Способ диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля



Способ диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля
Способ диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2546526:

Федеральное бюджетное учреждение науки "Федеральный научный центр медико-профилактических технологий управления рисками здоровью населения" (ФБУН "ФНЦ медико-профилактических технологий управления рисками здоровью населения") (RU)

Изобретение относится к области медицины, в частности к способам лабораторной диагностики токсического действия никеля, и описывает способ диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля, при этом осуществляют определение содержания никеля в пробе крови и определение лабораторных показателей: в сыворотке крови - содержание гидроперекиси липидов, а в моче - содержание 8-гидрокси-2-деоксигуанозина, далее проводят корреляционный анализ между указанными лабораторными показателями и уровнем никеля в крови, и при одновременном установлении достоверных зависимостей: повышенное содержание в крови ребенка никеля более 0,083 мг/дм3 и повышенное, по сравнению с референтным уровнем, содержание гидроперекиси липидов в сыворотке крови и повышенное, по сравнению с референтным уровнем, содержание 8-гидрокси-2-деоксигуанозина в моче, диагностируют наличие окислительного стресса в организме на уровне ДНК клетки и мембраны клетки. Изобретение обеспечивает высокую точность диагностики окислительного стресса населения на ранней стадии в условиях внешнесредового воздействия никеля, за счет комплексного использования при интерпретации результатов наряду с лабораторными показателями, характеризующими окислительное повреждение ДНК и мембраны клетки, также показателей содержания химического контаминанта - никеля в крови. 2 табл., 2 ил., 1 пр.

 

Изобретение относится к области медицины, в частности к способам лабораторной диагностики токсического действия никеля, в виде проявления окислительного стресса у детей, проживающих в условиях техногенной нагрузки среды обитания, и может быть использовано для раннего выявления нарушений здоровья, а также - при формировании санитарно-гигиенических мероприятий по предупреждению и устранению воздействия вредных химических веществ, в частности, никеля, обуславливающих формирование экологически обусловленной патологии.

Среда обитания промышленных городов характеризуется многосредовым загрязнением химическими веществами. Одним из загрязнителей из ряда тяжелых металлов является никель, накопление которого в организме выше определенной нормы оказывает токсический эффект. Воздействие никеля на организм на клеточном и субклеточном уровне реализуется в виде индукции свободно-радикального процесса, что подавляет стабильность синтеза и активирует окислительное повреждение дезоксирибонуклеиновой кислоты (ДНК) клетки.

Следует отметить, что небольшие количества никеля находятся в ДНК и РНК (рибонуклеиновая кислота), в химическом составе каждой клетки организма. Никель играет важную роль в циркуляции некоторых белков и может внести вклад в выработку гормонов и липидов, в образование клеточных мембран. Никель используется также в организме при превращении глюкозы в энергию, необходимую для функционирования клеток. Его небольшое количество необходимо для синтеза ферментов, которые ускоряют химические реакции в организме и участвуют в синтезе нуклеиновых кислот и ДНК. Однако слишком много никеля считается весьма токсичным и может иметь негативные последствия для здоровья.

Поэтому решение задачи по выявлению наличия окислительного стресса в организме человека от воздействия никеля является актуальной, что позволит своевременно провести адекватные мероприятия по его устранению, назначив необходимые препараты с антиоксидантными свойствами в соответствующих дозировках.

Из уровня техники известны способы, обеспечивающие выявление токсического действия тяжелых металлов на здоровье человека. Так, например, известен Способ определения чувствительности мембран эритроцитов к воздействию тяжелых металлов, в частности, никеля (Патент РФ №2332668), Способ определения токсичности действия тяжелых металлов на организм (Патент РФ №2138816). Недостатком данных известных способов является их недостаточная информативность в отношении возникновения окислительного стресса у населения, поскольку предлагаемые лабораторные показатели не отражают все стороны свободно-радикальных процессов в организме.

Также из уровня техники был выявлен ряд технических решений, касающихся диагностики окислительного стресса у населения, например: «Способ диагностики нарушений метаболизма в организме, вызванных окислительным стрессом» по патенту РФ №2436101; «Способ диагностики окислительного стресса организма у человека» по патенту РФ №2236008.

