Олигонуклеотидные праймеры, днк-зонд и способ для идентификации вируса инфекционной анемии лошадей методом пцр или от-пцр в режиме реального времени


 


Владельцы патента RU 2548799:

Государственное научное учреждение Всероссийский научно-исследовательский институт ветеринарной вирусологии и микробиологии (RU)

Группа изобретений относится к области биотехнологии. Способ выявления генома вируса инфекционной анемии лошадей предусматривает постановку полимеразной цепной реакции, амплификацию ДНК вируса, оценку проведения реакции. При этом при выявлении вирусной РНК предварительно проводят реакцию денатурации и обратной транскрипции, а идентификацию проводят с помощью ОТ-ПЦР в реальном времени при выявлении РНК вируса ИНАН и ПЦР в реальном времени при выявлении пДНК вируса ИНАН. Для осуществления способа используют специфические праймеры и ДНК-зонд. При этом температурные режимы включают следующие этапы: 5 мин предварительной денатурации при 94°C, 5 циклов амплификации без детекции (94°C - 10 сек, 56°C - 15 сек, 72°C - 15 сек) и 35 циклов амплификации с детекцией (94°C - 10 сек, 56°C - 15 сек, 72°C - 15 сек). Интерпретацию результатов проводят на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией (Threshold). Использование изобретений позволяет обнаружить РНК и пДНК вируса ИНАН с помощью ОТ-ПЦР в режиме реального времени, а также повысить специфичность и чувствительность способа. 2 н.п. ф-лы, 3 табл., 1 пр.

 

Изобретение относится к биотехнологии, а именно к генетической инженерии, и может быть использовано в ветеринарной вирусологии для выявления РНК и пДНК вируса инфекционной анемии лошадей.

Инфекционная анемия лошадей (ИНАН) - вирусная болезнь однокопытных, характеризующаяся поражением органов кроветворения и проявляющаяся рецидивирующей или постоянной лихорадкой, анемией, явлениями геморрагического диатеза и нарушением функций сердечнососудистой системы, а также длительным вирусоносительством [1, 2, 5].

Возбудитель ИНАН лошадей - РНК-содержащий вирус семейства Retroviridae, рода Lentivirus [1, 2, 4, 6].

С 2010 г. по 2013 г. по данным Международного эпизоотического бюро ИНАН лошадей регистрируется во многих странах мира. 2011 год - Франция, Германия, Греция, Япония - 42 вспышки. 2012 год - Бельгия, Германия, Франция, Греция, Великобритания - 24 вспышки. За полгода 2013 - Бельгия, Франция, Германия - 21 вспышка заболевания.

Также ИНАН регистрируется в странах ближнего зарубежья, например, таких, как Украина [3].

На период 2012 года в нашей стране выявили положительно реагирующих на ИНАН лошадей в Омской, Челябинской, Нижегородской, Кировской, Иркутской, Свердловской, Ленинградской, Курской и Томской областях, республике Бурятия и республике Коми, Приморском и Красноярском крае. За первое полугодие 2013 года выявлены больные животные в Нижегородской, Кировской, Омской, Томской областях, Красноярском крае, республике Коми и республике Хакасия.

Лабораторная диагностика ИНАН в Российской Федерации основана на серологических методах (РДП, ИФА), которые выявляют вирусспецифические антитела в сыворотке крови больных лошадей, начиная с 14-38 дня, и не дают возможности диагностировать заболевание на ранних стадиях болезни до образования антител, а также не позволяют определить статус жеребят, полученных от инфицированных кобыл [1, 2].

Разработка тест-системы для выявления РНК и пДНК вируса инфекционной анемии лошадей в формате реального времени была обусловлена необходимостью раннего обнаружения болезни, повышения чувствительности диагностических тестов, сокращения времени анализа и трудозатрат.

