Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, риновирусов, вирусов гепатита а и е из водной среды методом мультиплексной пцр



Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, риновирусов, вирусов гепатита а и е из водной среды методом мультиплексной пцр
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, риновирусов, вирусов гепатита а и е из водной среды методом мультиплексной пцр
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, риновирусов, вирусов гепатита а и е из водной среды методом мультиплексной пцр
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, риновирусов, вирусов гепатита а и е из водной среды методом мультиплексной пцр

 


Владельцы патента RU 2542968:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор"" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к области биотехнологии и вирусологи. Предложен набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е в образцах воды из окружающей среды методом мультиплексной ПЦР. Изобретение может быть использовано в вирусологии и эпидемиологии. 4 ил., 2 табл.

 

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала (РНК) энтеровирусов, риновирусов, вирусов гепатита А и Е в образцах воды из окружающей среды методом мультиплексной полимеразной цепной реакции и может быть использовано в вирусологии и эпидемиологии для обеспечения эпидемической безопасности населения при различных видах водопользования.

Проблема обеспечения эпидемической безопасности населения России при различных видах водопользования является приоритетной государственной задачей в системе предупредительного санитарно-эпидемиологического надзора. Будучи одним из ведущих в реализации кишечных вирусных инфекций, водный путь передачи в настоящее время является одним из основных в формировании спорадической и вспышечной заболеваемости.

Известно, что для индикации цитопатогенных вирусов, распространяющихся водным путем, в практической лабораторной службе используется метод их выделения на чувствительных культурах клеток. Однако данный метод имеет ряд недостатков, снижающих его практическую значимость: длительность процесса (3-4 недели), невозможность выделения нецитолитических и поврежденных вирусных агентов, не способных вызывать продуктивную цитолитическую инфекцию в системе in vitro, но, тем не менее, представляющих эпидемическую опасность для живого организма (Проблема лабораторной диагностики острых кишечных инфекций неустановленной этиологии у детей / Т.В. Амвросьева, Н.В. Поклонская, Е.П. Кишкурно, Н.Л. Клюйко, О.Н. Казинец, А.А. Безручко, О.И. Камяк // Перспективы сотрудничества государств-членов ШОС в противодействии угрозе инфекционных болезней: материалы междунар. науч.-практ. конф. / ФГУН «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора. - Новосибирск, 2009. - С. 52-55). Эти проблемы, возникающие при изучении вирусологического качества вод различных водных объектов, могут быть решены путем использования метода детекции, представляющего собой полимеразную цепную реакцию с этапом обратной транскрипции (ОТ-ПЦР), который позволяет в течение 3-6 часов обнаружить в исследуемом материале вирусную РНК.

Метод полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) является наиболее распространенным методом, используемым в лабораторной практике для дифференциальной диагностики инфекционных заболеваний. В основе метода лежат две реакции - обратная транскрипция и полимеразная цепная реакция. В реакции обратной транскрипции на матрице вирусной РНК строится комплиментарная ДНК (кДНК). В следующей за реакцией обратной транскрипции ПЦР происходит многократное избирательное удвоение целевого участка кДНК (амплификация). Амплифицируемый участок кДНК является маркерным, так как строго ограничен последовательностями ДНК-затравок (праймеров), без которых невозможно протекание ПЦР. Для детекции накопления продуктов амплификации в режиме реального времени помимо пары праймеров необходим также флуорисцентно-меченый ДНК-зонд. Сложность выбора праймеров и зонда обусловлена требованием их строгой видоспецифичности. В случае если выбранные олигонуклеотиды не обладают видовой специфичностью к целевому объекту либо не обладают достаточной гомологией к целевой нуклеотидной последовательности, возможны ложноотрицательные результаты исследования. В случае если выбранные праймеры и зонды демонстрируют сродство к нецелевым последовательностям ДНК, то возможны ложноположительные результаты исследования. Правильный выбор сочетания пары праймеров и флуоресцентно-меченого ДНК-зонда позволяет осуществить строго специфическую амплификацию целевого фрагмента кДНК и провести детекцию накопления продуктов ПЦР в режиме реального времени.