В первом способе определяют активность супероксиддисмутазы (СОДi) и каталазы (KATi) в гемолизате, оценивают изменение этих показателей относительно нормы. При значении соотношения этих показателей, равном 1,000±0,002, определяют отсутствие дисбаланса функционирования ферментов антирадикальной защиты, а при других значениях дополнительно определяют степень выраженности окислительного стресса по максимуму и площади вспышки хемилюминесценции. Далее оценивают дисбаланс функционирования ферментов антирадикальной защиты, вычисляя показатель ИПФФАР31, по формуле. При значении ИПФФАР31 ниже 70,0 ед. определяют недостаточность каталазы, а при значении ИПФФАР31 выше 130,0 ед. определяют недостаточность супероксиддисмутазы. Использование известного способа дает возможность оценить функционирование исследуемых ферментов, что позволяет проводить диагностику заболеваний, сопровождающихся окислительным стрессом. Однако его недостатком является то, что активность ферментов определяется только в эритроцитах, использование отношения активностей каталазы/супероксиддисмутазы без учета содержания субстратов, катализируемых ими реакций и содержания продуктов этих реакций, приводит к снижению его достоверности при оценке степени выраженности окислительного стресса.

Согласно способу по патенту РФ №2236008, в гемолизате определяют уровень тиоловых групп. По разнице между показателями среднего количества тиоловых групп гемолизата практически здоровых людей и количеством тиоловых групп гемолизата обследуемого человека определяют количество дисульфидных групп. При значении этой разницы, равной 0,000±0,008 оптических единиц, определяют отсутствие окислительного стресса. При положительном значении этой разницы дополнительно определяют количество промежуточных и минорных продуктов окислительной модификации биомолекул: белков, липидов, углеводов, нуклеиновых кислот, реагирующих с тиобарбитуровой кислотой. Дополнительно определяют количество продуктов модификации биомолекул после предварительной химической индукции Fe2+ процессов перекисного окисления. Определяют коэффициент окислительной модификации биомолекул эритротроцитов по расчетной формуле, и чем выше положительное значение этого коэффициента, тем выше уровень окислительного стресса организма. Но и этот известный способ не лишен недостатков, а именно: диагностика окислительного стресса проводится только в эритроцитах и базируется на определении только продуктов деградации биомолекул, реагирующих с тиобарбитуровой кислотой, таких как производные тиобарбитуровой кислоты, что не в полной мере отражает начальные и конечные этапы развития окислительных реакций (производные тиобарбитуровой кислоты являются, как правило, конечными продуктами окислительных реакций) и не позволяет с высокой достоверностью оценить степень выраженности окислительного стресса.

При этом из уровня техники не были выявлены известные способы определения окислительного стресса у детского населения при воздействии никеля, поэтому сделать выбор ближайшего аналога к заявляемому объекту не представляется возможным.

Технический результат, достигаемый предлагаемым изобретением, заключается в обеспечении высокой точности диагностики окислительного стресса населения на ранней стадии в условиях внешнесредового воздействия никеля, за счет комплексного использования при интерпретации результатов наряду с лабораторными показателями, характеризующими окислительное повреждение ДНК и мембраны клетки и показателей содержания химического контаминанта - никеля в крови.

Указанный технический результат достигается предлагаемым способом диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля, заключающимся в том, что осуществляют определение содержания никеля в пробе крови и определение лабораторных показателей: в сыворотке крови - содержание гидроперекиси липидов, а в моче - содержание 8-гидрокси-2-деоксигуанозина, далее проводят корреляционный анализ между указанными лабораторными показателями и уровнем никеля в крови, и при одновременном установлении достоверных зависимостей: повышенное содержание в крови ребенка никеля более 0,083 мг/дм3 и повышенное, по сравнению с референтным уровнем, содержание гидроперекиси липидов в сыворотке крови и повышенное, по сравнению с референтным уровнем, содержание 8-гидрокси-2-деоксигуанозина в моче, диагностируют наличие окислительного стресса в организме на уровне ДНК клетки и мембраны клетки.

Поставленный технический результат достигается за счет следующего.

Следует пояснить, что никель обладает прямым цитотоксическим действием на мембрану клетки. Взаимодействуя с билипидным слоем клеточной мембраны, никель осуществляет окисление липопротеидов низкой плотности, в результате образуются свободные радикалы (ОН-, О3- и др.), а также гидроперекиси липидов (первичный продукт перекисного окисления липидов). Свободные радикалы и гидроперекиси липидов в свою очередь вновь взаимодействуют с билипидным слоем клеточной мембраны с образованием активных форм кислорода, т.е. запускается свободно-радикальный процесс. Окислительный стресс приводит к разрывам ДНК, изменяет химический состав РНК и нуклеопротеидов и активирует процесс клеточной гибели (апоптоз) и как следствие повышение уровня модифицированного нуклеозида 8-гидрокси-2-деоксигуанозин (далее 8-OHdG), являющегося продуктом повреждения ДНК. Окислительный стресс и активация апоптоза являются пусковым звеном в механизме развития многих патологических процессов и заболеваний.