Обнаружение ПЦР-продуктов основанное, на флуоресцентной регистрации накопления ДНК, значительно увеличило производительность теста и снизило риск контаминации. В настоящее время широко применяются тесты, основанные на ОТ-ПЦР в режиме реального времени для обнаружения отдельных вирусов, что в случае вспышки заболевания позволяет быстро и в каждом конкретном случае идентифицировать вирус [5, 6]. Все существующие способы и основанные на них тест-системы были разработаны за рубежом, поэтому существенным недостатком служит их дороговизна и длительный срок поставки в нашу страну.

Целью данного изобретения является разработка способа выявления РНК и пДНК вируса инфекционной анемии лошадей с помощью ПНР в режиме реального времени с использованием пары синтезированных олигонуклеотидных праймеров и флуоресцентного зонда, комплементарных к консервативной области gag-гена вируса ИНАН.

Поставленная цель достигается за счет пары синтезированных олигонуклеотидных праймеров, ДНК-зонда и способа для обнаружения РНК и пДНК вируса инфекционной анемии лошадей в крови, пробах органов (селезенка, печень) от больных или погибших животных, при котором проводят амплификацию ДНК.

Специфические олигонуклеотидные праймеры и ДНК-зонд для обнаружения РНК и пДНК вируса инфекционной анемии лошадей используется в полимеразной цепной реакции с этапом обратной транскрипции в режиме реального времени. Данная процедура включает следующие этапы:

1. Денатурация РНК вируса ИНАН.

2. Обратная транскрипция - синтез кДНК.

3. ПЦР РВ.

Денатурацию РНК осуществляют при температуре 94°C в течение 5 минут в реакционной смеси со специфической парой олигонуклеотидных праймеров. Синтез кДНК осуществляют при температуре 42°C в течение 60 минут в реакционной смеси для обратной транскрипции, включающей дезоксирибонуклеотидтрифосфаты (ДНТФ), буфер для обратной транскрипции и фермент ревертазу (обратную транскриптазу). Полученную кДНК используют для проведения полимеразной цепной реакции. Или для постановки ПЦР можно использовать провирусную ДНК вируса ИНАН, то есть без этапов денатурации и обратной транскрипции. Готовят стандартную смесь для ПЦР, включающую буфер для ПЦР, ДНТФ, Mg2+, пару спецефических олигонуклеотидных праймеров, ДНК-зонд и фермент ДНК-полимеразу. Профиль реакции следующий: удержание температуры - 94°C - 4 мин; циклирование: 94°C - 10 с, 56°C - 15 с, 72°C - 15 с. Цикл повторить 5 раз без детекции продуктов амплификации. Затем циклирование: 94°C - 10 с, 56°C - 15 с, 72°C - 15 с. Цикл повторить 35 раз с детекцией продуктов амплификации.

В основе используемого способа - ПЦР в режиме реального времени, применение специфических олигонуклеотидов и технологии гибридизационных зондов TaqMan. Для детекции использовали зонд, несущий флуорофор и тушитель, комплементарный части амплифицируемого со специфическими праймерами фрагмента. Выбор и анализ вирусспецифических праймеров и зондов (табл.1) проводили при помощи пакета прикладных программ «Bio Edit 7.0.8», «Oligo 6.0» на основании анализа нуклеотидных последовательностей gag-гена, референтных штаммов и изолятов вируса ИНАН, опубликованных в информационной базе данных GenBank. В качестве источника флуоресценции на 5′ конце зонда применяли краситель FAM, а для тушения флуоресценции на 3′ конце RTQ1.

Таблица 1
Специфические праймеры и ДНК-зонд для выявления РНК и пДНК вируса ИНАН
ПЦР-мишень Праймеры /ДНК-зонд Нуклеотидная последовательность, 5′-3′ Локализация (NC_001450.1)
gag-ген EIA/q2/F gTC-TTC-Tgg-Agg-TgT-TCC-T 480-498
EIA/q2/R CCg-TCA-CCT-TCT-CTA-ACT-TC 560-579
EIA/q2/Z FAM - Agg-ARg-ACA-ggT-ARg-ATg-ggR-gA - RTQ1 510-532

Техническим результатом изобретения является возможность обнаружения РНК и пДНК вируса ИНАН с помощью ОТ-ПЦР в режиме реального времени, а также повышение специфичности и чувствительности, что позволит существенно сократить материальные затраты и время проведения работ по выявлению генома вируса ИНАН в образцах исследуемого биологического материала.

