Новые il-17-связывающие соединения и их медицинское применение



Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение
Новые il-17-связывающие соединения и их медицинское применение

 


Владельцы патента RU 2550272:

КОВАГЕН АГ (CH)

Изобретение относится к биотехнологии, а именно к новым IL-17-ингибирующим полипептидам, соответствующим слитым белкам, к композициям и применению их в медицинских целях. Полипептид содержит аминокислотную последовательность, которую выбирают из группы, состоящей из GVTLFVALYD YKAFWPGDLS FHKGEKFQIL RTSDGDWWEA RSLTTGETGY IPSNYVAPVD SIQ (SEQ ID NO: 39), GVTLFVALYD YKAFWPGDIS FHKGEKFQIL RTSDGEWWVA RSLTTGEEGY IPSNYVAPVD SIQ (SEQ ID NO:57) или GVTLFVALYD YKAFWPGDIS FHKGEKFQIL RTSDGEWWIA RSLTTGEEGY IPSNYVAPVD SIQ (SEQ ID NO: 107); аминокислотной последовательности, имеющей, по меньшей мере, 80%, предпочтительно, по меньшей мере, 90%, более предпочтительно, по меньшей мере, 95% идентичность аминокислотной последовательности с SEQ ID NO: 39, SEQ ID NO:57 или SEQ ID NO: 107; фрагмента или функционального производного SEQ ID NO: 39, SEQ ID NO:57 или SEQ ID NO: 107, получаемого за счет замещения, добавления и/или удаления не более чем 5 аминокислот. Предложенное изобретение позволяет с высокой специфичностью и аффинностью связывать IL-17. 12 н. и 21 з.п. ф-лы, 17 ил., 3 табл., 12 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к новым IL-17-ингибирующим полипептидам, соответствующим слитым белкам, к композициям и их медицинскому применению.

Предпосылки создания изобретения

CD4+ Т-клетки играют центральную роль в организации иммунных ответов, помогая другим клеткам адаптивной или врожденной иммунной системы. В ранних исследованиях были идентифицированы два класса CD4+ Т-клеток (Th1 и Th2). В последнее время, была идентифицирована новая субпопуляция CD4+ Т-клеток - линия Th17. По-видимому, Th17-клетки возникли как ответвление адаптивной иммунной системы, специализировавшись на усилении защиты хозяина от внеклеточных бактерий, а также некоторых грибов и микробов, против которых нет хорошей защиты со стороны Th1 или Th2-иммунитета.

Th17-клетки были идентифицированы в контексте открытия нового семейства цитокинов, семейства IL-17, которое, как известно в настоящее время, содержит шесть членов (IL-17A-F). IL-17 (ранее называемый CTLA-8) главным образом экспрессируется Th17-клетками и был обозначен как IL-17A для того, чтобы показать, что он является основоположником этого семейства цитокинов. Последовательности членов семейства IL-17 не имеют гомологии с другими известными в настоящее время белками млекопитающих и, следовательно, образуют отдельное семейство цитокинов. Предполагается, что структурные признаки членов семейства IL-17, установленные на основании кристаллической структуры IL-17F, сходны со многими цитокинами, причем каждый из членов семейства, вероятно, продуцируется как гомодимер, хотя структурные сходства подразумевают, что могут присутствовать и гетеродимеры. Совсем недавно, было обнаружено, что гетеродимер IL-17A и IL-17F, экспрессирующийся активированными CD4+ Т-клетками, передает сигнал через комплекс IL-17RA/IL-17RC (Wright J.F. et al. (2008) J. of Immunol., 181, p.2799-2805).

Идентификация Th17-клеток как центральных медиаторов хронических воспалительных процессов и как основных патогенетических эффекторов некоторых типов аутоиммунных состояний, ранее считавшимися Th1-опосредованными, предвещает создание новых терапевтических подходов (Weaver Т. et al. (2008) Annu. Rev. Immunol., 25, р.821-852). Кроме того, pro-воспалительный цитокин IL-17 главным образом экспрессируется Th17-клетками и присутствует в повышенных количествах в синовиальной жидкости у пациентов с ревматоидным артритом (RA) и, как показано, включен в развитие раннего RA. В дополнение, IL-17 является главным индуктором TNF-альфа и IL-1, последний из которых ответственен за развитие эрозии кости и очень болезненных последствий для травмированных пациентов (Lubberts E. (2008) Cytokine, 41, р.84-91). Кроме того, неадекватная и избыточная продукция IL-17 связана с патологией разных заболеваний и нарушений, таких как остеоартрит, ослабление костных имплантатов, острое отторжение трансплантата (Antonysamy et al., (1999) J. Immunol, 162, p.577-584; van Kooten et al. (1998) J. Am. Soc. Nephrol., 9, p.1526-1534), септицемия, септический и эндотоксический шок, аллергия, астма (Molet et al. (2001) J. Allergy Clin. Immunol., 108, p.430-438), потеря костной массы, псориаз (Teunissen et al. (1998) J. Invest. Dermatol, 111, p.645-649), ишемия, системный склероз (Kurasawa et al. (2000) Arthritis Rheum., 43, p.2455-2463), инсульт и другие воспалительные заболевания.

Следовательно, анти-IL-17-соединения имеют потенциал как противовоспалительные агенты, при этом терапевтический подход наряду с рядом исследований in vivo демонстрирует, что нейтрализация IL-17 ослабляет воспалительные процессы, такие как артрит. Например, ранняя нейтрализация эндогенного IL-17 посредством IL-17 рецептор-IgG1-Fc-слитого белка, начинающаяся после протокола иммунизации в течение начальной фазы артрита, подавляет развитие экспериментального артрита (Lubberts et al. (2001) J. Immunol., 167, p.1004-1013). Кроме того, лечение с помощью нейтрализующих анти-IL-17-антител в экспериментальной модели после начала коллаген-индуцированного артрита снижало воспаление суставов, разрушение хрящей и эрозию костей (Lubberts et al. (2004) Arthritis and Rheumatism, 50; 650-659). Гистологический анализ подтвердил подавление воспаления суставов, и системные уровни IL-6 значительно снижались после лечения анти-IL-17-антителами. Для сравнения, системная, а также локальная, сверхэкспрессия IL-17, используя аденовирусный вектор, экспрессирующий мышиный IL-17, ускоряла начало коллаген-индуцированного артрита (CIA) и усиливала синовиальное воспаление на месте (Lubberts et al. (2001) J. Immunol., 167, p.1004-1013 и Lubberts et al. (2002), Inflamm. Res. 51, p102-104).

Несмотря на то, что антитела рутинно используются для аналитических, очистительных, диагностических и терапевтических целей благодаря легкости их получения, высокой аффинности и специфичности к фактически любым желаемым антигенам-мишеням, все еще существует ряд серьезных недостатков, таких как необходимость комплексных систем продукции па основе клеток млекопитающих, зависимость от стабильности дисульфидной связи, тенденция некоторых фрагментов антител агрегировать, ограниченная растворимость и последний, но не менее важный, они могут вызывать нежелательные иммунные ответы, даже если гуманизированны. Вследствие этого, недавние исследования сосредоточились на разработке небольших глобулярных белков в качестве каркасов для создания новых классов универсальных связывающих белков. Для создания разнообразной и прицельной специфичности, обычно поверхностные компоненты (напр., внеклеточные петли) белкового остова с подходящими биофизическими свойствами комбинаторно мутировали для продуцирования библиотеки белков, которую подвергали скринингу для определения специфичностей связывания, вызывающих интерес (Binz, H. К., and Pluckthun, A. (2005) Curr. Opin. Biotechnol. 16, 459-469).

Эти не-иммуноглобулиновые по происхождению связывающие реагенты совместно обозначаются как "каркасы" (Skerra A. (2000) J. Mol. Recognit. 13, 167-187). За последние 10-15 лет предложено более чем 50 разных белковых каркасов, наиболее передовые подходы в этой области следующие (как отмечено в Gebauer M and Skerra A. (2009) Curr Opinion in Chemical Biology 13:245-255): аффитела (основанные на Z-домене стафилококкового белка А), домены Кунитц-типа, аднектины (основанные на 10-м домене фибронектина человека), антикалины (полученные из липокалинов), DARPins (полученные из белков с анкириновым повтором), авимеры (основанные на мультимеризованных LDLR-A), аффитины (основанные на Sac7d из гипертермофильного archaeon), и финомеры, которые получают из Fyn SH3-домена человека.