Для ПЦР диагностики энтеровирусов используются ПЦР-тест-системы с детекцией методом электрофореза таких компаний, как ЗАО «БиоХимМак» (http://www.biochemmack.ru/product/moleculardiagnostics/infectious/), ЗАО «Литех» (наборы реагентов для ПЦР производства "ИзоГен") (http://www.lytech.ru/ catalog_69.htm). Набор с гибридизационно-флуоресцентной детекцией производит компания «ИнтерЛабСервис» (http://www.interlabservice.ru/catalog/reagents/ index.php?sid=678).

Для диагностики вирусов гепатита А методом ПЦР используются набор реагентов для выявления РНК вируса гепатита A (HAV) в клиническом материале и объектах окружающей среды методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией "АмплиСенс® HAV-F (http://www.product_3056.html).

Для диагностики вируса гепатита Е методом ПЦР наборы на территории России не выпускаются.

Наиболее близким аналогом (прототипом) является набор для детекции кДНК риновируса человека методом ПЦР, включающий набор праймеров: "АмплиСенс®ОРВИ-скрин-FL" (ЦНИИ Эпидемиологии, г. Москва). Указанный набор реагентов позволяет выявлять возбудителей острых респираторных вирусных инфекций человека (ОРВИ) (РНК респираторно-синцитиального вируса, метапневмовируса, вирусов парагриппа 1-4 типов, коронавирусов, риновирусов, ДНК аденовирусов групп B, C и E и бокавируса в клиническом материале методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией (http://www.pacxodka39.ru/product_3056.html)..

Таким образом, в настоящее время мультиплексные ПЦР тест-системы для одновременной диагностики энтеровирусов, риновирусов, вирусов гепатита А и Е на территории России и за рубежом не известны. Тем более нет специализированных тест-систем для выявления вирусов в образцах воды.

Техническим результатом заявляемого изобретения является создание набора реагентов: праймеры и флуоресцентно-меченые зонды, позволяющие идентифицировать энтеровирусы, риновирусы, вирусы гепатита А и Е, методом мультиплексной ПЦР в реальном времени.

Указанный технический результат достигается разработкой набора олиго-дезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е из водной среды методом мультиплексной полимеразной цепной реакциии и имеющие представленную ниже (и в приложении к заявке) структуру нуклеотидных последовательностей:

для выявленя РНК риновирусов:

- прямые (F1 и F2) и обратные (R1 и R2) праймеры:

F1: 5`-TARACCTIGCAGATGRGGC-3`

F2: 5`-TTAACCGTYAICCGCCA-3`

R1: 5`-GAAACACGGACACCCAAAGTAG-3`

R2: 5`-ACCCAAAGTAGTCGGTCCC-3`

- флуоресцентно-меченые ДНК-зонды (Z1 и Z2):

Z1: FAM-CCYGCGTGGCIGCCTGC-BHQ1

Z2: FAM-YIAGCCTGCGTGGCGG-BHQ1

для выявления РНК всех энтеровирусов A, B, C, D и полиовирусов:

- прямой (F3) и обратный (R3) праймеры:

F3: 5`- CAAGIACTTCTGTTICCYCGGACIGA -3`

R3: 5`- ATITITCAATTGTCAICATAAGCAGCCA -3`

- флуоресцентно-меченый ДНК-зонд (Z3):

Z3: ROX- CCTIGGCNCCTGAIGCGGCTAATCC -BHQ2

для выявления РНК вируса гепатита А:

- прямой (F4) и обратный (R4) праймеры:

F4: 5`- GTAGGCTACGGGTGAAACCTCTT -3'

R4: 5`- CGGCGTTGAATGGTTTTTGT -3'

- флуоресцентно-меченый ДНК-зонд (Z4):

Z4: R6G- AGGGTAACAGCGGCGGATATTGGTGAGT -BHQ2

для выявления РНК вируса гепатита Е:

- прямой (F5) и обратный (R5) праймеры:

F5 5`- CGGCRGTGGTTTCTGGGGTGAC -3'