Сущность изобретения состоит в том, что при помощи указанных вирусспецифических олигонуклеотидных праймеров проводят ОТ-ПЦР в режиме реального времени, позволяющую выявить РНК и пДНК вируса ИНАН. Использование данной методики позволяет повысить специфичность и чувствительность реакции.

Пример конкретного выполнения

Выявление РНК и пДНК вируса ИНАН проводится в образцах биологического материала: кровь от инфицированных вирусом ИНАН животных, 10%-ная суспензия внутренних органов инфицированных животных, лиофилизированный культуральный материал, а также в образцах интактных культур клеток, крови от интактных животных и культуральном материале гетерологичных вирусов.

Из представленных образцов были выделены нуклеиновые кислоты с использованием следующей методики.

Исследуемый материал в объеме 100-200 микролитров (далее - мкл) вносят в 1,5 см3 пробирки, в которые предварительно внесено 800 мкл лизирующего буфера на основе гуанидинтиоционата. Пробирки перемешивают и инкубируют при температуре 56°C в течение 5-10 мин. Затем добавляют 35 мкл нуклеосорбента, который предварительно тщательно ресуспендируют. Смесь инкубируют в течение 7 мин при комнатной температуре с периодическим перемешиванием на смесителе типа «Vortex». Осаждают сорбент центрифугированием при 7 тыс об/мин - 15 сек. При помощи вакуумного отсасывателя с колбой-ловушкой отдельным для каждой пробы наконечником удаляют надосадок.

Затем к осадку добавляют 300 мкл отмывочного буфера и тщательно ресуспендируют сорбент. Центрифугируют пробу при 7 тыс об/мин - 30 сек. Удаляют, используя отдельный наконечник для каждой пробы, надосадочную жидкость с помощью вакуумного насоса с колбой-ловушкой.

Дважды промывают сорбент 75%-ным этиловым спиртом, в количестве 500 мкл на каждую пробу, тщательно ресуспендируют. Центрифугируют пробу при 13 тыс. об/мин - 30 сек. Надосадок удаляют при помощи вакуумного отсасывателя с колбой-ловушкой и отдельного наконечника для каждой пробы.

Осадок в пробирках подсушивают при 56°C в течение 5-10 мин, при этом крышки пробирок должны быть открыты.

К осадку добавляют 50 мкл элюирующего буфера. Перемешивают на смесителе типа «Vortex» и инкубируют 10 мин при 56°C в пробирках с закрытой крышкой.

Центрифугируют пробирки в течение 60 сек при 13 тыс об/мин и переносят надосадочную жидкость в новые пробирки.

Супернатант используют в дальнейшем в качестве матрицы для постановки реакции обратной транскрипции и ПЦР в режиме реального времени.

Затем для выявления РНК вируса ИНАН препараты нуклеиновых кислот использовали в реакции обратной транскрипции: 8 мкл образца добавляли к реакционной смеси для денатурации РНК. В пробирку с денатурированной РНК добавляли смесь для реакции обратной транскрипции. Препарат кДНК или пДНК (нуклеиновые кислоты после выделения без этапа обратной транскрипции) в количестве 8 мкл использовали для постановки собственно ПЦР (результаты представлены в таблице 2).

Проведение реакции обратной транскрипции

В подготовленные пробирки вносят по 7 мкл смеси для денатурации РНК, сверху наслаивают 40 мкл минерального масла. Под масло вносят 8 мкл препарата выделенных нуклеиновых кислот. Реакцию денатурации проводят при температуре 94°C в течение 5 минут.