В целом, SH3-домены присутствуют в различных белках, участвующих в трансдукции клеточного сигнала (Musacchio et al. (1994) Prog. Biopbys. Mol. Biol. 61; 283-297). Эти домены не занимают фиксированное положение в белках и могут экспрессироваться и очищаться независимо. Более чем 1000 событий в домене в настоящее время известны среди около 300 SH3-доменов человека (Musacchio A. (2003) Advances in Protein Chemistry. 61; 211-268). Хотя существует огромное разнообразие последовательностей среди доменов SH3, все они имеют консервативный фолд: компактный бета-бочонок, сформированный двумя анти-параллельными бета-слоями (Musacchio A. (2003) Advances in Protein Chemistry. 61; 211-268). Обычно, SH3-домены связываются с пролин-богатыми пептидами, содержащими связывающий мотив РХХР (Ren et al. (1993) Science 259; 1157-1161), но примеры нетрадиционных связывающих участков SH3 также описаны (Karkkainen et al. (2006) EMBO Rep.7; 186-191). Большинство SH3-доменов, уже секвенированных, имеют полную длину приблизительно от 60 до 65 аминокислот, но некоторые из них могут быть более 85 аминокислот вследствие вставок в петли, соединяющие основные консервативные элементы вторичной структуры (Koyama et al. (1993) Cell 72(6); 945-952). Выравнивание разных доменов SH3 раскрывает консервативные аминокислотные остатки, ответственные за образование правильной структуры, а также за узнавание канонического пролин-богатого мотива (Larson et al. (2000) Protein Science 9; 2170-2180).

Недавно изобретатели продемонстрировали, что Fyn SH3-домен является особенно эффективным каркасом ("Fynomer") для создания связывающих белков, поскольку он (i) может экспрессироваться в бактериях в растворимой форме в больших количествах, (ii) является мономерным и не агрегирует при хранении в растворе, (iii) очень стабилен (Tm 70,5°С), (iii) не содержит цистеиновые остатки, и (iv) имеет человеческое происхождение, характеризующееся аминокислотной последовательностью, полностью консервативной от мыши до человека и, вследствие этого, неиммуногенен (Grabulovski et al. (2007) JBC, 282, p.3196-3204).

Цель, лежащая в основе настоящего изобретения, заключается в обеспечении новых IL-17А-связывающих молекул, в частности таких, которые обладают высокой специфичностью и высокой аффинностью для IL-17A. Дополнительной целью является обеспечение IL-17А-связывающих молекул, предпочтительно IL-17 ингибиторов, подходящих для исследования, диагностики и лечения, предпочтительно для применения в лекарственных средствах для лечения и/или профилактики IL-17А-опосредованных заболеваний и медицинских состояний.

Удивительно, вышеуказанные цели достигаются за счет полипептидов, содержащих аминокислотную последовательность, выбранную из группы, состоящей из:

(i)

где а-h соответствует от 0 до 20,

предпочтительно а соответствует от 1 до 10, более предпочтительно от 2 до 8, наиболее предпочтительно 6;

предпочтительно b соответствует от 0 до 5, более предпочтительно от 1 до 3, наиболее предпочтительно 1;

предпочтительно с соответствует от 0 до 5, более предпочтительно от 1 до 3, наиболее предпочтительно 1;

предпочтительно d соответствует от 1 до 10, более предпочтительно от 3 до 9, наиболее предпочтительно 5 или 7;

предпочтительно е соответствует от 0 до 5, более предпочтительно от 1 до 3, наиболее предпочтительно 1;

предпочтительно f соответствует от 0 до 5, более предпочтительно от 1 до 3, наиболее предпочтительно 1;

предпочтительно g соответствует от 0 до 5, более предпочтительно от 1 до 3, наиболее предпочтительно 1;

предпочтительно h соответствует от 0 до 6, более предпочтительно от 1 до 3, наиболее предпочтительно 1 или 2;

(ii) аминокислотной последовательности, имеющей, по меньшей мере, 70%, предпочтительно, по меньшей мере, 80%, более предпочтительно, по меньшей мере, 90%, наиболее предпочтительно, по меньшей мере, 95% идентичности аминокислотных последовательностей с (i);

(iii) аминокислотной последовательности, кодируемой нуклеиновой кислотой, которая гибридизируется с комплементарной нитью нуклеиновой кислоты, кодирующей (i), предпочтительно при жестких условиях;

(iv) фрагмента или функциональных производных (i) - (iii), получаемых путем замещения, добавления и/или делеции, по меньшей мере, одной аминокислоты,

где указанный полипептид связывается с IL-17A.

Вышеуказанная общая формула (I) является результатом повторяющегося и экстенсивного мутационного анализа человеческого Fyn SH3-каркаса и селекции, основанной на связывании IL-17A.

Положения, обозначенные как X, могут сильно изменяться для типа аминокислоты(аминокислот) и также количества аминокислот. Предпочтительно, Х не является цистеином. Предпочтительное количество аминокислот для Х указывается подпунктами (а-h), все из которых составляют, предпочтительно, от 0 до 20, более предпочтительно от 0 или 1 до 10.

В нативном человеческом Fyn SH3, (Х)а и (X)d будут коррелировать с RT- и Src-петлей, соответственно. Предпочтительно, но не обязательно, что (Х)а и (X)d представляют собой петлевую структуру. Известно, что типичные петлевые структуры охватывают от 2 до более чем 20 аминокислот (Larson et al. (2000) Protein Science 9; 2170-2180). Вследствие этого, предпочтительно, что (Х)а и/или (X)d имеют от 2 до 20 аминокислот. Предпочтительно, а представляет собой от 1 до 10, более предпочтительно от 2 до 8, наиболее предпочтительно 6. Предпочтительно d представляет собой от 1 до 10, более предпочтительно от 3 до 9, наиболее предпочтительно 5 или 7. Предпочтительно (Х)а - это TAFWPG, более предпочтительно VAFWPG, наиболее предпочтительно KAFWPG. Предпочтительно (Х)d - это LNSSE, более предпочтительно TRTSD или LHTSD, наиболее предпочтительно LRTSD.

(Х)b, (X)c, (X)e, (X)f и (X)g представляют собой, независимо друг от друга, предпочтительно от 0 до 5, более предпочтительно от 1 до 3, наиболее предпочтительно 1. (Х)h представляет собой предпочтительно от 0 до 6, более предпочтительно от 1 до 3, наиболее предпочтительно 1.

В наиболее предпочтительном воплощении формула (I) соответствует:

Конечно, существует множество вариаций аминокислотной последовательности формулы (I), которые все еще допускают связывание IL-17A с полипептидом по изобретению. Вследствие этого, настоящее изобретение также охватывает полипептиды, содержащие аминокислотную последовательность, имеющую, по меньшей мере, 50, 60 или 70%, предпочтительно, по меньшей мере, 80%, более предпочтительно, по меньшей мере, 90%, наиболее предпочтительно, по меньшей мере, 95% идентичности аминокислотной последовательности с (i).

В используемом здесь значении, термин "идентичность аминокислотных последовательностей" между аминокислотными последовательностями относится к методам выравнивания и сравнения, общепринятых и широко используемых специалистами в области биохимии. Идентичность аминокислотных последовательностей двух аминокислотных последовательностей может быть определена общепринятыми методами и инструментами выравнивания. Например, для определения степени идентичности аминокислотных последовательностей произвольно выбранного полипептида относительно аминокислотной последовательности формулы (I), можно применять программу определения локальных сходств SIM Local similarity program (Xiaoquin Huang and Webb Miller, "A Time-Efficient, Linear-Space Local Similarity Algorithm." Advances in Applied Mathematics, vol. 12:337-357, 1991.), которая свободно доступна от авторов и их института (см., также Интернет: http://www.expasy.org/tools/sim-prot.html); для анализа множественного выравнивания можно использовать ClustalW (Thompson et al., „CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Res., 22(22):4673-4680, 1994.). Предпочтительно, степень идентичности аминокислотных последовательностей полипептида, фрагмента или функциональных производных изобретения с аминокислотной последовательностью формулы (I) определяется относительно полной последовательности формулы (I).

Кроме того, настоящее изобретение также охватывает полипептиды, содержащие аминокислотную последовательность, кодируемую нуклеиновой кислотой, которая гибридизируется с комплементарной нитью нуклеиновой кислоты, кодирующей (i), предпочтительно при жестких условиях. Другими словами, аминокислотная последовательность, охватываемая полипептидами в соответствии с изобретением, предпочтительно определяется, косвенным образом, кодирующей ее нуклеиновой кислотой, которая все еще способна гибридизироваться с комплементарной нитью нуклеиновой кислоты, кодирующей аминокислотную последовательность формулы (I). Гибридизируются ли нуклеиновые кислоты друг с другом, обычно определяется известными из уровня техники специфичными методами выравнивания и сравнения, а также экспериментально. Вслед за общепринятыми и/или стандартными протоколами, известными из уровня техники, для определения способности одной нуклеиновой кислоты гибридизироваться со специфически эталонной последовательностью нуклеиновой кислоты при жестких условиях (напр., Sambrook and Russell, Molecular cloning: A laboratory manual (3 volumes), 2001), является предпочтительным анализировать и определять способность произвольно выбранной нуклеиновой кислоты, кодирующей представляющий интерес полипептид, гибридизироваться с комплементарной нитью последовательности нуклеиновой кислоты, которая кодирует аминокислотную последовательность формулы (I) при жестких условиях, что выполняется посредством сравнения этих двух нуклеотидных последовательностей с помощью инструментов выравнивания, таких как, напр., BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410, 1990) и LALIGN. Наиболее предпочтительно, способность нуклеиновой кислоты, кодирующей полипептид интереса, который предположительно является полипептидом по изобретению, гибридизироваться с комплементарной нитью нуклеиновой кислоты, кодирующей аминокислотную последовательность формулы (I), подтверждается в анализе Саузерн-блоттинга при следующих условиях: 6х натрия хлорид/натрия цитрат (SSC) при 45°С, с последующим отмыванием в 0,2×SSC, 0,1% SDS при 65°С.