Благодаря тому, что в предлагаемом способе в качестве лабораторных показателей используют совокупные показатели: гидроперекиси липидов в крови и 8-OHdG в моче, характеризующие окислительное повреждение ДНК и мембраны клетки, с использованием корреляционного анализа, обеспечивается дополнительная информационная связь не только указанных лабораторных показателей с определенным содержанием (более 0,083 мг/дм3) никеля в крови и одновременно информационная связь между самими указанными лабораторными показателями, что делает способ точным и достоверным.

Кроме того, число максимально недействующего уровня никеля в крови для развития окислительного стресса было установлено экспериментальным путем. Иллюстрация этому приведена на Рис.1 и Рис.2. На Рис.1 показана связь повышения содержания гидроперекиси липидов в сыворотке крови, по сравнению с референтным уровнем, при увеличении в крови концентрации никеля. На Рис.2 - связь повышения содержания 8-OHdG в моче, по сравнению с референтным уровнем, при увеличении в крови концентрации никеля.

Данные, приведенные на Рис.1 и Рис.2, показывают, что достоверная корреляция между указанными лабораторными показателями и концентрацией никеля достигается только в диапазоне концентрации никеля более 0,083 мг/дм3. При более низкой концентрации никеля в пробе крови достоверная связь между этой концентрацией и лабораторными показателями: содержанием гидроперекиси липидов в сыворотке крови и содержания 8-OHdG в моче, не выявлена. Данные о концентрации никеля и указанной достоверной связи были подтверждены и нижеприведенными исследованиями, характеризующими пример реализации предлагаемого способа.

Таким образом, предлагаемый способ позволяет на ранней стадии, еще до проявления клинических признаков, прогнозировать вероятность окислительного стресса у детского населения, обусловленного мембранотоксическими эффектами воздействия никеля.

Все это повысит эффективность планирования санитарно-гигиенических мероприятий по предупреждению и устранению воздействия вредных химических веществ, в частности, никеля, обуславливающих экологически обусловленную патологию у детского населения.

Предлагаемый способ осуществляют следующим образом, реализуя его на конкретном примере:

- выбирают экологически неблагополучную территорию по высокой нагрузке химических факторов среды обитания. В качестве такой территории был выбран г.Чусовой Пермского края, характеризующийся наличием хронического аэрогенного воздействия на население компонентов выбросов Чусовского металлургического завода («ЧМЗ»). В частности, никель является одним из приоритетных компонентов выбросов в атмосферный воздух данного промышленного предприятия;

- отбирают случайным образом группу детей, проживающих на этой территории в зоне воздействия выбросов «ЧМЗ». Данный контингент выбран как наиболее чувствительная субпопуляция к внешнесредовой экспозиции химических факторов, что обусловливается возрастными анатомо-физиологическими особенностями органов и систем, вентиляции легких, проницаемости барьерных структур, несовершенством процессов нейроэндокринной регуляции. В результате было отобрано 83 ребенка из организованного детского дошкольного учреждения, проживающих в зоне влияния компонентов выбросов «ЧМЗ», в том числе, 32 мальчика (38% от числа обследованных детей), 51 девочка (62% от числа обследованных детей) - группа наблюдения. Возраст обследованных детей составил 4-7 лет. В обследовании принимали участие дети, прошедшие утренний фильтр, следовательно, без клинических проявлений заболеваний. Лабораторное диагностическое обследование выполняется в соответствии с обязательным соблюдением этических норм, изложенных в Хельсинкской декларации 1975 года с дополнениями 1983 года;

- у детей проводят отбор проб мочи, а также - венозной цельной крови в две пробирки;

- в цельной крови из первой пробирки определяют уровень содержания никеля в соответствии с действующими методическими указаниями в Российской Федерации - МУК 4.1.777-99 (Определение содержания цинка, никеля, меди и хрома в крови методом атомной абсорбции). Оценка установленных уровней содержания в крови никеля осуществляется на основании сравнительного анализа с референтным уровнем полученных результатов у детей. В качестве референтного содержания никеля в крови используется величина - 0,015 мг/дм3 (Клиническая оценка лабораторных тестов / Под ред. Н.У. Тица. М.: Медицина, 1986. 472 с.);

- в сыворотке крови, полученной из второй пробирки, определяют содержание гидроперекиси липидов. Оценка установленных уровней содержания в крови гидроперекиси липидов осуществляется на основании сравнительного анализа полученных результатов у детей с диапазоном нормальных значений (референтного уровня), установленных производителем набора - 0-350 мкмоль/дм3 (Оху Stat, кат. № BI-5007, Biomedica, Австрия). Исследование выполнено на иммуноферментном анализаторе «Infinite F50 Тесаn» (Австрия);