Готовят смесь для реакции обратной транскрипции, для этого в отдельной пробирке готовят общую реакционную смесь на необходимое количество образцов. На одну пробу смешивают: 9,8 мкл смеси для обратной транскрипции и 0,2 мкл MMLV-ревертазы, смесь перемешивают. В пробирки с денатурированной РНК вносят по 10 мкл смеси для обратной транскрипции с ферментом. Обратную транскрипцию проводят при температуре 42°C в течение 60 минут. После окончания реакции к ДНК используют для постановки ПНР.

Проведение ПЦР

В отдельной пробирке готовят общую реакционную смесь на необходимое количество образцов, для этого на одну пробу добавляют 13 мкл смеси для ПЦР, 2 мкл смеси праймеров, 0,3 мкл ДНК-зонда и 0,2 мкл (1 ед) Taq-полимеразы. Смесь перемешивают, избегая образования пены, и раскапывают по 16 мкл в пробирки объемом 0,2 см3. На поверхность смеси вносят воск в объеме 15 мкл.

В подготовленные для ПЦР пробирки на воск вносят по 8 мкл кДНК или пДНК.

Помещают пробирки в амплификатор со следующей программой:

Профиль реакции:

1. Удержание температуры / Hold 94°C - 4 мин
2. Циклирование / Cycling (без детекции 94°C- 10 с
продуктов амплификации) 56°C - 15 с
72°C - 15 с

Цикл повторить / Cycle repeats 5 раз (5 times)

3. Циклирование / Cycling (с 94°C - 10 с
детекцией продуктов амплификации 56°C - 15 с - детекция!
72°C - 15 с

Цикл повторить / Cycle repeats 35 раз (35 times)

Флуоресценцию измеряют по каналу Green при температуре 56°C.

С помощью программы "BioEdit 7.0.8" выравнены доступные в базе данных GenBank нуклеотидные последовательности полного генома и участков gag-гена вируса ИНАН. При анализе построенного элайнмента внутри gag-гена вируса ИНАН выбран консервативный участок, на который и были подобраны специфические олигонуклеотиды. С помощью программы "Oligo 6.0" рассчитаны первичные структуры олигонуклеотидных праймеров, фланкирующих выбранный участок генома, размером 99 п.о. Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентно-меченный зонд, комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров EIA/q2/F и EIA/q2/R.

С использованием программы "Oligo 6.0" описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР.

Свойства олигонуклеотидов, рассчитанные с помощью программы

"Oligo 6.0.

Название
олигонуклеотида
Температура
плавления, °С
AG гибридизации олигонуклеотида на матрицу, kcal/mol 3AG образования шпилечной структуры, kcal/mol Эффективность отжига олигонуклеотида на матрицу (Priming efficiency number)1
EIA/q2/F 57,5 -33,6 -8,2 365
EIA/q2/Z 68,2 -42,3 -7,9 417
EIA/q2/R 58,5 -35,1 -9,6 393

Примечание:

1- Priming efficiency number - это величина, определяющая эффективность гибридизации данного праймера (зонда) с заданным участком матрицы, рассчитывается по уникальному алгоритму, разработанному создателями программы "Oligo". Минимальное значение Priming efficiency number, при котором праймер (зонд) в ходе ПЦР эффективно гибридизуется со специфическим участком матрицы.

Определение аналитической чувствительности ПЦР в режиме реального времени при выявлении пДНК вируса ИНАН и ОТ-ПЦР в режиме реального времени при выявлении РНК вируса ИНАН.

Аналитическую чувствительность метода определяли с использованием рекомбинантной плазмиды со встройкой фрагмента генома вируса ИНАН и in vitro транскрипта, синтезированного на матрице рекомбинантной плазмиды со встройкой фрагмента генома вируса ИНАН. Концентрация очищенного препарата плазмидной ДНК измеренная спектрофотометрически составила 0,253*10 -6 г/мл, что соответствует 0,77×10 8 молекул ДНК/мкл. Спектрофотометрически измеренная концентрация in vitro транскрибированной РНК составила 1,593*10 -6 г/мл, что соответствует 1,18 ×10 9 молекул РНК /мкл.