Кроме того, настоящее изобретение охватывает полипептиды, содержащие фрагмент, предпочтительно функциональный фрагмент, или функциональные производные любых из вышеуказанных аминокислотных последовательностей по изобретению.

Вследствие этого, термин "полипептид или аминокислотная последовательность в соответствии с настоящим изобретением" также охватывает функциональные фрагменты и производные полипептида или аминокислотной последовательности изобретения, имеющие свойства, определенные выше, т.е. способность связывания с IL-17A. Функциональные производные полипептида или аминокислотной последовательности настоящего изобретения охватывают любую аминокислотную последовательность и/или ее химическое производное (неприродные аминокислотные эквиваленты, гликозилирование, химическое получение), которое имеет практически достаточное количество доступных аминокислотных остатков или неприродных эквивалентов для проявления связывания с IL-17A. В функциональных производных полипептида или аминокислотной последовательности изобретения одна или несколько аминокислот могут быть удалены, модифицированы, вставлены и/или замещены. Кроме того, в контексте "функционального производного", вставка относится к вставке одной или нескольких аминокислот в вышеописанные "непроизводные" связывающие белки. Предпочтительно, с возрастающим преимуществом, что функциональное производное содержит не более 5, 4, 3, 2, или не более чем 1 аминокислотное изменение(я) (т.е. удаленные, модифицированные, вставленные и/или замещенные аминокислоты). В другом воплощении, предпочтительно, с возрастающим преимуществом, что изменено не более чем 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% или не более чем 1% от всех аминокислот полипептида или аминокислотной последовательности (т.е. являются удаленными, модифицированными, вставленными и/или замещенными аминокислотами). Замещение в производном может быть консервативным или неконсервативным замещением, но предпочтительно является консервативным замещением. В некоторых воплощениях, замещение также включает замену природной аминокислоты на неприродную аминокислоту. Консервативное замещение содержит замещение аминокислоты другой аминокислотой, имеющей химическое свойство, сходное с аминокислотой, которая замещается. Предпочтительно, консервативным замещением является замещение, которое выбирают из группы, состоящей из: (i) замещения основной аминокислоты другой основной аминокислотой; (ii) замещения кислой аминокислоты другой кислой аминокислотой; (iii) замещения ароматической аминокислоты другой ароматической аминокислотой; (iv) замещения неполярной, алифатической аминокислоты другой неполярной, алифатической аминокислотой; и (v) замещения полярной, незаряженной аминокислоты другой полярной, незаряженной аминокислотой. Основную аминокислоту выбирают из группы, состоящей из аргинина, гистидина и лизина. Кислую аминокислоту выбирают из аспартата или глутамата. Ароматическую аминокислоту выбирают из группы, состоящей из фенилаланина, тирозина и триптофана. Неполярную, алифатическую аминокислоту выбирают из группы, состоящей из глицина, аланина, валина, лейцина, метионина и изолейцина. Полярную, незаряженную аминокислоту выбирают из группы, состоящей из серипа, треонина, цистеина, пролина, аспарагина и глутамина. По сравнению с консервативным аминокислотным замещением, неконсервативное аминокислотное замещение является заменой одной аминокислоты на любую аминокислоту, которая не подпадает под вышеобозначенное(ые) консервативпое(ые) замещение(я) (i) - (v). Если функциональное производное содержит делению, то в производном одна или несколько аминокислот, которые присутствует в исходном полипептиде, удалены. Однако делеция не должна быть сильно обширной, чтобы производное содержало менее чем 3, предпочтительно менее чем 4, более предпочтительно менее чем 5 и наиболее предпочтительно менее чем 6 аминокислот в целом. Как указывалось выше, аминокислоты полипептида или аминокислотной последовательности изобретения также могут быть модифицированы, напр., химически модифицированы. Например, боковая цепь или свободный амино- или карбокси-конец аминокислот полипептида может быть модифицирован, напр., посредством гликозилирования, амидирования, фосфорилирования, убиквитинирования и др. Химическая модификация также может происходить in vivo, напр., в клетке-хозяине, как известно из уровня техники. Например, подходящий химически модифицированный мотив, напр., мотив гликозилирования последовательности, присутствующий в аминокислотной последовательности полипептида, будет делать полипептид гликозилированным. Во всех воплощениях, относящихся к функциональному производному изобретения, необходимо понимать, что аминокислотная последовательность, имеющая формулу (I), как определено здесь выше, является исходной молекулой, в которую вводится функциональное производное. В случае вставки в двух исходных молекулах, имеющих идентичные последовательности, за исключением того, что в первой молекуле Ха эквивалентен 4 и во второй молекуле Ха эквивалентен 5, будут получаться молекулы идентичной длины и, возможно, с идентичной аминокислотной последовательностью, если вставка, напр., в С-конце Ха состоит из двух аминокислот в первой молекуле и одной аминокислоты во второй молекуле.

Полипептиды настоящего изобретения связывают IL-17A, предпочтительно IL-17A человека. Предпочтительно, они связываются специфически с IL-17A, т.е. они не связываются с другими цитокинами или связывают их в меньшей степени, предпочтительно, по меньшей мере, в 2, 5, 10, 50, 100, 500 или 1000 раз меньшей. Примерный и предпочтительный анализ ELISA для определения связывающей специфичности полипептидов настоящего изобретения обеспечивается в примерах 6 и 7.

В предпочтительном воплощении, полипептиды настоящего изобретения связывают IL-17A человека и мартышек специфично и с высокой аффинностью связывания.

В дополнительных предпочтительных воплощениях, полипептиды изобретения имеют специфическую (in vivo и/или in vitro) аффинность связывания с человеческим IL-17А, предпочтительно с KD от 10-7 до 10-12 М, более предпочтительно от 10-8 до 10-12 М, наиболее предпочтительно менее чем 10-12 М. Например и также предпочтительно, аффинность связывания полипептидов настоящего изобретения может быть определена в соответствии с Примером 2 ниже.

В наиболее предпочтительном воплощении, полипептиды настоящего изобретения выбирают из группы, состоящей из SEQ ID NO:1-119 или их функциональных производных, которые приложены к описанию.

В предпочтительном воплощении полипептиды настоящего изобретения не только связывают, но и фактически ингибируют IL-17A (функцию). Эта способность продемонстрирована в Примерах 3 и 10, в которых показана способность полипептидов ингибировать индукцию IL-6 в фибробластах кожи человека в ответ на добавление IL-17A.

Кроме того, полипептиды настоящего изобретения обладают высокой стабильностью в растворе, напр., они стабильны при температуре 4°С в течение, по меньшей мере, 6 месяцев в нормальном забуференном фосфатом физиологическом растворе (см. Пример 4).

Однако, стабильность не ограничивается композициями in vitro, но еще и подтверждена у мышей, которым полипептид настоящего изобретения был введен внутривенно (см. Примеры 5 и 12).

В заключение необходимо отметить, что полипептиды настоящего изобретения хорошо подходят для исследовательских, диагностических и медицинских целей.

Наряду с замещением IL-17А-антител, их также можно применять для создания новых и менее иммуногенных слитых белков для фармацевтических и диагностических применений in vivo и in vitro. Таким образом, во втором аспекте, изобретение относится к слитому белку, содержащему полипептид изобретения, который слит с фармацевтически и/или диагностически активным компонентом.

Как указывалось, слитый белок изобретения может содержать неполипептидные компоненты, напр., непептидные линкеры, непептидные лиганды, напр., для радионуклеидов, подходящих для терапевтических или диагностических целей.

Предпочтительно, указанным активным компонентом является цитокин, выбранный из группы, состоящей из IL-2, IL-12, TNF-альфа, IFN-альфа, IFN-бета, IFN-гамма, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, В70, TNF-бета, LT-бета, CD-40-лиганд, Fas-лиганд, TGF-бета, IL-1-альфа и IL-1-бета.

