Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом



Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом
Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом
Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом
Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом
Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом

 


Владельцы патента RU 2550027:

Общество с ограниченной ответственностью "Лаборатория медицинской биотехнологии" (ООО "ЛМБТ") (RU)

Изобретение относится к области биотехнологии и может быть использовано для рекомбинантного получения тканевого фактора человека (чТФ). Конструируют плазмиду pHYP-10ETFCS6 длиной 5912 п.о. с физической картой, представленной на Фиг. 2, для экспрессии в бактерии рода Escherichia предшественника мутеина [C245S] чТФ, содержащего отщепляемый N-концевой лидерный пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей указанный мутеин, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер. Способ получения предшественника мутеина [C245S] чТФ включает культивирование бактерии-продуцента в питательной среде, выделение телец включения, солюбилизацию белка-предшественника, металлохелатную хроматографию в денатурирующих условиях, рефолдинг и диафильтрацию раствора белка. Способ получения зрелого мутеина [C245S] чТФ, включает отделение N-концевого лидерного пептида от указанного предшественника мутеина с использованием энтерокиназы и выделение целевого белка. Изобретение позволяет повысить уровень биосинтеза и выход прокоагуляционно активного чТФ. 6 н. и 3 з.п.ф-лы, 5 ил., 1 табл., 7 пр.

 

Область техники

Изобретение относится к области биотехнологии, а именно к технологии получения биологически активных веществ (БАВ) методами генной инженерии, точнее к методам получения биологически активного рекомбинантного тканевого фактора человека.

Предшествующий уровень техники.

Тканевой фактор (ТФ) человека (синонимы: фактор свертывания крови III, тромбопластин, CD142, неактивная тканевая протромбиназа, апопротеин С-термостабильный липопротеид) - это трансмембранный белок, локализованный преимущественно в клетках субэндотелиальных тканей, обеспечивающий инициацию каскада свертывания крови за счет активации фактора VII.

Образование комплекса ТФ-фактор VII вызывает конформационные изменения последнего, приводящие к расщеплению связи Arg-152-Ile, сопровождающемуся превращением фVII в сериновую протеазу фVIIa. Возникающий активный комплекс (фVIIа-ТФ) путем сайт-специфического протеолиза конвертирует зимоген фактор Х в сериновую протеиназу фХа, которая, в свою очередь, конвертирует протромбин в тромбин. Показано, что комплекс ТФ-фVIIа способен активировать как фактор X, так и фактор IX, что в конечном итоге способствует генерации тромбина (Boyle, E.M., Verrier, E.D., et al., 1996).

По структуре ТФ - это гликопротеин, массой 47 кДа, состоящий из 263 аминокислот, и содержащий 5 остатков цистеина, образующих 2 внутримолекулярные дисульфидные связи. Внеклеточный домен (Ser-1-Glu-219, здесь и далее нумерация аминокислот для зрелого белка) и поверхность липидной мембраны участвует в образовании комплекса с фVII; 23-членный трансмембранный домен ТФ обеспечивает корректную ориентацию внеклеточного домена относительно мембраны; внутриклеточный домен ТФ обеспечивает «заякоривание» ТФ в мембране и передачу сигнала при функционировании ТФ в качестве трансмембранного рецептора. Функция трансмембранного рецептора не связана с функцией кофактора фVII, рекомбинантный ТФ без внутриклеточного домена проявляет прокоагуляционную активность.

Внеклеточный домен ТФ содержит 4 остатка цистеина, образующих две дисульфидные связи Cys49-Cys57 и Cys186- Cys-209 (Bach "Initiation of Coagulation by Tissue Factor", CRc Critical Rewiews in Biochemistry, 23(4):339-368 (1988)). Показано, что дисульфидная связь Cys186-Cys-209 является функционально значимой, именно ее участие необходимо для проявления кофакторных функций тканевого фактора по отношению к фактору VII и VIIa (Rehemtulla, et al., 1991).

Внеклеточный домен ТФ гликозилирован по трем остаткам аспарагина - Asn11, Asn124, Asn137 (Boys et al., 1993). Вариации в составе N-связанных олигосахаридов ТФ, влияют на суммарный заряд молекулы тканевого фактора, но не сказываются на его прокоагулянтной активности (Verstreeg, Ruf, 2006).

Внутриклеточный домен обеспечивает заякоривание в мембране за счет гидрофобного взаимодействия радикалов алифатических аминокислот и образования единственным остатком цистеина Cys245 этого домена тиоэфирной связи с липидами мембраны.

Тканевый фактор является основным компонентом «тромбопластинового реагента», использующегося для лабораторной диагностики патологий системы свертывания крови методом протромбинового теста (ПТ). ПТ - это один из наиболее распространенных методов лабораторной диагностики, выполняющийся как при скрининговых обследованиях, так и, например, для контроля антикоагулянтной терапии варфарином или гепарином. В ходе теста к исследуемому образцу плазмы крови, содержащему цитрат натрия, добавляют молярный избыток хлорида кальция и «тромбопластиновый реагент», представляющий собой липосомы определенного состава и заякоренный в них ТФ. Изменение времени свертывания плазмы относительно стандартного образца указывает на патологию системы гемостаза. Среднее время свертывания стандартных образцов плазмы (протромбиновое время, ПВ) и отношение времени свертывания исследуемой плазмы и стандартной (протромбиновое отношение, ПО) значительно варьирует в различных тест-системах и зависит, в первую очередь, от свойств тромбопластинового реагента. Для нормализации результатов используется показатель степени, в которую необходимо возвести найденную величину ПО - международный индекс чувствительности (МИЧ или ISI). Величина МИЧ в используемых наборах обычно варьирует в диапазоне от 1 до 2. При контроле антикоагулянтной терапии МИЧ используемого тромбопластинового реагента должен быть не выше 1,4.

Традиционным источником ТФ для получения тромбопластинового реагента является кадаверный мозг, плацента человека и мозг кроликов. Поскольку содержание ТФ в этих тканях очень невелико и состав природных липидов не оптимален, реагенты на основе природных вариантов ТФ имеют непостоянную чувствительность и требуют точного соблюдения технологии приготовления, а также чувствительны к вариациям в составе сырья. Кроме того, экстракты мозговых тканей могут содержать опасные вирусы и прионные возбудители, что увеличивает риск для лабораторного персонала. Использование рекомбинантного ТФ (и контролируемой смеси синтетических липидов) позволяет получать реагенты лучшего качества.

Ряд авторов использовал для получения рекомбинантного ТФ человека транзиентную трансфекцию культивируемой линии клеток человека А-293 плазмидной ДНК, кодирующей ТФ (US 5589363), либо получение штамма-продуцента E.coli, несущего плазмиду, кодирующую ТФ и лидерный пептид одного из белков Bordetella pertussis (US 6261803); либо получение штамма-продуцента Е. coli, несущего плазмиду, кодирующую лидерный пептид pel В, направляющий синтезируемый полипептид в периплазматическое пространство бактерии, слитый с ним в рамке короткий пептид, включающий эпитоп моноклонального антитела и сайт узнавания протеиназы фактор Ха, и слитый с ним в рамке внеклеточный домен ТФ (US 5298599).

Уровень продукции ТФ во всех указанных случаях не превышал 1% от тотального белка. Кроме того, существовала вероятность значительного протеолитического распада рекомбинантного ТФ в процессе культивирования, выделения и очистки.

Более совершенным способом экспрессии рекомбинантного ТФ является система, приведенная в (US 5858724). Для экспрессии рекомбинантного ТФ кролика, высокогомологичного ТФ человека, использовали вектор, содержащий ген тиоредоксина, слитого в рамке с геном ТФ, и специальный штамм Е. coli AD494[DE3]. Данная технология позволяет получать ТФ в растворимой форме в существенных количествах, однако требует специальных, точно подобранных условий ферментации, включающих принудительное охлаждение ферментера до температуры +16°С и непродолжительной индукции культуры на очень низкой плотности (1,5 О.Е.), что существенно ограничивает экономическую привлекательность такой системы экспрессии, а также требует проводить сложную многостадийную хроматографическую очистку. Кроме того, ТФ кролика и ТФ человека не полностью идентичны, что вносит определенные ограничения в область их применения.