- в пробе мочи определяют уровень 8-OHdG. Оценка установленных уровней содержания 8-OHdG в моче проводится на основании сравнительного анализа полученных результатов у детей с диапазоном референтных значений - 87,4-281,6 нг/см3. Референтный диапазон установлен на основании данных собственных исследований (выборка из 100 практически здоровых детей, проживающих на территории санитарно-гигиенического благополучия), выполненных с использованием набора Assay Designs DNA Damage ELISA (USA) на иммуноферментном анализаторе «Infinite F50 Тесаn» (Австрия);

- далее проводят расчет вероятности изменения исследуемых показателей, включая линейный корреляционный анализ (зависимости показателей детей из Чусового: повышенный уровень никеля в крови - повышенный уровень гидроперекиси липидов в сыворотке крови; повышенный уровень никеля в крови - повышенный уровень 8-OHdG в моче). Проверка статистических гипотез относительно полученных корреляционных зависимостей проводится с использованием критерия Стьюдента. Различия считают статистически значимыми при вероятности p≤0,05.

На конкретном примере, анализ результатов обследования 83 детей, проживающих на промышленно развитой территории Чусового и подвергающихся внешнесредовому воздействию никеля, позволил установить достоверные различия изучаемых показателей с референтными уровнями (таблица 1).

Таблица 1
Результаты исследования детей группы наблюдения
Показатель Группа наблюдения (М±m) Референтный уровень (RL) Доли RL Достоверность различий с референтным уровнем (p≤0,05)
Никель в крови, мг/дм3 0,15±0,022 0,015 10,0 0,002
8-OHdG в моче, нг/см3 356,4±29,4 87,4-281,6 1,3 0,05
Гидроперекиси липидов в сыворотке крови, мкмоль/дм3 535,61±63,06 0-350 1,5 0,000

Средняя концентрация никеля в крови детей группы наблюдения превысила референтный уровень в 10,0 раз (р=0,002). Статистически достоверное повышенное содержание никеля в крови обнаружено у 73% обследованных детей. Средний уровень 8-OHdG в моче в группе наблюдения (356,4±29,4 нг/см3) в 1,3 раза превысил верхнюю границу референтного уровня (281,6 нг/см3, р=0,05), уровень гидроперекисей липидов в сыворотке крови (535,61±63,06 мкмоль/дм3) в 1,5 раза превысил верхний предел референтного значения (350,0 мкмоль/дм3, р=0,000). Достоверное повышение (p≤0,05) относительно референтных значений уровня гидроперекиси липидов в сыворотке крови выявлено в 68,9% случаев от числа обследованных детей и уровня 8-OHdG моче в 63,5%;

- затем сопоставляют уровень никеля в цельной крови с уровнем гидроперекиси липидов в сыворотке крови и уровнем 8-OHdG в моче. При значении уровня гидроперекиси липидов в сыворотке крови выше нормы (референтный уровень равен 0-350 мкмоль/дм3) в сочетании с повышением уровнем содержания 8-OHdG в моче (референтный диапазон равен 87,4-281,6 нг/см3) на фоне повышенного уровня никеля в цельной крови, при установлении достоверных зависимостей: повышенный уровень никеля в крови - повышенный уровень гидроперекиси липидов в сыворотке крови; повышенный уровень никеля в крови - повышенный уровень 8-OHdG в моче, действие никеля определяют как токсическое (а именно, мембранотоксичное).

Оценка результатов математического моделирования причинно-следственных связей позволила установить зависимость повышения уровня гидроперекиси липидов в сыворотке крови и уровня 8-OHdG в моче от повышения концентрации в крови никеля. Данные представлены в таблице 2.

Таблица 2
Параметры моделей зависимости вероятности отклонения лабораторных показателей от концентрации никеля в крови детей (p≤0,05)
Вид ответа Параметры модели Критерий Фишера (F) Коэффициент корреляции (r) Концентрация никеля, мг/дм3 Доверительные границы, мг/дм3
b0 b1 верхняя нижняя
Гидроперекись липидов в сыворотке крови -2,76 7,73 17,57 0,46 0,092 0,083 0,101
8-OHdG в моче -1,47 19,81 98,18 0,83 0,114 0,107 0,121

Из полученных концентраций никеля в крови наименьшей концентрацией для вероятного проявления окислительного стресса у детского населения является 0,083 мг/дм (лимитирующий показатель - вероятность повышения гидроперекиси липидов в сыворотке крови). Установленная экспериментальным путем данная концентрация никеля рекомендована в качестве максимально недействующей концентрации никеля в крови для условий хронического аэрогенного воздействия никеля при диагностике окислительного стресса у детского населения.