В другом предпочтительном воплощении, указанным активным компонентом является токсичное соединение, предпочтительно низкомолекулярное органическое соединение или полипептид, более предпочтительно токсичное соединение выбирают из группы, состоящей из калихемицина, майтансиноида, неокарциностатина, эсперамицина, динемицина, кедарцидина, мадуропептина, доксорубицина, даунорубицина, ауристатина, А-цепи рицина, модеккина, укороченного экзотоксина A Pseudomonas, дифтерийного токсина и рекомбинантного гелонина.

В другом предпочтительном воплощении, слитый белок изобретения представляет собой такой белок, в котором указанным активным компонентом является хемокин, который предпочтительно выбирают из группы, состоящей из IL-8, GRO-альфа, GRO-бета, GRO-гамма, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1-альфа/бета, BUNZO/STRC33, I-TAC, BLC/BCA-1, М1Р-1альфа, MIP-1 бета, MDC, TECK, TARC, RANTES, HCC-1, HCC-4, DC-CK1, MIP-3-альфа, MIP-3-бета, MCP-1-5, эотаксина, эотаксина-2,1-309, MPIF-1, 6Ckine, CTACK, MEC, лимфотактина и фракталкина.

В дополнительном предпочтительном воплощении, полипептид или слитый белок согласно изобретению содержит искусственные аминокислоты.

В дополнительных предпочтительных воплощениях слитого белка настоящего изобретения, указанным активным компонентом является флуоресцентный краситель, предпочтительно компонент, выбранный из групп Alexa Fluor или красителей Су (Berlier et al. „Quantitative Comparison of Long-wavelength Alexa Fluor Dyes to Cy Dyes: Fluorescence of the Dyes and Their Bioconjugates", J. Histochem. Cytochem. 51 (12):1699-1712, 2003.); фотосенсибилизатор, предпочтительно фототоксичный красный флуоресцентный белок KillerRed (Bulina et al. (2006) Nat Biotechnol., 24, 95-99) или гематопорфирин; прокоагулянтный фактор, предпочтительно тканевый фактор; фермент для активации пролекарств, предпочтительно фермент, который выбирают из группы, состоящей из карбоксипептидаз, глюкуронидаз и глюкозидаз; радионуклид, либо из группы гамма-излучающих изотопов, предпочтительно 99mTc, 123I, 111In, либо из группы излучателей позитронов, предпочтительно 18F, 64Cu, 68Ga, 86Y, 124I, либо из группы бета-излучателей, предпочтительно 131I, 90Y, 177Lu, 67Cu, либо из группы альфа-излучателей, предпочтительно 213Bi, 211At.

В другом предпочтительном воплощении, полипептид настоящего изобретения может быть прикреплен непосредственно или посредством химического линкера к одному или нескольким неполипептидным компонентам, как указано здесь выше.

В более предпочтительном воплощении слитого белка настоящего изобретения, указанным активным компонентом является один или несколько функциональных Fc-доменов, предпочтительно один или несколько функциональных Fc-доменов человека (см., например, SEQ ID NO:117-119 и SEQ ID NO:130), которые(ый) позволяют(ет) продлить время полужизни in vivo (период полувыведения) IL-17А-связывающих полипептидов изобретения и некоторые из которых направляют иммунный ответ млекопитающих в сторону специфического направленного связывания полипептидного компонента слитого белка по изобретению, напр., в терапевтических, профилактических и/или диагностических целях. Полипептиды изобретения могут быть слиты либо с N- или с С-концом одного или нескольких функциональных Fc-доменов либо с обоими N- и C-концами одного или нескольких Fc-доменов. Предпочтительно, что слитые белки изобретения содержат мультимеры, предпочтительно тетрамеры, тримеры или наиболее предпочтительно димеры полипептидов изобретения, слитых с, по меньшей мере, одной частью, предпочтительно с N-концом одного или нескольких, предпочтительно одного Fc-домена. В этом отношении, необходимо отметить, что слитый белок Fynomer-Fynomer-Fc, обозначаемый (2Cl)2-Fc, демонстрирует преимущество мультимерных слияний полипептид-Fc, которые имеют более высокую аффинность к IL-17A, чем соответствующий мономерный слитый белок 2C1-Fc, как продемонстрировано ниже на Фиг.3е и 3f и Таблице II Примера 2. Вследствие этого, предпочтительное воплощение изобретения направлено на мультимерные слитые белки полипептид-Fc.

"Функциональный Fc-домен" антитела является термином, хорошо известным для квалифицированного специалиста в данной области, и определяется на основе папаинового расщепления антител. В зависимости от аминокислотной последовательности константного участка тяжелых цепей, иммуноглобулины подразделяются на классы: IgA, IgD, IgE, IgG и IgM, и некоторые из них могут быть дополнительно разделены на подклассы (изотипы), напр., IgG1, IgG2, IgG3 и IgG4, IgA1, и IgA2. В соответствии с константными участками тяжелых цепей различные классы иммуноглобулинов называются [альфа], [дельта], [эпсилон], [гамма] и [мю], соответственно. Функциональный Fc-домен антитела непосредственно включается в ADCC (антителозависимая клеточно-опосредованная цитотоксичность) и CDC (комплемент-зависимая цитотоксичность), основываясь на активацию комплемента, C1q-связывание и Fc-рецепторное связывание. Четыре изотипа IgG человека связывают разные рецепторы, такие как неонатальный Fc-рецептор, активирующие Fc-гамма рецепторы, FcγRI, FcγRIIa и FcγRIIIa, ингибирующий рецептор FcγRIIb и C1q с разными аффинностями, получая очень разные активности. Известно, что аффинности к активирующим и ингибирующему рецепторам Fc-домена антитела человека могут быть сконструированы и модифицированы (см., Strohl W. (2009) Curr Opin Biotechnol, 20, p.685-691). Следовательно, как указывалось выше, изобретение содержит Fc-слияние(я), которое(ые) позволяет(ют) увеличить время полужизни in vivo IL-17А-связывающих полипептидов изобретения, и которое(ые) содержит функциональный Fc-домен человеческого происхождения, предпочтительно, человеческий функциональный Fc-домен антитела IgG1 (см., например, SEQ ID NO:117-119 и SEQ ID NO:130).

В более предпочтительном воплощении слитого белка настоящего изобретения активным компонентом является один или несколько рекомбинантных функциональных Fc-доменов IgG1 человека с активированными или подавленными эффекторными функциями, предпочтительно один или несколько рекомбинантных функциональных Fc-доменов IgG1 человека с подавленными эффекторными функциями, и наиболее предпочтительно один или несколько рекомбинантных функциональных Fc-доменов IgG1 человека с подавленными эффекторными функциями с мутацией в L234 и L235 (см., например, SEQ ID NO:131-135), кодирование согласно номенклатуре Кэбата (см. Johnson G. and Wu T.T. (2000) Nucleic Acids Res. 28, p.214-218).

Дополнительное предпочтительное воплощение относится к полипептидам или слитым белкам изобретения, как указывалось выше, которые дополнительно содержат компонент, модулирующий время полужизни в сыворотке, причем компонент предпочтительно выбирают из группы, состоящей из полиэтиленгликоля (ПЭГ), иммуноглобулина и альбуминсвязывающих пептидов.

Кроме того, предпочтительно, что слитый белок изобретения содержит любой из вышеуказанных заявляемых IL-17А-связывающих полипептидов, предпочтительно тот, который выбирают из группы, состоящей из SEQ ID NO:117-119 и SEQ ID NO:130-135, или его функциональное производное.

Необходимо отметить, что полипептид или слитый белок изобретения предпочтительно является мономерным, но также охватываются и мультимеры, предпочтительно тетрамеры, более предпочтительно тримеры, или наиболее предпочтительно димеры заявляемых полипептидов.

Полипептиды и слитые белки изобретения могут быть приготовлены с помощью любого из многих традиционных и хорошо известных способов, таких как обычные стратегии синтеза органических соединений, техника твердофазного синтеза или с помощью коммерчески доступных автоматических синтезаторов. С другой стороны, их также можно приготовить с помощью традиционных рекомбинантных технологий самих по себе или в комбинации с общепринятыми способами синтеза.

В связи с этим, дополнительные аспекты настоящего изобретения относятся к (i) нуклеиновой кислоте, кодирующей полипептид или слитый белок изобретения, (ii) вектору, содержащему указанную нуклеиновую кислоту, и (iii) к клетке-хозяину, содержащему указанный полинуклеотид и/или указанный вектор.

