должна быть настолько узко интерпретирована, чтобы требовалось включение ошибочно идентифицированных оснований. Специалист может идентифицировать такие ошибочно идентифицированные основания и знает, как скорректировать такие ошибки.

В другом аспекте настоящего изобретения представлена нуклеиновая кислота, кодирующая деацетилазу полисахарида, соответственно гликозилтрансферазу, как определено ранее, обе нуклеиновые кислоты предназначены для применения для получения лекарственного средства. Предпочтительно указанное лекарственное средство представляет собой вакцину или адъювант, как определено далее в настоящем описании.

Конструкция нуклеиновой кислоты

Еще в одном аспекте настоящее изобретение относится к конструкции нуклеиновой кислоты, содержащей любую из последовательностей нуклеиновой кислоты, определенных в предыдущем разделе, указанная последовательность нуклеиновой кислоты кодирует полипептид, демонстрирующий:

- Активность в отношении полисахарида и имеющий аминокислотную последовательность, которая по меньшей мере на 50% идентична аминокислотной последовательности SEQ ID NO:1 или

- Активность в отношении гликозилтрансферазы и имеющий аминокислотную последовательность, которая по меньшей мере на 50% идентична аминокислотной последовательности SEQ ID NO:2.

Необязательно, последовательность нуклеиновой кислоты, присутствующая в конструкции нуклеиновой кислоты, оперативно связана с одной или несколькими контрольными последовательностями, которые направляют продукцию полипептида в подходящем экспрессионном хозяине.

В настоящем описании «оперативно связана» определяется как конфигурация, в которой контрольная последовательность соответствующим образом расположена в положении, по отношению к последовательности нуклеиновой кислоты, кодирующей полипептид по изобретению таким образом, что контрольная последовательность направляет продукцию полипептида по изобретению.

Будет понятно, что экспрессия включает любую стадию, вовлеченную в продукцию полипептида, в том числе, но не только, транскрипцию, пост-транскрипционную модификацию, трансляцию, пост-трансляционную модификацию и секрецию.

Конструкция нуклеиновой кислоты определяется как молекула нуклеиновой кислоты, которая выделена из природного гена или которая была модифицирована таким образом, чтобы содержать сегменты нуклеиновой кислоты, которые объединены или соединены способом, который в ином случае не существовал бы в природе.

Определенная в настоящем описании контрольная последовательность включает все компоненты, которые являются обязательными или предпочтительными для экспрессии полипептида. Как минимум, контрольные последовательности включают промотор и стоп-сигналы траскрипции и трансляции.

Вектор экспрессии

Настоящее изобретение дополнительно относится к вектору экспрессии, содержащему конструкцию нуклеиновой кислоты, содержащую последовательность нуклеиновой кислоты, кодирующую полипептид, проявляющий деацетилазную активность в отношении полисахарида и имеющий аминокислотную последовательность, которая по меньшей мере на 50% идентична аминокислотной последовательности SEQ ID NO:1, определенной в предыдущем разделе. Предпочтительно, вектор экспрессии содержит последовательность нуклеиновой кислоты, которая оперативно связана с одной или несколькими контрольными последовательностями, которые направляют продукцию кодируемого полипептида в подходящем для экспрессии хозяине. Как минимум, контрольные последовательности включают промотор и стоп-сигналы транскрипции и трансляции. Вектор экспрессии может рассматриваться как рекомбинантный вектор экспрессии. Вектором экспрессии может быть любой вектор (например, плазмида, вирус), который удобно подвергать методикам рекомбинантных ДНК и который может осуществлять экспрессию последовательности нуклеиновой кислоты, кодирующей этот полипептид. В зависимости от вида хозяина, в который будет введен вектор экспрессии и происхождения последовательности нуклеиновой кислоты по настоящему изобретению, специалист будет знать, как выбрать наиболее подходящий вектор экспрессии и контрольные последовательности. Наиболее предпочтительные клетки-хозяева представлены в разделе под названием клетки-хозяева.

В контексте настоящего изобретения вектор экспрессии при введении в клетку-хозяина приведет к тому, что в клетке повысится уровень экспрессии последовательности нуклеиновой кислоты, находящейся в векторе экспрессии, и/или повысится уровень экспрессии полипептида, кодируемого последовательностью нуклеиновой кислоты, находящейся в векторе экспрессии, и/или повысится уровень активности полипептида, кодируемого последовательностью нуклеиновой кислоты, находящейся в векторе экспрессии. В этом контексте, повышение оценивается в сравнении с клеткой-хозяином, которая не содержит указанный вектор экспрессии, и/или с клеткой-хозяином, которая не содержит эндогенный полипептид, по меньшей мере на 50% идентичный SEQ ID NO:1.

В другом аспекте настоящего изобретения представлен вектор экспрессии, охарактеризованный ранее, для использования, для получения лекарственного средства. Предпочтительно указанное лекарственное средство представляет собой вакцину или адъювант, как определено далее.

Инактивирующий вектор

Настоящее изобретение дополнительно относится к инактивирующему вектору, содержащему конструкцию нуклеиновой кислоты, содержащую последовательность нуклеиновой кислоты, кодирующую полипептид, проявляющий гликозилтрансферазную активность и имеющий аминокислотную последовательность, которая по меньшей мере на 50% идентична аминокислотной последовательности SEQ ID NO:2, охарактеризованной в предыдущем разделе. Инактивирующий вектор создают для снижения или инактивации экспрессии последовательности нуклеиновой кислоты, которая по меньшей мере на 50% идентична аминокислотной последовательности SEQ ID NO:2 в заданном хозяине.

Вектор инактивации можно рассматривать как рекомбинантный вектор экспрессии. Инактивирующим вектором может быть любой вектор (например, плазмида, вирус), который удобно подвергать методикам рекомбинантных ДНК и который может осуществлять инактивацию экспрессии последовательности нуклеиновой кислоты, как определено выше. В зависимости от вида хозяина, в который будет введен инактивирующий вектор, и происхождения последовательности нуклеиновой кислоты по изобретения, специалисту будет известно, как выбрать наиболее подходящий инактивирующий вектор. Наиболее предпочтительные клетки-хозяева представлены в разделе под названием клетки-хозяева.

В контексте настоящего изобретения, инактивирующий вектор при введении в клетку-хозяина будет приводить к тому, что в этой клетке будет уменьшенный (сниженный) уровень экспрессии последовательности нуклеиновой кислоты, находящейся в векторе экспрессии, и/или сниженный уровень экспрессии полипептида, кодируемого последовательностью нуклеиновой кислоты, находящейся в векторе экспрессии и/или сниженный уровень активности полипептида, кодируемого последовательностью нуклеиновой кислоты, находящейся в векторе экспрессии. В этом контексте, снижение предпочтительно оценивается сравнением с клеткой-хозяином, которая не содержит указанный инактивирующий вектор.

Снижение уровня экспрессии полипептида, проявляющего гликозилтрансферазную активность и имеющего аминокислотную последовательность, которая по меньшей мере на 50% идентична аминокислотной последовательности SEQ ID NO:2, и/или снижение уровня его активности достигалось традиционными способами, известными из уровня техники, например, инактивацией или отрицательной регуляцией экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей указанную гликозилтрансферазу у хозяина. Такая инактивация или отрицательная регуляция может достигаться делецией одного или нескольких нуклеотидов в последовательности нуклеиновой кислоты, кодирующей указанный полипептид. В другом варианте осуществления изобретение относится к хозяину, предпочтительно Bordetella, который имеет мутацию в последовательности нуклеиновой кислоты, кодирующей указанную гликозилтрансферазу. Предпочтительно для получения хозяина, имеющего инактивированную последовательность нуклеиновой кислоты, кодирующей гликозилтрансферазу, получают вектор замещения или инактивирующий вектор, и впоследствии вводят хозяину путем трансформации. Специалисту известно, как получить такой вектор.

Альтернативно или в сочетании с инактивацией последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, экспрессия последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, может быть снижена путем слияния ее со слабым промотором, подходящим для экспрессии белка на низком уровне в выбранном организме.

Альтернативно или в сочетании с инактивацией последовательности нуклеиновой кислоты, кодирующей эндогенную гликозилтрансферазу, экспрессию последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, можно сделать индуцибельной путем слияния ее с индуцибельным промотором, подходящим для индуцибельного уровня экспрессии белка в выбранном организме.

Альтернативно или в сочетании с изложенным ранее предпочтительным вариантом осуществления, инактивация последовательности нуклеиновой кислоты, кодирующей эндогенную гликозилтрансферазу предпочтительно достигается с помощью использования суицидного вектора. Более предпочтительно, суицидный вектор представляет собой pSS1129 (Stibitz et al., 1994).

В другом аспекте настоящего изобретения представлен инактивирующий вектор, охарактеризованный ранее, для применения для получения лекарственного средства. Предпочтительно указанное лекарственное средство представляет собой вакцину или адъювант, как определено далее в настоящем описании.

Клетка-хозяин

Еще в одном аспекте, изобретение относится к клетке-хозяину, содержащей вектор экспрессии по настоящему изобретению и/или инактивирующий вектор по настоящему изобретению, оба вектора охарактеризованы в предыдущих разделах. Выбор клетки-хозяина будет в большой степени зависеть от источника последовательности нуклеиновой кислоты по настоящему изобретению. В зависимости от типа клетки-хозяина, специалист знает, как трансформировать эту клетку конструкцией или вектором по настоящему изобретению.

Клеткой-хозяином может быть любая микробная, прокариотическая или эукариотическая клетка, которая подходит для экспрессии LPS по изобретению. В предпочтительном варианте осуществления клетка-хозяин представляет собой виды Bordetella, как упомянуто ранее в настоящем описании. Наиболее предпочтительно, Bordetella представляет собой Bordetella pertussis.

Методики, подходящие для трансформации Bordetella, могут включать способ, предусматривающий конъюгирование, в известной степени знакомый специалисту. Методики, подходящие для трансформации Bordetella, описаны у Stibitz et al., 1994.

В соответствии с первым предпочтительным вариантом осуществления, полученная таким образом клетка-хозяин имеет повышенный уровень экспрессии последовательности нуклеиновой кислоты, находящейся в векторе экспрессии, и/или имеет повышенный уровень экспрессии полипептида, кодируемого последовательностью нуклеиновой кислоты, находящейся в векторе экспрессии, и/или имеет повышенный уровень активности полипептида, кодируемого последовательностью нуклеиновой кислоты, находящейся в векторе экспрессии. В этом варианте осуществления, последовательность нуклеиновой кислоты, находящейся в экспрессирующей конструкции, кодирует полипептид, по меньшей мере на 50% идентичный SEQ ID NO:1. В этом контексте повышение оценивается сравнением с клеткой-хозяином, которая не содержит указанный вектор экспрессии и/или с клеткой-хозяином, которая не содержит эндогенный полипептид, по меньшей мере на 50% идентичный SEQ ID NO:1 при культивировании обеих клеток и/или анализе в одинаковых условиях.