После обследования детей предлагаемым способом было установлено, что у 52 из 83 детей, проживающих на промышленно развитой территории Чусового, имеется окислительный стресс на уровне ДНК и мембраны клетки, обусловленный токсическим действием никеля на организм.

Для доказательства такого вывода всем детям группы наблюдения (всем 83 детям) был выполнен цитогенетический анализ - микроядерный тест буккальных эпителиоцитов для выявления нарушений на уровне ДНК клетки. Анализ полученных результатов выявил, что максимальная частота ядерных аномалий (микроядра, протрузии и насечки ядра, многоядерные клетки) регистрируется у 52 детей с выявленными одновременно достоверными зависимостями (повышенный более 0,083 мг/дм уровень никеля в крови - повышенный уровень гидроперекиси липидов в сыворотке крови, повышенный более 0,083 мг/дм уровень никеля в крови - повышенный уровень 8-OHdG в моче). Данные цитогенетические нарушения свидетельствуют о повышенной генетической нестабильности, зафиксированной в эксфолиативных клетках буккального эпителия у вышеназванных 52 детей. Кратность превышения частоты регистрации ядерных аномалий у этих детей с указанными достоверными зависимостями до 3,5 раз статистически значимо превысила (p≤0,05) аналогичные показатели детей с отсутствием достоверных зависимостей.

Для доказательства развития окислительного стресса на уровне мембраны клетки всем детям группы наблюдения (83 человека) через 6 месяцев был проведен анализ заболеваемости. Из 52 детей с выявленными достоверными зависимостями у 12 была выявлена бронхиальная астма, у 11 - энцефалопатия, у остальных - частые манифестации ОРВИ в сочетании с хронической ЛОР патологией. Согласно токсикологическим свойствам никеля, все указанные болезни обусловлены воздействием именно повышенного содержания никеля в организме.

У 31 ребенка без корреляционной зависимости между уровнем содержания никеля в цельной крови и изучаемыми лабораторными показателями окислительного стресса анализ заболеваемости показал, что у 3 детей выявлена патология миндалин и аденоидов, установлен 1 случай бронхиальной астмы, у 2 зарегистрировано более 2 случаев ОРВИ за этот период, у 11 детей по одному эпизоду ОРВИ, у 14 детей клинической манифестации заболеваний не установлено. То есть заболеваемость на порядок ниже, чем у вышеназванных 52 детей.

Вышеуказанные данные являются доказательством того, что только при наличии предложенной взаимосвязи содержания никеля в крови более 0,083 мг/дм и уровня заявленных лабораторных показателей обеспечивается точность и информативность предлагаемого способа, посредством которого можно диагностировать окислительный стресс на уровне ДНК клетки и мембраны клетки у детского населения.

Таким образом, использование предлагаемого способа при обследовании детей, проживающих в экологически неблагополучных условиях внешнесредового воздействия никеля, позволяет:

- обеспечить возможность выявления с высокой точностью на ранней стадии развития окислительного стресса, как результата мембранотоксического действия никеля;

- обеспечить прогноз возникновения и характер течения заболевания различных нозологий (бронхиальная астма, болезни миндалин и аденоидов, энцефалопатия, развитие цитогенетических нарушений);

- обосновать необходимость углубленного клинического обследования ребенка именно в отношении заболеваний, характерных для развития окислительного стресса при повышенном содержании никеля в организме;

- своевременно выявлять группы риска и осуществлять профилактику окислительного стресса как первичной меры профилактики ряда заболеваний различной нозологии.

Способ диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля, характеризующийся тем, что осуществляют определение содержания никеля в пробе крови и определение лабораторных показателей: в сыворотке крови - содержание гидроперекиси липидов, а в моче - содержание 8-гидрокси-2-деоксигуанозина, далее проводят корреляционный анализ между указанными лабораторными показателями и уровнем никеля в крови, и при одновременном установлении достоверных зависимостей: повышенное содержание в крови ребенка никеля более 0,083 мг/дм3 и повышенное, по сравнению с референтным уровнем, содержание гидроперекиси липидов в сыворотке крови и повышенное, по сравнению с референтным уровнем, содержание 8-гидрокси-2-деоксигуанозина в моче, диагностируют наличие окислительного стресса в организме на уровне ДНК клетки и мембраны клетки.



 

Похожие патенты:

Изобретение относится к биологии и токсикологической химии и может быть использовано в практике химико-токсикологических, экспертно-криминалистических и клинических лабораторий.