R5 5`- GGGGTTGGTTGGATGAATATAGGGG -3'

- флуоресцентно-меченый ДНК-зонд (Z5):

Z5 Cy5- TGATTCTCAGCCCTTCGCCCTCCCC -BHQ2

Перечень графических материалов

На фиг. 1. приведены графики анализа образцов на содержание риновирусов методом ПЦР в реальном времени. На фиг. 2. представлены графики анализа образцов на содержание энтеровирусов методом ПЦР в реальном времени. На фиг. 3. представлены графики анализа образцов на содержание вируса гепатита А методом ПЦР в реальном времени. На фиг. 4. приведены графики анализа образцов на содержание вируса гепатита Е методом ПЦР в реальном времени

Апробация олигонуклеотидов была осуществлена с использованием лабораторной вирусной коллекции изолятов энтеровирусов, риновирусов, вирусов гепатита А и Е (порядок проведения исследования одобрен этическим комитетом ФБУН ГНЦ ВБ «Вектор» (IRB 00001360)). Экспериментально было показано, что выбранные праймеры и ДНК-зонды обеспечивают надежный синтез целевых ДНК-фрагментов. Специфичность амплификации дополнительно подтверждали секвенированием.

Характеристика набора праймеров и участка амплифицируемой геномной РНК риновирусов. Предлагаемые к патентованию праймеры, фланкируют участок гена кодирующего вирусный гликопротеин 1 (VP1-ген). В ПЦР амплифицируется фрагмент генома с 28117 по 28630 нуклеотид (513 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК энтеровирусов. Предлагаемые к патентованию праймеры комплементарны некодирующей части геномной РНК (5”-UTR). В ПЦР амплифицируется фрагмент генома с 72 по 521 нуклеотид (449 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК вируса гепатита А. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома с 311 по 421 нуклеотид (110 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК вируса гепатита Е. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома с 5298 по 5370 нуклеотид (72 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Оптимизация условий проведения ПЦР осуществлялась с использованием коммерчески доступных наборов реагентов, приборов и ферментов, предназначенных для массового использования в лабораторной практике, что позволяет быстрое и надежное применение данного изобретения в медицинских и научно-исследовательских лабораториях.

Методика получения положительных контрольных образцов

Положительные контрольные образцы были получены методом клонирования. Компетентные клетки E. coli линии TOP 10 (Invitrogen, США) были трансформированы рекомбинантными плазмидами pCR2.1 (Invitrogen, США), несущими вирусспецифическую вставку искусственно синтезированных фрагментов кДНК. Наличие специфической к вирусному геному ДНК-вставки подтверждали секвенированием.

Определение концентрации плазмидной ДНК осуществляли при помощи флуориметра QUBIT (Invitrogen, США) и наборов реагентов Quant-iT DNA HS. Измерение флюоресценции проводили на приборах “Rotor Gene 6000” (Corbet), ABI Prizm 7000 и iQ5 «BioRad» (США). Специфичность каждого из полученных амплификационных фрагментов была подтверждена секвенированием на генетическом анализаторе 3130x/ Genetic Analyzer («Applied Biosystems», США).

Анализ эффективности проведенной трансформации осуществляли методом ПЦР в режиме реального времени в соответствии с протоколом, описанным ниже, где в реакционную смесь в качестве положительного образца добавляли 1×ТЕ-буфер, содержащий рекомбинантную плазмиду, со встройкой вирусспецифического синтезированного кДНК-дуплекса. В качестве отрицательного контрольного образца в реакционную смесь добавляли 1×ТЕ-буфер.

Конструирование внутреннего контрольного образца

В качестве внутреннего контрольного образца была использована защищенная двухцепочечная РНК фага MS-2. Псевдофаг получали клонированием под T5 фаговый промотор фрагмента 370 п.н. кДНК фага MS-2 в вектор pQE31. Синтез матричной РНК индуцировали IPTG. Фаговые частицы очищали центрифугированием.