Относительно удобная биотехнологическая система получения тканевого фактора основана на штамме-продуценте дрожжей Р. pastoris GS115/pHILS1- rRTF (US 6100072). Данная система экспрессии позволяет получать рекомбинантный ТФ с делецией внутриклеточного домена и добавлением небольшого дополнительного С-концевого пептида, включающего гексагистидиновый кластер. Применение такого варианта белка дает возможность проводить его очистку в одну стадию при помощи металлохелатной хроматографии. Недостатком этой системы экспрессии также является низкий уровень биосинтеза ТФ (не более 1-2% общего белка), что обусловлено необходимостью включения рекомбинантного ТФ в мембрану дрожжевой клетки в процессе биосинтеза белка.

Наиболее близким по технической сущности аналогом настоящего изобретения является плазмида p6E-tTF и штамм-продуцент BL21(DE3)/tTF (RU2426780). Данная система экспрессии позволяет получать делеционный вариант рекомбинантного ТФ, включающий внеклеточный и трансмембранный домены и имеющий отщепляемый N-концевой лидерный пептид, содержащий гексагистидиновый кластер. Применение такого варианта белка дает возможность проводить его очистку в одну стадию при помощи металлохелатной хроматографии в денатурирующих условиях. Среди недостатков этой системы экспрессии можно выделить: 1) невысокий уровень биосинтеза ТФ бактериальной клеткой (100 мг/л культуры - 10% суммарного клеточного белка), вызванный использованием природной кДНК, содержащую неоптимальную для бактерий частоту встречаемости кодонов; 2) недостаточную чистоту белка после очистки металлохелатной хроматографией, обусловленную недостаточной аффинностью одного 6-гистидинового кластера к сорбенту; 3) предположительно невысокий выход процедуры ренатурации, вызываемый высокой гидрофобностью C-концевого участка белка, представляющей собой трансмембранный домен. Кроме того, пригодность описанного в данном патенте варианта ТФ для получения тромбопластинового реагента не установлена.

Общим существенным недостатком описанных выше примеров является наличие непарного остатка цистеина в положении 245 тканевого фактора человека, который в природном белке образует тиоэфирную связь с липидами мембраны. При выделении тканевого фактора человека из природных источников данный остаток цистеина обычно маскирован связанными липидами, в то время как у рекомбинантных вариантов тканевого фактора человека он может находиться в восстановленном состоянии, что уменьшает стабильность белка и потенциально может приводить к дисульфидному обмену с другими остатками цистеина и образованию ковалентно связанных димеров ТФ, т.е. к значительному уменьшению выхода процедуры рефолдинга.

Краткое описание настоящего изобретения

Технической задачей, решаемой авторами, являлось создание технологии получения прокоагуляционно активного рекомбинантного тканевого фактора человека с заменой остатка непарного цистеина в положении 245 на остаток серина [C245S], неотделяемым дополнительным С-концевым пептидом, отделяемым дополнительным N-концевым пептидом; с более высоким уровнем биосинтеза, высоким выходом при очистке, пригодного для получения тромбопластинового реагента.

Технический результат достигался путем создания технологии, включающей в себя новую экспрессионную плазмидную ДНК pHYP-10ETFCS6, кодирующую оптимизированный для экспрессии в бактериальной системе синтетический ген тканевого фактора человека с заменой [C245S], создания штамма-продуцента E.coli на ее основе и технологии выделения рекомбинантного мутеина тканевого фактора человека, пригодного для создания тромбопластинового реагента.

В основе данного решения лежат разработанные авторами экспрессионная плазмида pHYP-10ETFCS6, длиной 5912 п.о., содержащая фрагмент ДНК, включающий последовательность, кодирующую синтетический отщепляемый лидерный пептид длиной 23 аминокислоты, содержащий декагистидиновый кластер и сайт расщепления энтерокиназой, слитый в рамке с последовательностью, кодирующей мутеин [C245S] тканевого фактора человека и содержащей на С-конце неотщепляемый пептид длиной 13 аминокислот, включающий гексагистидиновый кластер. Указанный фрагмент содержит оптимальный для E.coli состав кодонов, позволяющий увеличить уровень экспрессии гетерологичного белка за счет эффективной трансляции всех аминокислот полипептида. Наличие отщепляемого N-концевого и неотщепляемого С-концевого пептидов с полигистидиновыми кластерами позволяет более эффективно проводить очистку полипептида при помощи металлохелатной хроматографии, наличие внутриклеточного домена ТФ, дополнительно увеличенного за счет неотщепляемого С-концевого пептида, содержащего гидрофильные и заряженные аминокислотные остатки, позволяет эффективно проводить рефолдинг белка и его последующую липидизацию и не влияет на проявление прокоагулянтной активности, что приводит к значительному увеличению выхода целевого белка и удешевлению тромбопластинового реагента на его основе.

Мутация [C245S] позволяет ренатурировать тканевый фактор человека с более высоким выходом, так как отсутствие непарного цистеина снижет вероятность установления межмолекулярных дисульфидных связей, т.е. образования ковалентных мультимеров.

Целью настоящего изобретения является предоставление экспрессионной плазмиды, содержащей фрагмент ДНК, кодирующий предшественник мутеина [C245S] тканевого фактора человека, включающий последовательность, кодирующую дополнительный отщепляемый N-концевой пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей мутеин [C245S] тканевого фактора человека, а также слитый с ним в рамке неотщепляемый С-концевой пептид длиной 13 аминокислот, включающий гексагистидиновый кластер, под контролем промотора, функционирующего в бактериальной клетке.

Также целью настоящего изобретения является предоставление описанной выше экспрессионной плазмиды, где указанная плазмида представлена плазмидой pHYP-10ETFCS6.

Также целью настоящего изобретения является предоставление бактерии, принадлежащей к роду Escherichia, трансформированной описанной выше плазмидой, - продуцента предшественника рекомбинантного мутеина [C245S] тканевого фактора человека с неотщепляемым С-концевым пептидом и отщепляемым N-концевым лидерным пептидом.

Также целью настоящего изобретения является предоставление описанной выше бактерии, где указанная бактерия представлена штаммом E.coli BL21[DE3]/pHYP-10ETFCS6.

Также целью настоящего изобретения является предоставление предшественника рекомбинантного мутеина [C245S] тканевого фактора человека с неотщепляемым С-концевым пептидом, включающим гексагистидиновый кластер, содержащего отщепляемый N-концевой лидер, включающий декагистидиновый кластер, и последовательность узнавания энтерокиназы.

Также целью настоящего изобретения является предоставление способа получения рекомбинантного мутеина [C245S] рекомбинантного тканевого фактора человека с неотщепляемым С-концевым пептидом и отщепляемым N-концевым лидерным пептидом, включающего культивирование описанной выше бактерии в питательной среде, выделение телец включения, солюбилизацию белка-предшественника, металлохелатную хроматографию в денатурирующих условиях и рефолдинг белка-предшественника.

Также целью настоящего изобретения является предоставление описанного выше способа, в котором культивируют штамм E.coli BL21[DE3]/pHYP-10ETFCS6.

Также целью настоящего изобретения является предоставление способа получения тромбопластинового реагента на основе мутеина [C245S] рекомбинантного тканевого фактора человека, включающий смешивание ренатурированного мутеина [C245S] рекомбинантного тканевого фактора человека с липидами в присутствии детергента и последующее удаление детергента диализом.

Также целью настоящего изобретения является предоставление тромбопластинового реагента на основе мутеина [C245S] тканевого фактора человека, полученного описанным выше способом.

Подробное описание настоящего изобретения

Для реализации настоящего изобретения главной технической задачей явилось создание способа получения рекомбинантного мутеина [C245S] тканевого фактора человека с использованием бактерии, трансформированной экспрессионной плазмидой, содержащей фрагмент ДНК, кодирующий предшественник рекомбинантного мутеина [C245S] рекомбинантного тканевого фактора человека, включающий последовательность, кодирующую отщепляемый N-концевой дополнительный пептид длиной 19 аминокислот, включающий декагистидиновый кластер и последовательность узнавания энтерокиназы, и слитую с ним в рамке последовательность, кодирующую рекомбинантный мутеин [C245S] рекомбинантного тканевого фактора человека и неотщепляемый С-концевой пептид длиной 13 аминокислот, содержащий гексагистидиновый кластер, под контролем промотора, функционирующего в бактериальной клетке.