«Повышенный уровень экспрессии полипептида» в настоящем описании предпочтительно определяется как продукция большего количества полипептида, как определено ранее, чем то количество, которое будет продуцировать родительская клетка-хозяин, из которой происходит трансформированная клетка при культивировании обоих типов клеток (родительской и трансформированных клеток) в одинаковых условиях. Предпочтительно, клетка-хозяин по настоящему изобретению продуцирует по меньшей мере на 3%, 6%, 10% или 15% больше полипептида по изобретению, по меньшей мере на 50% идентичного SEQ ID NO:1, чем будет продуцировать родительская клетка-хозяин, из которой происходит трансформированная клетка-хозяин при культивировании обоих типов клеток (родительской и трансформированных клеток) в одинаковых условиях. Также предпочтительными являются хозяева, которые продуцируют по меньшей мере на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% или 150% больше указанного полипептида, чем родительская клетка. В соответствии с другим предпочтительным вариантом осуществления уровень продукции этого полипептида клеткой-хозяином по настоящему изобретению сравнивают с уровнем продукции штаммом B213 Bordetella pertussis (Kasuga et al., 1953, см. также Таблицу 1), который взят в качестве контроля. В соответствии с еще более предпочтительным вариантом осуществления, в тех случаях, когда клетка-хозяин по изобретению представляет собой штамм Bordetella pertussis, уровень продукции полипептида клетки-хозяина по изобретению сравнивают с уровнем продукции штамма B213, как определено выше, который взят в качестве контроля.

Оценку уровня продукции полипептида можно проводить на уровне мРНК, путем проведения Нозерн-блоттинга или матричного анализа, и/или на уровне полипептида, проводя Вестерн-блоттинг. Все эти способы хорошо известны специалисту.

«Повышение активности полипептида» в настоящем описании определяется как проявление более высокой активности деацетилазы полисахарида, чем активность родительской клетки-хозяина, из которой происходит трансформированная клетка, используя анализ, специфичный для указанной активности. Предпочтительно, анализ представляет собой анализ, упомянутый в разделе полипептиды. Предпочтительно, клетка-хозяин по изобретению демонстрирует по меньшей мере на 3%, 6%, 10% или 15% более высокую активность деацетилазы полисахарида, чем будет демонстрировать родительская клетка-хозяин, из которой происходит трансформированная клетка, исследованную с помощью специфического для указанной активности анализа, который предпочтительно представляет собой анализ, упомянутый в разделе полипептиды. Также предпочтительным является хозяин, который демонстрирует по меньшей мере на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% или 150% больше указанной активности, чем родительская клетка. В соответствии с другим предпочтительным вариантом осуществления, уровень активности деацетилазы полисахарида клетки-хозяина по настоящему изобретению сравнивают с соответствующей активностью штамма B213, как определено выше, который взят в качестве контроля. В соответствии с более предпочтительным вариантом осуществления, в тех случаях, когда клетка-хозяин по изобретению представляет собой штамм Bordetella pertussis, уровень активности деацетилазы полисахарида клетки-хозяина по изобретению сравнивают с соответствующей активностью штамма B213, как определено ранее, который взят в качестве контроля.

Повышение экспрессии полипептида и/или активности может достигаться традиционными способами, известными из уровня техники, например введением в хозяина большего количества копий последовательности нуклеиновой кислоты, кодирующей деацетилазу полисахарида, будь то на носителе или в хромосоме, чем имеется в природе. Альтернативно, последовательность нуклеиновой кислоты, кодирующая деацетилазу полисахарида, может гиперэкспрессироваться посредством слияния ее с высоко экспрессируемым или сильным промотором, подходящим для высокого уровня экспрессии белка в выбранном организме, или сочетанием двух подходов. Специалисту будет понятно, какой сильный промотор является наиболее подходящим, в зависимости от типа клетки-хозяина. Предпочтительно, в тех случаях, когда клетка-хозяин представляет собой штамм Bordetella pertussis, сильным промотором является tac-промотор вектора pMMB67EH (Methods for General and Molecular Bacteriology, Editors P. Gerhardt et al., American Society for Microbiology, Washington DC, 1994, p.409-410).

Альтернативно или в сочетании с первым предпочтительным вариантом осуществления, настоящее изобретение относится ко второму предпочтительному варианту осуществления, в котором клетка-хозяин имеет сниженный уровень экспрессии последовательности нуклеиновой кислоты, кодирующей полипептид, по меньшей мере на 50% идентичный аминокислотной последовательности SEQ ID NO:2, и/или имеет сниженный уровень экспрессии указанного полипептида и/или имеет повышенный уровень активности указанного полипептида, предпочтительно посредством применения инактивирующего вектора по изобретению, охарактеризованного ранее в настоящем описании. В этом варианте осуществления последовательность нуклеиновой кислоты, находящейся в инактивирующем векторе, кодирует полипептид, по меньшей мере на 50% идентичный SEQ ID NO:2. В этом контексте снижение оценивают путем сравнения с клеткой-хозяином, которая не содержит такой инактивирующий вектор, при культивировании обеих клеток и анализе их в одинаковых условиях.

«Снижение уровня экспрессии полипептида» в настоящем описании предпочтительно определяется как продукция меньшего количества полипептида, охарактеризованного ранее, чем будет продуцировать родительская клетка, из которой происходит трансформированная клетка-хозяин, при культивировании обеих клеток (родительской и трансформированных клеток) в одинаковых условиях. Предпочтительно, клетка-хозяин по настоящему изобретению продуцирует по меньшей мере на 3%, 6%, 10% или 15% меньше полипептида по изобретению, по меньшей мере на 50% идентичного SEQ ID NO:2, чем будет продуцировать родительская клетка-хозяин, из которой происходит трансформированная клетка-хозяин при культивировании обеих типов клеток (родительской и трансформированных клеток) в одинаковых условиях. Также предпочтительными являются хозяева, которые продуцируют по меньшей мере на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% или 150% меньше указанного полипептида, чем родительская клетка. В соответствии с другим предпочтительным вариантом осуществления, уровень продукции этого полипептида клетки-хозяина по изобретению сравнивают с уровнем продукции штамма B213, охарактеризованного ранее, который взят в качестве контроля. В соответствии с еще более предпочтительным вариантом осуществления, в тех случаях, когда клетка-хозяин по изобретению представляет собой штамм Bordetella pertussis, уровень продукции полипептида клетки-хозяина по изобретению сравнивают с уровнем продукции штамма B213, охарактеризованного выше, который взят в качестве контроля.

Оценку уровня продукции полипептида можно проводить на уровне мРНК, путем проведения Нозерн-блоттинга или матричного анализа и/или на уровне полипептида, проводя Вестерн-блоттинг. Все эти способы хорошо известны специалисту.

«Снижение полипептидной активности» в настоящем описании определяется как проявление более низкой активности гликозилтрансферазы, чем активность родительской клетки-хозяина, из которой происходит трансформированная клетка, используя анализ, специфичный для указанной активности. Предпочтительно, анализ представляет собой анализ, уже описанный в настоящем описании в разделе полипептиды. Предпочтительно, клетка-хозяин по изобретению проявляет по меньшей мере на 3%, 6%, 10% или 15% ниже активность гликозилтрансферазы, чем будет проявлять родительская клетка-хозяин, из которой происходит трансформированная клетка-хозяин, которая исследована с помощью специфического анализа для указанной активности, который предпочтительно представляет собой анализ, описанный в разделе полипептиды. Также предпочтительным является хозяин, который проявляет по меньшей мере на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% или 150% больше указанной активности, чем родительская клетка. В соответствии с другим предпочтительным вариантом осуществления уровень активности гликозилтрансферазы клетки-хозяина по изобретению сравнивают с соответствующей активностью штамма B213, охарактеризованного ранее, который взят в качестве контроля. В соответствии с более предпочтительным вариантом осуществления, в тех случаях, когда клетка-хозяин по изобретению представляет собой штамм Bordetella pertussis, уровень активности деацетилазы полисахарида клетки-хозяина по изобретению сравнивают с соответствующей активностью штамма B213, охарактеризованного выше, который взят в качестве контроля.

Снижение экспрессии полипептида и/или активности может достигаться с помощью традиционных способов, известных из уровня техники, например путем введения в клетку-хозяина большего числа копий последовательности нуклеиновой кислоты, кодирующей деацетилазу полисахарида, будь то на носителе или в хромосоме, чем находится в природе. Альтернативно, последовательность нуклеиновой кислоты, кодирующей деацетилазу полисахарида, может быть гиперэкспрессирована путем слияния ее с высоко экспрессируемым или сильным промотором, подходящим для высокого уровня экспрессии белка в выбранном организме, или сочетанием этих двух подходов. Специалисту будет понятно, какой сильный промотор является наиболее подходящим, в зависимости от типа клетки-хозяина. Предпочтительно, в тех случаях, когда клетка-хозяин представляет собой штамм Bordetella pertussis, сильным промотором является tac-промотор вектора pMMB67EH, охарактеризованного выше.

В соответствии с более предпочтительным вариантом осуществления, клетка-хозяин не продуцирует никаких детектируемых количеств гликозилтрансферазы по изобретению и/или не проявляет никакой детектируемой гликозилтрансферазной активности. Предпочтительно, клетка-хозяин не продуцирует или по существу не продуцирует гликозилтрансферазу.

Альтернативно, в соответствии с другим более предпочтительным вариантом осуществления, клетка-хозяин продуцирует индуцибельное количество гликозилтрансферазы по изобретению и/или проявляет индуцибельную гликозилтрансферазную активность.

Снижение уровня экспрессии гликозилтрансферазы по изобретению и/или снижение уровня активности может достигаться традиционными способами, известными из уровня техники, например, инактивацией или отрицательной регуляцией последовательности нуклеиновой кислоты, кодирующей эндогенную гликозилтрансферазу хозяина. Инактивация или отрицательная регуляция может достигаться делецией одного или нескольких нуклеотидов в кодирующем гене. В другом варианте осуществления, настоящее изобретение относится к хозяину, предпочтительно Bordetella pertussis, имеющему мутацию в последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу. Предпочтительно, для получения хозяина, имеющего инактивированную последовательность нуклеиновой кислоты, кодирующей гликозилтрансферазу, получают вектор замещения или инактивирующий вектор, и впоследствии вводят хозяину путем трансформации. Специалисту будет понятно, как получить такой вектор.

Альтернативно или в сочетании с инактивацией последовательности эндогенной нуклеиновой кислоты, экспрессия последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, может быть снижена, путем слияния ее со слабым промотором, подходящим для низкого уровня экспрессии белка в выбранном организме.

Альтернативно или в сочетании с инактивацией последовательности эндогенной нуклеиновой кислоты, экспрессия последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, может стать индуцибельной, путем слияния ее с индуцибельным промотором, подходящим для индуцибельного уровня экспрессии белка в выбранном хозяине. Предпочтительно, в тех случаях, когда клетка-хозяин представляет собой штамм Bordetella pertussis, индуцибельным промотором является tac-промотор вектора pMMB67EH, охарактеризованного ранее.