Изобретение относится к медицине и токсикологической химии, а именно к способам определения 3-метоксигидроксибензола в биологическом материале, и может быть использовано в практике санэпидстанций, химико-токсикологических, экспертно-криминалистических и ветеринарных лабораторий.
Изобретение относится к медицине, в частности к медицинской диагностике в области онкологии, и описывает способ прогнозирования развития метастазов у больных меланомой кожи.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности ранибизумабом.
Изобретение относится к области медицины и представляет собой способ дифференциальной диагностики стеатоза печени и стеатогепатита путем биохимического исследования, отличающийся тем, что в сыворотке крови определяют фосфолипазу A2, оксид азота и эндотоксин и при значении фосфолипазы A2 199,7-252,5 нг/мл, оксида азота 93-94,6 мкмоль/л и эндотоксина 2,2-2,6 ЕЭ/мл диагностируют стеатоз печени, а при значении фосфолипазы A2 412,5-576,5 нг/мл, оксида азота 137,5-168,5 мкмоль/л и эндотоксина 3,32-4,18 ЕЭ/мл диагностируют стеатогепатит.
Изобретение относится к медицине и описывает способ прогнозирования высокого риска развития производственно обусловленных и профессиональных заболеваний у работников химического комплекса, занятых во вредных условиях труда, включающий определение в сыворотке крови общего антиоксидантного статуса, при этом дополнительно в сыворотке крови определяют количественное содержание продуктов перекисного окисления липидов и при одновременном увеличении количественного содержания перекисей в липидах более 4,31 мкмоль/л и снижении общего антиоксидантного статуса менее 1,3 ммоль/л прогнозируют высокий риск развития производственно обусловленных и профессиональных заболеваний.

Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для лечения вторичной митохондриальной дисфункции у детей с патологией мочевой системы.

Изобретение относится к медицине и может быть использовано для диагностики апоптоза лимфоцитов. Для этого клетки выделяют, инкубируют 48 часов при температуре 37°С и с 5% содержанием СО2, с добавлением индуктора апоптоза дексаметазона в концентрации 10-4 моль/мл.

Группа изобретений относится к инструментам для контроля качества и безопасности в ходе производства нейротоксинов. В частности, группа изобретений относится к способу определения количества частично процессированного и/или непроцессированного нейротоксин А полипептида (BoNT/A) в растворе, содержащем процессированный и частично процессированный и/или непроцессированный BoNT/A, где указанный способ содержит стадию контактирования образца указанного раствора с захватывающим антителом, которое специфически связывается с частично процессированным и непроцессированным BoNT/A в условиях, допускающих связывание указанного антитела с указанным частично процессированным и непроцессированным BoNT/A, в результате чего формируется комплекс, и стадию определения количества образованного комплекса, где количество комплекса является показателем количества частичного процессированного и/или непроцессированного BoNT/A в указанном растворе.
Изобретение относится к области медицины, в частности к офтальмологии. Изобретение представляет способ дифференциальной диагностики типов хориоидальной неоваскуляризации (ХНВ) при влажной форме возрастной макулярной дистрофии, отличающийся тем, что производят забор влаги передней камеры глаза, определяют концентрацию фактора роста эндотелия сосудов, после чего оценивают результат по уровню данных показателей.

Изобретение относится к медицинским токсикологическим исследованиям, в частности к санитарной токсикологии, и может быть использовано для количественного определения пентахлорфенола в крови. Для осуществления предлагаемого способа количественного определения пентахлорфенола в крови методом газохроматографического анализа производят отбор пробы крови, подкисляют ее до pH 2-3 водным раствором щавелевой кислоты, проводят экстракцию толуолом в течение 5 мин, полученный экстракт центрифугируют в течение 60 мин при 7000 об/мин, далее к полученному экстракту добавляют сульфат натрия для удаления воды и проводят ацетилирование в течение 3 часов введением трифторуксусного ангидрида при непрерывном перемешивании в среде пиридина. Пробу крови, толуол, трифторуксусный ангидрид и пиридин берут в объемном соотношении 5:2,5:0,2:0,1 соответственно. Способ обеспечивает упрощение стадии пробоподготовки при одновременном повышении чувствительности определения пентахлорфенола. 2 з.п. ф-лы, 4 табл., 1 пр.
Изобретение относится к области медицины, в частности к способу диагностики когнитивных нарушений у детей при воздействии марганца техногенного происхождения. Сущность способа: по результатам клинической диагностики и нейропсихологического тестирования устанавливают у ребенка наличие когнитивных нарушений. Затем в крови ребенка определяют содержание марганца и при превышении его содержания более референтного уровня определяют уровни: гидроперекиси липидов в сыворотке крови, малонового диальдегида МДА в плазме крови и содержание 8-гидрокси-2-деоксигуанозина 8-OHdG в моче; глутатионпероксидазы ГлПО, Cu/Zn-супероксиддисмутазы Cu/Zn-СОД, уровень антиоксидантной активности ОАС сыворотки кров; глутамата и γ-аминомасляной кислоты в сыворотке крови; содержание гормонов гипофизарно-надпочечниковой оси: уровень адренокортикотропного гормона АКТГ, кортизола и серотонина в сыворотке крови, циклического аденозинмонофосфата цАМФ и циклического гуанозинмонофосфата цГМФ. При повышенном содержании марганца в крови более 0,029 мкг/см3 с не менее чем 50% указанных клинико-лабораторных показателей при их следующей характеристике: повышенные по сравнению с возрастными физиологическими нормами уровни гидроперекиси липидов, МДА, 8-OHdG, глутамата, АКТГ, кортизола, цГМФ, пониженные по сравнению с возрастными физиологическими нормами уровни ГлПО, Cu/Zn-СОД, ОАС, γ-аминомасляной кислоты и цАМФ диагностируют наличие когнитивных нарушений у ребенка, ассоциированных с воздействием марганца. Применение изобретения обеспечивает высокую точность диагностики. 1 з.п. ф-лы, 1 пр.

