N-ацетил-l-цистеин для лечения эндометриоза

Изобретение относится к способу лечения млекопитающего с эндометриозом. Указанный способ включает импульсное или прерывистое пероральное введение в течение 3-5 последовательных суток с последующими 2-4 сутками перерыва или в течение 1-3 последовательных суток с последующими 1-2 сутками перерыва фармацевтической композиции, содержащей N-ацетил-L-цистеин, в течение периода времени по меньшей мере два месяца. N-ацетил-L-цистеин в указанном способе вводят в дозе, составляющей от 20 до 90 мг/кг/сутки. Заявленный способ обеспечивает более значительный эффект в отношении симптомов эндометриоза по сравнению с традиционным ежесуточным введением N-ацетил-L-цистеина. 10 з.п. ф-лы, 7 ил., 2 табл., 3 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к фармацевтической композиции, содержащей N-ацетил-L-цистеин, полезной в лечении эндометриоза и показаний, ассоциированных с эндометриозом.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Эндометриоз представляет собой третью лидирующую причину гинекологической госпитализации в Соединенных Штатах, и поражающую приблизительно 14 миллионов женщин в Европе. Широко используемые показатели заболеваемости эндометриозом включают 5-10% всех женщин репродуктивного возраста и 30-40% всех женщин с проблемой бесплодия. Он представляет собой заболевание, характеризующееся присутствием вне полости матки ткани, которая является гистологически идентичной эндометрию, то есть мембране, выстилающей внутреннюю часть матки млекопитающего. Эта аномально расположенная ткань развивается в новообразования или поражения (также называемые имплантатами или узелковыми утолщениями), которые реагируют на менструальный цикл так же, как эндометриальная ткань матки: каждый месяц ткань нарастает, разрушается и отторгается. В то время как менструальная кровь вытекает из матки, кровь и ткань, отторгнутая от эндометриальных новообразований, не имеет пути для вытекания. Это приводит к внутреннему кровотечению, отрыву кровеносных сосудов и ткани от поражений и последующему хроническому воспалению.

Двумя наиболее распространенными симптомами эндометриоза являются боль и бесплодие. Симптомы могут включать: дисменорею, то есть боль до или после менструальных периодов, а также боль во время или после секса; тазовую хроническую боль или боль нижней части спины и кишечника; тяжелые менструальные периоды или кровянистые выделения и кровотечение между периодами; болезненную дефекацию или болезненное мочеиспускание во время менструальных периодов; бесплодие.

Причина эндометриоза в настоящее время неизвестна, и было предложено несколько теорий для обоснования эктопической миграции и имплантации эндометриальных клеток. Последние данные устанавливают связь между возникновением эндометриоза и измененным состоянием ткани своего происхождения: эутопического эндометрия. В данной области укрепляется уверенность, что неконтролируемая миграция, имплантация и рост эндометриом возникают от расстройств в эутопических эндометриальных клетках.

В настоящее время не существует лечения эндометриоза. Существует множество вариантов лечения, и существуют способы минимизации симптомов, вызванных этим состоянием. За исключением применения анальгетиков для лечения боли, лечение эндометриоза главным образом связано с подавлением функции яичников в секреции эстрогенов, и вследствие этого гормональных лечений различных субъектов, вплоть до индукции менопаузы в наиболее тяжелых случаях. хирургию используют для удаления эндометриом, спаек, перитональных имплантатов и глубоких поражений, локализованных в ректовагинальной перегородке или в других местах (т.е. в мочевом пузыре, кишечнике), и для ослабления боли. Однако рецидивы возникают как после терапевтического, так и после хирургического лечения. Молодые женщины с эндометриозом часто встают перед трудными решениями относительно их будущей репродукции. Гормональное лечение, предназначенное для подавления функции яичников, несовместимо с беременностью.

N-ацетил-L-цистеин (ниже упоминаемый как NAC) представляет собой хорошо известное лекарственное средство, которое использовали главным образом в качестве муколитического агента и в лечении отравления парацетамолом. В последние годы он также был признан обладающим другими полезными свойствами, такими как противовоспалительное и антипролиферативное действие, и был предложен для лечения ряда различных расстройств и симптомов, таких как шизофрения, диабет и рак.

В предшествующих исследованиях, изучающих молекулярные механизмы, лежащие в основе эндометриоза и связанные с ним, предполагалось, что возросшие скорости клеточной пролиферации при эндометриозе могут быть индуцированы окислительным стрессом в эндометриоидной ткани, вызванным свободными радикалами или ROS (reactive oxygen species - активными формами кислорода). Таким образом, предполагалось, что новые терапевтические стратегии для эндометриоза могут быть основаны на антиоксидантах и акцепторах ROS, таких как NAC.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Charlotte Ngo et al. предположили (The American Journal of Pathology (2009), Vol.175, No.I, pages 225-234), что окислительный стресс может индуцировать или усиливать пролиферацию эндометриоидных клеток при эндометриозе. Поэтому для лечения эндометриоза были предложены антиоксиданты, такие как NAC. Исследования на первичных клеточных линиях пациентов с эндометриозом, а также на мышиной модели с имплантированной эндометриоидной тканью человеческого происхождения показали, что NAC аннулировал признаки окислительного стресса, а также повышенную пролиферацию в соответствующих моделях. Таким образом, предполагалось, что антиоксиданты, такие как NAC, можно применять в качестве безопасного и эффективного лечения эндометриоза.

Nastaran Foyouzi et al. также предложили (Fertility and Sterility (2004), Vol.82, Suppl. 3, pages 1019-1022), что антиоксиданты, такие как NAC, можно применять для лечения эндометриоза. В статье описано исследование in vitro, где клетки, выделенные из здоровых субъектов, а также пациентов с эндометриозом, обрабатывали другим антиоксидантом, например NAC. Все антиоксиданты ингибировали пролиферацию эндометриальных стромальных клеток.

В исследованиях Yan Wo and Sun-Wei Guo (Gynecologic and Obstetric Investigation (2006), Vol.62, No. 4, pages 193-205; European Journal of Obstetrics & Gynecology and Reproductive Biology, (2008), Vol.137, pages 198-203); патентной заявке US 2007/0287676 A1) исследовали влияние NAC на пролиферацию и остановку клеточного цикла в бессмертных эндометриальных стромальных клетках человека и сравнивали с другими агентами, предложенными для лечения эндометриоза. Было показано, что NAC оказывает влияние как на пролиферацию, так и на остановку клеточного цикла, хотя не так выражено, как ингибиторы гистондеацетилазы.

В исследовании S. Estany et al. (Journal of reproductive Immunology (2007), Vol.75, pages 1-10) было показано, что антиоксидантная активность NAC и других антиокислительных агентов в отношении эндометриальных клеток в культуре улучшала жизнеспособность окисленных клеток путем предотвращения клеточной цитотоксичности, индуцированной Н2О2.

Другой родственный уровень техники включает US 2003/0190381 А1, WO 2004/096206 А2, US 6239137 В1, US 2003/0119875 А1, US 2004/0014672 А1 и WO 2005/048822 А2.

Другой предшествующий уровень техники, описывающий молекулярное действие NAC в лечении рака, включает Т. Parasassi, et. al. (Cell Death and Differentiation (2005), Vol.12, No. 10, pages 1285-1296); E. K. Krasnowska et. al. (Free Radicals Biology and Medicine 2008, 45(11): 1566-72) и A.C. Gustafsson et. al. (BMC Cancer (2005), 5:75).

ЦЕЛИ ИЗОБРЕТЕНИЯ

Клинический результат лечения NAC при эндометриозе, по сведениям авторов изобретения, не был определен в известном уровне техники, также не была предложена эффективная схема приема для лечения эндометриоза или применение NAC для лечения показаний, ассоциированных с эндометриозом.

Поэтому главной целью настоящего изобретения является предложить решение проблемы получения фармацевтической композиции, содержащей N-ацетил-L-цистеин (NAC), для лечения эндометриоза и показаний, ассоциированных с эндометриозом, у людей и млекопитающих. Одним из аспектов этой цели является предложение фармацевтической композиции, содержащей N-ацетил-L-цистеин (NAC), для применения в эффективной схеме приема для лечения эндометриоза и симптомов, связанных с эндометриозом, у млекопитающих, включая людей.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Предполагалось, что NAC можно использовать в новых терапевтических стратегиях для эндометриоза на основании его применения в качестве антиоксиданта и акцептора ROS. Авторы настоящего описания показывают, что NAC индуцирует молекулярные и клеточные изменения, которые не только ингибируют пролиферацию, но также индуцирует дифференциацию больной ткани по отношению к нормальной ткани.

Эти сведения привели авторов настоящего изобретения к предложению нового назначения NAC в лечении эндометриоза и показаний, ассоциированных с эндометриозом, у пациента, представляющего собой человека или млекопитающего животного. Кроме того? предлагается интервал эффективных доз NAC в лечении эндометриоза. В одном воплощении настоящего изобретения предписанный режим лечения можно использовать, например, для контроля частоты и интенсивности болевых симптомов (дисменорея, диспареуния и ациклическая хроническая тазовая боль), для снижения размера эндометриоидных поражений в конечном счете вплоть до их исчезновения, для снижения рецидивов после операции и/или для улучшения оплодотворения. Побочные эффекты данного лечения практически отсутствуют и, в частности, данное лечение не препятствует беременности.