Предпочтительно, изобретение относится к изолированной и очищенной нуклеиновой кислоте, содержащей

(i) нуклеиновую кислоту, кодирующую полипептид изобретения, предпочтительно кодирующую аминокислотную последовательность формулы (I), более предпочтительно

(G/E)VTLFVALYDY-(X)6-D-(X)-SFHKGEKF-(X)1-I-(X)5-7-G-(X)1-WW-(X)-A-(X)-SLTTG-(X)1-2-GYIPSNYVAPVDSIQ;

(ii) нуклеиновую кислоту, имеющую последовательность, по меньшей мере, 60 или 70%, предпочтительно, по меньшей мере, 80%, более предпочтительно, по меньшей мере, 90%, наиболее предпочтительно по меньшей мере, 95% идентичность последовательности с последовательностью нуклеиновой кислоты (i);

(iii) нуклеиновую кислоту, которая гибридизируется с комплементарной нитью нуклеиновой кислоты из (i) или (ii);

(iv) нуклеиновую кислоту, при этом указанную нуклеиновую кислоту получают путем замены, добавления и/или удаления в одной из нуклеиновых кислот из (i), (ii) или

(iii);

(v) фрагмент любой из нуклеиновых кислот из (i) - (iv), которая гибридизируется с комплементарной нитью нуклеиновой кислоты из (I), кодирующей полипептид изобретения.

Более предпочтительно, нуклеиновая кислота изобретения содержит нуклеиновую кислоту, кодирующую полипептид или слитый белок, как описано выше. В этой связи, следует понимать, что любая из нуклеиновых кислот (i) - (v), выше, предпочтительно кодирует полипептид, который связывает IL-17A и более предпочтительно ингибирует функцию IL-17A.

Нуклеиновыми кислотами изобретения могут быть ДНК, РНК, ПНК и любые другие их аналоги. Векторами и клетками-хозяевами может быть любой общепринятый тип, который подходит для цели, напр., получения полипептидов и/или слитых белков изобретения, терапевтического применения векторов и клеток-хозяев, напр., для генной терапии. Специалист в данной области способен выбрать такие нуклеиновые кислоты, векторы и клетки-хозяева из широкого уровня техники и подтвердить их конкретную пригодность для желаемой цели, применяя рутинные способы и без чрезмерных трудов.

Предпочтительно нуклеиновая кислота функционально связана с промотором, предпочтительно связана с промотором, который выбирают из группы прокариотических промоторов, состоящей из Т5-промотор/lac-оператор элемента, Т7-промотор/lac-оператор элемента, или из группы эукариотических промоторов, состоящей из hEF1-HTLV, CMV enh/hFerL-промотора.

Также является предпочтительным, что рекомбинантный вектор изобретения представляет собой вектор, содержащий нуклеиновую кислоту изобретения и предпочтительно способный продуцировать полипептид или слитый белок изобретения. Предпочтительно такой вектор выбирают из группы, состоящей из pQE-векторов, рЕТ-векторов, pFUSE-векторов, pUC-векторов, YAC-векторов, фамидных векторов, фаговых векторов, векторов, применяемых в генной терапии, таких как ретровирусы, аденовирусы, аденоассоциированные вирусы.

В дополнение, настоящее изобретение относится к клеткам-хозяевам, содержащим нуклеиновую кислоту и/или вектор изобретения.

Кроме того, настоящее изобретение охватывает антитело, которое специфически связывается с полипептидом или слитым белком изобретения. Если антитело связывается со слитым белком, то оно специфически связывается с его частью, которая состоит из полипептида изобретения или слитого эпитопа, т.е. со связывающим сайтом антитела, частично состоящего из полипептида изобретения и частично состоящего из фармацевтически и/или диагностически активного компонента, которым является предпочтительно полипептид или пептид. Антитела могут быть поликлональными или моноклональными антителами. В используемом здесь значении, термин "антитело" относится не только к целым молекулам антитела, но также и к антигенсвязывающим фрагментам, напр., Fab, F(ab')2, Fv, и одноцепочечным Fv-фрагментам. Также включены химерные антитела, предпочтительно гуманизированные антитела. Такие антитела применимы в качестве исследовательских средств для выявления различий между случайными белками и полипептидами изобретения. Дополнительный аспект относится к гибридомной клеточной линии, экспрессирующей моноклональное антитело изобретения.

Поскольку полипептиды и слитые белки настоящего изобретения демонстрируют IL-17А-связывающие и ингибиторные свойства, а также стабильность при хранении и in vivo, дополнительный аспект настоящего изобретения относится к фармацевтической композиции, содержащей полипептид или слитый белок, нуклеиновую кислоту и/или рекомбинантный вектор изобретения и, при необходимости, фармацевтически подходящий носитель. Также, значение термина "фармацевтическая композиция" охватывает диагностические композиции для применения in vivo.

Фармацевтические композиции изобретения могут быть изготовлены любым общепринятым способом. Для осуществления лечения субъекта, страдающего от заболеваний, отмеченных ниже, по меньшей мере, одно соединение настоящего изобретения можно вводить в любой форме или любым путем, который делает терапевтический полипептид или его терапевтический фрагмент биодоступным в эффективном количестве, включая оральный или парентеральный путь введения. Например, композиции настоящего изобретения можно вводить подкожно, внутримышечно, внутривенно, путем ингаляции и подобным образом. Специалист в области приготовления составов может без труда выбрать подходящую форму и путь введения в зависимости от конкретных характеристик выбранного продукта, заболевания или состояния, которое требует лечение, стадии заболевания или состояния и других соответствующих обстоятельств (см., напр., Remington's Pharmaceutical Sciences, Mack Publishing Co. (1990)). Подходящим носителем или эксципиентом может быть жидкий материал, который может служить в качестве связующего или среды для активного ингредиента. Подходящие носители или эксципиенты хорошо известны из области техники и включают, например, стабилизаторы, антиоксиданты, рН-регулирующие вещества, контролирующие высвобождение эксципиенты и др. Композиция, согласно изобретению, предпочтительно обеспечивается в лиофилизированной форме. Для непосредственного введения ее растворяют в подходящем водном носителе, например, в стерильной воде для инъекций или в стерильном забуференном физиологическом растворе. Если требуется приготовить большие объемы для введения путем инфузии, но не в виде болюсной инъекции, то полезным является введение сывороточного альбумина человека или собственной гепаринизированной крови пациента в растворитель в момент завершения приготовления состава. Альтернативно, состав можно вводить подкожно. Наличие избытка физиологически инертного белка, такого как сывороточный альбумин человека, предотвращает потерю фармацевтически эффективного полипептида за счет абсорбции на стенках контейнера и ампулы, использующихся для инфузионного раствора. Если применяют альбумин, то подходящая концентрация составляет от 0,5 до 4,5% по массе физиологического раствора.

IL-17А-связывающие и ингибирующие полипептиды изобретения особенно подходят для лечения и/или профилактики IL-17A- и/или Th17-связанный заболеваний или медицинских состояний. Вследствие этого, дополнительный аспект настоящего изобретения направлен на применение полипептида или слитого белка, нуклеиновой кислоты и/или рекомбинантного вектора изобретения в медицинских целях, т.е. для приготовления лекарственного средства, предпочтительно для лечения и/или профилактики заболевания или медицинского состояния, которое предпочтительно выбирают из группы, состоящей из IL-17A- и/или Th17-связанных заболеваний или медицинских состояний.

В предпочтительном воплощении, медицинское применение изобретения относится к лечению и/или профилактике заболеваний или медицинских состояний, выбранных из группы, состоящей из воспалительных, аутоиммунных и/или связанных с остеопорозом заболеваний и состояний.

В наиболее предпочтительном воплощении, указанные воспалительные, аутоиммунные и/или связанные с остеопорозом заболевания и состояния выбирают из группы, состоящей из артрита, предпочтительно ревматоидного артрита, хронического прогрессирующего артрита, реактивного артрита, псориатического артрита, энтеропатического артрита и деформирующего артрита, ревматических заболеваний, спондилоартропатий, анкилозирующего спондилита, болезни Рейтера, гиперчувствительности (включая обе дыхательную гиперчувствительность и кожную гиперчувствительность), аллергий, системной красной волчанки, воспалительных поражений мышц, полихондрита, склеродемы, гранулематоза Вегенера, дерматомиозита, синдрома Стивена-Джонсона, хронического активного гепатита, миастении гравис, псориаза, идиопатического спру, аутоиммунного воспалительного заболевания кишечника, неспецифического язвенного колита, болезни Крона, синдрома раздраженной толстой кишки, эндокринной офтальмопатии, болезни Грейвса, саркоидоза, ишемии, системного склероза, рассеянного склероза, билиарного первичного цирроза печени, ювенильного диабета (сахарного диабета I типа), аутоиммунных гематологических поражений, гемолитической анемии, апластической анемии, врожденной апластической анемии, идиопатической тромбоцитопении, увеита (переднего и заднего), сухого кератоконъюнктивита, весеннего кератоконъюнктивита, интерстициального фиброза легких, гломерулонефрита (с и без нефротического синдрома), идиопатического нефротического синдрома или нефропатии минимальных изменений, опухолей, воспалительного заболевания воспаления кожи, воспаления роговицы, миозита, отторжения костных имплантатов, острого отторжения трансплантата, метаболических нарушений, атеросклероза, диабета и дислипидемии, потери костной массы, остеоартрита, остеопороза, парадонтоза, обструктивных или воспалительных заболеваний дыхательных путей, астмы, бронхита, пневмокониоза, эмфиземы легких, острых и сверхострых воспалительных реакций, заболеваний, в патогенез которых вовлечен IL-17A-опосредованный TNF-альфа, острых инфекций, септицимии, септического шока, эндотоксического шока, синдрома расстройства дыхания у взрослых, менингита, пневмонии, тяжелых ожогов, кахексии, синдрома истощения, инсульта, герпетического стромального кератита и сухого кератита. Все из вышеуказанных заболеваний и медицинских состояний имеют между собой общим то, что их этиология и/или симптом(ы) являются IL-17A- и/или Th-17-связанными.

