Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации рнк метапневмовируса человека



Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации рнк метапневмовируса человека
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации рнк метапневмовируса человека

 


Владельцы патента RU 2543149:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК метапневмовируса человека методом ПЦР в реальном времени, содержащему четыре прямых олигодезоксирибонуклеотидных праймера и два обратных олигодезоксирибонуклеотидных праймера, а также два флуоресцентно-меченых ДНК-зонда. Изобретение позволяет наравне с известными аналогами провести надежную и достоверную детекцию метапневмовируса человека в клинических образцах и других биологических материалах. 1 ил., 3 табл.

 

Изобретение относится к наборам праймеров и флуоресцентно-меченого зонда для выявления генетического материала (РНК) метапневмовируса человека в клинических образцах, секционных пробах, образцах окружающей среды, культуральных вируссодержащих жидкостях и прочих биопрепаратах с целью постановки диагноза, коррекции лечения, эпидемиологического расследования, а также для решения научно-исследовательских задач по мониторингу и изучению свойств метапневмовируса, созданию диагностических, профилактических и лечебных препаратов и может быть использовано в медицине, биотехнологии и эпидемиологии.

При помощи разработанных диагностических праймеров и флуоресцентно-меченых зондов возможно выявление генетического материала (РНК) метапневмовируса человека.

Метод полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) является наиболее распространенным методом, используемым в лабораторной практике для дифференциальной диагностики инфекционных заболеваний. В основе метода лежат две реакции - обратная транскрипция и полимеразная цепная реакция. В реакции обратной транскрипции на матрице вирусной РНК строится комплиментарная ДНК (кДНК). В следующей за реакцией обратной транскрипции ПЦР происходит многократное избирательное удвоение целевого участка кДНК (амплификация). Амплифицируемый участок кДНК является маркерным, так как строго ограничен последовательностями ДНК-затравок (праймеров), без которых невозможно протекание ПЦР. Для детекции накопления продуктов амплификации в режиме реального времени помимо пары праймеров необходим также флуорисцентно-меченый ДНК-зонд. Сложность выбора праймеров и зонда обусловлена требованием их строгой видоспецифичности. В случае если выбранные олигонуклеотиды не обладают видовой специфичностью к целевому объекту, либо не обладают достаточной гомологией к целевой нуклеотидной последовательности, возможны ложноотрицательные результаты исследования. В случае если выбранные праймеры и зонды демонстрируют сродство к нецелевым последовательностям ДНК, то возможны ложноположительные результаты исследования. Правильный выбор сочетания пары праймеров и флуоресцентно-меченого ДНК-зонда позволяет осуществить строго специфическую амплификацию целевого фрагмента кДНК и провести детекцию накопления продуктов ПЦР в режиме реального времени.

Известны зарубежные аналоги, представляющие собой набор праймеров, обеспечивающих специфичный синтез фрагментов кДНК на матрице геномной РНК метапневмовируса человека. В заявке США №20060014140, опубл. 2006 г. представлен набору праймеров для детекции метапневмовируса человека. В патентах Китая №CN102031314, опубл. 2011 г., №CN101550454, опубл. 2009 г., №CN101538618, опубл. 2009 г. представлены наборы праймеров и ДНК-зондов для детекции генетического материала метапневмовируса человека методом ПЦР в реальном времени.

Наиболее близким аналогом (прототипом) является набор праймеров для детекции кДНК метапневмовируса человека методом ПЦР "АмплиСенс®ОРВИ-скрин-FL" (http://www.pacxodka39.ru/product_3056.html ЦНИИ Эпидемиологии, г. Москва). Набор реагентов предназначен для выявления возбудителей острых респираторных вирусных инфекций человека (ОРВИ): РНК респираторно-синцитиального вируса, РНК метапневмовируса, вирусов парагриппа 1-4 типов, коронавирусов, риновирусов, ДНК аденовирусов групп B, C и E и бокавируса в клиническом материале методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией.