Десятикратные разведения (в трех повторах) препарата рекомбинантной плазмиды и транскрибированной in vitro РНК известной концентрации использовали для определения аналитической чувствительности ПЦР и ОТ-ПЦР в режиме реального времени. Пределом чувствительности считали максимальное разведение, при котором регистрировали положительный результат. Рассчитанное значение аналитической чувствительности метода ПЦР в режиме реального времени составило 0,77*102 молекул ДНК /мкл, что соответствует 6,16×102 молекулам ДНК в реакционной смеси. Рассчитанное значение аналитической чувствительности метода ПЦР в режиме реального времени составило 1,18*102 молекул РНК /мкл, что соответствует 9,44×102 молекулам ДНК в реакционной смеси.

Учет и интерпретация результатов амплификации

Результаты интерпретируют на основании наличия/отсутствия пересечения кривой флуоресценции с установленной на уровне пороговой линией (Threshold), что соответствует наличию/отсутствию значения Ct в соответствующей графе в таблице результатов. Результаты идентификации вируса ИНАН методом ОТ-ПЦР в режиме реального времени с использованием разработанных специфических олигонуклеотидов представлены в таблице 2.

Таблица 2
Результаты идентификации вируса ИНАН методом ОТ-ПЦР в режиме реального времени с использованием разработанных специфических олигонуклеотидов в различных образцах биологического материала.
№ проб Характеристика биологического материала Результат ОТ-ПЦР в режиме реального времени
1 культура клеток синовиальной мембраны ягненка (СМЯ), зараженная вирусом висна-маеди, шт. «М-88» 3,5-4,5 lg ТЦД50/мл -
2 культура клеток синовиальной мембраны козленка (СМК), зараженная вирусом АЭК, шт. «75G-63» 5,0-5,5 lg ТЦД50/мл -
3 культура клеток CV, зараженная вирусом африканской чумы лошадей, штамм «452» (8 серотип) -
4 10% суспензия легкого овцы с клиническими и патологическими признаками аденоматоза легких овец №12 (г. Пермь) -
5 кровь от клинически здоровой лошади -
6 кровь от клинически здоровой овцы, искусственно контаминированная вирусом висна-маеди, шт. «М-88» в разведении 1:10 -
7 кровь от клинически здоровой козы, искусственно контаминированная вирусом АЭК, шт. «75G-63» в разведении 1:10 -
8 культура клеток лейкоцитов лошади, интактная -
9 10% суспензия печени лошади, серопозитивной по инфекционной анемии лошадей +
10 10% суспензия селезенки лошади, серопозитивной по инфекционной анемии лошадей +
11 антиген (штамм «3-К-ВНИиТИБП-ВИЭВ») из «Набора для диагностики инфекционной анемии лошадей в реакции диффузионной преципитации (РДП) (организация-производитель ФГУП «Щелковский биокомбинат») +
12 кровь от экспериментально зараженной вирусом ИНАН лошади на 2 сутки наблюдения +
13 кровь от экспериментально зараженной вирусом ИНАН лошади на 14 сутки наблюдения +
14 кровь от экспериментально зараженной вирусом ИНАН лошади на 35 сутки наблюдения +

Синтетические олигонуклеотидные праймеры были проверены на специфичность. Установлено, что тест-система не амплифицирует РНК и ДНК других вирусов.

Таким образом, подобраны специфические олигонуклеотидные праймеры и ДНК-зонд, а также разработан способ, позволяющий с помощью ОТ-ПЦР в режиме реального времени с использованием специфических олигонуклеотидов обнаруживать РНК и пДНК вируса ИНАН.