Неожиданно, клетка-хозяин по настоящему изобретению обладает привлекательными свойствами, которые делают ее очень привлекательной для применения в качестве цельной коклюшевой вакцины или в качестве адъюванта: улучшенная потенциальная способность взаимодействовать с DC, и для последующей индукции их созревания, и чтобы индуцировать продукцию провоспалительных цитокинов. Альтернативно или в сочетании, LPS, получаемый из этих клеток также является очень подходящим для использования в качестве вакцины или в качестве адъюванта, как представлено ниже.

В соответствии с этим, в другом аспекте настоящего изобретения представлена клетка-хозяин, охарактеризованная ранее, для применения в качестве лекарственного средства. Предпочтительно, указанное лекарственное средство представляет собой вакцину или адъювант, определенный далее в настоящем описании.

LPS, получаемый с помощью клетки-хозяина

Еще в одном аспекте, настоящее изобретение относится к LPS, получаемому из клетки-хозяина по изобретению, как определено ранее в настоящем описании. Предпочтительно, клеткой-хозяином являются виды Bordetella, более предпочтительно Bordetella pertussis, еще более предпочтительно Bordetella pertussis с гиперэкспрессией деацетилазы полисахарида по настоящему изобретению и/или инактивацией гликозилтрансферазы по изобретению. Более предпочтительно, LPS по изобретению получают из мутантного штамма 2331, как получено в примерах.

Еще более предпочтительно, при анализе после выделения с помощью экстракции горячим фенолом/водой (Westphal and Jann, 1965), O-дезацетилированием мягким гидролизом (Holst 2000) и анализе с помощью ESI-MS в режиме определения отрицательных ионов, спектр ESI-MS LPS по настоящему изобретению характеризуется тем, что дает больше ионов, чем соответствующий спектр ESI-MS LPS, полученного из дикого типа Bordetella pertussis, называемым LPS дикого типа. Предпочтительно диким типом Bordetella pertussis является штамм B213, охарактеризованный выше. Не желая привязываться к какой-либо теории, эти дополнительные ионы могут отражать по меньшей мере частичное увеличение замены 1 или 4' фосфатных групп части LPS, относящейся к липиду А остатками гексозамина.

Обычно спектр ESI-MS LPS дикого типа характеризуется тем, что дает 7 ионов (см. таблицу 3), тогда как спектр ESI-MS LPS по настоящему изобретению характеризуется тем, что дает более чем 7 ионов, по меньшей мере 8, по меньшей мере 10, по меньшей мере 12, и более предпочтительно 14 ионов.

Альтернативно или в сочетании с предыдущим вариантом осуществления, предпочтительно спектр ESI-MS LPS по настоящему изобретению содержит больше ионов, содержащих гексозамин, чем ESI-MS спектр LPS дикого типа. Обычно ESI-MS спектр LPS дикого типа дает два иона с гексозамином (см. таблицу 3), тогда как ESI-MS спектр LPS по настоящему изобретению характеризуется тем, что дает более двух ионов, по меньшей мере 4, по меньшей мере 6 и более предпочтительно 8 ионов.

Фармацевтические композиции и применения в медицине

Изобретение дополнительно относится к фармацевтической композиции, содержащей клетку-хозяин по изобретению и/или LPS по изобретению, и то, и другое охарактеризовано ранее в настоящем описании. Фармацевтическая композиция может быть использована в качестве вакцины или в качестве адъюванта. Вакцина может быть использована для иммунизации (вызывания иммунного ответа) или вакцинации млекопитающего.

В настоящем описании определено, что адъюванты включают любое вещество или соединение, которое, при использовании в сочетании с антигеном, для иммунизации млекопитающего, предпочтительно человека, стимулирует иммунную систему, тем самым вызывая, усиливая или облегчая иммунный ответ на антиген, предпочтительно не вызывая специфической иммунной реакции на сам адъювант. Предпочтительные адъюванты усиливают иммунный ответ на заданный антиген, по меньшей мере в 1,5, 2, 2,5, 5, 10 или 20 раз, по сравнению с иммунным ответом, генерированным на антиген в тех же условиях, но в отсутствии адъюванта. Тесты для определения статистического среднего усиления иммунного ответа на заданный антиген, продуцируемого адъювантом в группе животных или людей по сравнению с соответствующей контрольной группой, доступны из уровня техники. Адъювант предпочтительно способен усиливать иммунный ответ по меньшей мере на два различных антигена. Адъювант по настоящему изобретению обычно будет представлять собой соединение, которое является чужеродным для млекопитающего, тем самым исключая иммуностимулирующие соединения, которые являются эндогенными для млекопитающих, например, такие как интерлейкины, интерфероны и другие гормоны.

В предпочтительном варианте осуществления, в тех случаях, когда фармацевтическую композицию используют в качестве адъюванта, композиция дополнительно содержит антиген.

В тех случаях, когда композицию используют в качестве вакцины, антиген представлен на поверхности клетки-хозяина по настоящему изобретению и/или находится в LPS, получаемом из таких клеток. В этом случае вакцина предпочтительно представляет собой вакцину против хозяина по настоящему изобретению и/или против любого хозяина, способного экспрессировать соответствующую молекулу LPS.

В тех случаях, когда композицию используют в качестве адъюванта, предпочтительно присутствует антиген. Антигеном предпочтительно является антиген из бактерий, вирусов, грибов, паразитов, злокачественных клеток или аллергена, как определено дополнительно ниже, или продуцируется этими организмами. Антиген и клетка-хозяин по изобретению и/или LPS, получаемый с помощью таких клеток, предпочтительно используются при лечении и/или профилактике инфекционного заболевания, вызываемого бактериями, вирусами, грибами или паразитами, или опухоли, вызываемой злокачественными клетками, или аллергической реакции, вызванной аллергеном.

Еще в одном предпочтительном варианте осуществления, фармацевтическая композиция, содержащая клетку-хозяина по настоящему изобретению и/или LPS, получаемый из нее, и необязательно антиген, как определено выше в настоящем описании, дополнительно содержит фармацевтически приемлемый носитель. Фармацевтические композиции дополнительно могут содержать фармацевтически приемлемые стабилизирующие агенты, осмотические агенты, буферные агенты, диспергирующие агенты и подобное. Предпочтительная форма фармацевтической композиции зависит от предполагаемого способа введения и терапевтического применения. Фармацевтический носитель может представлять собой любое совместимое нетоксическое вещество, подходящее для доставки в организм пациента активных ингредиентов, т.е. клетки-хозяина по изобретению и/или LPS, получаемого из такой клетки-хозяина и необязательно антигена. Для фармацевтически приемлемых носителей для интраназальной доставки примерами служат вода, забуференные солевые растворы, глицерин, полисорбат 20, кремофор EL, и водная смесь каприлового/каприкового глицерида, и могут быть забуферены для обеспечения нейтрального рН окружения. Примерами фармацевтически приемлемых носителей для парентеральной доставки служат стерильный забуференный 0,9% NaCl или 5% глюкоза необязательно дополненная 20% альбумином. Препараты для парентерального введения должны быть стерильными. Парентеральный путь для введения активных ингредиентов соответствует известным способам, например, инъекции или инфузии подкожным, внутривенным, внутрибрюшинным, внутримышечным, внутриартериальным путем или введением внутрь пораженных тканей. Композиции по настоящему изобретению предпочтительно вводят болюсной инъекцией. Характерная фармацевтическая композиция для внутримышечного введения содержала бы, например, 1-10 мл фосфатного буферного солевого раствора и от 1 до 100 мкг, предпочтительно 15-45 мкг антигена и от 1 до 100 мкг, предпочтительно 15-45 мкг клетки-хозяина и/или LPS по изобретению. Для перорального введения активный ингредиент может быть введен в жидких лекарственных формах, таких как эликсиры, сиропы и суспензии. Жидкие лекарственные формы для перорального введения могут содержать красители и ароматизаторы для повышения приемлемости для пациента. Способы получения композиций, вводимых парентерально, перорально или интраназально хорошо известны из уровня техники и описаны более подробно в различных источниках, в том числе, например, в Remington's Pharmaceutical Science (15th ed., Mack Publishing, Easton, PA, 1980) (включено в качестве ссылки в полном объеме для всех целей).

Антиген в композиции по изобретению предпочтительно представляет собой антиген из бактерий, вирусов, грибов, паразитов, злокачественных клеток или аллергена, или продуцируется ими. Вирусные антигены, которые могут быть объединены с клеткой-хозяином и/или LPS по настоящему изобретению, могут происходить из всех типов вирусов, неограничивающими примерами таких вирусов являются: ретровирусы, такие как вирус иммунодефицита человека (HIV); вирус краснухи; парамиксовирусы, такие как вирусы парагриппа, кори, инфекционного паротита, респираторный синцитиальный вирус, метапневмовирус человека; флавивирусы, такие как вирус желтой лихорадки, вирус денге, вирус гепатита С (HCV), вирус японского энцефалита (JEV), клещевого энцефалита, энцефалита Сент-Луис, или вирус Западного Нила; герпесвирусы, такие как вирус простого герпеса, цитомегаловирус, вирус Эпштейна-Барр; Буньянвирусы; Аренавирусы; Гантавирусы, такие как гантаан; коронавирусы; Паповавирусы такие как вирус папилломы человека; рабдовирусы, такие как вирус бешенства. Коронавирусы, такие как коронавирус человека; Альфавирусы, Артеривирусы, филовирусы, такие как Эболавирус, Аренавирусы, поксвирусы, такие как вирус натуральной оспы, и вирус африканской лихорадки свиней. Аналогичным образом клетка-хозяин и/или LPS по изобретению можно объединить с антигенами, происходящими из патогенных бактерий, грибов (в том числе дрожжей) или паразитических организмов. Такие антигены включают бактериальные антигены, например, Helicobacter, таких как H. pylori, Neisseria, таких как N. mengitidis, Haemophilus, таких как H. influenza, Bordetella, таких как B. pertussis, Chlamydia, Streptococcus, таких как Streptococcus sp. серотип A, Vibrio, таких как V. cholera, грамотрицательных кишечных патогенов, например, Salmonella, Shigella, Campylobacter и Escherichia, а также антиген из бактерий, вызывающих сибирскую язву, лепру, туберкулез, дифтерию, болезнь Лайма, сифилис, брюшной тиф и гонорею. Антигены из паразитических организмов, например, включают антигены из простейших, таких, как Babeosis bovis, Plasmodium, Leishmania spp. Toxoplasma gondii, и Trypanosoma, таких как T. cruzi. Антигены грибов могут включать антигены из таких грибов, как Aspergillus sp., Candida albicans, Cryptococcus, таких как, например, C. neoformans, и Histoplasma capsulatum.