Однако в известных аналогах и прототипе праймеры имеют недостаточный уровень гомологии ко всем циркулирующим в настоящее время метапневмовирусам человека в природе, а также имеющимся в базе данных геномам метапневмовируса человека, что снижает надежность и достоверность диагностики указанного вируса с использованием заявляемых праймеров.

Техническим результатом заявляемого изобретения является расширение спектра импортозамещающих олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов, позволяющих надежно и достоверно идентифицировать РНК метапневмовируса человека методом ПЦР в реальном времени. Указанный результат достигается разработкой набора олигодезоксирибонуклеотидных праймеров для детекции РНК метапневмовируса человека, содержащего четыре олигонуклеотидных полимера, обладающих активностью прямого и обратного праймеров в полимеразной цепной реакции, а также два флуоресцентно-меченых ДНК-зонда. Указанные олигонуклеотиды имеют следующую структуру:

В рамках заявляемого технического решения разработанные праймеры и ДНК-зонды обладают высокой степенью гомологии ко всем известным нуклеотидным последовательностям геномов изолятов метапневмовируса человека, доступным в международной базе данных биотехнологической информации GenBank.

По сравнению с известными наборами олигонуклеотидов-аналогов, предлагаемые к патентованию олигонуклеотиды для детекции метапневмовируса человека методом ПЦР в реальном времени имеют ряд значительных преимуществ. Во-первых, в заявляемом наборе присутствуют четыре прямых праймера, два обратных праймера и три меченых ДНК-зонда. Такая комбинация, в дополнении к примененной вырожденности олигонуклеотидов, обеспечивает максимальную гомологию патентуемых праймеров и зондов ко всем имеющимся в международной базе данных GenBank последовательностям геномов метапневмовируса человека. Во-вторых, патентуемый набор олигонуклеотидов был оптимизирован для применения с отечественными реагентами и ферментами (производства ООО «Лаборатория МЕДИГЕН»), а также самых распространенных в лабораторной практике приборов для ПЦР в реальном времени - “Rotor Gene 6000” (Corbet Research, Австралия) и iQ5 (BioRad, США).

Апробация олигонуклеотидов была осуществлена с использованием назофарингеальных смывов от пациентов с симптомами ОРВИ (порядок проведения исследования одобрен этическим комитетом ФБУН ГНЦ ВБ «Вектор» (IRB 00001360)). Экспериментально было показано, что выбранные праймеры и ДНК-зонд обеспечивают надежный синтез целевых ДНК-фрагментов. Специфичность амплификации дополнительно подтверждали секвенированием.

Характеристика набора праймеров и участка амплифицируемой геномной РНК. Предлагаемые к патентованию праймеры, фланкируют участок гена кодирующего вирусный белок нуклеопротеина (NP-ген). В ПЦР амплифицируется фрагмент генома с 3620 по 3742 нуклеотид (122 п.н.) и с 3204 по 3379 нуклеотид (175 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Важно отметить, что оптимизация условий проведения ПЦР осуществлялась с использованием наборов коммерчески доступных реагентов, приборов и ферментов, предназначенных для массового использования в лабораторной практике, что позволяет быстрое и надежное применение данного изобретения в медицинских и научно-исследовательских лабораториях.

Перечень графических материалов

На фиг. 1 представлены результаты анализа образцов методом ПЦР в реальном времени. В эксперименте методом ПЦР в реальном времени были проанализированы тридцать клинических образцов на наличие маркеров респираторных вирусов, в одном образце (кривая № 12) была обнаружена РНК метапневмовируса человека.

Методика конструирования набора диагностических праймеров и флуоресцентно-меченых зондов

На основе теоретического изучения структуры генома метапневмовируса человека, на консервативную область гена вирусного нуклеопротеина (NP-ген) были рассчитаны и синтезированы праймеры и флуоресцентно-меченые ДНК-зонды для проведения полимеразной цепной реакции (таблица 1). В ходе работы было проанализировано 1342 имеющихся в базе данных нуклеотидных последовательностей генома метапневмовируса человека.