Изобретение относится к медицинским токсикологическим исследованиям, в частности к санитарной токсикологии, и может быть использовано для количественного определения бенз(а)пирена в крови, для оценки риска здоровью человека и разработки мероприятий по обеспечению химической безопасности. Способ осуществляется следующим образом. Каждую пробу крови анализируют дважды. Свежеотобранную пробу крови центрифугируют со скоростью 2000 об/мин в течение 5 мин. Разделяют на фракции плазмы и форменных элементов. Проводят твердофазную экстракцию плазмы путем последовательного пропускания под вакуумом через картридж с сорбентом Oasis HLB 3 сс 100%-ного ацетонитрила, дистиллированной воды, плазмы, дистиллированной воды, 50%-ного водного раствора ацетонитрила. Затем картридж с сорбентом высушивают под вакуумом и пропускают через сорбент 100%-ный метиленхлорид. Аликвотную часть полученного экстракта хроматографируют. Для получения экстракта форменных элементов проводят дисперсионную твердофазную экстракцию: добавляют к ним 100%-ный ацетонитрил, интенсивно встряхивают. Добавляют набор солей QuECHeRS для экстракции, встряхивают интенсивно, центрифугируют 10 минут со скоростью 2000 об/мин, при этом образуется 3 слоя, верхний слой переносят в другую пробирку, в которой содержится набор солей QuECHeRS для очистки, центрифугируют со скоростью 2000 об/мин, отбирают верхний слой. Экстракт плазмы и форменных элементов анализируют на жидкостном хроматографе Agilent серии 1200 с флуориметрическим детектором на колонке Zorbax длиной 50 мм и внутренним диаметром 4,6 мм с сорбентом Eclipse РАН C18 при температуре колонки 27°C, при использовании в качестве подвижной фазы смеси ацетонитрила и воды со скоростью потока 1,5 см3/мин и оптимизации элюирования в градиентном режиме (1 мин подача подвижной фазы 60 об.% ацетонитрила и 40 об.% воды, увеличение ацетонитрила с 60 об.% до 68 об.% в течение 3 мин, увеличение ацетонитрила с 68 об.% до 70 об.% в течение 0,5 мин, увеличение ацетонитрила с 70 об.% до 90 об.% в течение 1,5 мин, увеличение ацетонитрила с 90 об.% до 100 об.% в течение 4,5 мин, подача 100%-ного ацетонитрила в течение 1,5 мин, затем снижение ацетонитрила до 60 об.% и подача 60%-ного ацетонитрила в течение 4 мин до уравновешивания колонки). При этом длина волны возбуждения флуориметрического детектора составляла 265 нм и длина волны эмиссии 412 нм. По градуировочному графику отдельно определяют содержание бенз(а)пирена в плазме и форменных элементах, а результаты суммируют. Изобретение обеспечивает высокую чувствительность способа при одновременном обеспечении селективности и его доступности для серийных анализов. 2 з.п. ф-лы, 6 табл., 1 пр.
Изобретение относится к области медицинской микробиологии, а именно к способу диагностики токсигенных штаммов Clostridium difficile. Сущность способа состоит в том, что пробу кала пациента выдерживают в абсолютном 96% спирте 30-60 мин при соотношении спирта и кала 1:1, центрифугируют 15-20 минут, далее обрабатывают пробу кала 1% раствором дезоксихолата натрия при соотношении 1:1 30-60 минут, центрифугируют, удаляют надосадочную жидкость, затем проводят первичный посев осадка на среде с добавлением 1% лактозы и 0,5-1,0 мМ арабинозы, инкубируют в анаэростате в течение 24-48 ч, выросшие колонии наносят на стандартные диски, пропитанные хромогенным субстратом - орто-нитрофенил-β-D-галактозидазой. При появлении ярко-желтой окраски диска диагностируют токсигенные штаммы Clostridium difficile. Использование заявленного способа позволяет с высокой чувствительностью и специфичностью, простотой и доступностью диагностировать токсигенные штаммы Clostridium difficile. 3 пр.
Изобретение относится к области медицины, а именно к неонатологии и педиатрии, и может быть использовано для прогнозирования развития детского церебрального паралича у недоношенных новорожденных с экстремально низкой массой тела при рождении. Сущность способа заключается в определении концентрации нейронспецифической енолазы (NSE) и васкулоэндотелиального фактора (VEGF) в сыворотке пуповинной крови и сыворотке периферической крови, концентрации мозгового нейротрофического фактора (BDNF) в сыворотке периферической крови на 7 сутки жизни с последующим вычислением прогностического индекса (PI) по формуле: PI=0,033×X1+0,016×X2-0,36×X3+0,002×X4+0,00054×X5-4,0, где X1 - концентрация NSE в пуповинной крови (мкг/л); X2 - концентрация VEGF в пуповинной крови (нг/мл); X3 - концентрация NSE в периферической крови на 7 сутки жизни (мкг/л); X4 - содержание VEGF в периферической крови на 7 сутки жизни (нг/мл); X5 - концентрация BDNF в периферической крови на 7 сутки жизни (нг/мл); Const=-4,0. Если PI менее 0, делают заключение о низком риске развития ДЦП. Если PI более 0, прогнозируют высокий риск развития данной патологии. Предлагаемый способ позволяет повысить эффективность развития детского церебрального паралича у недоношенных новорожденных с экстремально низкой массой тела при рождении до 85%. 2 пр.
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования судорожного синдрома у детей с перинатальными поражениями ЦНС в раннем неонатальном периоде. Для этого в сыворотке крови пуповины у новорожденных детей методом капиллярного электрофореза определяют концентрацию агматина и при его концентрации 0,038 мг/мл и выше прогнозируют развитие судорожных состояний. Изобретение позволяет прогнозировать возникновение судорожных состояний у новорожденных с перинатальным поражением ЦНС и своевременно назначить патогенетическую терапию. 3 пр.
Изобретение относится к медицине, а именно к способу прогнозирования высокого риска формирования хронической патологии адено-тонзиллярной системы у часто болеющих детей (ЧБД). Сущность способа состоит в том, что определяют уровень интерлейкина-17 и ММР-9 в слюне и при уровне интерлейкина-17 выше 5 пг/мл и уровне ММР-9 выше 10 нг/мл прогнозируют высокий риск формирование хронической патологии адено-тонзиллярной системы у ЧБД. Использование заявленного способа позволяет своевременно определить высокий риск формирования хронической патологии адено-тонзиллярной системы у ЧБД и проводить ранние профилактические мероприятия, направленные на их предотвращение. 4 табл., 2 пр.