В настоящем изобретении предлагается фармацевтическая композиция, содержащая N-ацетил-L-цистеин, для применения в лечении млекопитающего, включая человека с эндометриозом, где эта композиция предназначена для импульсного или прерывистого перорального введения, в течение периода времени два месяца или более, N-ацетил-L-цистеина в дозе, составляющей от 20 до 90 мг/кг/сутки в сутки, при введении.

В одном воплощении изобретения предлагается фармацевтическая композиция, содержащая N-ацетил-L-цистеин, для указанного выше применения, где композиция предназначена для введения в течение 3-5 последовательных суток с последующими 2-4 сутками перерыва. В еще одном воплощении фармацевтическая композиция, содержащая N-ацетил-L-цистеин, предназначена для введения в течение 1-3 последовательных суток с последующими 1-2 сутками перерыва.

В одном воплощении изобретения предлагается фармацевтическая композиция, содержащая N-ацетил-L-цистеин, для указанного выше применения, где композиция предназначена для введения N-ацетил-L-цистеина в дозе, составляющей от 30 до 60 мг/кг/сутки в сутки введения. В еще одном воплощении фармацевтическая композиция предназначена для введения N-ацетил-L-цистеина в дозе, составляющей от 30 до 45 мг/кг/сутки в сутки введения.

В одном воплощении изобретения предлагается фармацевтическая композиция, содержащая N-ацетил-L-цистеин, для применения, описанного выше, где фармацевтическая композиция защищена от света. В еще одном воплощении фармацевтическая композиция представляет собой водорастворимую таблетку. В еще одном воплощении фармацевтическая композиция содержит гидрокарбонат натрия. В одном воплощении фармацевтическая композиция представляет собой препарат с медленным высвобождением и/или препарат для защиты желудка.

В одном воплощении изобретения предлагается фармацевтическая композиция, содержащая N-ацетил-L-цистеин, для применения в лечении боли, вызванной эндометриозом. В еще одном воплощении фармацевтическая композиция предназначена для применения в лечении бесплодия, вызванного эндометриозом. В еще одном воплощении фармацевтическая композиция предназначена для применения в предварительном лечении млекопитающих с эндометриозом перед лапароскопией или операцией. В одном воплощении фармацевтическая композиция предназначена для применения в лечении млекопитающих с эндометриозом, после лапароскопии или операции, для предотвращения рецидивов.

В одном аспекте изобретения предлагается способ лечения млекопитающего с эндометриозом, включающий пероральное введение фармацевтической композиции, содержащей N-ацетил-L-цистеин, указанному млекопитающему в импульсной или прерывистой схеме приема в течение периода времени два месяца или более, N-ацетил-L-цистеина в дозе, которая составляет от 20 до 90 мг/кг/сутки в сутки при введении. В одном воплощении способа фармацевтическую композицию вводят в течение 3-5 последовательных суток с последующими 2-4 сутками перерыва. В еще одном воплощении фармацевтическую композицию вводят в течение 1-3 последовательных суток, с последующими 1-2 сутками перерыва.

В одном воплощении способа доза N-ацетил-L-цистеина составляет от 30 до 60 мг/кг/сутки в сутки введения. В еще одном воплощении способа доза N-ацетил-L-цистеина составляет от 30 до 45 мг/кг/сутки в сутки введения.

В одном воплощении способ предназначен для лечения боли, вызванной эндометриозом. В других воплощениях способ предназначен для лечения бесплодия, вызванного эндометриозом, для предварительного лечения млекопитающих с эндометриозом перед лапароскопией или операцией или для лечения после лапароскопии или операции, для предотвращения рецидивов эндометриоидных поражений.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Настоящее изобретение будет объяснено более подробно в следующем описании, со ссылкой на прилагаемые графические материалы, где:

на Фиг.1 показан ингибиторный эффект NAC на рост эндометриоидных поражений у мышей, как продемонстрировано в примере 1. Средняя общая масса контрольных (n=10) и NAC-обработанных (n=10) животных, через 21 сутки после имплантации, со стандартной ошибкой. Значимость p<0,05. Во вставках над гистограммами воспроизведены типичные картины эндометриом для контроля (А) и обработки NAC (В). Полоска: 1 см;

на Фиг.2А показаны типичные гели полуколичественной RT-PCR (полимеразная цепная реакция в реальном времени), как продемонстрировано в примере 1. На Фиг.2В показана пониженная экспрессия СОХ-2 и ММР-9 в кистах NAC-обработанных мышей, как продемонстрировано в примере 1. Значения полуколичественной RT-PCR, усредненные для 5 контрольных и 5 NAC-обработанных мышей со стандартной ошибкой;

на Фиг.3 показано перемещение Е-кадгерина в кистах NAC-обработанных мышей, как продемонстрировано в примере 1. Типичные изображения иммуноокрашивания Е-кадгерина в эндометриомах от контрольных (А и В) и NAC-обработанных мышей (С и D). В контрольных образцах можно наблюдать диффузное коричневатое окрашивание во всей цитоплазме эпителиальных клеток, в то время как в NAC-обработанных образцах это окрашивание четко ограничено на уровне контактов клетка-клетка. Увеличение оригинала 40х;

на Фиг.4 показано ослабленное окрашивание Сох-2 в кистах NAC-обработанных животных, как продемонстрировано в примере 1. Типичные изображения иммуногистохимического окрашивания кист контрольных мышей (А-С) и от NAC-обработанных мышей (D-F). В контрольных образцах обнаруживается заметное присутствие коричневатого окрашивания в нескольких областях, в то время как оно едва может быть обнаружено в NAC-обработанных образцах. Увеличение оригинала 40х;

на Фиг.5 показано ослабленное окрашивание Ki-67 в кистах NAC-обработанных животных, как продемонстрировано в примере 1. Типичные изображения иммуногистохимического окрашивания кист контрольных мышей (А-С) и NAC-обработанных мышей (D-F). Стрелки указывают на окрашенные, пролиферирующие клетки. Увеличение оригинала 40х;

на Фиг.6 показано схематическое представление уровня техники, демонстрирующее несколько механизмов, действующих, когда пролиферирующие клетки, которые показаны на примере раковых клеток, обрабатывают NAC. Эти механизмы сводятся к терминальной дифференциации клеток. Примеры настоящего описания также показывают, что по меньшей мере некоторые из этих эффектов также возникают, если NAC, согласно настоящему изобретению, применяют для лечения эндометриоза;

на Фиг.7 показаны результаты предварительного клинического исследования, выполненного суммарно на 64 женщинах, 33 пролеченных NAC и 31 непролеченном контроле. Изменение размера кист после трех месяцев лечения NAC измеряли при помощи ультразвука в виде максимального диаметра. На Фиг.7А показано изменение размера цист в абсолютных числах у пролеченных пациентов и контролей. На Фиг.7В показано то же самое сравнение в виде изменения в процентах.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

NAC в общем

N-ацетил-L-цистеин (NAC) представляет собой хорошо известное низкомолекулярное фармацевтическое лекарственное средство с химической формулой

NAC

Свойства NAC главным образом связаны с его тиоловой группой, которая делает его эффективным в большинстве биохимических путей, где задействован трипептидглутатион (GSH), присутствующий во всех тканях человека в относительно высоких концентрациях, даже выше 10 мМ. Цистеин действительно находится среди трех аминокислот, содержащих GSH, так что NAC считается предшественником GSH с его деацетилированным цистеином. NAC использовался и по-прежнему широко используется в качестве муколитического агента, когда способ действия в целом относится к окислительно-восстановительному разрушению чувствительных дисульфидных мостиков цистеина в белках слизи. Фактически NAC участвует в сложном окислительно-восстановительном цикле тиоловых групп, где действует несколько ферментов. Действительно, исключительной физиологической важностью обладает цикл образования и разрушения дисульфида, общий механизм, посредством которого регулируется активность белка и клеточная сигнализация. Ферменты, такие как протеинтирозинфосфатазы и тирозинкиназы, например, играют ключевые роли в контроле клеточного цикла, клеточной пролиферации и дифференциации, и многие из них регулируются окислительно-восстановительным состоянием их цистеинов.

В общем, хотя детальные механизмы действия не были окончательно выяснены, NAC, по-видимому, действует на все биохимические пути, где задействован GSH. Ферменты и белки, активность которых модулируется GSH, действуют в нескольких процессах, или непосредственно или посредством сети путей передачи сигналов. В этой ситуации, NAC может либо действовать аналогично GSH, либо может быть еще более эффективным, чем GSH.

GSH, например, обычно образует конъюгаты с реакционно-способными метаболитами, образованными парацетамолом и способствуют их детоксификации. Однако, когда принимают слишком большую дозу парацетамола, GSH истощается, и метаболиты парацетамола начинают взаимодействовать с клеточными белками, в конечном счете приводя к гибели клеток. В лечении скоротечной печеночной недостаточности после отравления парацетамолом NAC действует вместо GSH в детоксикации метаболитов парацетамола. Полагают, что у NAC фактически отсутствуют нежелательные побочные эффекты, на что также указывают высокие дозы NAC, которые используют в лечении отравления парацетамолом - предположительно примерно 40 г/сутки для пациента массой 70 кг.