Хотя вакцинацию обычно применяют для профилактической защиты от патогенов или для лечения заболеваний, следующих после инфицирования патогеном, специалист в данной области осведомлен о применении вакцин для лечения опухолей. Более того, обнаружено возрастающее число опухоль-специфичных белков, являющихся подходящими объектами, на которые могут быть нацелены антитела человека или гуманизированные антитела. Такие опухоль-специфичные белки также входят в объем настоящего изобретения. Многие опухоль-специфичные антигены известны из уровня техники. Таким образом, в одном предпочтительном варианте осуществления изобретение относится к композициям, содержащим опухоль-специфичный антиген и клетку-хозяина и/или LPS, как определено выше. Подходящие опухолевые антигены включают, например, эмбриональный опухолевый антиген, простат-специфичный мембранный антиген, простат-специфичный антиген, белок MZ2-E, полиморфный эпителиальный муцин (PEM), фолатсвязывающий белок LK26, (усеченный) рецептор эпидермального фактора роста (EGRF), HER2, антиген Томсона-Фриденрайха (T), ганглиозиды GM-2 и GD-2, Ep-CAM, муцин-1, эпителиальный гликопротеин-2, и специфичный антиген толстой кишки.

Кроме того, антигены могут быть нацелены на DC для индукции толерантности при профилактике аутоиммунного заболевания. Такие аллергены также входят в объем настоящего изобретения.

В соответствии с этим, в еще в одном аспекте клетка-хозяин по изобретению, предпочтительно Bordetella pertussis и/или LPS, получаемый из такой клетки, используют в качестве лекарственного средства. Предпочтительно, лекарственное средство представляет собой вакцину против коклюша.

В другом предпочтительном варианте осуществления клетка-хозяин по изобретению, предпочтительно Bordetella pertussis и/или LPS, получаемый из такой клетки, применяют в качестве адъюванта. Более предпочтительно, клетка-хозяин по изобретению, предпочтительно Bordetella pertussis и/или LPS, получаемый из такой клетки, применяют в сочетании с антигеном.

В соответствии с еще одним аспектом, настоящее изобретение относится к применению клетки-хозяина по изобретению, предпочтительно Bordetella pertussis и/или LPS, получаемого из такой клетки, для получения лекарственного средства для профилактики и/или лечения коклюша. В предпочтительном варианте осуществления клетку-хозяина по изобретению, предпочтительно Bordetella pertussis и/или LPS, получаемый из такой клетки, применяют в качестве адъюванта для получения лекарственного средства для вызывания иммунного ответа на антиген. Более предпочтительно, клетка-хозяин по изобретению и/или LPS, получаемый из такой клетки, применяются в качестве адъюванта в сочетании с указанным антигеном.

В соответствии с еще одним аспектом, настоящее изобретение относится к применению полипептида по изобретению, охарактеризованного ранее в настоящем описании, и/или последовательности нуклеиновой кислоты по изобретению, охарактеризованной в настоящем описании, для профилактики и/или лечения коклюша.

В соответствии с еще одним аспектом, изобретение относится к применению полипептида по изобретению, охарактеризованного ранее в настоящем описании, и/или последовательности нуклеиновой кислоты по изобретению, охарактеризованной ранее в настоящем описании, для получения адъюванта. Предпочтительно, в этом аспекте, полипептид по изобретению, охарактеризованный ранее в настоящем описании и/или последовательность нуклеиновой кислоты по изобретению, охарактеризованная ранее в настоящем описании, применяют в сочетании с антигеном для получения лекарственного средства для вызывания иммунного ответа на этот антиген.

В способах и применениях по изобретению млекопитающим предпочтительно является человек.

В этом документе и в формуле изобретения глагол «содержать» и его спряжения используется в неограничивающем смысле для обозначения того, что понятия, следующие за этим словом, включены, но понятия, которые специально не указаны, не исключены. Кроме того, ссылка на элемент в единственном числе не исключает возможности того, что присутствует более одного такого элемента, если контекст явным образом не требует наличия одного и только одного такого элемента. Единственное число, таким образом, обычно означает «по меньшей мере один».

Описание фигур

Фиг. 1. (A) Схематическое представление идентифицированного гликозилтрансферазного оперона. Темно-серые стрелки показывают гены, которые кодируют предполагаемые гликозилтрансферазы, а светло-серые и белые стрелки показывают ген, кодирующий предполагаемую деацетилазу моносахарида и фланкирующие ORF, соответственно. (B) Анализ профиля LPS из штамма B. pertussis дикого типа (WT), и BP2329-, BP2328-, и BP2331-мутантных штаммов с помощью трицин-SDS-PAGE.

Фиг. 2. ESI-MS в режиме отрицательных ионов O-дезацетилированного LPS B. pertussis дикого типа (A) и мутантных штаммов BP2328 (B), BP2329 (C) и BP2331 (D) B. pertussis.

Фиг. 3. Тандемная масс-спектрометрия с анализом отрицательных ионов O-дезацетилированного LPS из мутантного штамма BP2331. (A) полученный спектр MS/MS иона с m/z 1108,3, (B) полученный спектр MS/MS иона с m/z 1162,0, (C) полученный спектр MS3 иона с m/z 1112,6 от иона с m/z 1162,0.

Фиг. 4. Активация DC после стимуляции клетками дикого типа и мутантными B. pertussis. (A) Анализ экспрессии CD83, HLA-DR, CD86, и CD40 на клеточной поверхности DC человека после 24 ч стимуляции PFA-фиксированными клетками B. pertussis дикого типа и мутантными клетками при MOI 10 (черная линия) или 100 (пунктирная линия). Нестимулированные DC служили в качестве контроля (серая гистограмма). Показаны FACS гистограммы для указанных штаммов B. pertussis из 5000 подсчитанных случаев. Вертикальная ось представляет число клеток, а горизонтальная ось представляет интенсивность окрашивания. (B) Продукция IL-10 и IL-12p70 культивированными DC человека после стимуляции PFA-фиксированными клетками B. pertussis дикого типа и мутантными клетками при MOI 10 или 100. Результаты выражены в виде средних концентраций цитокинов (± SD).

Фиг. 5. Активация DC после стимуляции очищенным LPS B. pertussis дикого типа и мутантного штамма. (A) Анализ экспрессии CD83, CD86, и CD40 на поверхности клеток DC человека после 24 ч стимуляции 1 мкг/мл очищенного LPS. Нестимулированные DC служили в качестве контроля (серая гистограмма). Показаны гистограммы FACS для LPS указанных штаммов B. pertussis из 5000 подсчитанных случаев. Вертикальная ось представляет число клеток, а горизонтальная ось представляет интенсивность окрашивания. (B) Продукция IL-10 культивированными DC человека после стимуляции 1 мкг/мл очищенного LPS. Результаты выражены в виде средних концентраций цитокина.

Фиг. 6. Индукция IL-6 под действием очищенного LPS B. pertussis и целых бактериальных клеток. Продукцию IL-6 клеточной линией MM6 макрофагов человека стимулировали серийными разведениями маточных растворов очищенного LPS (A) или цельных бактериальных клеток (B) из штамма B. pertussis дикого типа (WT), или BP2328-, BP2329-, и BP2331-мутантных штаммов. Концентрации IL-6 в культуральных супернатантах количественно анализировали в ELISA в сравнении с IL-6 человека. Данные представляют средние значения трех отдельных экспериментов.

Фиг. 7. Структура LPS B. pertussis. Представленные усеченные структуры OS ядра BP2328- и BP2329-мутантных штаммов указаны красными стрелками. Заимствовано у Caroff et al. (2000).

Примеры

Материалы и методы

Бактериальные штаммы и условия роста

Все использованные бактериальные штаммы описаны в Таблице 1. Обычно штаммы E. coli выращивали при 37°C в бульоне Луриа-Бертани при встряхивании 200 об/мин. При целесообразности бактерии выращивали в присутствии 100 мкг/мл ампициллина, 50 мкг/мл канамицина или 10 мкг/мл гентамицина, для поддержания плазмиды или селекции штамма. B. pertussis выращивали при 35°C на агаре Борде-Жангу (BG), дополненном 15% дефибринированной кровью овцы (Tritium).

Методики рекомбинантных ДНК

Все используемые плазмиды описаны в Таблице 1. Плазмидную ДНК выделяли, используя систему Promega Wizard® Plus SV Minipreps. Эндонуклеазы рестрикции использовали в соответствии с инструкциями производителя (Roche). Фрагменты ДНК выделяли из агарозных гелей, используя Promega Wizard® SV Gel и систему PCR Clean-Up. Лигирования проводили, используя набор rapid DNA ligation kit (Roche).

Все используемые праймеры описаны в Таблице 2. Хромосомную матричную ДНК для ПЦР реакций получали ресуспендированием ~109 бактерий в 50 мкл дистиллированной воды, после чего суспензию нагревали в течение 15 мин при 95°C. Затем суспензию центрифугировали в течение 1 мин при 16100 × g, после чего супернатант использовали в качестве матричной ДНК. Для конструирования мутантных штаммов B. pertussis B213ΔBP2328 и ΔBP2329, авторы изобретения амплифицировали сегменты ДНК, охватывающие 5' область и вышележащие последовательности соответствующих ORF, используя праймеры BP2328_FWup, BP2329_FWup, и праймеры BP2328_REVup, и BP2329_REVup, оба содержали сайт BamHI. Кроме того, фрагменты ДНК, содержащие 3' области и нижележащие последовательности ORF, получали с помощью ПЦР с праймерами BP2328_FWdown, BP2329_FWdown, оба содержащие сайт BamHI, и праймерами BP2328_REVdown, и BP2329_REVdown. Для конструирования мутантного штамма B. pertussis BP2331, соответствующую ORF амплифицировали, используя праймеры BP2331_FW и BP2331_REV. ПЦР проводили, используя чистые бусы для ПЦР Taq Ready-to-go (Amersham Biosciences) в суммарном объеме реакционной смеси 25 мкл с 5 пмоль каждого праймера. Температурный режим был следующим: 95°C на 3 мин, 30 циклов по 15 с при 95°C, 30 с при 55°C и 1 мин при 72°C, после этого 7 мин при 72°C и с последующим охлаждением до 4°C. Продукты ПЦР очищали от агарозного геля и после этого клонировали в pGEM-T Easy, получая в результате плазмиды pGEM-BP2328up, pGEM-BP2328down, pGEM-BP2329up, pGEM-BP2329down и pGEM-BP2331, соответственно. BamHI-SpeI фрагменты pGEM-BP2328down и pGEM-BP2329down лигировали в pGEM-BP2328up и pGEM-BP2329up, рестриктированные BamHI-SpeI, соответственно. Полученные в результате плазмиды и плазмиду pGEM-BP2331 резали с использованием BamHI и EcoRV, соответственно, для возможности осуществления вставки кассеты устойчивости к канамицину из плазмиды pBSL128, полученной путем расщепления под действием BamHI и HindIII, соответственно. Наконец, EcoRI фрагменты полученных конструкций лигировали в рестриктированную EcoRI суицидную плазмиду pSS1129. Окончательные конструкции, обозначенные pSS1129-BP2328KO, pSS1129-BP2329KO и pSS1129-BP2331KO, соответственно, содержали кассету устойчивости к канамицину в той же ориентации, что и направление транскрипции оперона. Плазмиды на основе pSS1129 использовали для трансформации E. coli SM10(λpir), что в дальнейшем позволяло осуществлять перенос плазмид в B. pertussis и конструировать мутантные штаммы B. pertussis BP2328, BP2329 и BP2331 посредством замены аллелей. Трансформанты подвергали скринингу с помощью ПЦР, используя различные пары праймеров.