Термин «экспрессионная плазмида» означает плазмидную ДНК, содержащую все необходимые генетические элементы для экспрессии внедренного в него гена, например, такие как промотор, терминатор. Конкретным примером генетических элементов, необходимых для экспрессии предшественника рекомбинантного мутеина [C245S] тканевого фактора человека в составе экспрессионной кассеты согласно настоящему изобретению, является, но не ограничивается им, промотор РНК-полимеразы бактериофага Т7.

Фрагментом ДНК, кодирующим предшественник рекомбинантного мутеина [C245S] тканевого фактора человека, является, например, синтетический ген, кодирующий предшественник рекомбинантного мутеина [C245S] тканевого фактора человека, включающий последовательность, кодирующую отщепляемый N-концевой дополнительный пептид, включающий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитые в рамке с последовательностью, кодирующей рекомбинантный мутеин [C245S] тканевого фактора человека и неотщепляемый С-концевой гексагистидиновый кластер. Указанный фрагмент ДНК может быть получен, например, методом ПЦР (см. Пример 1, Фиг. 1). Также указанный фрагмент ДНК может быть получен с использованием технологии клонирования фирмы Sloning BioTechnology, описанной в заявке РСТ WO 2005071077.

Чтобы обеспечить эффективную трансляцию клонированного гена в E.coli, предпочтительно, чтобы в последовательности, кодирующей предшественник рекомбинантного мутеина [C245S] тканевого фактора человека, все редкие кодоны были заменены синонимичными часто встречающимися в активно транслируемых генах E.coli кодонами.

Последовательность ОРС гена, кодирующего предшественник мутеина [C245S] рекомбинантного тканевого фактора человека с неотделяемым С-концевым тагом - 10E-TF-CS6 согласно настоящему изобретению, представлена в Перечне последовательностей под номером SEQ ID NO: 1.

Аминокислотная последовательность предшественника мутеина [C245S] рекомбинантного тканевого фактора человека с неотделяемым С-концевым тагом - 10E-TF-CS6 согласно настоящему изобретению представлена в Перечне последовательностей под номером SEQ ID NO: 2.

Аминокислотная последовательность зрелого мутеина [C245S] рекомбинантного тканевого фактора человека с неотделяемым С-концевым тагом - TF-CS6 представляет собой последовательность под номером SEQ ID NO: 2 без 23 первых аминокислот.

Фрагменты ДНК, которые кодируют, по существу, тот же белок, могут быть получены, например, путем модификации нуклеотидной последовательности фрагмента ДНК (SEQ ID NO: 1), кодирующей предшественник рекомбинантного мутеина [C245S] тканевого фактора человека, например, посредством метода сайт-направленного мутагенеза, так, что один или несколько аминокислотных остатков в определенном сайте будут делетированы, заменены, вставлены или добавлены. Фрагменты ДНК, модифицированные, как описано выше, могут быть получены с помощью традиционных методов обработки с целью получения мутации. Фрагменты ДНК, которые кодируют, по существу, тот же белок, могут быть выявлены путем экспрессии фрагментов ДНК, имеющих мутацию, описанную выше, в соответствующей клетке и установления активности экспрессируемого продукта.

Тканевой фактор человека (синонимы: фактор свертывания крови III, тромбопластин, CD142, неактивная тканевая протромбиназа, апопротеин С-термостабильный липопротеид) - это трансмембранный белок, локализованный преимущественно в клетках субэндотелиальных тканей, обеспечивающий инициацию каскада свертывания крови за счет активации фактора VII. По структуре ТФ - это гликопротеин массой 47 кДа, состоящий из 263 аминокислот и содержащий 5 остатков цистеина, образующих 2 внутримолекулярные дисульфидные связи. В образовании комплекса с фVII участвует только внеклеточный домен (Ser-1-Glu-219) и поверхность липидной мембраны; 23-членный трансмембранный домен ТФ обеспечивает корректную ориентацию внеклеточного домена относительно мембраны; внутриклеточный домен ТФ обеспечивает «заякоривание» ТФ в мембране. Тканевый фактор является основным компонентом «тромбопластинового реагента», использующегося для лабораторной диагностики патологии системы свертывания крови методом протромбинового теста (ПТ). ПТ - это один из наиболее распространенных методов лабораторной диагностики, выполняющийся как при скрининговых обследованиях, так и, например, для контроля антикоагулянтной терапии варфарином или гепарином. В ходе теста к исследуемому образцу плазмы крови, содержащему цитрат натрия, добавляют молярный избыток хлорида кальция и «тромбопластиновый реагент», представляющий собой липосомы, содержащие ТФ. Изменение времени свертывания плазмы относительно стандартного образца указывает на патологию системы гемостаза. Среднее время свертывания стандартных образцов плазмы (протромбиновое время, ПВ) и отношение времени свертывания исследуемой плазмы и стандартной (протромбиновое отношение, ПО) значительно варьирует в различных тест-системах и зависит, в первую очередь, от свойств тромбопластинового реагента. Для нормализации результатов используется показатель степени, в которую необходимо возвести ПО - международный индекс чувствительности (МИЧ или ISI). Величина МИЧ в используемых наборах обычно варьирует в диапазоне от 1 до 2. При контроле антикоагулянтной терапии МИЧ используемого тромбопластинового реагента должен быть не выше 1,4. Основным показателем прокоагулянтной активности используемого для получения реагента варианта ТФ является время свертывания нормальной плазмы крови, при этом МИЧ реагента в большей степени определяется составом липидных мицелл. Таким образом, протромбиновое время для нормальной плазмы является основным показателем функциональной активности ТФ. Считается, что вариант белка обладает свойствами рекомбинантного тканевого фактора человека, пригодного для создания тромбопластинового реагента на его основе, при условии, что нормальное протромбиновое время для указанного варианта ТФ в составе белок-липидных мицелл составляет не более 25 с, предпочтительно не более 18 с.

Экспрессионная плазмида согласно настоящему изобретению содержит фрагмент ДНК, кодирующий предшественник рекомбинантного мутеина [C245S] тканевого фактора человека, включающий последовательность, кодирующую отщепляемый N-концевой дополнительный пептид длиной 23 аминокислоты, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, и слитую с ним в рамке последовательность, кодирующую мутеин [C245S] тканевого фактора человека и неотщепляемый С-концевой пептид длиной 13 аминокислот, содержащий гексагистидиновый кластер, под контролем промотора, функционирующего в бактериальной клетке.

В качестве рекомбинантной плазмиды согласно настоящему изобретению могут использоваться различные плазмиды, обладающие способностью к экспрессии в клетке-реципиенте, такие как плазмиды pBR322, pMW119, pUC19, pET22b, pET28b и подобные им, но список плазмид не ограничивается ими.

Конкретным вариантом реализации настоящего изобретения являются плазмида, которая состоит из:

1) фрагмента NheI -HindIII вектора pHYP длиной 5093 п.о., содержащего область начала репликации плазмиды pBR322, последовательность, кодирующую аминогликозид-3'-фосфотрансферазу, последовательность для сегрегационной стабилизации плазмиды, промотор РНК-полимеразы бактериофага Т7; участок терминации транскрипции; последовательность, кодирующую репрессор лактозного оперона; последовательности кодирующие N-концевой декагистидиновый кластер и С-концевой гексагистидиновый кластер;

2) фрагмента NheI-HindIII длиной 819 п.о., кодирующего мутеин [C245S] тканевого фактора человека и слитую в рамке последовательность узнавания энтерокиназой.

Указанная плазмида содержат уникальные сайты узнавания эндонуклеазами рестрикции: PsiI (5855), PciI (3542), BglII (1509), NcoI (1404), NheI (1363), PstI (1075), HindIII (544). Структура плазмиды pHYP-10ETFCS6 приведена на Фиг. 1.

При помощи созданной плазмиды можно трансформировать бактериальную клетку, предпочтительно бактерию, принадлежащую к роду Escherichia, восприимчивую к подобной трансформации указанной плазмидой. Выбор конкретной клетки не является критическим, поскольку методология и приемы трансформации хорошо известны специалисту в данной области техники. И хотя в зависимости от вида клетки и условий культивирования полученного трансформанта уровень экспрессии предшественника мутеина легкой цепи энтерокиназы человека может варьироваться, факт экспрессии целевого белка будет иметь место при условии успешной трансформации клетки-реципиента.