В отличие от трипептида GSH, который может распадаться уже в желудке, простая молекула NAC свободно диффундирует почти во все ткани и клетки. Фармакокинетические исследования NAC определили пиковую концентрацию в плазме, достигаемую примерно за один час, с периодом полувыведения примерно три часа. Полный клиренс имеет место между шестью и двенадцатью часами.

NAC в качестве антипролиферативного, дифференцирующего агента

Недавно авторы изобретения обнаружили, что N-ацетил-L-цистеин (NAC) обладает заметным антипролиферативным воздействием на раковые клетки эпителиального происхождения - такого же происхождения, что и эндометриальные клетки (Cell Death and Differentiation 2005, 12(10): 1285-1296). Хотя рак и эндометриоз являются преимущественно неродственными заболеваниями, они имеют некоторые общие свойства, которые в конечном счете привели авторов изобретения к идее, что NAC может быть полезным также в лечении эндометриоза. В частности, эндометриоз, почти также как рак, представляет собой пролиферативное заболевание, хотя и с другим неизвестным лежащим в основе молекулярным механизмом и этиологией. Наблюдения, полученные для рака, будут представлены в данном описании изобретения в качестве предпосылки для эффектов NAC и в качестве вероятного способа действия также при эндометриозе.

NAC использовали для остановки пролиферации и индуцирования дифференциации в двух клеточных линиях аденокарциномы и в первичных нормальных клетках кератиноцитов, все клетки эпителиального происхождения. В этих системах дифференциацию характеризовали морфологически, биохимически и посредством анализа экспрессии гена (анализ экспрессии гена широко освещен в ВМС Cancer 2005, 5: 75).

В исследовании рака антипролиферативный эффект NAC не был связан с гибелью клеток или токсичностью, но, вместо этого, являлся следствием активации пути физиологической дифференциации, которую можно расценивать как нормализацию клеточных функций по отношению к ткани происхождения.

В дополнение к уменьшенной пролиферации также изменялась морфология NAC-обработанных раковых клеток. In vitro, эпителиальные клетки при активной пролиферации проявляют нерегулярную морфологию - мезенхимальную морфологию - и часто образуют несколько многоклеточных слоев. В отличие от этого, когда клетки претерпевают процесс дифференциации к структуре и функции их конечной целевой ткани, они останавливают пролиферацию, их морфология становится регулярной полигональной, каждая клетка иногда толще, и они образуют монослой смежных клеток. Этот процесс сопровождается возросшими соединениями клетка-клетка и клетка-субстрат, в соответствии со сдвигом от пролиферирующего мезенхимального к адгезивному, менее подвижному и дифференцированному фенотипу.

В целом, сложные серии метаболических изменений обнаруживались после добавления NAC к раковым клеткам, все из которых сводились к остановке неконтролируемой пролиферации и индуцированию их терминальной дифференциации, как изображено на схеме, показанной на Фиг.6.

Особенно лечение NAC индуцировало значительное увеличение адгезионных комплексов клетка-клетка и клетка-субстрат.Неконтролируемую пролиферацию можно отнести к состоянию, когда клетки потеряли контактное торможение и свою способность реагировать на сигналы дифференциации. Клетки, входящие на путь дифференциации, проявляют заметное увеличение комплексов соединения клетка-клетка, и этот процесс также, как правило, указывают как контактное торможение. Некоторые данные указывают на то, что сигналы клеткам для вхождения в конечную точку дифференциации порождают компоненты самих межклеточных комплексов. Эти соединения также являются путем распространения сигналов между клетками.

Мигрирующие клетки, такие как эндометриальные клетки при эндометриозе, должны в дополнение к пониженному количеству адгезионных комплексов, иметь и секретировать достаточное количество активных матриксных металлопротеиназ, ферментов, предназначенных для разрушения внеклеточного матрикса, для обеспечения возможности миграции через внеклеточный матрикс.Интересно, что в данной модели эпителиальных видов рака, NAC, как было обнаружено, подавляет этот фермент, позволяя предположить, что клеточная миграция была задержана. Также пример 1 данного описания действительно показывает, что NAC при использовании согласно настоящему изобретению для лечения эндометриоза подавляет экспрессию матриксной металлопротеиназы 9 (ММР-9). Это говорит о том, что NAC может препятствовать клеточной миграции как из эутопического эндометрия к новым имплантатам (предотвращение рецидивов), так и в эндометриоидной ткани (предотвращение дальнейших поражений).

Известный эффект NAC также имеет отношение к его противовоспалительному эффекту, причине его добавления в семейство нестероидных противовоспалительных лекарственных средств (NSAID). Профиль экспрессии гена NAC-обработанных клеток действительно показал подавление циклооксигеназы-2 (СОХ-2), индукция гена которой ассоциирована с воспалительными реакциями. Также этот эффект NAC был подтвержден в эндометриоидной ткани в примере 1 данного описания, свидетельствуя о том, что NAC также может ослаблять симптомы, связанные с воспалением при эндометриозе.

В качестве примера способности NAC модулировать сигнальную трансдукцию в клетках через окислительно-восстановительный статус чувствительных цистеинов, изучали фермент - нерецепторную тирозинкиназу с-Src в in vitro модели клеток карциномы толстой кишки (СаСо-2) и клеток карциномы яичников (OVCAR-3) (Free Radicals Biology and Medicine 2008, 45(11): 1566-72). c-Src вовлечена в переключение пролиферация/дифференциация и является активной в сборке/разборке связанных комплексов и цитоскелетной организации. Эта киназа активируется и сверхэкспрессируется в ряде раковых заболеваний человека, особенно в карциноме толстой кишки и яичников. Заметные международные усилия по разработке лекарственных средств действительно направляются на поиск специфических ингибиторов c-Src. Вместо этого было обнаружено, что посредством простого лечения клеток аденокарциномы с помощью NAC можно достичь цели - подавления c-Src с помощью механизма, относящегося к окислительно-восстановительным переходам в чувствительных цистеиновых остатках в c-Src, способного «выключать» данную киназу, доставлять ее в эндолизосомы, где она хранится или разрушается. Таким образом, NAC, индуцировавший терминальную дифференциацию в клетках аденокарциномы, был связан с подавлением c-Src. Стоит отметить, что активность этой киназы оказывается важной во время децидуальной фазы цикла эндометриальных клеток, таким образом позволяя предположить вовлечение ее дерегулирования при эндометриозе (Endocrine Journal, 2008, 55(5): 795-810).

NAC и эндометриоз

Как объясняется в предшествующем разделе, ранее предполагалось, что NAC можно было бы использовать в новых терапевтических стратегиях в отношении эндометриоза, на основании его применения в качестве антиоксиданта и акцептора ROS. В исследованиях эпителиального рака, описанных выше, авторы настоящего изобретения обнаружили, что NAC обладал некоторыми полезными воздействиями, отличными от таких как эффекты антиоксиданта и акцептора ROS, на клетки эпителиального рака, и что такие эффекты также могли бы быть полезными в лечении эндометриоидных клеток, в случае если эндометриоидные клетки отвечают подобным образом. В частности, ожидалось, что антипролиферативные и дифференцирующие эффекты NAC, обнаруженные при раке, также могут иметь место при использовании NAC в лечении эндометриоза.

Полагали, что если NAC обладает следующими молекулярными эффектами, наблюдавшимися при раковом заболевании, также на эндометриоидной ткани, он мог бы являться полезным для лечения эндометриоза;

1) увеличение соединений клетка-клетка и клетка-субстрат в соответствии со сдвигом от пролиферирующего к дифференцированному фенотипу;

2) уменьшение экспрессии матриксных металлопротеиназ, ассоциированных с уменьшением клеточной миграции;

3) уменьшение экспрессии циклооксигеназы-2 (СОХ-2), ассоциированной с уменьшенной воспалительной реакцией;

4) модулирование активности c-Src для регулирования эндометриального цикла пролиферации/децидуализации и для обеспечения возможной беременности.

Поэтому была выдвинута гипотеза, что NAC может оказывать следующие физиологические эффекты при эндометриозе:

1) уменьшение эндометриальной клеточной пролиферации;

2) уменьшение местного хронического воспаления, и таким образом облегчения связанной с ним боли;

3) нормализация ткани источника, эутопического эндометрия, посредством более регулярного цикла пролиферации-дифференциации;

4) уменьшенное количество эктопических эндометриальных клеток, связанное с уменьшенной клеточной подвижностью вследствие как снижения тканевых металлопротеиназ, так и уменьшенных соединений клетка-клетка и клетка-субстрат;

5) реорганизация конформации эстрогеновых рецепторов посредством повторной сборки дисульфидных мостиков в релевантных цистеиновых остатках.

В целом, все предполагаемые результаты подтверждали или непосредственно или косвенно через ответ пациентов в клиническом исследовании и посредством гистологического анализа их биопсий или, в животной модели, на уровне морфологии, гистологии, биохимии и молекулярной биологии.