Выделение LPS и получение де-O-ацетилированного LPS

LPS выделяли, используя способ экстракции горячим фенолом/водой (Westphal и Jann, 1965) с небольшими модификациями (Geurtsen et al., 2006). Де-O-ацетилирование LPS достигалось мягким гидролизом (Holst, 2000). Вкратце, LPS растворяли в безводном гидразине (200 мкл) и инкубировали при 37°C в течение 50 мин при постоянном перемешивании для высвобождения O-связанных жирных ацильных цепей. Смесь охлаждали и добавляли 600 мкл холодного ацетона небольшими порциями для превращения гидразина в гидразон ацетона. Преципитат де-O-ацилированного LPS собирали центрифугированием (4000 × g, при 7°C в течение 30 мин). Осадок промывали дважды 600 мкл холодного ацетона, центрифугировали и растворяли в воде перед лиофилизацией.

Капиллярный электорофорез-масс спектрометрия с электрораспылением

Систему Prince CE (Prince Technologies) соединяли с масс-спектрометром 4000 QTRAP (Applied Biosystems/MDS Sciex). Анодный раствор (изопропанол-метанол, 2:1) поступал со скоростью потока 1,0 мкл/мин. Разделения получали на неизолированном капилляре из кварцевого стекла длиной ~90 см, используя 15 мМ ацетат аммония в деионизированной воде, pH 9,0. 5 кВ и -5 кВ напряжение ионизации электрораспылением использовали для режима разделений положительного и отрицательного иона, соответственно. Для всех масс-спектрометрических экспериментов азот использовали в качестве газа для отражения и столкновения. В MS2 (усиленный продукт ион сканирования или EPI) и MS3 экспериментах, скорость сканирования устанавливали до 4000 Да/с с улавливанием Q0, разностное время улавливания устанавливали как «динамичное» и разрешение Q1 устанавливали как «единицу». Для MS3 экспериментов, коэффициент экстинкции был установлен на величине для возбуждения только первого изотопа для однозарядного предшественника со временем возбуждения, установленном на 100 мс.

Анализ LPS с помощью трипсин-SDS-PAGE

Приблизительно 109 бактерий суспендировали в 50 мкл буфера для образца (Laemmli, 1970), и добавляли 0,5 мг/мл протеиназы K (конечная концентрация). Образцы инкубировали в течение 60 мин при 55°C, затем 10 мин при 95°C для инактивации протеиназы K. Затем образцы разбавляли в 10 раз добавлением буфера для образца, после чего 2 мкл каждого образца наносили на гель в трипсин-SDS-PAGE (Lesse et al., 1990). Бромфеноловый синий прогоняли в разделяющем геле при 35 В, после чего напряжение повышали до 105 В. После достижения фронтом нижней части геля электрофорез продолжали в течение еще 45 мин. Гели фиксировали в течение ночи в воде/этаноле/уксусной кислоте 11:8:1 (об/об/об) и впоследствии окрашивали серебром, как описано (Tsai and Frasch, 1982).

Получение суспензий бактериальных клеток

Бактерии инактивировали в 0,5% параформальдегиде (PFA) в фосфатно-буферном солевом растворе (PBS) в течение 30 мин и тщательно промывали в среде RPMI 1640 без фенола красного (Gibco). Бактериальные суспензии с оптической плотностью при 600 нм (OD600), равной 1, соответствующие ~109 бактерий/мл, получали в среде RPMI 1640 без фенола красного.

Получение и культивирование DC человека

Незрелые DC человека получали из мононуклеарных клеток периферической крови человека (PBMC), как описано ранее с незначительными модификациями (Sallusto and Lanzavecchia, 1994). Вкратце, PBMC выделяли из гепаринизированной крови от здоровых добровольцев, используя центрифугирование в градиенте плотности по градиенту Фиколла (Amersham Biosciences). Извлеченные фракции PBMC промывали три раза в среде RPMI 1640, дополненной 10% инактивированной нагреванием эмбриональной сывороткой теленка (FCS) (Bodinco BV). Далее моноциты из PBMC получали центрифугированием через трехслойный Percoll градиент (GE Healthcare Bio-Sciences AB) (60%, 47,5%, и 34% Percoll в RPMI 1640, 10% FCS). Моноциты собирали с верхней поверхности раздела и промывали три раза, используя RPMI 1640, 10% среду FCS и инкубировали в шести луночном планшете (4 мл на лунку, 0,5×106 клеток/мл) в RPMI 1640, 10% FCS, дополненной 2,4 мМ L-глутамина (Sigma-Aldrich), 100 Ед/мл пенициллина-стрептомицина (Gibco), 100 нг/мл рекомбинантного GM-CSF человека (Peprotech), и 50 нг/мл рекомбинантного IL-4 человека (Strathmann-Biotec AG). После шести дней культивирования собирали незрелые DC (imDC), которые были негативными по CD14 и CD83, экспрессировали низкие уровни CD86 и HLA-DR, и экспрессировали высокие уровни CD40 и CD11c, по данным проточной цитометрии.

Стимуляция DC

ImDC промывали и ресуспендировали в концентрации 5×105 клеток/мл в RPMI 1640 10% FCS и совместно инкубировали либо с PFA-фиксированными клетками B. pertussis с множественностью заражения (MOI) 10 или 100, либо с LPS в концентрации 10 или 1000 нг/мл. Нестимулированные imDC служили в качестве контроля во всех экспериментах. DC собирали через 24 часа и напрямую окрашивали на экспрессию маркеров клеточной поверхности, супернатанты хранили при -80°C до измерения цитокинов.

Проточный цитометрический анализ маркеров клеточной поверхности

Поверхностную экспрессию маркеров созревания DC и молекул ко-стимуляции оценивали с помощью проточной цитометрии. Незрелые или стимулированные DC собирали, промывали в RPMI 1640, 10% FCS и ресуспендировали в стерилизованном фильтрацией PBS, содержащем 0,1% бычий сывороточный альбумин (FACS буфер). Далее, клетки инкубировали в течение 30 мин при 4°C с одним из следующих антител: FITC-конъюгированным против CD11c человека (mIgG1) и CD83 (mIgG1), конъюгированным с фикоэритрином против CD86 человека (mIgG1) и CD40 (mIgG1), конъюгированным с аллофикоцианином против CD14 человека (mIgG1) и HLA-DR (mIgG2b) и соответствующими изотипными контролями, меченными флуорохромом (CD11c, CD40 и CD14 от eBioscience; CD83, CD86 и HLA-DR от BD Pharmingen). Клетки промывали дважды буфером FACS и анализировали, с помощью проточной цитометрии (FACScan, Becton Dickinson).

Измерения цитокинов

Концентрации IL-10 и IL-12p70 в супернатантах, стимулированных DC определяли, используя твердофазный иммуноферментный анализ (ELISA) в соответствии с инструкциями производителя (BD Biosciences Pharmingen).

Исследования эндотоксической активности

Клеточную линию макрофагов человека MM6 (Ziegler-Heitbrock et al., 1988) стимулировали серийными разведениями суспензий цельных бактериальных клеток или очищенного LPS, как описано (Geurtsen et al., 2006). Суспензии бактериальных клеток получали, собирая клетки из культур центрифугированием, после чего их ресуспендировали в PBS с OD590 1,0, инактивировали нагреванием в течение 10 мин в присутствии 8 мМ формальдегида и хранили при 4°C. После стимуляции, концентрации IL-6 в культуральных супернатантах количественно анализировали с помощью ELISA в отношении IL-6 человека в соответствии с инструкциями производителя (PeliKine Compact™).

Результаты

Идентификация нового оперона биосинтеза LPS в B. pertussis

Авторы изобретения обнаружили кластер из четырех генов (BP2328-BP2331, GenBank Accession Numbers NP_880966-NP_880969), три из которых демонстрировали высокое сходство последовательностей с гликозилтрасферазами LPS из различных бактерий, т.е. BP2328, BP2329 и BP2331. BP2330 демонстрирует самое высокое сходство с деацетилазой полисахаридов из Xylella fastidiosa. Четыре ORF расположены близко друг к другу и в некоторых случаях даже перекрываются, давая возможность предположить, что они составляют оперон (Фиг. 1A). Гены выше, и в обратной ориентации, ниже оперона, предположительно кодируют гомологи ДНК полимеразы III субъединицы альфа DnaE и предполагаемой сульфатазы YhbX E. coli, соответственно. Для изучения роли предполагаемых гликозилтрансфераз LPS, авторы изобретения изготовили конструкции в суицидной плазмиде pSS1129, несущей отдельные гены BP2328, BP2329 и BP2331, которые прерываются кассетой устойчивости к канамицину для вставочной инактивации посредством аллельного обмена. Используя этот подход, нокаут-мутанты для всех трех генов можно легко получить в штамме B. pertussis B213. Анализ их LPS с помощью трипсин-SDS-PAGE лизатов цельных клеток, показал отчетливо усеченный LPS для мутантных штаммов BP2328 и BP2329 (Фиг. 1B). В отличие от этого, LPS мутантного штамма BP2331 был более гетерогенным и состоял из множества полос, в том числе длины дикого типа.

Структурный анализ LPS

Для определения их структуры, LPS из штаммов дикого типа и мутантных штаммов BP2328-, BP2329-, и BP2331- выделяли, O-дезацетилировали и анализировали с помощью ESI-MS в режиме определения отрицательных ионов (Фиг. 2). Предложенные составы LPS суммированы в Таблице 3. Спектр LPS дикого типа (Фиг. 2A) показал основной трехзарядный ион с m/z 1108,5, соответствующий полноразмерному LPS B. pertussis с составом GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA·Glc·GlcN2·GlcA·Hep3·Kdo· липид A-OH. Дополнительные ионы присутствовали при m/z 770,1 ([M-3H]3-), 811,1 ([M-4H]4-), 831,4 ([M-4H]4-), 888,3 ([M-3H]3-), 951,8 ([M-H]-), 987,1 ([M-2H]2-), 1081,7 ([M-3H]3-), 1121,1 ([M-3H+K]3-), 1155,0 ([M-2H]2-), и 1162,1 ([M-3H]3-). Большинство этих ионов соответствовали дефосфорилированным или усеченным гликоформам; однако, трехзарядный ион с m/z 1162,1 соответствовал полноразмерному LPS B. Pertussis, замещенному дополнительной гексозаминной частью (Таблица 3). ESI-MS спектр LPS мутантного штамма BP2328 (Фиг. 2B) показал трехзарядные ионы с m/z 743,6, 770,0, и 823,7, вместе с их соответствующими двухзарядными ионами с m/z 1115,2, 1155,1, и 1235,7. Дополнительные пики находились при m/z 777,3 ([M-3H+Na]3-), 952,1 ([M-H]-), 1034,6 ([M-2H]2-), 1074,6 ([M-2H]2-), и 1166,1 ([M-2H+Na]2-). Распределение пиков показало, что наиболее полная структура ядерного OS была представлена ионами с m/z 823,7 и 1235,7, соответствующими составу GalNA·Glc·GlcN2·GlcA·Hep2·P·Kdo·липид A-OH. Мутантный LPS BP2329 (Фиг. 2C) показал трехзарядные ионы с m/z 603,9 и 657,6, вместе с соответствующими им двухзарядными ионами с m/z 906,0 и 986,6. Кроме того, натриевые и калиевые аддукты этих ионов находились при m/z 917,4 и 997,6, и m/z 925,0 и 1005,6, соответственно. Дополнительные пики находились на m/z 866,0 ([M-2H]2-), 937,4 ([M-2H-H2O]2-), и 1067,1 ([M-2H]2-). В этом случае, наиболее полная структура ядра была представлена двухзарядным ионом с m/z 1067,1, соответствующим составу GlcN2·GlcA·Hep2·P·Kdo·липид A-OH. Мутантный LPS BP2331 (Фиг. 2D) показал большое число пиков, в том числе трехзарядные ионы с m/z 1108,3 и 1162,0, соответствующие полноразмерному LPS B. pertussis и полноразмерному LPS B. Pertussis, замещенному дополнительным гексозамином, соответственно.