«Трансформация клетки плазмидой» означает введение плазмиды в клетку с помощью методов, хорошо известных специалисту в данной области техники. Трансформация этой плазмидой приводит к экспрессии гена, кодирующего белок согласно настоящему изобретению, и к синтезу белка в бактериальной клетке. Методы трансформации включают любые стандартные методы, известные специалисту в данной области техники, например метод, описанный в Jac A. Nickoloff, Electroporation Protocols for Microorganisms (Methods in Molecular Biology) //Humana Press; 1st edition (August 15, 1995).

Согласно настоящему изобретению, «бактериальная клетка - продуцент предшественника мутеина тканевого фактора человека» означает бактериальную клетку, обладающую способностью к продукции и накоплению предшественника мутеина тканевого фактора человека согласно настоящему изобретению, когда бактериальная клетка согласно настоящему изобретению выращивается в указанной питательной среде. Используемый здесь термин «бактериальная клетка - продуцент предшественника мутеина тканевого фактора человека» также означает клетку, которая способна накапливать продукт предшественника мутеина тканевого фактора человека в количестве не менее чем 10 мг/л, более предпочтительно не менее чем 100 мг/л. Указанный предшественник мутеина тканевого фактора человека накапливается в указанной клетке предпочтительно в виде телец включения.

Предпочтительно использование бактерии, принадлежащей к роду Escherichia, для трансформации рекомбинантной плазмидой, содержащей фрагмент ДНК, кодирующий предшественник мутеина тканевого фактора человека.

Термин «бактерия, принадлежащая к роду Escherichia» может означать, что бактерия относится к роду Escherichia в соответствии с классификацией, известной специалисту в области микробиологии. В качестве примера микроорганизма, принадлежащего к роду Escherichia, может быть упомянута бактерия Escherichia coli (E.coli).

Круг бактерий, принадлежащих к роду Escherichia, не ограничен каким-либо образом, однако, например, бактерии, описанные в книге Neidhardt, F.C. et al. (Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington D.C., 1208, Таблица 1), могут быть приведены в качестве примеров.

Конкретным примером штамма-реципиента для получения продуцента предшественника мутеина тканевого фактора человека согласно настоящему изобретению является, но не ограничиваются им, штамм Escherichia coli BL21[DE3].

Штамм Escherichia coli BL21[DE3] характеризуется следующими культурально-морфологическими, физиолого-биохимическими признаками и генетическими признаками.

Культурально-морфологические особенности штамма: грамотрицательные палочки, образуют нити; на агаризованной среде - беловатые крупные колонии с неровным краем. Активность штамма определяется методом денситометрии электрофореграммы. Штамм хранится в следующих условиях: среда Лурье-Бертрана, 1% глюкозы, 10% глицерина. Штамм размножается в следующих условиях - среда Лурье-Бертрана, 1% глюкозы, канамицина сульфат 30 мкг/мл.

Генетические особенности штамма. Генотип штамма - F- ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

Трансформация штамма Escherichia coli BL21[DE3] плазмидой pHYP-10ETFCS6 приводит к получению штамма-продуцента BL21[DE3]/pHYP-10ETFCS6, который обеспечивает синтез рекомбинантного белка-предшественника мутеина тканевого фактора человека в количестве 30-70% от суммарного содержания белка клеток.

Штамм Escherichia coli BL21[DE3]/pHYP-10ETFCS6 кодирует белок предшественник 10ETFCS6, состоящий из аминокислотной последовательности мутеина [C245S] рекомбинантного тканевого фактора человека, слитого в рамке N-концевого пептида длиной 23 аминокислоты, содержащего декагистидиновый кластер, сайт расщепления энтерокиназой, находящийся непосредственно перед первой аминокислотой мутеина тканевого фактора человека и неотщепляемого С-концевого пептида длиной 13 аминокислот, содержащего гексагистидиновый кластер.

Способ получения мутеина [C245S] тканевого фактора человека согласно настоящему изобретению включает культивирование описанной выше бактерии в питательной среде, подходящей для выращивания указанных прокариотических клеток, индукцию промотора гена предшественника мутеина [C245S] тканевого фактора человека, выделение телец включения, солюбилизацию белка-предшественника, металлохелатную хроматографию в денатурирующих условиях и рефолдинг целевого белка.

Способ получения тромбопластинового реагента состоит в смешивании ренатурированного белка с липидами в присутствии детергента и последующего удаления детергента диализом.

Особенности плазмиды и результаты ее практического применения приведены на следующих Фигурах.

Краткое описание Фигур:

На Фигуре 1 показана схема сборки синтетического гена мутеина [C245S] тканевого фактора человека из олигонуклеотидных праймеров и схема получения экспрессионных плазмид pHYP-10ETFCS6 и pHYP-MTFCS6. Используются следующие обозначения:; TF[C245S] - продукт полимеразной цепной реакции, кодирующий мутеин [[C245S] тканевого фактора человека; FLAG-TF[C245S] - продукт полимеразной цепной реакции, кодирующий мутеин тканевого фактора человека c N-концевым лидерным пептидом. Пунктирная линия обозначает полимеразную цепную реакцию, сплошная - рестрикцию и лигирование фрагментов ДНК. Курсивом указаны названия использованных эндонуклеаз рестрикции.

На Фигуре 2 показана карта экспрессионной плазмиды pHYP-10ETFCS6. Используются следующие обозначения: «pBR322ori» область начала репликации плазмиды pBR322; «KanR2» - последовательность, кодирующая аминогликозид-3'-фосфотрансферазу, обеспечивающую устойчивость бактерий к канамицину; «T7 prom» - промотор РНК-полимеразы бактериофага Т7; «T7term» - участок терминации транскрипции; «lacI»- последовательность, кодирующая репрессор лактозного оперона; HS - элемент для обеспечения сегрегационной стабильности плазмиды, «p10E-TFCS6 ORF» - открытая рамка считывания (ОРС) полипептида белка-предшественника мутеина [C245S] тканевого фактора человека c неотделяемым С-концевым пептидом, содержащим гексагистидиновый кластер 6 his, и отделяемый N-концевой дополнительный пептид «10E», содержащий декагистидиновый кластер. Стрелками указаны направления транскрипции генов, в скобках указаны номера первого и последнего нуклеотидов фрагментов. Курсивом выделены сайты узнавания эндонуклеаз рестрикции, в скобках указаны номера нуклеотидов в точках разрезания.

На Фигуре 3 показана карта экспрессионной плазмиды pHYP-MTFCS6. Используются обозначения аналогично Фигуре 2, а также: «MTF-CS6»- открытая рамка считывания (ОРС) метионил мутеина [C245S] тканевого фактора человека c неотделяемым С-концевым пептидом.

На Фигуре 4 показана электрофореграмма тотального белка для двух случайно отобранных колоний штамма-продуцента BL21[DE3]/pHYP-10ETFCS6 до и после индукции. Культивация во встряхиваемой колбе, среда 2xYT, индукция 1 мМ ИПТГ, 37oC, 14 часов. Дорожка 1 - тотальный белок колонии 1 до индукции, дорожка 2 - после индукции, дорожка 3 - тотальный белок колонии 2 до индукции, дорожка 4 - после индукции. Дорожка 5 -маркер молекулярных масс. Положение целевого белка указано стрелкой.

На Фигуре 5 приведена электрофореграмма фракций белка-предшественника 10ETFCS6 при очистке металлохелатной хроматографией в денатурирующих условиях и последующего рефолдинга. Восстанавливающие условия для всех дорожек, кроме “REF”. Обозначения: “IB” - солюбилизированные тельца включения; “FF” - фракция проскока, “50-500” - фракции элюций соответствующими концентрациями имидазола, в мМ; “REF” - белок 10ETFCS6 после рефолдинга; “М” - маркер молекулярных масс. Молекулярные массы полос маркера указаны в кДа. Положение целевого белка указано стрелкой.

Настоящее изобретение будет более подробно описано ниже со ссылкой на следующие не ограничивающие настоящее изобретение Примеры.

Пример 1. Получение плазмидной ДНК pAL-TF[C245S] и pAL-FLAG-TF[C245S]

Для аминокислотной последовательности мутеина [C245S] рекомбинантного тканевого фактора человека (SEQ ID NO: 3) была проведена обратная трансляция в последовательность нуклеотидов ДНК. При этом были использованы кодоны, оптимальные для экспрессии этого гена в E.coli класса В, а также была проведена оптимизация структуры гена по вторичной структуре мРНК, GC составу, обеспечено отсутствие нежелательных регуляторных элементов (например, отсутствие внутренних сайтов связывания рибосом), а также отсутствие протяженных повторов, палиндромов. Индекс CAI (Codon Adaptation Index), отражающий эффективность экспрессии гена в данном организме, для полученной последовательности составил 0,68, что является хорошим прогностическим показателем для промышленной пригодности полученного на его основе штамма-продуцента. Полученная нуклеотидная последовательность с добавленными рестриктными сайтами для последующего субклонирования приведена в Перечне последовательностей под номером SEQ ID NO:4.