В частности, авторы изобретения обнаружили, что NAC действительно снижает экспрессию циклооксигеназы-2 (СОХ-2) и матриксной металлопротеиназы 9 (ММР-9) в эндометриоидной ткани. Они также демонстрируют, что NAC индуцирует релокализацию Е-кадгерина из цитоплазмы в эндометриоидной ткани в межклеточных соединениях в ткани, обработанной NAC. Это указывает на увеличение межклеточных соединений, которое согласуется с уменьшением клеточной пролиферации. Действительно, другие эффекты, такие как возросшая экспрессия р21 и уменьшенная экспрессия Ki-67, также указывают на то, что лечение NAC при эндометриозе приводит к уменьшенной клеточной пролиферации. Авторы изобретения также демонстрируют, что эти молекулярные эффекты NAC-лечения эндометриоза приводят к уменьшению размера эндометриоидных поражений, облегчению боли и к желаемой беременности. Преимущество при использовании NAC для лечения эндометриоза или показаний, связанных с эндометриозом, заключается в том, что не требуется использовать обычно применяемые гормональные лечения для эндометриоза, которые подавляют функции яичников. Применение NAC, таким образом, сравнительно увеличивает вероятность этих пациентов забеременеть. Лечение NAC перед операцией также приводило к более правильным и компактным эндометриомам, которые легче удалялись, и вызывало крайне малое кровотечение во время лапароскопии.

Схема приема

Из исследования лечения NAC на клеточных линиях аденокарциномы и первичных нормальных клетках кератиноцитов (Cell Death and Differentiation 2005, 12(10): 1285-1296) был сделан вывод, что эффективная доза NAC для индукции антипролиферативного-дифференцирующего эффекта варьировалась и зависела от типа клеток. Таким образом, происхождение ткани диктует эффективную концентрацию NAC, которая требуется, чтобы наблюдалось полное блокирование пролиферации, должна быть определена для каждой ткани. Кроме того, дозу NAC также соотносили со злокачественностью клеток. Более подробно, в то время как нормальным клеткам требовалась низкая доза для остановки пролиферации и начала дифференциации, клеткам карциномы с характерным неблагоприятным прогнозом требовалась более высокая концентрация NAC.

Для цели настоящего изобретения схему приема NAC для лечения эндометриоза у млекопитающего, включая человека, разрабатывали на основании следующих критериев:

1) дозировка NAC в сутки, которая согласуется с другими современными клиническими лечениями и считается не имеющей нежелательных побочных эффектов;

2) доза, которая считается достаточно высокой для удовлетворения требованию аномально пролиферирующих клеток, чтобы перевести их на путь дифференциации;

3) учитывая описанное уменьшение уровня NAC в плазме после продолжительных лечений (Pendyala L, Creaven PJ. Cancer Epidemiol Biomarkers Prev. 1995; 4:245-51), перерыв в лечении в течение примерно половины каждой недели считали оптимальным биологическим ответом в лечении в течение двух месяцев или дольше.

Композиция по настоящему изобретению, содержащая NAC, для лечения эндометриоза или показаний, ассоциированных с эндометриозом, согласно одному воплощению подлежит введению в дозе от приблизительно 20 до 90 мг/кг/сутки. Нижний предел основан на удвоенной дозе, применяемой для муколитического действия, то есть известно, что она сама по себе обладает физиологическим эффектом. Верхний предел основан на соображении, что более высокие дозы, как обнаружено, вызывают проблемы с желудком у многих пациентов. В еще одном воплощении настоящего изобретения композиция содержит NAC для введения в дозе приблизительно 30-60 мг/кг/сутки. Показано, что нижний предел эффективен при эндометриозе, и известно, что верхний предел фактически не имеет побочных эффектов. В еще одном воплощении настоящего изобретения композиция содержит NAC для введения в дозе приблизительно 30-45 мг/кг/сутки. Неожиданно было показано, что эта низкая дозировка является эффективной при эндометриозе.

В одном воплощении композиция подлежит введению в течение периода времени, который составляет два месяца или более, или предпочтительно три месяца или более. Чтобы воспрепятствовать уменьшению уровня NAC в плазме после продолжительного лечения, можно вводить NAC в предписанной дозировке прерывистым образом, то есть согласно прерывистой схеме приема/лечения. Прерывистое введение или лечение означает, что лечение прерывают на периоды, то есть, что фармацевтическую композицию вводят в течение некоторого периода времени, например нескольких суток, с последующим перерывом во введении, когда фармацевтическую композицию не вводят в течение некоторого периода времени, например в течение нескольких суток. Прерывистое лечение может быть регулярным, например лечение в течение фиксированного количества суток или недель с последующим перерывом в течение фиксированного количества суток или недель. Примеры включают повторяющиеся схемы с лечением в течение 4 суток с последующим перерывом в течение 3 суток каждую неделю, или лечение в течение 2 недель с последующим перерывом 1 неделю. Особый случай регулярного прерывистого лечения представляет собой импульсное лечение, то есть регулярное лечение и длительность перерыва, например введение каждые вторые сутки или введение в течение двух суток с последующими двумя сутками перерыва и так далее. Также являются возможными схемы нерегулярного прерывистого лечения, которые повторяют нерегулярно или имеют более сложную схему, которую повторяют, например в зависимости от ответа на лечение. В разных иллюстративных воплощениях настоящего изобретения предписанную дозу NAC вводят в течение 3-5 последовательных суток с последующими 2-4 сутками перерыва, или вводят в течение 1-3 последовательных суток с последующими 1-2 сутками перерыва.

В одном воплощении, со ссылкой на массу тела приблизительно 60 кг, доза NAC находится в интервале от 1,2 до 5,4 г/сутки, предпочтительно от 1,8 до 3,6 г/сутки. Эту дозу можно разделять на два или более, предпочтительно три или четыре, суточных введения либо из одной, либо двух доз (например, пилюль) каждое, где каждая доза может содержать, например, 0,15-2,7 г NAC или предпочтительно 0,6-1,2 г NAC. Лечение включает введение вышеупомянутых доз импульсно или прерывисто, например каждые вторые сутки или в течение трех-четырех последовательных суток каждую неделю, с перерывом от четырех до трех суток соответственно. Минимальная общая длительность лечения оставляет от двух месяцев, при отсутствии максимальной длительности. Для пациентов с другими массами, например субъектов с массой выше или ниже указанной, суточную дозу следует соответственно скорректировать.

В одном воплощении настоящего изобретения фармацевтическая композиция для лечения эндометриоза или родственных эндометриозу симптомов, содержит NAC в дозе 150-5400 мг для введения двумя или более введениями в сутки в течение периода по меньшей мере 2 месяца, такого как по меньшей мере 3 месяца. В предпочтительном воплощении настоящего изобретения фармацевтическая композиция содержит NAC в дозе 230-3600 мг для введения двумя или более введениями в сутки в течение периода по меньшей мере 2 месяца, такого как по меньшей мере 3 месяца. Лечение включает введение вышеуказанных доз импульсно или прерывисто, например каждые вторые сутки или в течение трех-четырех последовательных суток каждую неделю с перерывом от четырех до трех суток соответственно.

Фармацевтические композиции

Фармацевтическая композиция согласно настоящему изобретению может быть приготовлена способом, который сам по себе известен специалисту в фармацевтической области. Композиция может содержать эффективное количество NAC в соответствии с изобретением, а также подходящий носитель или эксципиент, который служит средством доставки или средой для активного ингредиента. Такие носители или эксципиенты известны в данной области техники и включают твердые вещества, такие как лимонная кислота, цитрат натрия, карбонат натрия (кислота) плюс ароматизатор. Фармацевтическая композиция предпочтительно адаптирована для перорального введения. Такие композиции могут быть введены в разных формах, в настоящее время предпочтительно в виде таблеток. Также возможны другие формы, такие как капсулы, суппозитории, растворы, суспензии, сиропы или тому подобное.

Изобретение требует строгой оценки фармацевтического качества препарата NAC для получения эффективной дозы. Поэтому следует применять бренды или сертифицированные непатентованные препараты. NAC не является стабильной молекулой, его активный тиоловый остаток может быть легко окислен кислородом, светом и другими излучениями, так что эффективная доза может быть не достигнута. Препарат, таким образом, предпочтительно защищен от света, в растворимых таблетках, с гидрокарбонатом натрия, который содействует частичному удалению кислорода из воды во время растворения.

Наблюдалось, что высокие дозы NAC могут вызывать абдоминальную боль. Для преодоления этого возможно предложение NAC в композиции с защитой желудка, подходящей для предотвращения высвобождения/растворимости NAC в желудке. Такие композиции хорошо известны в данной области техники и могут быть использованы в настоящем изобретении. Например, можно использовать таблеточные покрытия, которые устойчивы к жидкостям желудка и делают возможным высвобождение лекарственного средства только в кишечнике после его прохождения через желудок. Обычно используемые композиции включают полимеры, такие как производные целлюлозы, сополимеры сложных аминоэфиров метакрилата. Покрытие защищает ядро таблетки от разрушения в кислой среде желудка посредством применения чувствительного к pH полимера, который набухает или солюбилизируется после прохождения через желудок в ответ на увеличение pH, с высвобождением лекарственного средства.