Для определения локализации дополнительной гексозаминной части, которая наблюдалась в LPS как дикого типа, так и в мутантном LPS BP2331, проводили исследования ESI-MS2 в режиме отрицательного иона (Фиг. 3). MS/MS спектры ионов с m/z 1108,3 (Фиг. 3A) и 1162,0 (Фиг. 3B) оба показали однозарядный фрагментный ион с m/z 951,5, который показал, что A-OH, полученный в результате расщепления между связью Kdo-липид A в условиях диссоциации, индуцированной столкновением, состоял из β-(1→>6)-связанного дисахарида N-ацилированных (3OH C14) глюкозаминных остатков, каждый остаток замещен фосфатной группой. Спектр иона с m/z 1162,0 также показал дополнительный ион с m/z 1112,6, который указывает на то, что дополнительный гексозаминный остаток был напрямую присоединен к липиду A. MS3 на m/z 1112,6 дополнительно поддержал это заключение (Фиг. 3C).

Активация дендритных клеток под действием мутантных LPS B. pertussis

Для определения влияния мутаций LPS на активацию DC, незрелые DC совместно культивировали с PFA-фиксированными B. pertussis дикого типа и мутантными бактериями с MOI 10 и 100. Активацию DC контролировали анализом маркеров созревания (CD83 и HLA-DR), а экспрессию молекул ко-стимулирования (CD86 и CD40) с помощью проточной цитометрии (Фиг. 4A) и индукцию IL-10 и IL12p70 с помощью ELISA (Фиг. 4B). Бактери дикого типа и все мутантные бактерии индуцировали экспрессию CD83, HLA-DR, CD86, и CD40, демонстрируя, что все штаммы были способны активировать DC. Однако BP2329- и BP2331-мутантные бактерии были явно менее и более стимулирующими соответственно, чем бактерии дикого типа, тогда как мутантный штамм BP2328 был также эффективен, как и штамм дикого типа. Меньшее созревание DC наблюдалось в случае мутантного штамма BP2329 сопровождалось более низкой индукцией IL-10 и IL-12p70 (Фиг. 4B). Аналогично, мутантный штамм BP2331, который демонстрировал повышенную способность DC к созреванию, индуцировал более высокие количества IL-10 и IL-12p70. Штамм дикого типа и мутантный штамм BP2328 индуцировали сравнимые уровни IL-10, что согласуется с равной экспрессией молекул ко-стимуляции и маркеров созревания на DC в ответ на эти штаммы. Однако тогда как штамм дикого типа отчетливо индуцировал продукцию IL-12p70, это было мало вероятно в случае мутантного штамма BP2328 (Фиг. 4B), что дает возможность предположить, что экспрессия IL-10 и IL-12p70 может регулироваться дифференциально.

Чтобы оценить связаны ли наблюдаемые отличия в способности активировать DC между штаммами дикого типа и мутантными штаммами непосредственно с различиями в составе LPS, исследования активации DC проводили с 10 и 1000 нг/мл очищенного LPS. В отличие от большого повышения в экспрессии маркеров созревания и молекул ко-стимуляции на DC в ответ на бактерии дикого типа, BP2328-, и BP2331-мутантные бактерии, только незначительные повышения в экспрессии CD83, CD86, и CD40 (Фиг. 5A) и отсутствие повышения в экспрессии HLA-DR (данные не показаны) были обнаружены даже с 1000 нг/мл LPS этих штаммов. Аналогично, индукция IL-10 была низкой (Фиг. 5B) и IL-12p70 не мог быть детектирован в супернатантах DC, стимулированных LPS (данные не показаны). Тем не менее взаимное сличение (Фиг. 5A и 5B) показало, что в соответствии с результатами, полученными с интактными бактериями, наибольшая способность активировать DC была обнаружена для LPS, выделенного из мутантного штамма BP2331, за ним следовали LPS мутантного штамма BP2328 и штамма дикого типа, тогда как LPS мутантного штамма BP2329 был неспособен вызывать созревание DC. Таким образом, изменения в структуре LPS мутантных штаммов дифференцильно влияет на способность активировать DC.

Эндотоксическая активность LPS и цельных бактериальных клеток

Чтобы оценить последствия мутаций LPS для эндотоксической активности LPS, была протестирована эффективность очищенного LPS в отношении стимуляции клеточной линии макрофагов человека MM6 к продукции IL-6. По сравнению с LPS дикого типа, LPS, очищенный из мутантного штамма BP2331, обладал гораздо более высокой эффективностью в отношении стимуляции макрофагов (Фиг. 6A). В отличие от этого, LPS из мутантного штамма BP2329 обладал сниженной эффективность в отношении стимуляции продукции IL-6, тогда как активность LPS из мутантного штамма BP2328 была сходна с активностью LPS дикого типа (Фиг. 6A). Только в двух самых высоких тестируемых концентрациях LPS, последний LPS был более активным, чем LPS дикого типа. Согласуясь с данными, полученными с очищенным LPS, суспензии цельных клеток мутантного штамма BP2331 показали, по сравнению с клетками дикого типа, отчетливо повышенную эффективность в отношении стимуляции макрофагов (Фиг. 6B). Однако также мутантные клетки BP2328 показали тот же эффект (Фиг. 6B), хотя мутантные клетки BP2329 имели аналогичную активность, что и клетки дикого типа, несмотря на их менее активный очищенный LPS (Фиг. 6A).

Обсуждение

Целью настоящего исследование было идентифицировать новые гликозилтрансферазы LPS в геноме B. pertussis. Используя последовательности известных гликозилтрансфераз LPS в качестве лидеров, авторам изобретения удалось идентифицировать четыре генных оперона. В предыдущем исследовании, в котором геномную последовательность птичьего патогена Bordetella avium сравнивали с геномными последовательностями других Bordetellae, было описано, что генный кластер, гомологичный одному из идентифицированных в настоящем исследовании, вовлечен в биосинтез LPS (Sebaihia et al., 2006). Однако о каких-либо функциональных исследованиях, которые могли бы подтвердить это распределение, не сообщалось.

Для изучения роли этого оперона в биосинтезе LPS B. pertussis, авторы изобретения инактивировали предполагаемые гены гликозилтрансферазы посредством аллельного обмена и сравнили профили LPS штаммов дикого типа и мутантных штаммов, используя трицин-SDS-PAGE и ESI-MS. Неожиданно, авторы изобретения обнаружили, что штамм дикого типа не только содержал полноразмерный LPS B. pertussis, а также содержал полноразмерные виды, замещенные еще одной гексозаминной частью, которая, как было показано авторами изобретения, была непосредственно присоединена к липиду А. Замещение липида А B. pertussis гексозамином ранее не наблюдалось и, следовательно, представляет новую модификацию липида А B. pertussis.

Предложенные усеченные олигосахаридные структуры для мутантных штаммов BP2328- и BP2329- суммированы на Фиг. 7. Наиболее полная структура ядерного OS в мутантном штамме BP2328 состояла из GalNA·Glc·GlcN2·GlcA·Hep2·P·Kdo·липид A-OH·HexN, указывая на то, что мутантный штамм BP2328 лишен терминального трисахарида, остатка гепрозы и одного из остатков GlcN. Этот состав позволяет предположить, что BP2328-кодируемый белок функционирует как GlcN (1-4) в отношении Glc трансферазы (Фиг. 7). Анализ LPS мутантного штамма BP2329 показал, что этот LPS был дополнительно усечен, и что его наиболее полная структура состояла из GlcN·GlcA·Hep2·P·Kdo·липид A-OH·HexN. Поскольку эта структура лишена Glc, к которому должен быть присоединен второй GlcN ядерного OS, оставшийся присутствующий остаток GlcN должен быть присоединен ко второй гептозе. Таким образом, этот состав позволяет предположить, что BP2329-кодируемый белок функционирует в качестве гликозилтрансферазы, которая присоединяет Glc к первой гептозной субъединице (Фиг. 7). Это согласовывалось бы с высокой гомологией этого генного продукта с глюкозой (β1-4) гептозтрансферазами, такими как rfaK и lgtF/icsB, которые были использованы для идентификации гена в первом положении. Наиболее сложный фенотип наблюдался в случае мутантного штамма BP2331. Хотя этот белок демонстрирует высокое сходство последовательностей с различными гликозилтрансферазами LPS, полноразмерный LPS B. pertussis все же присутствовал в мутантном штамме. Это наблюдение позволяет предположить, что либо этот ген BP2331 не кодирует активную гликозилтрансферазу LPS, либо что кодируемый фермент демонстрирует дублирование. Согласно этому последнему мнению, авторы изобретения идентифицировали ген, т.е. BP3671 с регистрационным номером GenBank CAE43928, в геноме B. Pertussis, который кодирует белок, который на 69% идентичен белку, кодируемому BP2331. Хотя профили LPS штамма дикого типа и мутантного BP2331 были более или менее сравнимыми, одним поразительным наблюдением было то, что мутантный LPS был более гетерогенным. Хотя точную причину этого феномена остается объяснить, одним возможным объяснением может быть то, что BP2331 мутант так или иначе проявляет повышенную нестехиометрическую замену его LPS, возможно, гексозамином. Модификация липида А аминосахарами была описана у различных бактерий, например, замещение 4-аминоарабинозой в E. coli и Salmonella (Trent et al., 2001b), и галактозамином в Francisella tularensis (Phillips et al., 2004). Аминоарабинозный путь был изучен подробно у E. coli и было показано, что он вовлечен в сборку сахарной части на отдельном ундекапренилфосфатном носителе до переноса в липид A (Trent et al., 2001a). Поскольку возможно, что вставка кассеты устойчивости к канамицину в BP2331 повысила экспрессию нижележащего гена BP2330, можно было сделать предположение, что повышенная экспрессия BP2330 может привести к повышенной гексозаминной модификации липида А и, следовательно, к повышенной гетерогенности LPS в BP2331-мутантных клетках. Основанием для такой интерпретации является повышенный уровень гексозаминной модификации в мутантном ВР2331, см. Таблицу 3.