Основными преимуществами заявляемого изобретения являются:

- высокая специфичность и чувствительность способа идентификации вируса ИНАН с помощью ОТ-ПЦР в режиме реального времени, благодаря избирательному выявлению уникальной нуклеотидной последовательности gag-гена генома вируса ИНАН;

- быстрота и относительная дешевизна метода, благодаря использованию ОТ-ПЦР в режиме реального времени для идентификации вируса ИНАН, благодаря исключению ряда процедур, необходимых для регистрации продуктов амплификации в классической ПНР;

- простота выполнения методики, исключающая необходимость привлечения высококвалифицированного персонала.

Источники информации

1. Архипов, Н.И. Медленные инфекции животных / Н.И Архипов, И.А. Бакулов, Л.И. Соковых. - М.: Агропромиздат, 1987. - 191 с.

2. Юров, К.П. Вирусные болезни лошадей / К.П. Юров, В.Т. Заблоцкий, Н.Е. Косминков. - М.: Зоомедлит, 2010. - 256 с.

3. Эпизоотологический мониторинг, лечение и профилактика заразных болезней лошадей в Украине / А.Е. Галатюк, В.Л. Бегас, А.И. Каневский [и др.] // Ветеринарная медицина. Современные проблемы и перспективы развития: материалы Международной научно-практической конференции. - Саратов, 2010. - С.109-113.

4. An EIAV field isolate reveals much higher levels of subtype variability than currently reported for the equine lentivirus family / J.K. Craigo, S. Barnes, B. Zhang [et al.] // J. Retrovirology. - 2009. - №6 - P 95.

5. Momtaz, H. Detection of proviral sequences of equine infectious anemia virus in peripheral blood cell of horses in Iran / H. Momtaz, S. Nejat // Bulgarian Journal of Veterinary Medicine. - 2010. - Vol.13, №1, P.18-22.

6. Nagarajan, M.M. Detection of horses infected naturally with equine infectious anemia virus by nested polymerase chain reaction / M.M. Nagarajan, C. Simard // Journal of Virological Methods. - 2001. - Vol.94. - P.97-109.

1. Синтетические олигонуклеотидные праймеры и ДНК-зонд, комплементарные консервативной области gag-гена вируса ИНАН, используемые для выявления генома вируса инфекционной анемии лошадей, имеющие следующий нуклеотидный состав (5′-3′):
EIA/q2/F gTC-TTC-Tgg-Agg-TgT-TCC-T
EIA/q2/Z FAM-Agg-ARg-ACA-ggT-ARg-ATg-ggR-gA-RTQ1
EIA/q2/R CCg-TCA-CCT-TCT-CTA-ACT-TC

2. Способ выявления генома вируса инфекционной анемии лошадей, включающий постановку полимеразной цепной реакции, амплификацию ДНК вируса, оценку проведения реакции, при этом при выявлении вирусной РНК предварительно проводят реакцию денатурации и обратной транскрипции, а идентификацию проводят с помощью ОТ-ПЦР в реальном времени при выявлении РНК вируса ИНАН и ПЦР в реальном времени при выявлении пДНК вируса ИНАН, с использованием специфических праймеров и ДНК-зонда по п.1, при этом температурные режимы включают следующие этапы: 5 мин предварительной денатурации при 94°C, 5 циклов амплификации без детекции (94°C - 10 сек, 56°C - 15 сек, 72°C - 15 сек) и 35 циклов амплификации с детекцией (94°C - 10 сек, 56°C - 15 сек, 72°C - 15 сек), а интерпретацию результатов проводят на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией (Threshold).



 

Похожие патенты:

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин.

Группа изобретений относится к многоканальным устройствам, модифицированным нанослоями анилинсодержащих полимеров. Предложен многоканальный наконечник для выделения нуклеиновых кислот, белков, пептидов и способ изготовления многоканального элемента, входящего в состав многоканального наконечника.