Другим вариантом является снижение дозы NAC, поступающей в ток крови одновременно. Введение NAC три или более раз в сутки может быть трудновыполнимым для пациента. Несмотря на это, повторяющееся введение может быть желательным для достижения почти постоянной концентрации NAC в сыворотке. Для преодоления этих проблем введение один или два раза в сутки, например утром и ночью, может быть более легким для выполнения пациентом. Одним вариантом является предложение NAC в композиции с медленным высвобождением (также называемым замедленным высвобождением или регулируемым высвобождением). Такая композиция делает возможным введение большей дозы с более длинными интервалами, так как способна снижать скорость диффузии и захват NAC в кровоток. Затем доза распределяется в крови в течение продолжительного времени в небольших количествах, например в течение 12+12 часов в случае схемы приема два раза в сутки. Множество разных технологий и композиций для замедленного высвобождения давно известны в данной области техники и могут использоваться в настоящем изобретении. В таких технологиях активное вещество, например, инкапсулируют в оболочку или матрицу, которая является нерастворимой или менее растворимой в жидкой среде организма, куда ее вводят. Композиции, обладающие комбинированным эффектом медленного высвобождения и защиты желудка, также являются возможными и могут использоваться в настоящем изобретении.

Применение/медицинские показания настоящего изобретения

Показано, что настоящее изобретение обладает полезными свойствами во многих аспектах, связанных с эндометриозом, и может применяться как для лечения эндометриоза, так и для лечения различных показаний, ассоциированных с эндометриозом. Под лечением различных показаний, ассоциированных с эндометриозом, понимают, например, лечение для облегчения симптомов заболевания, таких как боль и воспаление; лечение для увеличения вероятности наступления беременности; предварительное лечение перед операцией для облегчения удаления эндометриоидных поражений и для улучшения результата операции; лечение после операции для предотвращения рецидива поражений; и профилактическое лечение в случае подтвержденных, оцененных факторов риска или наличия наследственного эндометриоза.

Было показано, что NAC, согласно настоящему изобретению, уменьшает размер поражения и возвращает пролиферативную ткань к более дифференцируемой, нормальной ткани. Таким образом, в одном воплощении настоящего изобретения фармацевтическая композиция содержит NAC для лечения эндометриоза с целью снижения - в конечном счете вплоть до их исчезновения - эндометриом, спаек, перитональных имплантатов и глубоких поражений, локализованных в ректовагинальной перегородке или в других местах.

Также было показано, что NAC, согласно настоящему изобретению, ослабляет симптомы боли, вызванной эндометриозом. Таким образом, в еще одном воплощении настоящего изобретения фармацевтическая композиция содержит NAC для ослабления боли, ассоциированной с эндометриозом.

В еще одном воплощении настоящего изобретения фармацевтическая композиция содержит NAC для стимулирования желаемой беременности у пациента с эндометриозом.

В еще одном воплощении настоящего изобретения фармацевтическая композиция содержит NAC для предварительного лечения перед лапароскопией или операцией в случаях эндометриоза, для облегчения удаления массы, уменьшения кровотечения, чтобы сделать ткани стать более компактными/менее хрупкими.

В еще одном воплощении настоящего изобретения фармацевтическая композиция содержит NAC для предотвращения рецидивов после лапароскопии или операции.

В еще одном воплощении настоящего изобретения фармацевтическая композиция содержит NAC для применения в случае подтвержденных, оцененных факторов риска, для предотвращения эндометриоза вследствие наследственного заболевания.

ПРИМЕРЫ

Далее изобретение будет дополнительно описано и проиллюстрировано посредством следующих примеров. Следует отметить, однако, что эти примеры не следует рассматривать как ограничивающие изобретения каким-либо образом.

Пример 1. Эффект NAC в мышиной модели эндометриоза

Материалы и методы

Вещества. Если не указано, все химикаты были от Sigma-Aldrich, Milan, Италия.

Животные. 36 самок BALB/C мышей в возрасте 6-8 недель приобретали у Charles River Italia (Calco, Италия). Корма в виде гранул (обогащенная стандартная диета; Mucedola, Milan, Италия) и воды предоставляли, сколько угодно. Животных содержали в цикле свет/темнота 16/8 часов в контролируемых условиях. Перед любой инвазивной процедурой мышей анестезировали посредством внутрибрюшинной инъекции 0,4 мл физиологического раствора, содержащего 2,5% авертина.

Индукция эндометриоза. Индукцию эндометриоза выполняли, следуя способу, описанному в Somigliana et al, Hum Reprod 1999 Dec;14(12):2944-50. Хирургические вмешательства выполняли в чистых условиях. Кратко, рога матки сингенных мышей удаляли через небольшой срединный разрез в брюшной полости чуть ниже пупка и помещали в чашку Петри, содержащую фосфатно-солевой буферный раствор (PBS). Фрагменты эндометрия получали мелким дроблением рогов матки, используя лезвие бритвы. Фрагменты суспендировали в 0,6 мл PBS и быстро инокулировали в брюшную полость мышей-реципиентов в соотношении один донор на два реципиента. Мышей с индуцированным эндометриозом случайным образом разделяли на две группы по 12 мышей каждая: контроль и обработка NAC.

Обработка NAC. Через сутки после имплантации эндометрия мышей из группы лечения подвергали зондовому питанию с помощью 100 мкл 10 мг/мл основного раствора NAC в воде. Контрольная группа получала только воду. Введение NAC продолжали ежедневно в течение 21 суток. Учитывая среднюю массу тела мыши 22,5±0,7, доза NAC 1 мг/мышь соответствует 44 мг/кг/сутки. Не было отмечено никаких признаков токсичности при введении дозы на основании массы тела - неизмененной в конце лечения - в отношении потребления пищи, груминга или уровни активности по сравнению с контролями. В конце лечения мышей убивали посредством смещения шейных позвонков.

Сбор эндометриом. В конце лечения животных умерщвляли и эндометриоидные поражения осторожно вырезали из окружающей ткани, оценивали их общую массу и количество. Кисты либо сразу же фиксировали в 10% формалине, либо замораживали в жидком азоте и хранили при -80°C.

Гистология и иммуногистохимия. Фиксированные в формалине образцы заливали парафином и тканевые срезы (толщиной 5 мкм) окрашивали, используя гематоксилин-эозин. Все микроскопические препараты оценивал опытный патологоанатом, который действовал вслепую в отношении исследования, и гистологический диагноз эндометриоза был основан на морфологической идентификации эндометриальной гландулярной ткани и стромы.

Для иммуногистохимии срезы депарафинизировали и регидратировали в марочном этаноле. Для извлечения антигена срезы обрабатывали микроволнами в течение 6 мин в 0,1 М цитратном буфере (pH 6,0) и активность эндогенной пероксидазы блокировали посредством инкубирования в течение 20 мин в 3% смеси Н2О2/метанол. Срезы промывали в смеси PBS/ТритонХ-100, погружали на 15 мин в 1% смесь PBS-бычий сывороточный альбумин (BSA), чтобы блокировать участки неспецифического связывания, и затем инкубировали с выбранным первичным антителом, разбавленным в 1% PBS-BSA. Для иммунологического анализа циклооксигеназы (СОХ)-2 (кролика к мыши поликлональные, Cayman Chemical, Milan, Италия), Ki-67 (кролика к человеку поликлональные, Monosan Xtra, DBA Italia, Segrate, Италия) и E-кадгерина (BD Biosciences, Milan, Италия) инкубацию выполняли в течение ночи при 4°C и разведения представляли собой 1:100, 1:600, 1:200 соответственно. Иммуногистохимическое окрашивание продолжали, используя DAKO Cytomation LSAB2 System-HRP (Dako Italia, Milan, Италия), и участки связывания антител визуализировали при помощи раствора strept кролика против человека поликлональных антител авидин-биотин пероксидазного комплекса, используя диаминобензидин в качестве хромогена. Срезы контрастно окрашивали гематоксилином, обезвоживали, помещали в канадский бальзам и затем рассматривали с помощью микроскопа Leica. Количественное определение экспрессии Ki-67 выполняли слепым способом с помощью двух независимых наблюдателей; каждый наблюдатель подсчитывал по меньшей мере 200 клеток в более чем 10 случайным образом выбранных полях для каждого образца и индекс мечения Ki-67 выражали в процентах.

Экстракция РНК, полуколичественная RT-PCR (полимеразная цепная реакция с обратной транскрипцией) и qRT-PCR (количественная RT-PCR). Общую РНК выделяли посредством лизиса замороженных эндометриальных кист с TissueLyser (QIAGEN, Milan, Италия), используя реагент Тризол (Invitrogen, Milan, Италия) в соответствии с инструкциями изготовителя. Один микрограмм общей РНК из каждого образца обрабатывали 1 Ед ДНКазы I (Invitrogen) и обратно транскрибировали 200 Ед обратной транскриптазы Superscript III (Invitrogen), используя 250 нг выбранных случайно праймеров в 20 мкл конечного объема. Такой же продукт кДНК, полученный от каждого образца, использовали для последующей ПЦР амплификации с наборами праймеров, полученных для целевых генов. Конститутивный ген 18S РНК использовали в качестве внутреннего контроля. Образцы отрицательного контроля состояли из реакционной смеси и праймеров без кДНК-матрицы. Последовательности праймеров (Таблица 1) создавали, используя программное обеспечение Primer-BLAST, доступное онлайн на: http://www.ncdi.nlm.nih.gov/

Сначала вычисляли соотношение между образцом и конститутивным геном посредством синхронной амплификации ген-специфической мРНК и 18S РНК в одной реакционной пробирке. Так как эта процедура не была успешной для всех образцов - возможно из-за относительно небольшого количества специфических транскриптов и, таким образом, предпочтительной амплификации мРНК 18S - для предотвращения количественных неточностей, происходящих от конкурентых эффектов, целевые гены и кДНК 18S, созданные в одной и той же реакции RT, амплифицировали в отдельных пробирках. Чтобы документировать амплификацию в экспоненциальном интервале, создавали график амплификации для РНК 18S и выбирали соответствующее количество циклов. Полуколичественную ПЦР выполняли в реакционном объеме 25 мкл с 1 мкл кДНК, 2 мМ MgCl2, 0,2 мМ dNTP, 0,5 мкМ каждого праймера и 1,25 Ед полимеразы Hotstart Taq (QIAGEN). ПЦР амплификацию выполняли с помощью iCycler (Bio-Rad, Milan, Италия). Затем продукты ПЦР электрофоретически разделяли на 1,5% агарозном геле и окрашивали бромидом этидия. Уровни целевой мРНК оценивали посредством денситометрического сканирования и нормализовали против 18S загруженных контролей. Денситометрические анализы продуктов ПЦР выполняли, используя программное обеспечение для обработки изображений Quantity One (VersaDOC, Bio-Rad).