Обратившись к структуре LPS, очищенный LPS и цельные бактериальные клетки были протестированы на их способность индуцировать созревание DC и стимулировать продукцию провоспалительных цитокинов макрофагами человека. Результаты показали, что по сравнению со штаммом дикого типа, ВР2331-мутантный штамм демонстрировал повышенную способность индуцировать созревание DC и продукцию провоспалительных цитокинов. Аналогичные результаты были получены с очищенным LPS. В отличие от этого, цельные бактериальные клетки и очищенный LPS из мутантных штаммов ВР2328 и ВР2329 демонстрировали сходную и сниженную способность вызывать созревание DC и стимулировать макрофаги, соответственно. Эти результаты показывают, что изменения в LPS ядерного OS-состава дифференциально влияют на биологические свойства LPS В. pertussis. Исходя из перспективы создания вакцин это является интересным открытием, поскольку это может давать возможность получать штаммы, которые более эффективно примируют иммунные ответы. Более того, мутантные штаммы, которые демонстрируют повышенную гетерогенность LPS, например мутантный штамм ВР2331, могут вызывать образование большого разнообразия антител против LPS, что само по себе может положительно влиять на эффективность вакцины. Найдена хорошая корреляция между уровнем активации DC и макрофагов с одной стороны и степенью гексозаминной модификации липида A с другой (см. Таблицу 3), убедительно указывает на то, что повышенная модификация в мутантном штамме ВР2331 является решающей в этом отношении.

Таблица 1
Бактериальные штаммы и плазмиды
Штамм или плазмида Генотип или описание Источник или ссылка
Штаммы
B. pertussis
B213 Устойчивый к стрептомицину производный штамм B. pertussis Tohama Kasuga et al., 1953
B213 ΔBP2328 BP2328 мутант штамма B213, StrR, KmR Это исследование
B213 ΔBP2329 BP2329 мутант штамма B213, StrR, KmR Это исследование
B213 ΔBP2331 BP2331 мутант штамма B213, StrR, KmR Это исследование
E. coli
TOP10F' F´{lacI q Tn10 (Tet R )} mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74
deoR recA1 araD139 Δ (ara-leu)7697 galU galK rpsL endA1 nupG
Invitrogen
DH5α F - Δ(lacZYA-algF)U169 thi-1 hsdR17 gyrA96 recA1 endA1 supE44 relA1
phoA Φ80 dlacZΔM15
Hanahan, 1983
SM10(λpir) thi thr leu fhyA lacY supE recA::RP4-2-Tc::Mu λ pir R6K KmR N.V.I.a
Плазмиды
pGEM-T Easy E. coli клонирующий вектор AmpR Promega
pUC4K E. coli вектор, содержащий кассету устойчивости к канамицину, AmpR KmR Vieira and Messing, 1982
pSS1129 Вектор аллельной замены, bla gen rpsL oriVColE1 oriT λ cos Stibitz, 1994
pGEM-BP2328up производное pGEM-T Easy, содержащее последовательность BP2328, расположенную
перед сайтом инициации транскрипции
Это исследование
pGEM-BP2328down производное pGEM-T Easy содержащее последовательность BP2328, расположенную
по ходу транскрипции
Это исследование
pGEM-BP2329up производное pGEM-T Easy, содержащее последовательность BP2329, расположенную
перед сайтом инициации транскрипции
Это исследование
pGEM-BP2329down производное pGEM-T Easy, содержащее последовательность BP2329, расположенную
по ходу транскрипции
Это исследование
pGEM-BP2331 производное pGEM-T Easy, содержащее последовательность BP2331 Это исследование
pSS1129-BP2328KO производное pSS1129, содержащее нокаут конструкцию BP2328, KmR Это исследование
pSS1129-BP2329KO производное pSS1129, содержащее нокаут конструкцию BP2329, KmR Это исследование
pSS1129-BP2331KO) производное pSS1129, содержащее нокаут конструкцию BP2331, KmR Это исследование
a Netherlands Vaccine Institute, Bilthoven, Нидерланды
Таблица 2
Праймеры
Название Последовательность (5'-3')a
BP2328_FW up TTCCGCACTTACTGGCTGAG
BP2328_FW down GGATCCTCGCGGTACGACAGCACAT
BP2328_REV up GGATCCTGTTGCGCGAGATGCTGGAG
BP2328_REV down CCTCATCGCCAAGGTCAATC
BP2329_FW up TCACCTTCGACGACGGATAC
BP2329_FW down GGATCCGTGCGCATCTACCTGATCC
BP2329_REV up GGATCCGAATCGACCACGATGAAC
BP2329_REV down GATCCAGCTTGGCCTGGTTG
BP2331_FW GTGACGTGGTGGTACATCAG
BP2331_REV TGGTCTACCGCAGGAACAAT
a BamHI сайты рестрикции подчеркнуты

Ссылки

Alexeyev, M. F., Shokolenko, I. N., and Croughan, T. P. (1995) Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vitro deletion/insertion mutagenesis. Gene 160: 63-67.

Allen, A. G., Isobe, T., and Maskell, D. J. (1998a) Identification and cloning of waaF (rfaF) from Bordetella pertussis and use to generate mutants of Bordetella spp. with deep rough lipopolysaccharide. J. Bacteriol. 180: 35-40.

Allen, A. G., Thomas, R. M., Cadisch, J. T., and Maskell, D. J. (1998b) Molecular and functional analysis of the lipopolysaccharide biosynthesis locus wlb from Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Mol. Microbiol. 29: 27-38.

Allen, A., and Maskell, D. (1996) The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol. Microbiol. 19: 37-52.

Caroff, M., Brisson, J., Martin, A., and Karibian, D. (2000) Structure of the Bordetella pertussis 1414 endotoxin. FEBS Lett. 477: 8-14.

Clementz, T., and Raetz, C. R. H. (1991) A gene coding for 3-deoxy-D-manno-octulosonic-acid transferase in Escherichia coli. Identification, mapping, cloning, and sequencing. J. Biol. Chem. 266: 9687-9696.

Di Fabio, J. L., Caroff, M., Karibian, D., Richards, J. C., and Perry, M. B. (1992) Characterisation of the common antigenic lipopolysaccharide O-chains produced by Bordetella bronchiseptica and Bordetella parapertussis. FEMS Microbiol. Lett. 76: 275-281.

Geurtsen, J., Steeghs, L., Hamstra, H-J., ten Hove, J., de Haan, A., Kuipers, B., Tommassen, J., and van der Ley, P. (2006) Expression of the lipopolysaccharide-modifying enzymes PagP and PagL modulates the endotoxic activity of Bordetella pertussis. Infect. Immun. 74: 5574-5585.

Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166: 557-580.

Holst, O. (2000) Deacylation of lipopolysaccharides and isolation of oligosaccharides phosphates. in Methods in Molecular Biology, Bacterial Toxins: Methods and Protocols (Holst, O., Ed.) pp 345-353, Humana Press, Totowa, NJ.

Heinrichs, D. E., Yethon, J. A., and Whitfield, C. (1998) Molecular basis for structural diversity in the core regions of the lipopolysaccharides of Escherichia coli and Salmonella enterica. Mol. Microbiol. 30: 221-232.

Isobe, T., White, K. A., Allen, A. G., Peacock, M., Raetz, C. R. H., and Maskell, D. J. (1999) Bordetella pertussis waaA encodes a monofunctional 2-keto-3-deoxy-D-manno-octulosonic acid transferase that can complement an Escherichia coli waaA mutation. J. Bacteriol. 181: 2648-2651.

Kasuga, B., Nakase, Y., Ukishima, K., and Takatsu, K. (1953) Studies on Haemophilus pertussis. Kitasato Arch. Exp. Med. 27: 21-28.

Kurzai, O., Schmitt, C., Claus, H., Vogel, U, Frosch, M, and Kolb-Maurer, A. (2005) Carbohydrate composition of meningococcal lipopolysaccharide modulates the interaction of Neisseria meningitidis with human dendritic cells. Cell. Microbiol. 7: 1319-1334.

Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685.

Lesse, A. J., Campagnari, A. A., Bittner, W. E., and Apicella, M. A. (1990) Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis. J. Immunol. Methods 126: 109-117.

MacLachlan, P. R., Kadam, S. K., and Sanderson, K. E. (1991) Cloning, characterization, and DNA sequence of the rfaLK region for lipopolysaccharide synthesis in Salmonella typhimurium LT2. J. Bacteriol. 173: 7151-7163.

O'Neill, L. A. J. (2006) How Toll-like receptors signal: what we know and what we don't know. Curr. Opin. Immunol. 18: 3-9.

Pålsson-McDermott, E. M., and O'Neill, L. A. J. (2004) Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology 113: 153-162.

Peppler, M. S. (1984) Two physically and serologically distinct lipopolysaccharide profiles in strains of Bordetella pertussis and their phenotype variants. Infect. Immun. 43: 224-232.

Phillips, N. J., Schilling, B., McLendon, M. K., Apicella, M. A., and Gibson, B. W. (2004) Novel modification of lipid A of Francisella tularensis. Infect. Immun. 72: 5340-5348.

Plüddeman, A., Mukhopadhyay, S., and Gordon, S. (2006) The interaction of macrophage receptors with bacterial ligands. Exp. Rev. Mol. Med. 8: 1-25.

Raetz, C. R. H., and Whitfield, C. (2002) Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71: 635-700.

Sallusto, F., and Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor α. J. Exp. Med. 179: 1109-1118.

Schnaitman, C. A., and Klena, J. D. (1993) Genetics of lipopolysaccharide biosynthesis in enteric bacteria. Microbiol. Rev. 57: 655-682.

Sisti, F., Fernández, J., Rodríguez, M. E., Lagares, A., Guiso, N., and Hozbor, D. F. (2002) In vitro and in vivo characterization of a Bordetella bronchiseptica mutant strain with a deep rough lipopolysaccharide structure. Infect. Immun. 70: 1791-1798.

Steeghs, L., van Vliet, S. J., Uronen-Hansson, H., van Mourik, A., Engering, A., Sanchez-Hernandez, M., Klein, N., Callard, R., van Putten, J. P. M., van der Ley, P., van Kooyk, Y., and van de Winkel, J. G. J. (2006) Neisseria meningitidis expressing lgtB lipopolysaccharide targets DC-SIGN and modulates dendritic cell function. Cell. Microbiol. 8: 316-325.

Stibitz, S. (1994) Use of conditionally counterselectable suicide vectors for allelic exchange.
Methods Enzymol. 235: 458-465.

Takada H, and Kotani S. (1989) Structural requirements of lipid A for endotoxicity and other biological activities. Crit. Rev. Microbiol. 16: 477-523.

Trent, M. S., Ribeiro, A. A., Doerrler, W. T., Lin, S., Cotter, R. J., and Raetz, C. R. H. (2001a) Accumulation of a polyisoprene-linked amino sugar in polymyxin-resistant Salmonella typhimurium and Escherichia coli: structural characterization and transfer to lipid A in the periplasm. J. Biol. Chem. 276: 43132-43144.