Синтетический ген мутеина [C245S] рекомбинантного тканевого фактора человека собирали методом полимеразной цепной реакции (ПЦР) с праймерами AS-TF-F1 - AS-TF-F7 и AS-TF-R1 - AS-TF-R7 (SEQ ID NO:5-16) и AS-TF-F6short (SEQ ID NO:17), последовательности которых приведены в Таблице 1.

Таблица №1. Последовательности праймеров

SEQ ID NO Наименование олигонуклеотида Sequence(5'-3')
5 AS-TF-F6 TTACATGTCTGGCACCACTAACACTGTTGCAGCGTACAACCTGACCTGGAAATCCACCAACTTCAAAACGATCCTGGAGTGGG
6 AS-TF-F5 ACGATCCTGGAGTGGGAACCGAAACCGGTTAACCAGGTTTACACTGTCCAGATCAGCACCAAATCCGGCGATTGGAAATCCAAATGCTTC
7 AS-TF-F4 GATTGGAAATCCAAATGCTTCTACACGACTGATACTGAGTGCGACCTGACTGACGAAATCGTGAAAGACGTGAAACAGACCTACCTGGCT
8 AS-TF-F3 AACAGACCTACCTGGCTCGCGTCTTCTCTTATCCGGCAGGTAACGTGGAAAGCACTGGCTCTGCAGGTGAACCGCTGTATGAAAACTCTC
9 AS-TF-F2 CCGCTGTATGAAAACTCTCCGGAATTCACCCCATACCTGGAAACTAACCTGGGTCAGCCAACTATCCAGTCTTTCGAACAGGTAGGCACC
10 AS-TF-F1 TCGAACAGGTAGGCACCAAAGTGAACGTTACTGTAGAAGACGAACGTACCCTGGTTCGTCGCAACAACACTTTTCTGTCTCTCCGTGACG
11 AS-TF-R1 GTTTTGGCGGTTTTTTTGCCAGAAGAGCTGGATTTCCAGTAATACAGCGTATAGATCAGGTCTTTGCCAAAGACGTCACGGAGAGACAGA
12 AS-TF-R2 GAATCACAGCCTGAACGCTGAAACAGTAGTTCTCACCTTTGTCCACGTCGATCAGGAATTCGTTGGTGTTGGTTTTGGCGGTTTTTTTGC
13 AS-TF-R3 GGAACTCACCTTTCTCCTGACCCATACACTCTACCGGAGAATCAGTGCTTTTGCGGTTTACCGTGCGAGATGGAATCACAGCCTGAACGC
14 AS-TF-R4 GCTAATCGCCAGAATGATCACCAGAATGATAACTACGAACACGACAGCGCCGATAATGTAAAAGATTTCACGGAACTCACCTTTCTCCTG
15 AS-TF-R5 AGCTTGGAAACGTTCAGTGGGGAGTTCTCTTTCCAAGACTGACCAACACCCGCTTTACGAGATTTATGCAGGCTAATCGCCAGAATGATC
16 AS-TF-R6 TTAAGCTTGGAAACGTTCAGT
17 AS-TF-F6short TTACATGTCTGGCACCACTAACA

ПЦР проводили на приборе Терцик MC2 («ДНК-технология», Россия). Препаративные реакции проводили в объеме 50 мкл. Готовили инкубационную смесь следующего состава: 1х буфер для термостабильной ДНК-полимеразы; 10 пМ каждого праймерного олигонуклеотида; 2 мМ каждого дезоксирибонуклеотидтрифосфата; 2 ед. термостабильной ДНК-полимеразы. Поверх этой смеси наслаивали 50 мкл минерального масла и вели амплификацию по схеме: 1 цикл - денатурация - 94°С, 3 мин; 25 циклов - денатурация 94°С, 30 с, отжиг 62°С, 30 с, наращивание цепи 72°С, 120 с; 1 цикл - наращивание цепи 72°С, 10 мин. Продукты ПЦР выделяли из 1% агарозного геля, используя набор реактивов «Wizard SV Gel and PCR Clean-Up System» («Promega», США) по протоколу производителя, после чего лигировали в Т-вектор PAL-TA («Евроген», Россия) с использованием ДНК-лигазы фага Т4 и стандартного буферного раствора («Fermentas», Литва). Лигирование вели в объеме 10 мкл при молярном соотношении вектора и вставки 1:10, в течение 2-20 часов при комнатной температуре. Полученными лигазными смесями трансформировали клетки E.coli штамма DH5α, с генотипом F- φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ- thi-1 gyrA96 relA1. Для этого к 200 мкл замороженной суспензии клеток E.coli добавляли 5 мкл лигазной смеси, инкубировали на льду 20 минут для сорбции плазмидной ДНК, нагревали до 42°С в течение 45 секунд и инкубировали на льду в течение 5 минут. После чего добавляли 800 мкл питательного бульона SOB и инкубировали при 37°С в течение 60 минут. Затем переносили суспензию на чашку Петри с твердой агаризованной средой, содержащей ампициллин в концентрации 100 мкг/1 мл агара, и помещали в термостат на 18 часов при 37 С. Колонии E.coli, отобранные в результате бело-голубого скрининга, анализировали методом ПЦР с клонов с праймеров T7prom (SEQ ID NO:18) и SP6 (SEQ ID NO:19). Отобранные клоны наращивали в 5 мл питательного бульона 2xYT-Amp и проводили выделение плазмидной ДНК набором реактивов «Wizard Plus SV Minipreps» («Promega», США) по протоколу производителя, первичную нуклеотидную последовательность подтверждали методом ПЦР-секвенирования с использованием праймеров T7prom (SEQ ID NO:18) и SP6 (SEQ ID NO:19).

Для получения плазмиды pAL-FLAG-TF[C245S], проводили ПЦР с праймеров AS-TF-R6 (SEQ ID NO: 16) и AS-TF-F6NheTag (SEQ ID NO: 20), используя в качестве матрицы плазмиду pAL-TF[C245S], с образованием ПЦР-продукта, содержащего область, кодирующую N-концевой таг и рестриктные сайты для последующего субклонирования. Последовательность полученного ПЦР продукта соответствует SEQ ID NO: 4, где первые 7 нуклеотидов заменены на последовательность SEQ ID NO:21.

ПЦР, клонирование в вектор PAL-TA и анализ клонов вели как описано выше.

Пример 2. Получение экспрессионных плазмид pHYP-MTFCS6 и pHYP-10ETFCS6

Для получения pHYP-MTFCS6 донорную плазмиду pAL-TF[C245S] рестрицировали эндонуклеазами PciI и HindIII. Для получения pHYP-10ETFCS6 донорную плазмиду pAL-FLAG-TF[C245S] рестрицировали эндонуклеазами NheI и HindIII. Продукты реакции разделяли в 1% агарозном геле и выделяли с помощью набора реактивов Wizard SV Gel&PCR Clean-Up System по методике производителя донорный фрагмент для получения экспрессионной плазмиды.

Реципиентную плазмиду pHYP (заявка p0, рис. 2) расщепляли последовательно каждой из эндонуклеаз NcoI и HindIII - для получения pHYP-MTFCS6, или NheI и HindIII - для получения pHYP-10ETFCS6. Сначала аликвоты плазмиды инкубировали 2 часа при 37°С с каждой из рестриктаз, контролировали электрофорезом в агарозном геле полную линеаризацию плазмид, затем добавляли вторую рестриктазу и инкубировали в течение еще 2 часов. Затем пробы объединяли, ферменты инактивировали прогреванием при 65°С в течение 20 минут и проводили дефосфорилирование щелочной фосфатазой («Fermentas», Литва) по протоколу производителя. Щелочную фосфатазу инактивировали прогреванием до 85°С в течение 20 минут. Рестрицированную и дефосфорилированную плазмиду переосаждали 3 объемами этанола, центрифугировали 10 минут на скорости 13200 об/мин при комнатной температуре, промывали осадок 70% спиртом, растворяли в воде и использовали для постановки реакции лигирования в рабочей концентрации 10-2 мкг/мкл. Реакцию лигирования очищенных донорных фрагментов и реципиентной плазмиды и трансформацию лигатами клеток E.coli штамма DH5α вели как описано в примере 1. Колонии E.coli анализировали методом ПЦР с клонов с праймеров T7prom (SEQ ID NO:18) и T7t (SEQ ID NO:22). Отобранные клоны наращивали в 5 мл питательного бульона 2хYT-Kan, проводили выделение плазмидной ДНК с набором «Wizard Plus SV Minipreps». Нуклеотидную последовательность верифицировали при помощи ПЦР-секвенирования с праймеров T7prom (SEQ ID NO:18) и T7t (SEQ ID NO:22).