Изобретение относится к области биотехнологии, вирусологии и иммунологии. В частности, настоящее изобретение относится к новому птичьему астровирусу; к антителам и их фрагментам, направленным против указанного нового вируса; к антигенным препаратам, белкам и ДНК-молекулам нового птичьего астровируса; к вакцинам на основе указанного нового вируса или к его антигенным препаратам, белку или ДНК; к способам получения таких вакцин и к диагностическим наборам.

Группа изобретений относится к биотехнологии. Предложен способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий и способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, с его использованием.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности ранибизумабом.

Настоящее изобретение относится к биотехнологии и представляет собой мутантные варианты рекомбинантной L-аспарагиназы, характеризующиеся аминокислотной последовательностью, соответствующей аминокислотной последовательности L-аспарагиназы бактерий Wolinella succinogenes, в которой аминокислотный остаток лизина в положении 24 заменен на остаток серина либо аминокислотный остаток валина в положении 23 заменен на остаток глутамина, а аминокислотный остаток лизина в положении 24 заменен на остаток треонина.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В.

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз.

Группа изобретений относится к области биотехнологии. Способ выбора пищевого рациона предусматривает определение пищевого рациона или вещества, которые повышают количество микроРНК, присутствующее в молоке млекопитающего, используя корреляцию профилей микроРНК в молоке и пищевом рационе, полученном млекопитающим, или веществе, содержащемся в пищевом рационе, в качестве индекса.

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине. Предлагается способ комплексной оценки ангиогенного потенциала прогениторных клеток у больных сердечно-сосудистыми заболеваниями, апробированный на мезенхимальных стромальных клетках жировой ткани (МСК-ЖТ) пациентов с ишемической болезнью сердца и включающий в себя измерение содержания мРНК и белков основных ангиогенных факторов, продуцируемых прогениторными клетками, таких как фактор роста эндотелия сосудов (VEGF), плацентарный фактора роста (PlGF), фактор роста гепатоцитов (HGF), ангиопоэтин-1 и ангиогенин, ангиогенной активности суммарных продуктов секреции клеток, а также оценку способности прогениторных клеток стимулировать васкуляризацию подкожных имплантатов Матригеля, введенных иммунодефицитным мышам. В качестве скринингового метода используют более простой и доступный, но менее информативный метод экспресс-оценки ангиогенных свойств прогениторных клеток, основанный на измерении ангиогенной активности суммарных продуктов секреции. Изобретение позволяет проводить тестирование аутологичного клеточного материала, полученного от пациентов, в том числе с ишемической болезнью сердца, перед трансплантацией для выбора оптимальной тактики клеточной терапии с целью стимуляции роста кровеносных сосудов. 2 н.п. ф-лы, 2 ил., 4 табл., 4 пр.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242). Способ основан на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. В способе используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК - по максимуму первой производной графиков флуоресценции. Изобретение позволяет повысить надежность и доступность генотипирования. 1 ил.

Изобретение относится к биотехнологии, в частности к способу выделения микроРНК из биологических жидкостей, содержащих экзосомы. Способ включает последовательное центрифугирование, ультрафильтрацию и ультрацентрифугирование культуральной конденсированной среды. Растворяют полученный осадок в фосфатно-солевом буфере и повторно центрифугируют. Растворяют полученный осадок в воде. Подвергают полученный раствор электрофорезу в свободном потоке на приборе FFE System. Проводят ультрацентрифугирование каждой из полученных фракций. Очищают каждую фракцию от клеточных стенок экзосом посредством фильтрации и центрифугирования. Проводят реакцию обратной транскрипции при помощи обратной транскриптазы. Останавливают реакцию нагреванием до 95°С в течение 5 минут. Предложенное изобретение позволяет выделить микроРНК из биологических жидкостей, содержащих экзосомы, с высоким выходом. 2 ил., 1 пр.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности вереска обыкновенного (Calluna vulgaris (L.) Hull.). Предложен набор синтетических олигонуклеотидов для ПЦР с фрагментом ITS2 ядерной ДНК, включающий прямой и обратный праймеры и разрушаемый зонд. Набор обладает высокой чувствительностью и специфичностью и позволяет быстро и достоверно провести идентификацию лекарственного растения. 1 ил., 1 пр.