Trent, M. S., Ribeiro, A. A., Lin, S., Cotter, R. J., and Raetz, C. R. H. (2001b) An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J. Biol. Chem. 276: 43122-43131.

Tsai, C. M., and Frasch, C. E. (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119: 115-119.

Uronen-Hansson, H., Steeghs, L., Allen, J., Dixon, G.L.J., Osman, M., van der Ley, P., Wong, S.Y.C., Callard, R., and Klein, N. (2004) Human dendritic cell activation by Neisseria meningitidis: phagocytosis depends on expression of lipooligosaccharide (LOS) by the bacteria and is required for optimal cytokine production. Cell. Microbiol. 6: 625-637.

van Amersfoort, E. S., Van Berkel, T. J., and Kuiper, J. (2003) Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock. Clin. Microbiol. Rev. 16: 379-414.

Westphal, O., and Jann, J. K. (1965) Bacterial lipopolysaccharides, extraction with phenol-water and further applications of the procedure. Methods Carbohydr. Chem. 5: 83-91.

Ziegler-Heitbrock, H. W. L., Thiel, E., Futterer, A., Herzog, V., Wirtz, A., and Riethmüller, G. (1988) Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes. Int. J. Cancer 41: 456-461.

1. Клетка-хозяин Bordetella pertussis, Bordetella bronchiseptica или Bordetella parapertussis для применения в качестве адъюванта, имеющая сниженную активность эндогенной гликозилтрансферазы с по меньшей мере 98% идентичности с аминокислотной последовательностью SEQ ID NO: 2 по сравнению с активностью гликозилтрансферазы соответствующего родительского штамма, где сниженная активность достигается применением инактивирующего вектора, который вызывает инактивацию экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, или приводит к сниженному уровню экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, слиянием последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, со слабым или индуцибельным промотором.

2. Клетка-хозяин Bordetella pertussis, Bordetella bronchiseptica или Bordetella parapertussis для применения для профилактики или лечения коклюша, имеющая сниженную активность эндогенной гликозилтрансферазы с по меньшей мере 98% идентичности с аминокислотной последовательностью SEQ ID NO: 2 по сравнению с активностью гликозилтрансферазы соответствующего родительского штамма, где сниженная активность достигается применением инактивирующего вектора, который вызывает инактивацию экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, или приводит к сниженному уровню экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, слиянием последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, со слабым или индуцибельным промотором.

3. Клетка-хозяин по п.1 или п.2, где инактивирующий вектор, который вызывает инактивацию экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, представляет собой суицидный вектор.

4. Препарат для применения в качестве адъюванта, состоящий из LPS, полученного из клетки-хозяина по п.1, где препарат состоит из LPS с увеличенной заменой гексозамином 1' или 4' фосфатных групп части LPS, относящейся к липиду А, по сравнению с препаратом LPS из соответствующего родительского штамма, и посредством чего LPS характеризуется получением по меньшей мере 8 ионов в ESI-MS спектре.

5. Препарат для применения в качестве лекарственного средства для профилактики или лечения коклюша, состоящий из LPS, полученного из клетки-хозяина по п.2, где препарат состоит из LPS с увеличенной заменой гексозамином 1' или 4' фосфатных групп части LPS, относящейся к липиду А, по сравнению с препаратом LPS из соответствующего родительского штамма, и посредством чего LPS характеризуется получением по меньшей мере 8 ионов в ESI-MS спектре.

6. Фармацевтическая композиция для применения в качестве адъюванта, содержащая клетку-хозяина по п.1 или препарат по п.4 в эффективном количестве и фармацевтически приемлемый носитель.

7. Фармацевтическая композиция для применения в качестве вакцины для профилактики и/или лечения инфекции Bordetella, содержащая клетку-хозяина по п.1 или препарат по п.4 в эффективном количестве и фармацевтически приемлемый носитель и дополнительно содержащая антиген в эффективном количестве.

8. Фармацевтическая композиция для применения в качестве вакцины для профилактики и/или лечения инфекции Bordetella, содержащая клетку-хозяина по п.2 или препарат по п.5 в эффективном количестве и фармацевтически приемлемый носитель.

9. Применение клетки-хозяина по п.2 или препарата по п.5 для получения лекарственного средства для профилактики и/или лечения коклюша.

10. Применение клетки-хозяина по п.1 или препарата по п.4 для получения лекарственного средства для иммунизации млекопитающего, где клетка-хозяин или LPS используются в качестве адъюванта.

11. Применение по п.10, где клетку-хозяина или препарат применяют в сочетании с антигеном.

12. Применение по п.11, где адъювант дополнительно объединен с антигеном для получения лекарственного средства для вызывания иммунного ответа на антиген.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложены варианты антиген-связывающего полипептида, специфичного к полипептиду LIGHT, характеризующиеся наличием вариабельной области тяжелой и легкой цепей, а также варианты конъюгатов на их основе для лечения заболевания или состояния.

Изобретение относится к области биотехнологии и иммунологии. Описаны биспецифические антитела против фактора роста сосудистого эндотелия человека VEGF и ангиопоэтина-2 человека ANG-2, способы их получения, фармацевтические композиции, содержащие указанные антитела, и их применения.

Изобретения относятся к области биотехнологии и касаются вектора, клетки-хозяина, содержащего вектор, генетически модифицированного микроорганизма Clostridium thermocellum, способа получения такого микроорганизма и способа преобразования лигноцеллюлозной биомассы в этанол.

Представленные изобретения касаются выделенного полинуклеотида, кодирующего полипептид, вовлеченный в биосинтез пирипиропена А, вектора и клетки-хозяина, включающих такой полипептид, и способов получения предшественников пирипиропена А, включающих культивирование клетки-хозяина.

Изобретение относится к области биотехнологии и иммунологии. Описано антитело и его функциональный фрагмент, специфически узнающее Siglec-15 человека и обладающее активностью ингибирования образования остеокластов.

Изобретение относится к области биотехнологии и иммунологии. Описано выделенное антитело человека или его антигенсвязывающий фрагмент.

Изобретение относится к области биотехнологии, в частности к интегративной генетической конструкции pWpr-le. Предложенное изобретение может использоваться для введения в хромосому клетки Bacillus subtilis и родственных видов рода Bacillus гена релизинг фактора гормона роста человека/свиньи и последующей его экспрессии в указанных клетках.

Изобретение относится к биотехнологии, в частности к опухолеспецифичным промоторам, и может быть использовано в противоопухолевой терапии. Сконструированы опухолеспецифичные промоторы широкого спектра действия, обеспечивающие экспрессию терапевтического гена внутри раковой клетки.

Изобретение относится к области иммунологии и биотехнологии. Описаны гуманизированное антитело и его антигенсвязывающий фрагмент (Fab), которые селективно связывают человеческий ИФН-γ и содержат вариабельный участок тяжелой цепи (VH) и вариабельный участок легкой цепи (VL), где VH и VL имеют последовательности аминокислот соответственно SEQ ID NO:1 и 2, представленные в описании.

Изобретение относится к области биотехнологии или генной инженерии. Описана система модулирования экспрессии рекомбинантного гена, вектор экспрессии и клетка-хозяин.

Изобретение относится к области биохимии, в частности к полипептиду, обладающему амилазной активностью, происходящему от родительского полипептида, являющегося не-мальтогенной экзоамилазой дикого типа, имеющей по меньшей мере 90% идентичность SEQ ID NO: 13.

Изобретение относится к биохимии и представляет собой фармацевтическую композицию для лечения болезни Гоше, содержащую в качестве активного ингредиента лиофилизированные растительные клетки, экспрессирующие рекомбинантную человеческую глюкоцереброзидазу, и фармацевтически приемлемый носитель, где указанная фармацевтическая композиция составлена для перорального введения и где указанная человеческая глюкоцереброзидаза имеет высокоманнозное гликозилирование.

Изобретение относится к области биохимии. Описана альфа-D-галактозидаза, обладающая измененной региоспецифичностью по отношению к α1,4-связи и содержащая мутацию либо Pro402Asp, либо Phe328Ala в соответствующем положении аминокислотной последовательности исходного фермента дикого типа, выделенного из штамма Thermotoga maritima MSB8.

Настоящее изобретение относится к области биотехнологии и может быть использовано в производстве композиций, предназначенных для удаления крахмалсодержащих загрязнений.

Изобретение относится к области биотехнологии, а именно к клетке-хозяину Trichoderma reesei для получения целлюлолитической белковой композиции, целлюлолитической белковой композиции, способам получения и применения композиции.

Изобретение относится к области биохимии. .

Изобретение относится к биохимии и представляет собой различные варианты модифицированной ксиланазы Семейства 11. .

Изобретение относится к области биотехнологии и касается целлюлазных слитых белков. .
Изобретение относится к области биотехнологии и может быть использовано в микробиологической и пищевой промышленности для получения глюкоамилазы с целью дальнейшего ее применения для осахаривания (гидролиза) крахмалосодержащего сырья в спиртовой, хлебопекарной, крахмалопаточной и пивоваренной промышленности.

Изобретение относится к биотехнологии, в частности к опухолеспецифичным промоторам, и может быть использовано в противоопухолевой терапии. Сконструированы опухолеспецифичные промоторы широкого спектра действия, обеспечивающие экспрессию терапевтического гена внутри раковой клетки.

Изобретение относится к области биотехнологии и иммунологии. Представлена клетка-хозяин Bordetella pertussis, Bordetella bronchiseptica или Bordetella parapertussis, которая используется в качестве адъюванта или для профилактики или лечения коклюша, имеющая сниженную активность эндогенной гликозилтрансферазы с по меньшей мере 98 идентичностью с аминокислотной последовательностью SEQ ID NO: 2 по сравнению с активностью гликозилтрансферазы соответствующего родительского штамма, где сниженная активность достигается применением инактивирующего вектора, который вызывает инактивацию экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, или приводит к сниженному уровню экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, слиянием последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, со слабым или индуцибельным промотором. Раскрыт препарат, состоящий из LPS из указанной клетки-хозяина с увеличенной заменой гексозамином 1 или 4 фосфатных групп части LPS, относящейся к липиду А, по сравнению с препаратом LPS из соответствующего родительского штамма, и посредством чего LPS характеризуется получением по меньшей мере 8 ионов в ESI-MS спектре, где препарат используется в качестве адъюванта или для профилактики или лечения коклюша. Предложено применение указанных клетки-хозяина или препарата LPS для получения лекарственного средства для профилактики иили лечения коклюша, или получения лекарственного средства для иммунизации млекопитающего, где клетка-хозяин или LPS используются в качестве адъюванта. Описана фармацевтическая композиция, используемая в качестве адъюванта или для профилактики или лечения инфекции Bordetella, содержащая указанную клетку-хозяина или указанный препарат LPS в эффективном количестве и фармацевтически приемлемый носитель. Изобретение позволяет получить фармацевтический препаратклеток Bordetella или LPS, обладающий повышенной иммуногенностью по сравнению с препаратом из соответствующего родительского штамма Bordetella. 9 н. и 3 з.п. ф-лы, 7 ил., 3 табл., 1 пр.

Наверх