Количество и путь введения заявляемых соединений, т.е. полипептидов, слитых белков, нуклеиновых кислот, векторов и клеток-хозяев, для лечения и/или профилактики заболевания или медицинского состояния, предпочтительно выбирают из группы, состоящей из IL-17A- и/или Th17-связанных заболеваний или медицинских состояний, более предпочтительно тех, которые перечислены выше, будут, конечно, изменяться в зависимости от конкретного ингибитора полипептида или слитого белка изобретения, определенной группы пациентов или пациента, присутствия дополнительных медицински активных соединений и природы и тяжести состояния, которое подвергается лечению. Однако, в настоящее время предпочтительно, чтобы для профилактического и/или терапевтического применения вводили дозы от около 0,01 мг до около 20 мг на килограмм массы тела, предпочтительно от около 0,1 мг до около 5 мг на килограмм массы тела. Предпочтительно, частота введения для профилактического и/или терапевтического применения составляет от около дважды в неделю до около однократно каждые 3 месяца, предпочтительно от около однократно каждые 2 недели до около однократно каждые 10 недель, более предпочтительно однократно каждые 4-8 недель. IL-17А-связывающие полипептиды и слитые белки изобретения удобно и предпочтительно вводят парентерально, внутривенно, предпочтительно в локтевую или другую периферическую вену, внутримышечно или подкожно. Также, IL-17А-связывающие полипептиды можно доставлять местно в виде глазных капель. Предпочтительное профилактическое и/или терапевтическое воздействие на пациента включает введение полипептидов изобретения от однократно в месяц до однократно каждые 2-3 месяца или реже.

Следовательно, настоящее изобретение также относится к способу лечения, в котором фармакологически эффективное количество вышеуказанной фармацевтической композиции вводят пациенту, нуждающемуся в лечении, предпочтительно пациенту, страдающему от IL-17A- и/или Th17-связанных заболеваний или медицинских состояний, более предпочтительно от одного из приведенных выше заболеваний или медицинских состояний. Термин "лечение", в используемом здесь значении, относится к профилактическому и/или терапевтическому воздействию, направленному на излечение заболевания или медицинского состояния.

IL-17А-связывающие полипептиды и слитые белки изобретения можно вводить как единственный активный ингредиент или одновременно с, напр., как адъювант к или в комбинации с, другими лекарственными средствами, напр., иммуносупрессивными или иммуномодулирующими агентами или другими противовоспалительными агентами, напр., для лечения или профилактики заболеваний, указанных выше. Например, IL-17A-связывающие полипептиды и слитые белки изобретения можно использовать в комбинации с иммуносупрессивными моноклональными антителами, напр., моноклональными антителами с аффинностью к рецепторам лейкоцитов, напр., МНС, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40, CD45, CD58, CD80, CD86 или их лагандами; с другими иммуномодуляторными соединениями, напр., рекомбинантной связывающей молекулой, имеющей, по меньшей мере, часть внеклеточного домена CTLA4 или ее мутант, напр., по меньшей мере, внеклеточную часть CTLA4 или ее мутант, связанный с HC-CTLA4 белковой последовательностью, напр., CTLA4Ig (напр., обозначаемой АТСС 68629) или ее мутант, напр., LEA29Y; с ингибиторами адгезивных молекул, напр., LFA-I-антагонистами, ICAM-I или -3-антагонистами, VCAM-4-антагонистами или VLA-4-антагонистами. В дополнении, полипептиды и слитые белки изобретения можно использовать в комбинации с DMARD, напр., золото-хлористоводородным натрием, сульфасалазином, противомалярийным средством, метотрексатом, D-пенициллинамином, азатиоприном, микофеноловой кислотой, циклоспорином А, такролимуом, сиролимусом, миноциклином, лефлуномидом, глюкокортикоидами; ингибитором кальциневрина, напр., циклоспорином А или FK 506; модулятором рециркуляции лимоцитов, напр., FTY720 и FTY720-аналогами; ингибитором mTOR, напр., рапамицином, 40-O-(2-гидроксиэтил)-рапамицином, CCI779, АВТ578, АР23573 или TAFA-93; аскомицином, имеющим иммуносупрессивные свойства, напр., АВТ-281, ASM981 и др.; кортикостероидами; циклофосфамидом; азатиопреном; метотрексатом; лефлуномидом; мизорибином; микофеноловой кислотой; мофетила микофенолатом; 15-деоксиспергуалином или иммуносупрессивным гомологом, аналогом или его производным; или с химиотерапевтическим агентом, напр., паклитакселем, гемцитабином, цисплатинумом, доксорубицином или 5-фторурацилом; анти-TNF агентами, напр., моноклональными антителами к TNF, напр., инфликсимабом, адалимумабом, CDP870, или рецепторными конструкциями к TNF-RI или TNF-RII, напр., Этанерцептом, ПЭГ-TNF-RI; блокаторами провоспалительных цитокинов, IL-1-блокаторами, напр., Анакинрой или IL-1-ловушкой, AAL160, ACZ 885, IL-6-блокаторами; ингибиторами или активаторами протеаз, напр., металлопротеазами, анти-IL-15 антителами, анти-IL-6 антителами, анти-IL-23 антителами, анти-IL-22 антителами, анти-IL-21 антителами, анти-IL-12 антителами, анти-IFN- гамма антителами, анти-IFN-альфа антителами, анти-CD20 антителами, НПВП, такими как аспирин, или противоинфекционным агентом. Разумеется, данный перечень агентов для комбинированного введения не является исчерпывающим.

Дополнительно, изобретение описывается посредством следующих примеров, ни один из которых не ограничивает объем изобретения, который определяется заявленной формулой изобретения.

Фигуры

Фиг 1. показывает анализ SDS PAGE различных вариантов IL-17-связывающих полипептидов изобретения: (a) SDS PAGE B1_2 (SEQ ID No:39) (дорожка 1), Е4 (SEQ ID NO:57) (дорожка 2), 2C1 (SEQ ID NO:107) (дорожка 3), E4-Fc (SEQ ID NO:117) (дорожка 4: не-восстановительные условия, дорожка 5: восстановительные условия), 2C1-Fc (SEQ ID NO:118) (дорожка 6: не-восстановительные условия, дорожка 7: восстановительные условия); (b) SDS PAGE [(2Cl)2-Fc] (SEQ ID NO:119) (дорожка 1: не-восстановительные условия, дорожка 2: восстановительные условия). Молекулярная масса (2Cl)2-Fc рассчитывается относительно молекулярной массы маркера широкого диапазона (не показано).

Фиг.2 показывает гель-хроматограммы (SEC) IL-17А-связывающих полипептидов изобретения: (а) Клон B1_2 (SEQ ID NO:39), (b) Е4 (SEQ ID NO:57), (с) 2С1 (SEQ ID NO:107), (d) E4-Fc (SEQ ID NO:117), (e) SEC-пик очищенного E4-Fc, проанализированный через 40 дней после очистки и хранения в PBS при 4°С, (f) 2C1-Fc (SEQ ID NO:118), (g) (2Cl)2-Fc (SEQ ID NO:119).

Фиг.3 изображает BIAcore-сенсограммы IL-17А-связывающих полипептидов изобретения: (а) Клон B1_2 (SEQ ID NO:39), (b) Е4 (SEQ ID NO:57), (с) 2C1 (SEQ ID NO:107), (d) E4-Fc (SEQ ID NO:117), (e) 2C1-Fc (SEQ ID NO:118), f) (2Cl)2-Fc (SEQ ID NO:119).