Внутренний контрольный образец (ВКО), позволяет компенсировать ингибирование и контролировать процессы пробоподготовки и амплификации, что обеспечивает более точное определение РНК в каждом анализируемом образце. ВКО представляет собой неинфекционную защищенную РНК бактериофага MS2 (концентрация 105 копий РНК MS2/мл).

Выделение вируссодержащего материала из образцов воды.

Пробу воды готовили 1000-кратным разведением клинического образца, содержащего ротавирус в дистилированной и автоклавированнной воде. Пробы подвергались фильтрации через подобранную оптимальную фильтрационную систему. После чего производилась элюция с мембраны, выделение РНК, обратная транскрипция и ПЦР в режиме реального времени с использованием мультиплексного варианта тест-систем. Наиболее удобной в работе оказалась система вакуумной фильтрации с приставкой предварительной фильтрации (Sartorius, Германия), поскольку одновременно позволяла проводить отсечку бактериального компонента из образцов воды (на первый 0.22 мкм фильтр) и сорбцию вирусного материала на мембрану марки ММПА+-020-142 (ООО НПП «Технофильтр», Россия). Мембраны обладают повышенной сорбционной способностью по отношению к вирусам, колифагам и пирогенам. Мембраны микропористые полиамидные с положительным дзета-потенциалом, изготовленные на основе полиамида (Nylon-6 и Nylon-66). Мембраны ММПА+ имеют крупноячеистое строение с тонкими микропористыми перегородками, что предопределяет непрерывность структуры мембран и обеспечивает прочность и эластичность в сухом и смоченном виде. Благодаря высокой пористости и контролируемому размеру пор мембраны обладают высокой эффективностью удержания микрочастиц при большой скорости фильтрации.

Экстракция вирусной РНК

Вирусную РНК выделяли из 100 мкл вируссодержащей жидкости с использованием набора «ЛИТЕХ» (г. Москва) согласно инструкции производителя.

Реакция обратной транскрипции

Синтез комплементарной ДНК (кДНК) проводили на матрице суммарной РНК с использованием набора реагентов «Реверта-L» (ФБУН ЦНИИЭ, г. Москва) согласно инструкции производителя.

Проведение полимеразной цепной реакции

Условия проведения амплификации оптимизировали по концентрации ионов магния, концентрации праймеров и зондов в реакционной смеси, а также по температуре отжига праймеров.

Реакцию амплификации проводили в 30 мкл смеси для ПЦР (таб. 1), содержащей 1×Taq буфер для амплификации, 2.5 мМ MgCl2, 0.17 мМ каждого из нуклеозидтрифосфатов, 1.5 активных единиц Smart Taq ДНК-полимеразы (все компоненты ООО «Лаборатория МЕДИГЕН»), 20 пМ прямого и обратного праймеров и 8 пМ флуоресцентного ДНК-зонда.

Таблица 1
ПЦР-смесь (из расчета на одну пробирку)
Компонент Объем, мкл
ПЦР-буфер×10 3
дНТФ (5 мМ) 1
MgCl2 (50 мМ) 1.5
Hot Start Taq ДНК-полимераза 0.3
Смесь прямых праймеров - F (10 нМ) 2
Смесь обратных праймеров - R (10 нМ) 2
Смесь ДНК-зондов - Z (15 нМ) 0.5
Образец 3
diH2O 16.7

ПЦР в режиме реального времени проводили согласно программе амплификации (таблица 2). Детекцию интенсивности флуоресценции проводили по каналам - по каналам Green (FAM, 470 nm /510 nm), Yellow (530 нм / 555 нм), Red (625 нм / 660 нм) и Orange ( ). Измерение флуоресценции проводили на приборах “Rotor Gene 6000” (Corbet Research, Австралия) и iQ5 (BioRad, США). Результаты оценивали по наличию флуоресценции до 30 цикла (фиг. 1-4).