Таблица 1
Последовательность праймеров, использования для полуколичественного qRT-PCR
Целевая мРНК Праймеры Последовательность Отжиг (на 30 секунд) Число циклов Продукт ПЦР (пар оснований)
18S РНК NR_003278.1 прямая обратная CGCGGTTCTATTTTGTTGGT 60°C 18-24 219
AGTCGGCATCGTTTATGGTC
СОХ-2
NM_011198.3
прямая обратная CCCCCACAGTCAAAGACACT 60°C 35 196
AGTTGCTCATCACCCCACTC
ММР-9 NM_013599.2 прямая обратная TGAATCAGCTGGCTTTTGTG 60°C 35 242
GTGGATAGCTCGGTGGTGTT
Р21 (cdknla) NM_007669.4 прямая обратная TCCACAGCGATATCCAGACA 60°C 35 196
ACGAAGTCAAAGTTCCACCG

Результаты

Влияние обработки NAC на рост эндометриоидных поражений. Через двадцать одни сутки после индукции эндометриоза всех экспериментальных мышей умерщвляли и их эндометриомы удаляли и собирали. Из 12 контрольных мышей одна умерла и у одной не развились эндометриомы. Из 12 мышей, обработанных NAC, у двух не развились эндометриомы. Морфологически эктопические поражения были крупными, кистозными и васкуляризированными: они состояли из заполненных жидкостью кист, которые были либо белыми, красными, либо изредка коричневыми по цвету, и предпочтительно локализовались на брюшине абдоминально-тазовой полости. Во вставках Фиг.1.1 авторы изобретения представляют типичные изображения кист от контрольных (А) и NAC-обработанных (В) животных. В среднем, значительное уменьшение массы наблюдалось в группе лечения (n=10) по сравнении с контролями (n=10) (Фиг.1).

NAC снижает экспрессию СОХ-2 и ММР-9 и выключает пролиферацию. Анализ RT-PCR показал, что, относительно кист от контрольных мышей (п=5), обработка NAC (n=5) индуцировала значительное уменьшение уровней СОХ-2 (-32%) и ММР-9 (-34%) мРНК, со значимостью p<0,01, которые нормализовали к экспрессии 18S (Фиг.2А и В). Ген Р21, обычно экспрессирующийся только, когда цикл пролиферации блокирован, ни разу не экспрессировался в 5 контролях, хотя он экспрессировался в 3 из 5 изучаемых NAC-обработанных образцах (типичный пример на Фиг.2А).

NAC запускает в действие релокализацию Е-кадгерина. Иммуногистохимическое обнаружение Е-кадгерина было положительным в 100% изучаемых случаев. Мечение было ограничено гландулярными эпителиальными клетками, в то время как ни один образец не представлял стромальное окрашивание. На клеточном уровне в кистах контрольных мышей авторы изобретения обнаружили, что окрашивание Е-кадгерина было рассеянным по всей клеточной цитоплазме, в то время как в кистах NAC-обработанных мышей Е-кадгерин главным образом обнаруживали вдоль межклеточных соединений (Фиг.3). Е-кадгерин является частью многобелкового адгезионного комплекса, поэтому его возросшее присутствие на границах клеток указывает на увеличение межклеточных сцеплений. Кроме того и в соответствии с экспрессией Р21, описанной выше, это перемещение согласуется с потерей пролиферирующего поведения у клеток, переключенных на терминальную дифференцировку (Conacci-Sorrell et al, J. Clin. Invest. 2002, 109: 987-991; Parasassi et al, Cell Death Differ. 2005, 12: 1285-1296).

Обработка NAC уменьшает количество Cox-2 в эндометриомах. Иммуногистохимическое обнаружение связанного с воспалением белка Сох-2 показало, что по отношению к кистам от контрольных мышей, образцы, собранные от NAC-обработанных мышей, показали довольно ослабленное окрашивание, которое в некоторых случаях полностью отсутствовало (Фиг.4).

NAC уменьшает количество пролиферирующих клеток. Антиген Ki-67 (Ki-67) является классическим маркером клеточной пролиферации, у покоящихся, находящихся в фазе покоя клеток, у которых полностью отсутствует экспрессия Ki-67. При использовании для окрашивания кист контрольных мышей можно было обнаружить несколько меченых клеток (стрелки в панелях А-С на Фиг.5). Вместо этого очень мало меченых клеток было обнаружено в кистах NAC-обработанных мышей (стрелки в панелях D-F на Фиг.5). Статистическая оценка, выполненная на 8 животных в каждой группе (10 изображений/200 мышиных клеток), обеспечивала 54%-ное уменьшение пролиферирующих клеток (Таблица II).

Таблица II
Индекс мечения для Ki-67 со стандартной ошибкой. Значимость: p<0,01
Контроль (n=8х5) NAC-обработанные (n=8х5)
1,88±0,28 0,87+0,11а

Обсуждение

Животная модель эндометриоза была эффективной в индуцировании эктопических эндометриальных имплантатов. Только у одного животного в контроле и двух в NAC-обработанной группе не оказалось эндометриом.

В соответствии с ожиданиями, масса - пропорционально размеру - кист была ниже у NAC-обработанных мышей. Это можно объяснить антипролиферативным эффектом NAC (Parasassi et al, Cell Death Differ. 2005, 12: 1285-1296), который широко проиллюстрирован в данном описании анализом экспрессии гена и иммуногистохимией. Действительно Р21, ген, экспрессирующийся только в дифференцирующихся, непролиферирующих клетках, наблюдался у 60% NAC-обработанных животных, в то время как он не экспрессировался в контролях. Напротив, белок Ki-67, который экспрессируется только в пролиферирующих клетках, показал 54% уменьшение у NAC-обработанных относительно контрольных мышей.

Релевантные белки при эндометриозе, такие как ММР-9 (Collette et al., Hum Reprod 2006; 21:3059-3067) и Cox-2 (Carli et al, Endocrinology 2009; 150: 3128-3137), показали уменьшение после обработки NAC. ММР-9 считается основным для клеточного движения и инвазивного поведения, в то время как Сох-2 является хрестоматийным ферментом, ассоциированным с воспалением. Оба родственных гена показали уменьшение примерно 30% после обработки NAC. Кроме того, количество Сох-2 также изучали при помощи гистохимического окрашивания в кистах, и результаты продемонстрировали релевантное ослабление при окрашивании.

На основе широко признанного представления, рассматривающего цитоплазматический Е-кадгерин в качестве маркера пролиферативного поведения клеток, в то время как его нахождение в межклеточном адгезионном комплексе, напротив, рассматривается и как маркер, и как индуктор дифференцировки, авторы изобретения также изучали локализацию Е-кадгерина в кистах контрольных и NAC-обработанных мышей. Результаты находятся в идеальном согласии с предшествующими данными, полученными авторами изобретения на клетках аденокарциномы (Parasassi et al., Cell Death Differ. 2005,12: 1285-1296), свидетельствуя о перемещении Е-кадгерина из клеточной цитоплазмы к границам клетки после обработки NAC. Такая ассоциация Е-кадгерина с адгезионным комплексом также находится в согласии с менее подвижным, менее инвазивным поведением клеток.

В заключение, во всех рассмотренных отношениях NAC может представлять собой оптимальное лечение эндометриоза. При переносе на лечение женщин, это лекарственное средство имеет значимое преимущество, фактически не имея побочных эффектов по сравнению с величиной нежелательных эффектов при гормональном лечении. Поэтому NAC можно использовать для уменьшения величины кист, для уменьшения местного воспаления и ассоциированной хронической боли и для уменьшения рецидива после операции. Этот последний пункт обусловлен уменьшенной пролиферацией и сниженной клеточной подвижностью.

Пример 2. Предварительное клиническое исследование действия NAC в лечении эндометриоза.

Цель исследования. Данное пилотное клиническое исследование было разработано для лечения женщин с эндометриозом посредством применения NAC вместо других видов лечения. Единственным возможным дополнительным лечением были анальгетики для облегчения боли, когда это было необходимо.