Фиг.4 представляет результаты анализа клеточного ингибирования IL-17A: (а) дозозависимую индукцию IL-6 после инкубации NHDF-клеток с IL-17A. (b) дозозависимое ингибирование IL-17А-индуцированной IL-6-продукции в NHDF-клетках, посредством полученных на основе Fyn SH3 IL-17-связующих веществ и химеры IL-17A рецептор-Fc. (с) то же что и b), белок Fyn SH3 wt использовали в качестве контрольного белка без аффинности связывания с IL-17A. (d) ХТТ-анализ: жизнеспособные клетки способны метаболизировать соль тетразолия ХТТ до окрашенного продукта. В нашем эксперименте, все клетки были жизнеспособны после 24 часов инкубации с IL-17A, IL-17A и Fyn SH3 связующими веществами, или IL-17A и химерой IL-17R-Fc.

Фиг.5 изображает гель-хроматографию с IL-17А-связующим полипептидом изобретения, обозначаемым G3 (SEQ ID NO:34), через один день после очистки (хранился в PBS при 4°С). Хроматографию осуществляли, используя колонку Superdex 75 (GE Healthcare).

Фиг.6 изображает гель-хроматографию с IL-17А-связующим полипептидом изобретения, обозначаемым G3 (SEQ ID NO:34), хранимым более шести месяцев при 4°С (а) и -20°С (b).

Фиг.7 показывает фармакокинетические данные IL-17А-связующего полипептида изобретения, обозначаемого E4-Fc (SEQ ID NO:117), у мышей: (а) концентрация E4-Fc в сыворотке нанесена в зависимости от времени после внутривенного введения, (b) так же как и в (а), но с полулогарифмическим изображением. Последние четыре момента времени использовались для расчета конечного времени полужизни, составляющее 50,6 часов.

Фиг.8 показывает таблицу связывающей специфичности полипептида изобретения, обозначаемого 2С1 (SEQ ID NO:107). Результаты абсорбции относятся к ELISA, выполненной с использованием различных белков-мишеней: человеческий IL-17А, человеческий IL-17F, mIL-17A (мышиный IL-17 А), TNF-альфа (человеческий фактор некроза опухоли-альфа), BSA (бычий сывороточный альбумин), Овальбумин (куриный яичный белок), IL-6 (человеческий интерлейкин 6).

Фиг. 9 показывает специфичность полученного на основе Fyn SH3 полипептида изобретения 2С1 (SEQ ID NO:107). Разные члены семейства IL-17, IL-17A разных видов и другие неродственные антигены использовались в ELISA вместе с полученным на основе Fyn SH3 полипептидом изобретения 2С1 (SEQ ID NO:107) в качестве связывающего агента. Полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) связывается только с IL-17A человека и макаки. Не обнаружено связывания с любыми другими антигенами. На правой стороне Фигуры (правая сторона пунктирной линии) показан сигнал ELISA к IL-17C человека, который определяли на другой день вместе с контролем IL-17A человека. Обозначения: hIL-17A: Интерлейкин 17А человека, hIL-17B: Интерлейкин 17В человека, HIL-17D: Интерлейкин 17D человека, ML-17E: Интерлейкин 17Е человека, ML-17F: Интерлейкин 17F человека, IL-17A мыши: Интерлейкин 17А мыши, IL-17A крысы: Интерлейкин 17А крысы, IL-17A собаки: Интерлейкин 17А собаки, Il-17А макак: Интерлейкин 17А макак, EDB: внешний домен В фибронектина, hIL-6: Интерлейкин 6 человека, hTNF альфа: фактор некроза опухоли-альфа человека, Овальбумин: альбумин из куриного яйца, BSA: бычий сывороточный альбумин neg ctrl: для покрытия антиген не использовался, hIL-17C: Интерлейкин 17С человека.

Фиг.10 представляет Biacore-сенсограмму полученного на основе Fyn SH3 полипептида изобретения 2С1 (SEQ ID NO:107) на чипе, покрытым IL-17A макаки ренатурированным из телец включения.

Фигура 11 показывает анализ SDS PAGE Fc-слитых белков. Дорожка 1: многоцветный маркер широкого диапазона (GE Healthcare), дорожка 2: 2C1-Fc (SEQ ID NO:130), дорожка 3: многоцветный маркер широкого диапазона (GE Healthcare), дорожка 4: 2C1-m5-Fc(LALA) (SEQ ID NO:133), дорожка 5: 2C1-m10-Fc(LALA) (SEQ ID NO:134), дорожка 6: 2C1-m15-Fc(LALA) (SEQ ID NO:135), дорожка 7: 2C1-m5E-Fc(LALA) (SEQ ID NO:132), дорожка 8: 2C1-Fc(LALA) (SEQ ID NO:131).

Фигура 12 показывает ELISA 2C1-Fc (SEQ ID NO:130) связывания с IL-17A после хранения в течение 5 дней при 37°С в сыворотке человека (*) по сравнению со стандартным контролем 2C1-Fc (SEQ ID NO:130), хранимым при 4°С в PBS (х).

Фигура 13 показывает концентрацию в сыворотке в различные моменты времени 2C1-Fc(LALA) (SEQ ID NO:131) после одной внутривенной инъекции мышам. 2С1-Fc(LALA)-слитый белок (SEQ ID NO:131), продуцируемый в клетках млекопитающих, инъецировали (40 мкг на животного) внутривенно (iv) (n=5) мышам. Последние четыре момента времени PK-профиля использовали для расчета конечного времени полужизни 2С1-Fc-слитого белка, составляющего 53 часа.

Фигура 14 показывает ингибирование человеческого IL-17A, индуцирующего продукцию КС посредством анти-IL-17 полипептида 2С1 (SEQ ID NO:107) изобретения полученного на основе Fyn SH3 в модели острого воспаления. Через два часа после подкожной (s.c.) инъекции либо 3 мкг IL-17A человека (IL-17), PBS (PBS), 3 мкг IL-17A человека с 17 мкг мономерного полученного на основе Fyn SH3 полипептида 2С1 (SEQ ID NO:107) изобретения (IL-17+2C1), 3 мкг IL-17A человека с 16 мкг Fyn SH3-мономера дикого типа (IL-17+wt), 17 мкг мономерного полученного на основе Fyn SH3 полипептида 2С1 (SEQ ID NO:107) изобретения только (2С1), либо 16 мкг Fyn SH3-мономера дикого типа только (we), отбирали образцы крови и рассчитывали уровни КС в мышиной сыворотке. Представлены средние уровни KC 4 мышей на группу (±SD), за исключением контрольных групп дикого типа (Fyn SH3 без и с IL-17A), где показаны средние уровни 3 мышей (±SD).

Фигура 15 представляет ингибирование человеческого IL-17A, индуцирующего продукцию KC, посредством 2С1-Fc-слитого белка (SEQ ID NO:130) в модели острого воспаления. 2C1-Fc/IL-17: 44 мкг 2C1-Fc (SEQ ID NO:130) инъецировали внутривенно с последующим подкожным введением 3 мкг IL-17A человека. Через два часа после введения IL-17A, из мышей отбирали образцы крови и измеряли уровни KC в сыворотке посредством ELISA. Контрольные эксперименты осуществляли следующим образом: PBS/IL-17: внутривенная инъекция PBS с последующей подкожная инъекцией IL-17; 2C1-Fc/PBS: внутривенное инъекция 2C1-Fc (SEQ ID NO:130) с последующей подкожной инъекцией PBS; PBS/PBS: внутривенная инъекция PBS с последующей подкожной инъекцией PBS. Показаны средние уровни KC 3-5 мышей на группу (±SD).

Примеры

Пример 1. Полученные на основе Fyn SH3 полипептиды изобретения присоединяются к IL-17A, как определено с помощью моноклонального фагового иммуноферментного анализа ELISA.

Методы

ДНК, кодирующую аминокислотные последовательности, показанные в SEQ ID NO:1-116, клонировали в фагмидный вектор pHEN1, как описано для FYN SH3-библиотеки в Grabulovski et al. (Grabulovski et al. (2007) JBC, 282, p.3196-3204). Продукцию фагов осуществляли в соответствии со стандартными протоколами (Viti F. et al. (2000) Methods Enzymol., 326, 480-505). Для ELISA использовали моноклональные бактериальные супернатанты: биотинилированный IL-17A (приобретенный у R&D Systems, биотинилирование выполняли с NHS-PEO4-биотином (Pierce) в соответствии с инструкциями производителя) иммобилизировали на покрытые стрептавидином лунки (StreptaWells, High Bind, Roche), и затем блокировали с помощью PBS, 2% молока (Rapilait, Migros, Switzerland), 20 мкл PBS, 10% молока и вносили 80 мкл фаговых супернатантов. После инкубирования в течение 1 ч и промывания, связавшиеся фаги детектировали с помощью конъюгата антител с анти-М13-HRP (GE Healthcare). Детектирование активности пероксидазы осуществляли путем добавления субстрата ВМ blue POD (Roche) и реакцию останавливали путем добавления 1 М H2SO4. ДНК-последовательность связующих веществ проверяли с помощью секвенирования ДНК (набор для секвенирования BigDye Terminator v3.1 cycle, генетический анализатор ABI PRISM 3130, Applied Biosystems).