Таблица 2
Программа амплификации
Операция T, °C T, мин:с
1 Hold/Активация Smart-Taq-ДНК-полимеразы 95 05:00
2 Cycling 1/Циклирование 1 (10 циклов) 95 00:10
55 00:30
72 00:20
3 Cycling 2/Циклирование 2 (30 циклов) 95 00:10
55 00:30 детекция
72 00:20

В эксперименте методом ПЦР в реальном времени были проанализированы последовательные десятикратные разведения кДНК энтеровирусов, риновирусов, вирусов гепатита А и Е из образцов воды. На фиг. 1-4 представлены графики результатов анализа образцов методом ПЦР в реальном времени.

На фиг. 1. приведены результаты анализа образцов на содержание риновирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов, где:

1 - положительный контрольный образец (плазмидная конструкция, содержащая кДНК риновируса);

2 - кДНК риновируса, (разведение 1:100);

3 - кДНК риновируса, (разведение 1:1000);

4 - кДНК риновируса, (разведение 1:10000);

5 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 2. Приведены результаты анализа образцов на содержание энтеровирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов, где:

1 - положительный контрольный образец (плазмидная конструкция содержащая кДНК энтеровируса);

2 - кДНК энтеровируса, (разведение 1:100);

3 - кДНК энтеровируса, (разведение 1:1000);

4 - кДНК энтеровируса, (разведение 1:10000);

5 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 3. представлены результаты анализа образцов на содержание вируса гепатита А методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов, где:

1 - положительный контрольный образец (плазмидная конструкция содержащая кДНК вируса гепатита А);

2 - кДНК вируса гепатита А, (разведение 1:100);

3 - кДНК вируса гепатита А, (разведение 1:1000);

4 - кДНК вируса гепатита А, (разведение 1:10000);

5 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 4. приведены результаты анализа образцов на содержание вируса гепатита Е методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов, где:

1 - положительный контрольный образец (плазмидная конструкция содержащая кДНК вируса гепатита Е);

2 - кДНК вируса гепатита Е (разведение 1:100);

3 - кДНК вируса гепатита Е (разведение 1:1000);

4 - кДНК вируса гепатита Е (разведение 1:10000);

5 - отрицательный контрольный образец (однократный ТЕ-буфер).

Таким образом, из вышеизложенного следует, что достигнут заявляемый технический результат, а именно: разработан набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов, обеспечивающих надежную детекцию энтеровирусов, риновирусов, вирусов гепатита А и Е в образцах воды из окружающей среды методом мультиплексной полимеразной цепной реакции.

В рамках заявляемого технического решения разработанные праймеры и ДНК-зонды обладают высокой степенью гомологии ко всем известным нуклеотидным последовательностям геномов изолятов РНК энтеровирусов, риновирусов, вирусов гепатита А и Е человека, доступным в международной базе данных биотехнологической информации GenBank.

Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е из водной среды методом мультиплексной полимеразной цепной реакциии и имеющие следующую структуру:
Для выявления РНК риновирусов:
прямые (F1 и F2) и обратные (R1 и R2) праймеры:
F1: 5`-TA(A/G)ACCT(A/T/C/G)GCAGATG(A/G)GGC-3`
F2: 5`-TTAACCGT(А/С)A(A/T/C/G)CCGCCA-3`
R1: 5`-GAAACACGGACACCCAAAGTAG-3`
R2: 5`-ACCCAAAGTAGTCGGTCCC-3`
флуоресцентно-меченые ДНК-зонды (Z1 и Z2):
Z1: FAM-CC(A/C)GCGTGGC(A/T/C/G)GCCTGC-BHQ1
Z2: FAM-(A/C)(A/T/C/G)AGCCTGCGTGGCGG-BHQ1
Для выявления РНК всех энтеровирусов А, В, С, D и полиовирусов:
- прямой (F3) и обратный (R3) праймеры:
F3: 5`-CAAG(A/T/C/G)ACTTCTGTT(A/T/C/G)CC(A/C)CGGAC(A/T/C/G)GA-3`
R3: 5`-AT(A/T/C/G)T(A/T/C/G)TCAATTGTCA(A/T/C/G)CATAAGCAGCCA-3`
- флуоресцентно-меченый ДНК-зонд (Z3):
Z3: ROX-CCT(A/T/C/G)GGC(A/T/C/G)CCTGA(A/T/C/G)GCGGCTAATCC-BHQ2
Для выявления РНК вируса гепатита А:
- прямой (F4) и обратный (R4) праймеры:
F4: 5`-GTAGGCTACGGGTGAAACCTCTT-3′
R4: 5`-CGGCGTTGAATGGTTTTTGT-3′
- флуоресцентно-меченый ДНК-зонд (Z4):
Z4: R6G-AGGGTAACAGCGGCGGATATTGGTGAGT-BHQ2
Для выявления РНК вируса гепатита Е:
- прямой (F5) и обратный (R5) праймеры:
F5: 5`-CGGC(A/G)GTGGTTTCTGGGGTGAC-3′
R5: 5`-GGGGTTGGTTGGATGAATATAGGGG-3′
- флуоресцентно-меченый ДНК-зонд (Z5):
Z5 Су5-TGATTCTCAGCCCTTCGCCCTCCCC-BHQ2