Критерии включения пациентов. Женщины с начальным диагнозом эндометриоз, основанным на боли и подтверждении заболевания при помощи УЗИ яичников, и пациенты с рецидивом боли и/или эндометриомы яичников после лапароскопического лечения были включены в данное исследование.

Перед лечением измеряли интенсивность болевых симптомов с помощью 10-балльной визуальной аналоговой шкалы (VAS) и характеристики эндометриом яичников посредством чрезвлагалищного УЗИ. Во время лечения NAC другие виды лечения были исключены, за исключением анальгетика для лечения боли, когда это было необходимо.

Пациенты. С февраля 2008 года до июля 2010 года 64 женщины со средним возрастом 35±7 лет (±SD) с диагностированным эндометриозом яичников были включены в исследование, 33 из них было назначено лечение NAC (средний возраст: 37±6 лет), в то время как 31 не следовали NAC- или какому-либо другому лечению и рассматривали в качестве контрольных случаев (средний возраст: 33±8 лет). У всех из них присутствовала одна или более кист в одном или обоих яичниках.

Лечение. Предписанная доза NAC была близкой к используемой в исследовании животных, 30 мг/кг/сутки. На практике, для средней массы тела 60 кг, для всех зарегистрированных пациентов были предписаны три пероральные дозы по 600 мг NAC три раза в сутки в течение трех последовательных суток каждую неделю с четырьмя сутками перерыва. Результатом были 1,8 г NAC в сутки, 5,4 г в неделю, 21,6 г в месяц. Эти точные способы лечения были основаны на следующих соображениях: 1) доза 1,8 г NAC в сутки находится в согласии с другими современными клиническими видами лечения и считается не имеющей нежелательных побочных эффектов; 2) установленные фармакокинетические показатели NAC, три суточные дозы по 0,6 мг приближаются к почти постоянному уровню в плазме без дискомфорта для пациентов во время комплексного лечения; 3) установленное зарегистрированное уменьшение уровня NAC в плазме после продолжительных лечений (Pendyala L, Creaven PJ. Cancer Epidemiol Biomarkers Prev. 1995; 4:245-51), остановка лечения в течение примерно половины каждой недели обеспечивает оптимальный биологический ответ при длительном лечении, например от двух до шести месяцев или дольше.

Контроль. Интенсивность болевых симптомов (шкала боли VAS) и размер эндометриом яичника (клиническое и US обследование) оценивали после первых трех месяцев лечения. При необходимости через 3 месяца осуществляли лапароскопическое лечение.

Результаты

Данные после первого трехмесячного контрольного периода описаны ниже.

Изменение размера кист (неизмененные, увеличенные или уменьшенные) после трех месяцев лечения NAC, который измеряли при помощи ультразвука как максимальный диаметр, показано на Фиг.7А (абсолютное количество кист) и Фиг.7В (процент кист). На фигурах показано сравнение кист у пациентов, пролеченных NAC, и киста у нелеченных контролей. В процентах (Фиг.7В) уменьшение размера кист наблюдалось в 38% случаев, в то время как у контролей только менее 10% случаев показали самопроизвольное уменьшение. Учитывая уменьшение размера эндометриом, несколько (21 из 33) пациентов решили отменить или отложить запланированную лапароскопию.

Болевые ощущения после лечения NAC также изменялись. Боль оценивали до и после трехмесячного лечения, по 10-балльной визуальной аналоговой шкале (VAS), где ноль представлял собой отсутствие боли, а 10 баллов представляли самую сильную мыслимую боль. Интенсивность симптомов классифицировали как отсутствие (0), слабая (1-4), умеренная (5-7) или тяжелая (8-10). Пролеченные NAC пациенты сообщали об уменьшении боли в среднем от 7,6±0,3 до 5,1±0,8 (р<0,01) после трех месяцев лечения.

Не сообщалось ни о каких вредных побочных эффектах.

Хотя авторы изобретения не оценивали, желали ли пациенты беременность, и поэтому не могут охарактеризовать статистическую значимость полученных данных, авторы изобретения также сообщают о трех случаях беременности, очевидно невозможных с используемыми в настоящее время терапиями эндометриоза, нацеленными на подавление функции яичников.

Примечательным являлось наблюдение, описанное опытным хирургом, что при лапароскопии после лечения NAC эндометриома была более регулярной и компактной и более легко удаляемой, поэтому связанной со значительным уменьшением кровотечения во время лапароскопии.

В еще одном случае узелок на ректовагинальной перегородке исчез, что свидетельствует об эффективности NAC за пределами эндометриом яичников.

Пример 3. Воздействие импульсного, прерывистого и ежесуточного лечения NAC на экспериментально индуцированный эндометриоз: вагинальная гиперчувствительность у крыс, как сигнал боли - пилотное исследование

Материалы и методы

Животные. Использовали 16 взрослых неоплодотворенных самок крыс Sprague-Dawley. Они весили 200-230 г в начале исследования и содержались по отдельности в комнате с контролируемой температурой в пластиковых клетках, застеленных подстилкой. Крысы имели свободный доступ к воде и крысиному корму и содержались в 12-часовом цикле свет/темнота с включением освещения в 07:00. Репродуктивный статус (предтечка, течка, послетечка и диэструс) определяли путем ежесуточного осуществления промывания влагалища.

Экспериментальная модель и предхирургическая тренировка. Перед индукцией эндометриоза крыс тренировали на выполнение реакции избегания для прекращения расширения влагалища, производимого надувным латексным баллоном. Небольшой ненадутый латексный баллон соединяли с тонким катетером, смазанным перед введением в середину вагинального канала. Надувание баллона разными объемами воздуха растягивало вагинальный канал. Давление, производимое каждым растягиваемым объемом, измеряли для контроля посредством датчика давления малого объема. Аппаратура для тестирования представляла собой небольшую цилиндрическую камеру из органического стекла, созданную для содержания крысы так, чтобы помешать ей поворачиваться. Открывание задней части камеры позволяло соединить катетер, присоединенный к вагинальному стимулятору, со стимулирующим аппаратом. Фоточувствительный элемент определял положение крысы в камере. Если крыса растягивалась, как части реакции избегания, то световой луч прерывался и воздействие прекращали. Крысам давали освоиться в камере тестирования путем помещения их в камеру на 15 мин ежедневно в течение 5 суток. Затем крыс, во время сеансов тренировки, приучали к механической реакции избегания для уменьшения растяжения влагалища, которая включала вытягивание крысой головы для прерывания светового луча. Все крысы обучались реакции избегания за 4 сеанса. После обучения начинали сеанса тестирования.

Сеансы тестирования выполняли 3 раза/неделю в не следующие подряд сутки. Каждый сеанс тестирования включал ряд испытаний контролируемого избегания. Каждое испытание состояло из быстрого надувания баллона (1 мл/с) до фиксированного объема, который сохранялся либо до осуществления крысой реакции избегания или протяжении 15 секунд, и баллон быстро сдували. Разные объемы расширения, включая контрольный объем (0,01 мл), нагнетали каждый три раза в случайном порядке. Максимальный период ожидания 15 секунд считался отсутствием ответа.

Время до ответа и реакции избегания измеряли как функцию объема расширения для каждого сеанса, как описано в Cason AM et al (Horm Behav. (2003), Vol.44, pages 123-31). Чем короче было время до ответа и меньше объем, дающий ответ, тем сильнее была реакция избегания у крысы. Для каждой крысы реакции избегания и давление/объемы для всех сеансов у данной крысы (по меньшей мере 12 сеансов) объединяли и вычисляли средние значения величин. Во всех четырех экспериментальных группах (см. ниже) обнаружили, что исходные реакции избегания на растяжение влагалища до хирургической операции по поводу эндометриоза были очень похожи.

Индуцирование эндометриоза. Эндометриоз у крыс можно экспериментально индуцировать посредством автотрансплантации кусочков матки. Хирургическую операцию по поводу эндометриоза выполняли, следуя протоколу, первоначально разработанному Vernon and Wilson 1985 (Fertility and Sterility, 1985, Vol.44, pages 684-694). Крыс в диэструсе анестезировали, помещали на грелку-подушку для поддержания температуры тела и выполняли операцию. Выполняли разрез средней линии брюшной полости для раскрытия матки. Четыре кусочка рога матки пришивали вокруг альтернативного каскада брыжеечных артерий, которые питают каудальную часть тонкого кишечника. Послеоперационное восстановление происходило гладко, и регулярная цикличность течки возобновлялась у всех крыс в течение одной недели.

Лечение NAC.

Всех крыс лечили NAC в дозе 60 мг/кг/сутки (когда это применимо, в сутки введения) или плацебо в течение 8 недель после операции. Крыс разделяли в четыре экспериментальные группы:

Первая группа получала импульсное лечение NAC, то есть лечение через день.

Вторая группа получала прерывистое лечение NAC, то есть ежесуточное лечение в течение 5 суток и 2 суток отдыха (то есть 2 суток без лечения).

Третья группа получала ежесуточное лечение NAC.

Четвертая группа получала мнимое лечение, то есть лечение плацебо.

Реакцию избегания для прекращения вагинального растяжения, как описано выше, оценивали через 8 недель.

Результаты

Результаты показывают, что после операции на матке у крыс была индуцирована вагинальная гипералгезия (повышенная чувствительность к боли).