Изобретение относится к области биохимии, в частности к способу выявления соматических мутаций в гене PI3K, ответственных за чувствительность опухоли к таргетной терапии, с помощью технологии ДНК-биочипов. Определяют наличие соматических мутаций E542K, E545K, Q546K, H1047L и H1047R в гене PI3K с помощью LNA-блокирующей мультиплексной «гнездовой» ПЦР, последующей гибридизацией меченого ПЦР-продукта на биочипе, регистрацией и интерпретацией результатов. Изобретение позволяет быстро и эффективно выявить соматические мутации в гене PI3K, ассоциированные с чувствительностью опухоли к таргетной терапии. 2 з.п. ф-лы, 2 ил., 4 табл., 4 пр.

Группа изобретений относится к области биохимии. Предложено устройство для забора нуклеиновой кислоты, применение устройства для забора нуклеиновой кислоты, набор для амплификации нуклеиновой кислоты, а также способ амплификации нуклеиновой кислоты. Устройство включает зонд для удержания образца нуклеиновой кислоты и манипулятор, подсоединенный к зонду с учетом возможности маневрирования зондом. Зонд включает множество элементов зонда, которые способны перемещаться относительно друг друга между сближенной и взаимно удаленной конфигурациями. Каждый элемент зонда имеет наконечник. При перемещении элементов зонда в сближенную конфигурацию каждый наконечник объединяется с другими наконечниками для образования составного наконечника. Составной наконечник способен контактировать с нуклеиновой кислотой с целью доставки ее образца. Способ амплификации нуклеиновой кислоты из высших эукариот включает контакт устройства для забора образцов с источником нуклеиновой кислоты из высших эукариот, введение устройства для забора образцов или его части в реакционный сосуд для проведения реакции амплификации нуклеиновой кислоты без предварительной обработки материала и осуществление реакции амплификации нуклеиновой кислоты. Изобретения обеспечивают портативность, легкость в применении устройства для забора нуклеиновой кислоты, а также проведение анализа в течение короткого периода времени. 6 н. и 37 з.п. ф-лы, 27 ил., 2 табл., 12 пр.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела. Охарактеризованное изобретение специфично и высокоафинно связывается с аутоантителами, характерными для рассеянного склероза и может быть использовано для диагностики рассеянного склероза. 3 ил., 2 пр.

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав: амплификацию ДНК вируса и оценку проведения реакции. Представленные изобретения могут быть использованы в ветеринарной вирусологии для выявления и дифференциации вакцинного штамма B-82 вируса миксомы кроликов от полевых изолятов. 2 н.п. ф-лы, 6 табл., 6 пр.

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1. Разделяют типичные и атипичные штаммы средневекового биовара следующим образом: отсутствие гибридизационно-флуоресцентного сигнала по обеим ДНК-мишеням «Med24» и «pCKF» у типичных штаммов, наличие по обеим ДНК-мишеням «Med24» и «pCKF» у атипичных штаммов, наличие ДНК-сигнала по «Med24» и отсутствие по «pCKF» у штаммов, не относящихся к штаммам средневекового биовара. 1 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии, а именно к способу воздействия на пролиферативный статус клеток. Предложенное изобретение может быть использовано в медицине в области лечения онкологических заболеваний, в иммунологии, в геронтологии и косметологии. Способ включает внесение в среду, окружающую клетки, и последующее проникновение в них специфических нуклеотидных последовательностей однонитевых оверхенгов G-цепи теломерной ДНК человека в конечной концентрации, не превышающей 30 мкМ. Указанные последовательности различаются вариациями теломерного повтора ДНК и триплетными окончаниями. Предложенное изобретение позволяет контролировать время наступления определенных фаз клеточного цикла и его общую продолжительность. 7 з.п. ф-лы, 8 ил., 4 пр.
Наверх