 

Похожие патенты:

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.

Изобретение относится к области биотехнологии и микробиологии. Предложен способ количественного определения видового состава пропионовых бактерий, обитающих на коже человека.

Группа изобретений относится к области биотехнологии, в частности к автоматическому устройству и способу очистки и выделения целевой нуклеиновой кислоты из биологического образца, причем устройство обеспечивает возможность предотвратить загрязнение выделенной целевой нуклеиновой кислоты от аэрозоля и которое может быть применено ко всем видам оборудования выделения и очистки нуклеиновых кислот из множества биологических образцов, использующего магнитный стержень или мультипипеточный блок, движущийся в двух или трех осевых направлениях.

Изобретение относится к области биохимии, в частности к набору реагентов и способу для выявления ДНК возбудителей чумы, сибирской язвы и туляремии. Набор содержит шесть видоспецифичных олигонуклеотидных праймеров и три зонда, комплементарных фрагментам ДНК генов Yersinia pestis, Bacillus anthracis и Francisella tularensis.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a.

Изобретение относится к биотехнологии, а именно к способу пренатальной и постнатальной ДНК-диагностики синдрома Дауна, Эдвардса и Патау, мутации delF508 в гене муковисцидоза и резус-фактора плода методом количественной флюоресцентной полимеразной цепной реакции.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК метапневмовируса человека методом ПЦР в реальном времени, содержащему четыре прямых олигодезоксирибонуклеотидных праймера и два обратных олигодезоксирибонуклеотидных праймера, а также два флуоресцентно-меченых ДНК-зонда. Изобретение позволяет наравне с известными аналогами провести надежную и достоверную детекцию метапневмовируса человека в клинических образцах и других биологических материалах. 1 ил., 3 табл.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации риновирусов человека видов А, В и С, методом ПЦР в реальном времени, содержащему два прямых и два обратных олигодезоксирибонуклеотидных праймера и два флуоресцентно-меченых ДНК-зонда. Изобретение позволяет наравне с известными аналогами провести надежную и достоверную детекцию риновируса человека в клинических образцах и других биологических материалах. 2 ил., 3 табл.

Изобретение относится к генетике, медицине и молекулярной биологии. Предложен способ неинвазивной диагностики анеуплоидий плода на основе использования геномных библиотек. Изобретение позволяет повысить чувствительность и селективность определения анеуплоидии плода. 22 з.п. ф-лы, 4 пр.

Группа изобретений относится к области биотехнологии. Способ выбора пищевого рациона предусматривает определение пищевого рациона или вещества, которые повышают количество микроРНК, присутствующее в молоке млекопитающего, используя корреляцию профилей микроРНК в молоке и пищевом рационе, полученном млекопитающим, или веществе, содержащемся в пищевом рационе, в качестве индекса. Сравнивают профили микроРНК в молоке, обнаруженные до и после получения пищевого рациона, и если количество по меньшей мере одного вида микроРНК, обнаруженное после получения, выше, чем обнаруженное до получения, полагают, что пищевой рацион повышает количество микроРНК в молоке. Причем способ дополнительно включает измерение профилей микроРНК в молоке и профилей микроРНК в сыворотке или плазме, и если количество микроРНК, содержащееся и в молоке, и в сыворотке или плазме, при получении пищевого рациона повышается в молоке в 1,47 раза или больше по сравнению с обнаруженным в сыворотке или плазме, полагают, что пищевой рацион повышает количество микроРНК в молоке. Использование группы изобретение позволяет получить грудное молоко, обладающее иммуностимулирующим действием. 2 н. и 4 з.п. ф-лы, 7 ил., 11 табл., 5 пр.