Таблица 1.

Праймеры и зонды для детекции метапневмовируса человека

Вирус Последовательность в GenBank Локализация Нуклеотидная последовательность
5' →3'
Tm, °C ПЦР-продукт, п.н.
MpV DQ843659.1 3620-3639 AARATGGCYGTYAGYTTCAG
AAGAATGGTCGCTAGCTTCAG
49.2
50.8
122
3742-3723 GGCYARYTCAGCATCNGTCAT 51.0
3678-3702 ROX-TTTCAGACAAYGCAGGGATAACACC-BHQ2
ROX-TTTCAGACAAYGCTGGAATAACACC-BHQ2
58.1
57.2
AY525843.1 3204-3226
3207-3226
TYTTYACATTAGARGTTGGTGATGT
TTTACACTGGAGGTAGGTGATGT
51.3
49.8
175
3379-3356 ACAAAYCTWGATTGYCTGGG 50.2
3250-3269 ROX-TGGRCCYAGCYTAAWCAAAACAGA-BHQ2 57.4

Методика получения положительных контрольных образцов

Положительные контрольные образцы были получены методом ТОРО-Т/А клонирования. После чего компетентные клетки E. Coli линии TOP 10 (Invitrogen, США) были трансформированы полученными плазмидами pCR2.1 (Invitrogen, США), несущими вирусспецифическую вставку синтезированных фрагментов ДНК. В ходе проделанной работы была сконструирована рекомбинантная плазмида: pMpV. Наличие специфической к вирусному геному ДНК-вставки подтверждали секвенированием.

Анализ эффективности проведенной трансформации осуществляли проведением ПЦР в режиме реального времени в соответствии с протоколом, описанным ниже, где в реакционную смесь в качестве положительного образца добавляли 1×ТЕ-буфер, содержащий рекомбинантную плазмиду pMpV, со встройкой вирусспецифического синтезированного ДНК-дуплекса. В качестве отрицательного контрольного образца в реакционную смесь добавляли 1×ТЕ-буфер.

Экстракция вирусной РНК

Вирусную РНК выделяли из 100 мкл назофарингеального смыва с использованием набора «РИБО-преп» (ФБУН ЦНИИЭ, г. Москва) согласно инструкции производителя.

Реакция обратной транскрипции

Синтез комплементарной ДНК (кДНК) проводили на матрице суммарной РНК с использованием набора реагентов «Реверта-L» (ФБУН ЦНИИЭ, г. Москва) согласно инструкции производителя.

Проведение полимеразной цепной реакции

Условия проведения амплификации оптимизировали по концентрации ионов магния, концентрации праймеров и зондов в реакционной смеси, температуре отжига праймеров.

Таблица 2.

ПЦР-смесь (из расчета на одну пробирку)

Компонент Объем, мкл
ПЦР-буфер×10 3
дНТФ (5 мМ) 1
MgCl2 (50 мМ) 1.5
Hot Start Taq ДНК-полимераза 0.3
Смесь прямых праймеров - F (каждого 10 нМ) 2
Смесь обратных праймеров - R (каждого10 нМ) 2
Смесь ДНК-зондов - Z (каждого 15 нМ) 0.5
Образец 3
diH2O 16.7

Реакцию амплификации проводили в 30 мкл смеси для ПЦР (таблица 2), содержащей 1×Taq буфер для амплификации, 2.5 мМ MgCl2, 0.17 мМ каждого из нуклеозидтрифосфатов, 1.5 активных единиц Smart Taq ДНК-полимеразы (все компоненты ООО «Лаборатория МЕДИГЕН»), 20 пМ прямого и обратного праймеров, 8 пМ флуоресцентного ДНК-зонда.