В результате секвенирования установили, что в полученных препаратах плазмид pHYP-MTFCS6 и pHYP-10ETFCS6 не содержатся мутации в области вставки, то есть кодируется корректная последовательность гена. Карты конструкций приведены на фиг.2 и фиг.3 соответственно.

Пример 3. Получение штамма-продуцента E.coli BL21[DE3]/pHYP-10ETFCS6, оценка продуктивности штамма-продуцента и локализация целевого белка.

Для получения штамма-продуцента мутеина [C245S] тканевого фактора человека, конструкцию, полученную по примеру 2, использовали для трансформации компетентных клеток Escherichia coli BL21(DE3) (с генотипом F- ompT hsdSB (r-m-) gal dcm (DE3)) и проводили отбор клонов, сохраняющих уровень биосинтеза рекомбинантного полипептида после индукции не ниже 30% от суммарного клеточного белка в течение, по крайней мере, четырех последовательных пассажей. Для получения штамма E.coli BL21[DE3]/pHYP-10ETFCS6 - продуцента белка-предшественника мутеина [C245S] тканевого фактора человека клетки штамма E.coli BL21[DE3] трансформировали экспрессионной плазмидой pHYP-10ETFCS6. Трансформанты E.coli BL21[DE3] высевали на агаризованную среду 2хYT с добавлением канамицина до 30 мкг/мл и глюкозы до 2%, проводили индукцию экспрессии целевого гена для пяти случайно выбранных колоний трансформантов с типичным фенотипом колоний. Клоны подращивали в питательном бульоне с добавлением канамицина до 30 мкг/мл и раствора глюкозы до 2% в течение 6-7 часов, инокулировали новую порцию питательной среды в соотношении 1:100, растили культуру до достижения оптической плотности 2 O.E., индуцировали изопропилтио-β-D-галактозидом (ИПТГ) и культивировали в течение еще 16 ч. После окончания культивации осадок клеток отделяли центрифугированием, ресуспендировали клетки в растворе 10 мМ Трис-HCl, 2 мМ ЭДТА-Na, 0.1% Тритона-Х100, 10 мкг/мл лизоцима в соотношении 10 мл раствора на 1 г клеточной пасты, выдерживали суспензию в течение 30 мин на льду и проводили разрушение клеток ультразвуковым диспергатором до исчезновения видимой вязкости суспензии. Отбирали образцы для электрофоретического анализа, разделяли в них растворимую и нерастворимую фракцию белков центрифугированием в микроцентрифуге, дополнительно ресуспендировали осадок в том же растворе и осаждали центрифугированием. Результаты электрофоретического анализа тотального белка для двух колоний штамма BL21[DE3]/pHYP-10ETFCS6 приведены на фиг.4.

Электрофоретическая подвижность целевого белка соответствует расчетному значению. По данным гель-электрофореза белковых фракций (данные не приводятся) целевой белок практически полностью локализован в нерастворимой фракции белков, т.е. находится в форме «телец включения».

Пример 4. Выделение и очистка денатурированного рекомбинантного мутеина [C245S] тканевого фактора человека.

Штамм-продуцент BL21[DE3]/pHYP-10ETFCS6 высевали из музея петлей истощающим штрихом на чашку Петри с агаризованной средой LB, содержащей 30 мкг/мл канамицина и 1% глюкозы, растили 14 часов при 37°С. Одну отдельную колонию штамма переносили в 5 мл жидкой среды LB, содержащей 30 мкг/мл канамицина и 1% глюкозы, и растили на качалке в течение 14 часов при 37°С. Содержимым инокулировали 250 мл среды 2xYT, содержащей 30 мкг/мл канамицина и 0,1% глюкозы, растили на качалке в течение 3,5 часов при 37°С, отбирали образцы бактериальной суспензии для анализа, добавляли ИПТГ до конечной концентрации 1 мМ и растили в течение еще 3-15 ч.

Осадок клеток отделяли центрифугированием, ресуспендировали в 20 мл раствора А (50 мМ Трис-HCl pH=7,4, 2 мМ ЭДТА), добавляли лизоцим до 0,1 мг/мл и Тритон X100 до 0,1%, инкубировали в течение 30 мин на льду. Проводили разрушение клеток и геномной ДНК при помощи ультразвукового диспергатора пульсами по 10 с до исчезновения повышенной вязкости суспензии. Отделяли осадок центрифугированием в течение 10 мин при 20000 об/мин. Осадок ресуспендировали в растворе A, добавляли детергент NP-40 до 1%, отделяли осадок центрифугированием, как указано выше. Осадок ресуспендировали в растворе A, добавляли NaCl до 500 мМ, отделяли осадок. Осадок очищенных телец включения ресуспендировали в растворе 50 мМ Трис-HCl pH=7,4 и отделяли осадок центрифугированием в течение 10 мин при 20000 об/мин. Полученный препарат обогащенных телец включения хранили при -70°C.

Для проведения солюбилизации целевого белка к осадку телец включения добавляли раствор Б (8 М мочевины, 50 мМ Трис-HCl, 50 мМ бета-меркаптоэтанола, pH=9,5) в соотношении 10 мл раствора на 1 г осадка. Суспензию инкубировали при перемешивании 2 часа при +37°C, отделяли не растворившийся клеточный дебрис центрифугированием 10 мин при 20000 об/мин. Супернатант разбавляли в 5 раз раствором В (8 М мочевины, 50 мМ фосфата натрия, 500 мМ хлорида натрия, pH=8,0) для уменьшения конечной концентрации бета-меркаптоэтанола, отделяли выпавший осадок центрифугированием в течение 10 мин при 20000 об/мин и наносили супернатант на колонку с сорбентом Chelating Sepharose Fast Flow («GE Healthcare»,США), содержащим хелатированные ионы никеля и уравновешенным раствором B. Последовательно промывали колонку раствором Г (8 М мочевины, 50 мМ фосфата натрия, 500 мМ хлорида натрия, pH 7.0) и раствором Д (8 М мочевины, 50 мМ фосфата натрия, 500 мМ хлорида натрия, 50 мМ имидазола pH=7,0) до стабилизации базовой линии. Элюировали очищенный белок растворами с концентрацией имидазола 100, 200 и 500 мМ. Элюат, содержащий очищенный белок-предшественник 10ETFCS6, концентрировали ультрафильтрацией до конечной концентрации общего белка 20 мг/мл и обессоливали, полученный раствор хранили в замороженном виде. Полипептид был очищен в денатурирующих условиях до доли видимых примесей менее 5% по денситометрии электрофореграммы (фиг.5).

Пример 5. Ренатурация рекомбинантного мутеина [C245S] тканевого фактора человека.

Для рефолдинга к размороженному раствору денатурированного 10ETFCS6 добавляли ДТТ до концентрации 10 мМ и инкубировали при 37°С в течение 2 часов. Затем белок разбавляли буферным раствором для рефолдинга (50 мМ ТРИС, рН=8,8, 2 мМ ЭДТА, 2 мМ восстановленного глутатиона, 0,2 мМ окисленного глутатиона; 2 М мочевины, 10 мМ октилглюкозида) в соотношении 1:40 и инкубировали при комнатной температуре в течение 12-16 ч. Отделяли осадок центрифугированием и использовали полученный раствор для липидизации тканевого фактора.

Пример 6. Получение тромбопластинового реагента на основе рекомбинантного мутеина [C245S] тканевого фактора человека.