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз. Устройство для автоматической очистки содержит блок 100 пипеток, который размещен с возможностью вертикального и горизонтального перемещения, в который с возможностью удаления установлено множество пипеток 141, 142 для всасывания и выведения материала текучей среды, нагревательный элемент 810 для нагревания конкретного блока лунок многолуночного планшета 420, 420′, элемент 700 для приложения магнитного поля, установленный на опорной плите 400, содержащий элемент 710 для установки магнита. На элементе 700 смонтирован магнит 711, размещенный у нижней стороны конкретного блока лунок многолуночного планшета 420, 420′, и подъемный элемент 760 для подъема вверх и опускания вниз элемента 710 для установки магнита, с возможностью приложения магнитного поля к конкретному блоку лунок многолуночного планшета 420, 420′, размещенному у нижней стороны блока 100 пипеток, и удалять от него. В способе извлечения целевого вещества из биологического образца использовано устройство для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля. Изобретения обеспечивают повышение эффективности и качества выделения и очистки. 6 н. и 20 з.п. ф-лы, 48 ил.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА0090, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА1526, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

Настоящее изобретение относится к биотехнологии и представляет собой мутантные варианты рекомбинантной L-аспарагиназы, характеризующиеся аминокислотной последовательностью, соответствующей аминокислотной последовательности L-аспарагиназы бактерий Wolinella succinogenes, в которой аминокислотный остаток лизина в положении 24 заменен на остаток серина либо аминокислотный остаток валина в положении 23 заменен на остаток глутамина, а аминокислотный остаток лизина в положении 24 заменен на остаток треонина. Изобретение позволяет получить варианты L-аспарагиназы с улучшенной устойчивостью к протеолизу под действием трипсина по сравнению с немодифицированным рекомбинантным белком и различным уровнем глутаминазной активности при полном сохранении аспарагиназной активности, что делает их привлекательными объектами для разработки на их основе новых противоопухолевых терапевтических препаратов. 2 н.п. ф-лы, 1 ил., 1 табл., 11 пр.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности ранибизумабом. Предложен набор, содержащий первый олигонуклеотид и дополнительные олигонуклеотиды, специфичные для аллелей полиморфизма гена матриксной металлопротеазы 25 (ММР25), соответствующего rs1064875. Если соответствующий генотип содержит АА или AG, у пациента прогнозируют повышенную вероятность эффекта от указанного лечения. Предложенная группа изобретений обеспечивает эффективные средства и методы для прогнозирования у пациента с влажной AMD повышенной вероятности получения эффекта от лечения высокоаффинным антителом против VEGF. 2 н. и 7 з.п. ф-лы, 1 ил., 5 табл., 1 пр.

Группа изобретений относится к биотехнологии. Предложен способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий и способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, с его использованием. Указанный продукт получают забором пробы нативного материала, посевом и выращивание бактерий из фекалий пациента на селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием ПЦР, ее депонированием в криохранилище при температуре не выше -75оС со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски. В качестве лактобактерий используют аутоштаммы Lactobacillus spp. Для ПЦР используют специфичные для определенных видов лактобацилл праймеры. Молочнокислую закваску готовят из чистой культуры полученных штаммов с титром не менее 1×108 KOE/мл. Полученный продукт назначают субъекту в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 мин после еды в течение не менее 10 дней. Группа изобретений позволяет повысить длительность стойкого лечения и его эффективность. 2 н.п. ф-лы, 5 табл.
Наверх