Определяли реакцию избегания (то есть время до ответа и число ответов в течение 15 секунд при определенном объеме растяжения по сравнению с контрольной группой) и вагинальное давление для разных объемов растяжения вагинального канала. Показаны результаты для четырех разных экспериментальных групп (значения для группы мнимого лечения использовали в качестве исходных значений).

Относительное уменьшение реакции избегания при 0,5 мл объеме растяжение относительно группы мнимого лечения составляло:

1. Для группы импульсного лечения NAC: уменьшение реакции избегания на 32%;

2. Для группы прерывистого лечения NAC: уменьшение реакции избегания на 28%;

3. Для группы ежесуточного лечения NAC: уменьшение реакции избегания на 18%.

Примечательно, что результаты, таким образом, показывают, что уменьшающий боль эффект, индуцированный лечением NAC, был более заметным в группе импульсного лечения и в группе прерывистого лечения, по сравнению с группой, которая получала ежесуточное лечение.

1. Способ лечения млекопитающего с эндометриозом, включающий импульсное или прерывистое пероральное введение в течение 3-5 последовательных суток с последующими 2-4 сутками перерыва или в течение 1-3 последовательных суток с последующими 1-2 сутками перерыва фармацевтической композиции, содержащей N-ацетил-L-цистеин, в течение периода времени по меньшей мере два месяца, где N-ацетил-L-цистеин вводят в дозе, составляющей от 20 до 90 мг/кг/сутки в сутки введения.

2. Способ по п. 1, где N-ацетил-L-цистеин вводят в дозе, составляющей от 30 до 60 мг/кг/сутки в сутки введения.

3. Способ по п. 2, где N-ацетил-L-цистеин вводят в дозе, составляющей от 30 до 45 мг/кг/сутки в сутки введения.

4. Способ по п. 1, где фармацевтическая композиция, содержащая N-ацетил-L-цистеин, защищена от света.

5. Способ по п. 1, где фармацевтическая композиция, содержащая N-ацетил-L-цистеин, представляет собой водорастворимую таблетку.

6. Способ по п. 1, где фармацевтическая композиция, содержащая N-ацетил-L-цистеин, содержит гидрокарбонат натрия.

7. Способ по п. 1, где фармацевтическая композиция, содержащая N-ацетил-L-цистеин, содержит полимерное таблеточное покрытие на основе производных целлюлозы или сополимеров сложных аминоэфиров метакрилата, которое обеспечивает высвобождение лекарственного средства в кишечнике.

8. Способ по п. 1, который используют в лечении боли, вызванной эндометриозом.

9. Способ по п. 1, который используют в лечении бесплодия, вызванного эндометриозом.

10. Способ по п. 1, который используют в предварительном лечении млекопитающих с эндометриозом перед лапароскопией или операцией.

11. Способ по п. 1, который используют в лечении после лапароскопии или операции для предотвращения рецидивов эндометриоидных поражений.



 

Похожие патенты:
Изобретение относится к области ветеринарии и предназначено для профилактики послеродовых воспалительных заболеваний матки и молочной железы. Способ включает внутримышечное введение в организм лекарственного препарата антиоксидантного действия до предполагаемого отела дважды.
Изобретение относится к области ветеринарии и предназначено для лечения мастита у овец. Способ включает внутримышечное введение тилозинсодержащего препарата в дозе 0,05 мл/кг массы тела один раз в сутки в течение 3-4 дней при всех формах мастита.

Группа изобретений относится к медицине и касается стабильной композиции наноструктурированного силденафила, ингибирующей цГМФ-специфичную фосфодиэстеразу типа 5 (PDEV), содержащей наноструктурированное основание силденафила или его фармацевтически приемлемые соли, имеющие средний размер частиц менее чем примерно 500 нм, стабилизатор, где композицию получают в проточном реакторе непрерывного действия на основе микроструйной техники и где композиция обладает полуаморфной структурой.

Изобретение относится к соединениям структурной формулы (I), которые могут быть использованы для лечения заболеваний, опосредованных андрогенным рецептором. В формуле (I) R1 обозначает (С2-6)алкил, (С1-6)алкилокси, -S(O)m-(C1-6)алкил, (С1-6)фторалкил, CN или галоген, R2 и R3 являются одинаковыми или разными и обозначают атом водорода или (С1-9)алкил, R4, R5, R6, R7 являются одинаковыми или разными и обозначают атом водорода или галоген, X обозначает СН или N, Y обозначает либо атом азота, либо атом углерода, замещенный (C1-6)алкилом, (C1-6)алкилокси, (C1-6)фторалкилом, атомом водорода или галогена, m равен 0, 1 или 2.
Изобретение относится к области ветеринарии и предназначено для профилактики послеродового эндометрита у коров. Способ включает интравагинальное введение пробиотического препарата «Гипролам» (Lactobacillus fermentum 44/1 и Lactococcus lactis subsp.
Изобретение относится к области ветеринарии и предназначено для лечения субклинического мастита у лактирующих коров. Способ включает совместное применение тканевого препарата на 1, 3 и 5 дни лечения и 15%-ного раствора АСД-2ф на тетрагидровите в дозе 10 мл внутримышечно на 2, 4 и 6 дни лечения.

(57) Заявленное изобретение относится к области ветеринарии и предназначено для лечения животных при эндометритах. В качестве химиотерапевтического средства применяются N,N-диметиламино-пропиламиды жирных кислот формулы 1 (n=10; 12) которые применяют в виде солей с фармакологически приемлемыми кислотами.

Изобретение относится к области ветеринарии и предназначено для лечения эндометритов у животных. Способ включает использование химиотерапевтических средств.

Группа изобретений относится к медицине и медицинской технике, а именно к акушерству и гинекологии, и может быть использована для местного лечения воспалительных заболеваний полости матки.
Изобретение относится к ветеринарии, в частности к средству для лечения и профилактики эндометрита у животных. Сущность изобретения заключается в следующем.

Изобретение относится к медицине, а именно к травматологии и ортопедии, и может быть использовано для лечения повреждений проксимального отдела плечевой кости. Для этого проводят комплексные лечебные мероприятия в три этапа.
Группа изобретений относится к медицине и касается композиции, обладающей действием на центральную нервную систему, в виде раствора, содержащей в своем составе глицин, глицерин, консервант, воду.
Изобретение относится к фармацевтической промышленности, в частности к водорастворимой фармацевтической композиции L-аргинина-дигидрокверцетина и способу ее получения.

Изобретения относятся к фармацевтической композиции с антиишемической и антиоксидантной активностью в виде таблеток или капсул и способу ее получения. Композиция содержит 4-((3-оксо-3-этоксипропаноил)амино)бензойную кислоту в количестве от 40 до 80 мас.%, аминосодержащее соединение и фармацевтически приемлемые наполнители.
Группа изобретений относится к композициям для ухода за полостью рта, содержащим основную аминокислоту или ее соль. Предлагаемая композиция для ухода за полостью рта для повышения закрытия дефектов дентина в полости рта пациента содержит аргинин в свободной форме или в форме соли и абразивное вещество, представляющее собой синтетический аморфный диоксид кремния и содержащее фракцию мелких частиц, составляющую, по меньшей мере, примерно 5% от общей массы композиции, в которой частицы фракции мелких частиц имеют d50 от 3 до 4 мкм.
(57) Изобретение относится к области медицины и предназначено для воздействия на микроциркуляцию в костной ткани при экспериментальном остеопорозе и переломах на его фоне.
(57) Изобретение относится к области медицины и предназначено для воздействия на микроциркуляцию в костной ткани при экспериментальном остеопорозе и переломах на его фоне.
Изобретение относится к области медицины, предназначено для воздействия на микроциркуляцию в костной ткани при экспериментальном остеопорозе и переломах на его фоне.
Изобретение относится к области медицины и предназначено для воздействия на микроциркуляцию в костной ткани при экспериментальном остеопорозе и переломах на его фоне.

Изобретение относится к фармацевтической промышленности и представляет собой офтальмологический раствор, содержащий рибофлавин и витамин Е, для защиты внутренних структур глазного яблока от УФ-А-лучей или для лечения кератоконуса методом трансэпителиального кросс-линкинга.

Изобретение относится к фармацевтической промышленности и представляет собой сбалансированный инфузионный раствор, содержащий хлориды натрия, калия и магния, растворитель и натрий L-аргинина сукцинат формулы: , причем компоненты в растворе находятся в определенном соотношении в масс.%. Изобретение обеспечивает повышенную детоксицирующую активность, низкую токсичность и широкую область клинического применения. 11 табл., 6пр.

Изобретение относится к способу лечения млекопитающего с эндометриозом. Указанный способ включает импульсное или прерывистое пероральное введение в течение 3-5 последовательных суток с последующими 2-4 сутками перерыва или в течение 1-3 последовательных суток с последующими 1-2 сутками перерыва фармацевтической композиции, содержащей N-ацетил-L-цистеин, в течение периода времени по меньшей мере два месяца. N-ацетил-L-цистеин в указанном способе вводят в дозе, составляющей от 20 до 90 мгкгсутки. Заявленный способ обеспечивает более значительный эффект в отношении симптомов эндометриоза по сравнению с традиционным ежесуточным введением N-ацетил-L-цистеина. 10 з.п. ф-лы, 7 ил., 2 табл., 3 пр.

Наверх