Изобретение относится к медицине, к хирургии, к онкологии и может быть использовано при дооперационном определении объема хирургического лечения высокодифференцированного рака щитовидной железы. Сущность способа: в материале опухоли, взятом тонкоигольной аспирационной биопсией, определяют экспрессию натрий-йодного симпортера на мембране опухолевой клетки и при экспрессии менее 1% в объем операции дополнительно включают центральную лимфодиссекцию. Экспрессию натрий-йодного симпортера на мембране опухолевой клетки определяю методом проточной флуороцитометрии. Способ позволяет на основе дооперационного определения экспрессии натрий-йодного симпортера на мембране опухолевой клетки достоверно установить объем хирургического лечения высокодифференцированных раков щитовидной железы - папиллярного и фолликулярного. 1 з.п. ф-лы, 2 ил., 2 пр.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242). Способ основан на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. В способе используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК - по максимуму первой производной графиков флуоресценции. Изобретение позволяет повысить надежность и доступность генотипирования. 1 ил.
Изобретение относится к медицине, а именно к способу прогнозирования течения саркоидоза. Сущность способа состоит в том, что исследуют биоптат средней доли правого легкого. Проводят иммуногистохимическое исследование, по меньшей мере, в 5 полях зрения при увеличении ×400 по определению среднего количества миофибробластов в межальвеолярном интерстиции. При значении этой величины более 50 прогнозируют неблагоприятное течение саркоидоза, при выявлении 15 и менее среднего количества миофибробластов прогнозируют благоприятное течение саркоидоза. Использование заявленного способа позволяет осуществить ранний прогноз и выявить группу больных, которым нет необходимости проводить большое количество дополнительных исследований. 2 пр.
Наверх