ПЦР в режиме реального времени проводили согласно программе амплификации, приведенной в таблице 3. Детекцию интенсивности флуоресценции проводили по каналу - Orange 585/610 нм (краситель ROX). Измерение флуоресценции проводили на приборах “Rotor Gene 6000” (Corbet Research, Австралия) и iQ5 (BioRad, США). Результаты оценивали по наличию флуоресценции до 30 цикла. Результаты анализа образцов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов по каналу ROX (585/610 нм) представлены на фиг. 1, на графиках которой приведены:

1 - положительный контрольный образец (плазмидная конструкция pMpV);

12 - клинический образец, в котором обнаружена РНК метапневмовируса;

К - отрицательный контрольный образец (однократный ТЕ-буфер).

Таблица 3.

Программа амплификатора для ПЦР-РВ

Операция T, °C T, мин:с
1 Hold/Активация Smart Taq-ДНК-полимеразы 95 05:00
2 Cycling 1/Циклирование 1 (10 циклов) 95 00:15
51 00:20
72 00:15
3 Cycling 2/Циклирование 2 (30 циклов) 95 00:15
51 00:20 детекция
72 00:15

Апробация патентуемых олигонуклеотидов

Предлагаемые к патентованию олигонуклеотиды были нами апробированы в эпидемиологическом исследовании по изучению видового разнообразия агентов, вызывавших ОРВИ у жителей г. Новосибирска и Новосибирской области в октябре-апреле 2011-2012 г.г.

Нами было исследовано 164 образца назофарингеальных смывов от пациентов с симптомами острой респираторной вирусной инфекции. Этиологический агент заболевания был нами установлен в 43% случаев (69 образцов). Метапневмовирус в исследуемых образцах был выявлен в 1% случаев (2 образца). Специфичность ПЦР-исследования дополнительно подтверждали секвенированием.

Таким образом, заявляемый набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов обеспечивает наравне с известными аналогами надежную и достоверную детекцию метапневмовируса человека в клинических образцах и других биологических материалах.

Приложение

<110> Федеральное бюджетное учреждение науки «Государственный

научный центр вирусологии и биотехнологии "Вектор"» (ФБУН

ГНЦ ВБ "Вектор")

<120> Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК метапневмовируса человека.

<210> 3

<223> Последовательности олигонуклеотидов, видоспецифических к метапневмовирусу человека.

<400> 1 прямые праймеры (forward primers) 5`→3`

F: 5`-AARATGGCYGTYAGYTTCAG-3` (20 н.)

F: 5`-AAGAATGGTCGCTAGCTTCAG-3` (21 н.)

F: 5`-TYTTYACATTAGARGTTGGTGATGT-3` (25 н.)

F: 5`-TTTACACTGGAGGTAGGTGATGT-3` (23 н.)

<400> 2 обратные праймеры (reverse primers) 5`→3`

R: 5`-GGCYARYTCAGCATCNGTCAT-3` (21 н.)

R: 5`-ACAAAYCTWGATTGYCTGGG-3` (20 н.)

<400> 3 флуоресцентно-меченые ДНК-зонды (probes) 5`→3`

Z: 5`-ROX-TTTCAGACAAYGCAGGGATAACACC-BHQ2-3` (25 н.)

Z: 5`-ROX-TTTCAGACAAYGCTGGAATAACACC-BHQ2-3` (25 н.)

Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК метапневмовируса человека методом ПЦР в реальном времени, содержащий четыре прямых олигодезоксирибонуклеотидных праймера и два обратных олигодезоксирибонуклеотидных праймера, а также два флуоресцентно-меченых ДНК-зонда, имеющих следующую структуру:
• прямые праймеры (forward primers) 5`→3`
F: 5`-AARATGGCYGTYAGYTTCAG-3` (20 н.)
F: 5`-AAGAATGGTCGCTAGCTTCAG-3` (21 н.)
F: 5`-TYTTYACATTAGARGTTGGTGATGT-3` (25 н.)
F: 5`-TTTACACTGGAGGTAGGTGATGT-3` (23 н.)
• обратные праймеры (reverse primers) 5`→3`
R: 5`-GGCYARYTCAGCATCNGTCAT-3` (21 н.)
R: 5`-ACAAAYCTWGATTGYCTGGG-3` (20 н.)
• флуоресцентно-меченые ДНК-зонды (probes) 5`→3`
Z: 5`-ROX-TTTCAGACAAYGCAGGGATAACACC-BHQ2-3` (25 н.)
Z: 5`-ROX-TTTCAGACAAYGCTGGAATAACACC-BHQ2-3` (25 н.)



 

Похожие патенты:

Изобретение относится к области биотехнологии и вирусологи. Предложен набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е в образцах воды из окружающей среды методом мультиплексной ПЦР.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.

Изобретение относится к области биотехнологии и микробиологии. Предложен способ количественного определения видового состава пропионовых бактерий, обитающих на коже человека.

Группа изобретений относится к области биотехнологии, в частности к автоматическому устройству и способу очистки и выделения целевой нуклеиновой кислоты из биологического образца, причем устройство обеспечивает возможность предотвратить загрязнение выделенной целевой нуклеиновой кислоты от аэрозоля и которое может быть применено ко всем видам оборудования выделения и очистки нуклеиновых кислот из множества биологических образцов, использующего магнитный стержень или мультипипеточный блок, движущийся в двух или трех осевых направлениях.

Изобретение относится к области биохимии, в частности к набору реагентов и способу для выявления ДНК возбудителей чумы, сибирской язвы и туляремии. Набор содержит шесть видоспецифичных олигонуклеотидных праймеров и три зонда, комплементарных фрагментам ДНК генов Yersinia pestis, Bacillus anthracis и Francisella tularensis.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации риновирусов человека видов А, В и С, методом ПЦР в реальном времени, содержащему два прямых и два обратных олигодезоксирибонуклеотидных праймера и два флуоресцентно-меченых ДНК-зонда. Изобретение позволяет наравне с известными аналогами провести надежную и достоверную детекцию риновируса человека в клинических образцах и других биологических материалах. 2 ил., 3 табл.

Изобретение относится к генетике, медицине и молекулярной биологии. Предложен способ неинвазивной диагностики анеуплоидий плода на основе использования геномных библиотек. Изобретение позволяет повысить чувствительность и селективность определения анеуплоидии плода. 22 з.п. ф-лы, 4 пр.

Группа изобретений относится к области биотехнологии. Способ выбора пищевого рациона предусматривает определение пищевого рациона или вещества, которые повышают количество микроРНК, присутствующее в молоке млекопитающего, используя корреляцию профилей микроРНК в молоке и пищевом рационе, полученном млекопитающим, или веществе, содержащемся в пищевом рационе, в качестве индекса. Сравнивают профили микроРНК в молоке, обнаруженные до и после получения пищевого рациона, и если количество по меньшей мере одного вида микроРНК, обнаруженное после получения, выше, чем обнаруженное до получения, полагают, что пищевой рацион повышает количество микроРНК в молоке. Причем способ дополнительно включает измерение профилей микроРНК в молоке и профилей микроРНК в сыворотке или плазме, и если количество микроРНК, содержащееся и в молоке, и в сыворотке или плазме, при получении пищевого рациона повышается в молоке в 1,47 раза или больше по сравнению с обнаруженным в сыворотке или плазме, полагают, что пищевой рацион повышает количество микроРНК в молоке. Использование группы изобретение позволяет получить грудное молоко, обладающее иммуностимулирующим действием. 2 н. и 4 з.п. ф-лы, 7 ил., 11 табл., 5 пр.