Смешивание раствора ренатурированного белка 10ETF6 с липидами проводили в растворе HBS, содержащем 10 мМ HEPES pH=7,0, 140 мМ NaCl, 0.1% NaN3. Навеску твердой смеси фосфатидилсерина и фосфатидилхолина состава 70:30 М:М (Avanti Polar Lipids, США) растворяли в HBS, дополнительно содержащего 20 мМ октилглюкозида, конечная суммарная концентрация липидов 80 г/л. Смешивали раствор белка 10ETFCS6, раствор липидов и раствор HBS с добавлением октилглюкозида до 10 мМ до конечной концентрации мономера 10ETFCS6 20 мкг/мл, липидов - 0,8 г/л. Полученную смесь инкубировали 2 ч при температуре 37°С при помешивании, после чего проводили удаление детергента диализом против раствора HBS в течение 48 ч со сменой диализующего раствора каждые 12 ч.

Полученная эмульсия липосом, содержащих рекомбинантный тканевой фактор, была использована в качестве тромбопластинового реагента при определении “протромбинового времени” (ПВ). Основным показателем функциональной активности тканевого фактора является время свертывания нормализованной цитратной плазмы крови при добавлении к ней тромбопластинового реагента и ионов кальция. Для полученного препарата липидизированного белка 10ETFCS6 время свертывания составило 13,4 с, время свертывания плазмы с контрольным тромбопластиновым реагентом на основе природного тканевого фактора - 16,9 с, время свертывания плазмы с контрольным реагентом, содержащим только липосомы, - более 200°с. Измерения проводили при помощи полуавтоматического коагулометра ThromboScreen 400c (Pacific Hemostasis, США) и реагентов производства НПО “Ренам” (Россия). Полученный ренатурированный белок 10ETFCS6 пригоден для изготовления тромбопластинового реагента.

Пример 7. Сравнение прокоагулянтной активности тромбопластинового реагента, полученного на основе рекомбинантного мутеина [C245S] тканевого фактора человека с процессированным и непроцессированным N-концевым лидерным пептидом и N-концевым остатком метионина.

Полученный по примерам 4-5 очищенный и ренатурированный белок-предшественник мутеина [C245S] тканевого фактора человека 10ETFCS6 концентрировали до 2 мг/мл ультрафильтрацией, вносили CaCl2 до 5 мМ, добавляли энтерокиназу (“Sigma”, США) в молярном соотношении 1:1000 и вели отщепление N-концевого пептида в течение 16 ч при комнатной температуре. Прохождение реакции контролировали при помощи ДСН-ПААГ, степень расщепления составила более 90%. Блокировали активность энтерокиназы добавлением ЭДТА-Na до 10 мМ, отделяли свободный пептид 10E ультрафильтрацией на мембране с порами 10 кДа. Полученный таким образом препарат зрелого белка TFCS6, содержащего внеклеточный домен тканевого фактора без дополнительных аминокислот, использовали для получения тромбопластинового реагента, как указано в Примере 6.

Для получения штамма E.coli BL21[DE3]/pHYP-MTFCS6 - продуцента белка-предшественника мутеина [C245S] тканевого фактора человека c N-концевым остатком метионина клетки штамма E.coli BL21[DE3] трансформировали экспрессионной плазмидой pHYP-MTFCS6 аналогично примеру 3. Последовательность ОРС гена, кодирующего метионил-мутеин [C245S] рекомбинантного тканевого фактора человека с неотделяемым С-концевым пептидом - MTFCS6, представляет собой последовательность под номером SEQ ID NO: 1, в которой отсутствуют нуклеотиды 4-69. Аминокислотная последовательность метионил-мутеина [C245S] рекомбинантного тканевого фактора человека с неотделяемым С-концевым тагом MTFCS6 представляет собой последовательность под номером SEQ ID NO: 2, в которой отсутствуют аминокислоты 2-23. Выделение и ренатурацию белка MTFCS6 проводили, как указано в примерах 4 и 5.

Полученные препараты белков TFCS6 и MTFCS6 липидизировали, как указано в Примере 6, и измеряли “протромбиновое время” для полученных вариантов тромбопластинового реагента. Было установлено, что протромбиновое время для нормализованной плазмы не имеет значимых отличий для всех трех вариантов тромбопластинового реагента и составляет 13-14 с.

Приведенные результаты показали, что использование для кодирования ОРС оптимальных для E.coli кодонов позволяет увеличить уровень экспрессии гетерологичного белка за счет эффективной трансляции всех аминокислот полипептида. Наличие отщепляемого N-концевого и неотщепляемого С-концевого пептидов с полигистидиновыми кластерами позволяет эффективно проводить хроматографическую очистку экспрессируемого белка в денатурирующих условиях методом металлохелатной хроматографии. Наличие мутации [C245S] позволяет проводить процедуру рефолдинга для очищенного белка-предшественника с высоким выходом. Такой порядок стадий позволяет получать полностью очищенный и ренатурированный продукт при помощи одной хроматографической стадии очистки. Наличие удлиненного за счет неотщепляемого С-концевого пептида внутриклеточного домена помимо металлохелатной очистки позволяет проводить рефолдинг целевого белка с высоким выходом. N-концевой пептид может быть отделен при обработке энтерокиназой (“Sigma”, США), при этом специфическая прокоагулянтная активность липидизированного белка не изменяется. Сочетание этих преимуществ позволяет удешевить тромбопластиновый реагент на основе белка 10ETFCS6 за счет уменьшения затрат на получение раствора ренатурированного рекомбинантного тканевого фактора.

Преимущества предлагаемого штамма E.coli BL21[DE3] заключаются в использовании бактерий с фенотипом Lon OmpT, что исключает возможность протеолитического расщепления синтезируемого de novo мутеина тканевого фактора человека и контаминации выделяемого белка наиболее активными протеазами E.coli. Встроенный в геном штамма-реципиента ген РНК полимеразы бактериофага Т7 под контролем lacUV5 промотора при использовании T7-lac промотора и Т7 терминатора в плазмидах приводит к быстрой и эффективной продукции белка. Еще одним общим преимуществом использованного штамма, экспрессионного вектора и стратегии биосинтеза является возможность проводить индукцию без изменения температуры культивирования. Еще одним преимуществом является возможность получения мутеина тканевого фактора человека, не содержащего загрязнений белками-партнерами, без дополнительной хроматографической очистки.

Хотя указанное изобретение описано в деталях со ссылкой на Примеры, для специалиста в указанной области техники очевидно, что могут быть совершены различные изменения и произведены эквивалентные замены, и такие изменения и замены не выходят за рамки настоящего изобретения.

1. Плазмида pHYP-10ETFCS6 длиной 5912 п.о. с физической картой, представленной на Фиг. 2, для экспрессии в бактерии, принадлежащей к роду Escherichia, предшественника мутеина [C245S] тканевого фактора человека, содержащего отщепляемый N-концевой лидерный пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей указанный мутеин, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер, по существу, в следующей последовательности состоящая из:
- участка инициации репликации pBR322 ori;
- гена репрессора лактозного оперона;
- промотора РНК-полимеразы бактериофага Т7;
- области, представленной в Перечне последовательностей под номером SEQ ID NO: 1, кодирующей N-концевой лидерный пептид, характеризующийся декагистидиновым кластером и последовательностью узнавания энтерокиназы, слитой в рамке с последовательностью с оптимизированными для экспрессии в указанной бактерии кодонами, кодирующей мутеин [C245S] тканевого фактора человека, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, характеризующийся гексагистидиновым кластером;
- участка терминации транскрипции бактериофага Т7;
- фрагмента, обеспечивающего сегрегационную стабильность плазмиды; и
- гена устойчивости к канамицину.

2. Плазмида по п. 1, отличающаяся тем, что предшественником мутеина [C245S] тканевого фактора человека является белок, последовательность которого приведена в Перечне последовательностей под номером SEQ ID NO: 2.

3. Бактерия, принадлежащая к роду Escherichia, трансформированная плазмидой по п. 1, - продуцент предшественника мутеина [C245S] тканевого фактора человека, последовательность которого приведена в Перечне последовательностей под номером SEQ ID NO: 2, содержащего отщепляемый N-концевой лидерный пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей указанный мутеин, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер.

4. Бактерия по п. 3, отличающаяся тем, что указанной бактерией является бактерия Е. coli BL21[DE3]/pHYP-10ETFCS6.