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз. Устройство для автоматической очистки содержит блок 100 пипеток, который размещен с возможностью вертикального и горизонтального перемещения, в который с возможностью удаления установлено множество пипеток 141, 142 для всасывания и выведения материала текучей среды, нагревательный элемент 810 для нагревания конкретного блока лунок многолуночного планшета 420, 420′, элемент 700 для приложения магнитного поля, установленный на опорной плите 400, содержащий элемент 710 для установки магнита. На элементе 700 смонтирован магнит 711, размещенный у нижней стороны конкретного блока лунок многолуночного планшета 420, 420′, и подъемный элемент 760 для подъема вверх и опускания вниз элемента 710 для установки магнита, с возможностью приложения магнитного поля к конкретному блоку лунок многолуночного планшета 420, 420′, размещенному у нижней стороны блока 100 пипеток, и удалять от него. В способе извлечения целевого вещества из биологического образца использовано устройство для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля. Изобретения обеспечивают повышение эффективности и качества выделения и очистки. 6 н. и 20 з.п. ф-лы, 48 ил.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА0090, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА1526, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

Настоящее изобретение относится к биотехнологии и представляет собой мутантные варианты рекомбинантной L-аспарагиназы, характеризующиеся аминокислотной последовательностью, соответствующей аминокислотной последовательности L-аспарагиназы бактерий Wolinella succinogenes, в которой аминокислотный остаток лизина в положении 24 заменен на остаток серина либо аминокислотный остаток валина в положении 23 заменен на остаток глутамина, а аминокислотный остаток лизина в положении 24 заменен на остаток треонина. Изобретение позволяет получить варианты L-аспарагиназы с улучшенной устойчивостью к протеолизу под действием трипсина по сравнению с немодифицированным рекомбинантным белком и различным уровнем глутаминазной активности при полном сохранении аспарагиназной активности, что делает их привлекательными объектами для разработки на их основе новых противоопухолевых терапевтических препаратов. 2 н.п. ф-лы, 1 ил., 1 табл., 11 пр.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности ранибизумабом. Предложен набор, содержащий первый олигонуклеотид и дополнительные олигонуклеотиды, специфичные для аллелей полиморфизма гена матриксной металлопротеазы 25 (ММР25), соответствующего rs1064875. Если соответствующий генотип содержит АА или AG, у пациента прогнозируют повышенную вероятность эффекта от указанного лечения. Предложенная группа изобретений обеспечивает эффективные средства и методы для прогнозирования у пациента с влажной AMD повышенной вероятности получения эффекта от лечения высокоаффинным антителом против VEGF. 2 н. и 7 з.п. ф-лы, 1 ил., 5 табл., 1 пр.

Группа изобретений относится к биотехнологии. Предложен способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий и способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, с его использованием. Указанный продукт получают забором пробы нативного материала, посевом и выращивание бактерий из фекалий пациента на селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием ПЦР, ее депонированием в криохранилище при температуре не выше -75оС со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски. В качестве лактобактерий используют аутоштаммы Lactobacillus spp. Для ПЦР используют специфичные для определенных видов лактобацилл праймеры. Молочнокислую закваску готовят из чистой культуры полученных штаммов с титром не менее 1×108 KOE/мл. Полученный продукт назначают субъекту в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 мин после еды в течение не менее 10 дней. Группа изобретений позволяет повысить длительность стойкого лечения и его эффективность. 2 н.п. ф-лы, 5 табл.

Изобретение относится к области биотехнологии, вирусологии и иммунологии. В частности, настоящее изобретение относится к новому птичьему астровирусу; к антителам и их фрагментам, направленным против указанного нового вируса; к антигенным препаратам, белкам и ДНК-молекулам нового птичьего астровируса; к вакцинам на основе указанного нового вируса или к его антигенным препаратам, белку или ДНК; к способам получения таких вакцин и к диагностическим наборам. Настоящее изобретение может быть использовано в ветеринарии. 8 н. и 3 з.п. ф-лы, 5 ил., 4 табл., 12 пр.
Наверх