5. Способ получения рекомбинантного предшественника мутеина [C245S] тканевого фактора человека, последовательность которого приведена в Перечне последовательностей под номером SEQ ID NO: 2, содержащего отщепляемый N-концевой лидерный пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей указанный мутеин, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер, включающий культивирование бактерии по п. 3 в питательной среде, выделение телец включения, солюбилизацию белка-предшественника, металлохелатную хроматографию в денатурирующих условиях, рефолдинг и диафильтрацию раствора белка.

6. Способ по п. 5, отличающийся тем, что культивируют бактерию Е. coli BL21 [DE3]/pHYP-10ETFCS6.

7. Предшественник мутеина [C245S] тканевого фактора человека, последовательность которого приведена в Перечне последовательностей под номером SEQ ID NO: 2, содержащий отщепляемый N-концевой лидерный пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей указанный мутеин, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер, полученный способом по п. 5.

8. Способ получения зрелого мутеина [C245S] тканевого фактора человека, последовательность которого приведена в Перечне последовательностей под номером SEQ ID NO: 2 без первых 23 аминокислот, содержащего неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер, включающий отделение N-концевого лидерного пептида от предшественника указанного мутеина по п. 7 с использованием энтерокиназы и выделение целевого зрелого мутеина [C245S] тканевого фактора человека.

9. Зрелый мутеин [C245S] тканевого фактора человека, последовательность которого приведена в Перечне последовательностей под номером SEQ ID NO: 2 без первых 23 аминокислот, содержащий неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер, полученный способом по п. 8.



 

Похожие патенты:

Изобретение относится к области биотехнологии. Предложен способ получения рекомбинантного белка интерфероноподобного фактора III типа (ИПФ III) штамма-продуцента E.
Изобретение относится к медицине, а именно к медицинской микробиологии, и может быть использовано для культивирования дифтерийных микробов в искусственных питательных средах при бактериологической диагностике дифтерии.
Изобретение относится к биотехнологии и микробиологии. Предложен штамм микромицета Aspergillus foetidus 379-К-5-1 - продуцент комплекса пектиназ, β-глюканазы, ксиланазы, целлюлазы, хитиназы, маннаназы и протеазы для деструкции полисахаридов растительного и микробного сырья.

Группа изобретений относится к штамму Lactobacillus rhamnosus CNCM I-3690 и к молочному пищевому продукту, содержащему указанный штамм. Предложенный штамм обладает специфичными в отношении маннозы адгезионными свойствами.

Изобретения относятся к области биотехнологии. Предложены композиция и способ для контроля численности моллюсков классов Gastropoda и Bivalvia.
Группа изобретений относится к области биотехнологии. Предложены штаммы Cryptococcus flavescens 3C NRRL Y-50378 и Cryptococcus flavescens 4С NRRL Y-50379 для подавления и контроля фузариоза злаков, обладающие устойчивостью к протиоконазолу.
Изобретение относится к молочной промышленности, а именно к способу приготовления кисломолочного продукта. Для получения кисломолочного продукта обезжиренное коровье молоко после пастеризации и охлаждения заквашивают путем добавления суспензии, взятых в равных соотношениях штаммов бактерий Bacillus subtilis ТНП-3-ДЕП и Bacillus subtilis ТНП-5-ДЕП в 1%-ном растворе хлористого натрия в концентрации 5 млрд КОЕ/мл, сквашивают при температуре 38-42°C в течение 6-8 часов до кислотности 100-120°T, вымешивают в течение 30 мин, разливают и направляют на созревание.

Группа изобретений относится к биотехнологии. Предложены способ получения лизогликолипида, способ биоконверсии гликолипидов и способ получения пищевого продукта.
Изобретение относится к области биотехнологии и медицины и касается фармацевтической композиции. Представленная композиция содержит рекомбинантный лизоцим бактериофага FMV Р.

Изобретение относится к микробиологии и может быть использовано для количественной оценки способности микроорганизмов к биопленкообразованию на различных биотических и абиотических поверхностях.

Группа изобретений относится к вариантам способа микробиологического синтеза гибридного белка E7-HSP70. Синтез белка E7(6)-HSP70, E7(11)-HSP70, E7(16)-HSP70 или E7(18)-HSP70 осуществляют путем культивирования соответственно штамма дрожжей Saccharomyces cerevisiae ВКПМ Y-3919, штамма дрожжей Saccharomyces cerevisiae ВКПМ Y-3853, штамма дрожжей Saccharomyces cerevisiae ВКПМ Y-4057 или штамма дрожжей Saccharomyces cerevisiae ВКПМ Y-4058 в подходящих условиях на среде, содержащей в качестве источника углерода сахарозу.

Настоящее изобретение относится к области биотехнологии и может быть использовано для получения рекомбинантных белков с Gla-доменом в клетках китайского хомячка. Сконструирована плазмида для экспрессии в клетке китайского хомячка, в следующей последовательности, по существу, содержащая следующие элементы: область начала репликации плазмиды pUC; открытая рамка считывания бета-лактамазы, обеспечивающей устойчивость к ампициллину; прокариотический промотор гена bla; участок терминального повтора вируса Эпштейна-Барр человека; функциональный промотор гена фактора элонгации 1 альфа китайского хомячка, 5' нетранслируемая область этого гена и нетранскрибируемая область, фланкирующая этот ген; область, кодирующая последовательность Козак для кэп-зависимой инициации трансляции; ОРС гена субъединицы 1 комплекса 2,3-эпоксиредуктазы витамина К (VKORC1) китайского хомячка со стоп-кодоном; функциональный терминатор и сигнал полиаденилирования гена фактора элонгации 1 альфа китайского хомячка, 3' нетранслируемая область этого гена и нетранскрибируемая область, фланкирующая этот ген; промотор ранних генов вируса SV40; ген устойчивости к селекционному агенту; и сигнал полиаденилирования и терминатор вируса SV40.

Изобретение относится к области биотехнологии, конкретно к новым аналогам инсулина, и может быть использовано в медицине. Указанный аналог инсулина характеризуется одной из следующих структур: Arg(A0), His(A8), Gly(A21), Arg(В31), Arg(В32)-NH2-инсулин; His(A8), Gly(A21), Arg(В31), Arg(В32)-NH2-инсулин; Arg(А0), Glu(A15), His(A8), Gly(A21), Arg(В31), Arg(В32)-NH2-инсулин.

Изобретение относится к области биотехнологии, конкретно к лейколектинам, и может быть использовано в медицине. Получен полипептид лейколектин, характеризующийся SEQ ID NO:1-8.

Изобретение относится к области биотехнологии, конкретно к модифицированному фактору Виллебранда (VWF), и может быть использовано в медицине. Рекомбинантным путем получают модифицированный VWF, слитый в С-концевой части своего первичного продукта трансляции с N-концевой частью альбумина посредством линкера SSGGSGGSGGSGGSGGSGGSGGSGGSGGSGS.

Группа изобретений относится к области биохимии. Предложен L-фукоза α1→6-специфичный лектин, экстрагируемый из базидиального гриба или сумчатого гриба, характеризующийся пиковым значением молекулярной массы около 4500 m/z, определяемым при масс-спектрометрическом анализе MALDI-TOF.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложены варианты нуклеиновых кислот, каждый из которых кодирует аминокислотную последовательность тяжелой цепи иммуноглобулина IgG1.

Изобретение относится к области биотехнологии и касается применения штамма дрожжей Komagataella pastoris ВКПМ Y-727. Охарактеризовано применение штамма дрожжей Komagataella pastoris ВКПМ Y-727 в качестве реципиента для конструирования продуцентов целевого белка, необязательно включающее введение в него мутаций, обеспечивающих использование ауксотрофных селективных маркеров.

Изобретение относится к области биотехнологии, конкретно к рекомбинантной продукции белков человека, и может быть использовано для получения гибридного рекомбинантного эритропоэтина человека.

Изобретение относится к области биотехнологии, конкретно к мутеинам липокалина слезной жидкости человека, и может быть использовано в медицине. Мутеин липокалина слезной жидкости человека (hTLc) имеет обнаруживаемую аффинность связывания с рецепторной тирозинкиназой Met (c-Met) человека, или ее доменом, или фрагментом c-Met человека.

Представленные изобретения касаются выделенного полинуклеотида, кодирующего полипептид, вовлеченный в биосинтез пирипиропена А, вектора и клетки-хозяина, включающих такой полипептид, и способов получения предшественников пирипиропена А, включающих культивирование клетки-хозяина.
Наверх