Результаты

Аминокислотные последовательности, полученные на основе Fyn SH3 IL-17A-связующих веществ, представлены в SEQ ID NO:1-116, которые приведены в перечне последовательностей.

Пример 2. Полученные на основе Fyn SH3 полипептиды изобретения связываются с рекомбинантным человеческим IL-17А с высокой аффинностью.

Этот пример показывает клонирование и экспрессию разных форматов полученных на основе Fyn SH3 IL-17А-связывающих полипептидов, а также характеристику этих полипептидов по результатам гель-хроматографии и поверхностного плазменного резонанса.

а) Клонирование и экспрессия IL-17А-связывающих полипептидов, полученных на основе Fyn SH3.

Выбранные IL-17А-связывающие полипептиды (клон B1_2: SEQ ID NO:39, клон Е4: SEQ ID NO:57 и клон 2С1: SEQ ID NO:107), полученные на основе Fyn SH3 клонировали в цитозольный экспрессирующий вектор pQE-12 и экспрессировали, а также очищали, как описано в Grabulovski et al. (Grabulovski et al. (2007) JBC, 282, p.3196-3204).

b) Клонирование и экспрессия полученных па основе Fyn SH3 IL-17A-связывающих полипептидов, слитых с Fc-частью антитела человека IgG1.

Клоны Е4 и 2С1 (SEQ ID NO:57 и SEQ ID NO:107) клонировали и экспрессировали, в виде слитых белков с Fc-частью антитела человека IgG1 (см. ниже для процедуры; SEQ ID NO:117 и 118). Кроме того, клонировали 2С1-димер с линкером из 10 аминокислот [(2C1)2-Fc] и экспрессировали, как Fc-слитый белок (SEQ ID NO:119).

Fc-часть IgG1 человека амплифицировали с помощью ПЦР, используя праймеры fm5 (5' ATCGGGATCCGACAAAACTCACACATGCC 3', SEQ ID NO:121) и fm6 (5' TACGAAGCTTTCATTTACCCGGAGACAGGG 3', SEQ ID NO:122) и используя коммерческий эукариотический вектор pFUSE-hIgG1-Fc2 (Invivogen) в качестве матрицы. Результирующий ПЦР-продукт расщепляли с помощью BamHI/HindIII и лигировали с вектором pASK-IBA2 (IBA-Biotagnology), предварительно расщепленным теми же ферментами, получая новый вектор pAF.

Генетическую информацию клонов Е4 и 2С1 (SEQ ID NO:57 и SEQ ID NO:107) амплифицировали с помощью ПЦР с использованием fm7 (5' ATATCACCATGGGGCCGGAGTGACACTCTTTGTGGCCCTTTATG 3', SEQ ID NO:123) и fm8 (5' CGTAGGA-TCCCTGGATAGAGTCAACTGGAGC 3', SEQ ID NO:124). Для приготовления 2С1-димера, слитого с Fc, использовали 2С1 ДНК-матрицу для двух независимых PCR. В первой реакции использовали праймеры 47b.fo (5' AGA GCC ACC TCC GCC TGA ACC GCC TCC ACC CTG GAT AGA GTC AAC TGG AGC CAC 3', SEQ ID NO:125) и 52. ba (5' GAC TAA CGA GAT CGC GGA TCC GGA GTG АСА СТС TTT GTG GCC CTT TAT 3', SEQ ID NO:126) и во второй использовали ПЦР-праймеры 48b.ba (5' GGT GGA GGC GGT TCA GGC GGA GGT GGC TCT GGA GTG АСА СТС TTT GTG GCC CTT TAT 3', SEQ ID NO:127) и 51. fo (5' АТС ССА AGC ТТА GTG ATG GTG ATG GTG ATG CAG АТС СТС TTC TGA GAT GAG TTT TTG TTC ACC CTG GAT AGA GTC AAC TGG AGC CAC 3', SEQ ID NO:128).

Два ДНК-фрагмента собирали с помощью ПЦР с получением 2С1-гомодимера с линкером из 10 аминокислот (GGGGSGGGGS, SEQ ID NO:120) между двумя доменами. Результирующий ДНК-фрагмент дополнительно амплифицировали, как описано для 2С1-мономера, используя праймеры fm7 и fm8. Затем, полученные ПЦР-продукты расщепляли с помощью NcoI/BamHI и клонировали в дважды расщепленный периплазматический экспрессирующий вектор pAF. Плазмиды электропорировали в TG1 Е.coli и экспрессию белков индуцировали с помощью 0,2 мкг/мл ангидротетрациклина. Бактериальные культуры растили всю ночь при температуре 25°С в ротационном шейкере и слитые белки Fynomer-Fc очищали от периплазматической фракции в стадии очистки монобелка А с помощью аффинной хроматографии. Электрофорез в полиакриламидном геле в присутствии додецилсульфата натрия (SDS PAGE, Invitrogen) проводили с 20 мкл белкового раствора.

c) Гель-хроматография (SEC)

Гель-хроматографию (SEC) выполняли на системе AKTA FPLC, используя колонку Superdex 75 (10/300) или колонку Superdex 75 Short (5/150) (GE Healthcare).

d) Измерения аффинности

Измерения аффинности осуществляли, используя устройство BIAcore 3000 (Biacore). Для анализа взаимодействия между биотинилированными IL-17A и мономерными IL-17А-связывающими полипептидами, полученными на основе Fyn SH3, и между биотинилированными IL-17A и E4-Fc (SEQ ID NO:117), использовали стрептавидиновый SA-чип (Biacore) с иммобилизированными 1300 и 510 RU биотинилированными IL-17A, соответственно. Подвижным буфером являлся PBS, 0,1% NaN3 и сурфактант Р20 (Biacore). Взаимодействия измеряли при скорости потока 20 мкл/мин и вводили различные концентрации IL-17А-связывающих полипептидов, полученных на основе Fyn SH3. Для анализа взаимодействия между IL-17A и слитым 2С1-Fc, а также слитым (2C1)2-Fc, чип СМ5 (Biacore) покрывали 2900 RU козьим античеловеческим IgG Fc-специфичным антителом (Jackson Immunoresearch). Подвижным буфером являлся HBS-EP (Biacore). Взаимодействия измеряли путем введения от около 250 до 275 резонансных единиц Fc-слитого белка при скорости потока 10 мкл/мин, с последующим инъецированием различных концентраций IL-17A (R&D Systems) при скорости потока 30 мкл/мин. Все кинетические данные взаимодействия (отдельные kon/koff) оценивали с использованием программного обеспечения 3.2RC1 для определения BIA.

e) Результаты

Выходы экспрессии для мономерных IL-17А-связывающих полипептидов изобретения, полученных на основе Fyn SH3, изменялся от 60 до 85 мг/литр бактериальной культуры при неоптимизированных условиях во встряхиваемых колбах. Fc-слитые белки экспрессировались с выходом от 0.2 до 0,4 мг/литр (Таблица I). Fc-слитые белки имеют последовательности, указанные в SEQ ID NO:117-119, которые находятся в приложении.

Таблица I
Выходы экспрессии после очистки бактериальной культуры при неоптимизированных условиях во встряхиваемых колбах в Е.coli
Клон SEQ ID NO: Выход экспрессии (мг/л)
В1_2 39 65
Е4 57 85
2С1 107 60
E4-Fc 117 0,4
2C1-Fc 118 0,3
[(2C1)2-Fc] 119 0,2

Фиг.1 показывает анализ SDS PAGE указанных очищенных белков.

Профили гель-хроматографии (SEC) демонстрируют, что все конструкции элюированы главным образом как единичные, мономерные пики (см. Фиг.2). Как уже наблюдалось в более ранних исследованиях для связывающих белков, полученных на основе Fyn SH3 (Grabulovski et al. (2007) JBC, 282, p.3196-3204), основной пик элюирует позже, чем ожидалось для белка около 8 кДа. Для Fc-слитых белков изобретения вторую стадию очистки с помощью гель-хроматографии осуществляли после одностадийной очистки с использованием белок А-сефарозы, получая мономерные белки, как показано для слитого белка E4-Fc (SEQ ID NO:117) на Фиг.2е. E4-Fc (SEQ ID NO:117) стабилен в течение, по меньшей мере, 40 дней при хранении при температуре 4°С в PBS.

Свойства связывания анализировали путем проведения анализа взаимодействия в реальном времени на чипе BIAcore (Фигура 3), показывая следующие константы диссоциации (KD) для выбранных IL-17А-связывающих полипептидов и слитых белков:

Таблица II
Клон SEQ ID NO: KD
В1_2 39 117 нМ
Е4 57 31 нМ
2С1 107 5 нМ
E4-Fc 117 5 нМ
2C1-Fc 118 305 пМ
[(2C1)2-Fc] 119 180 пМ

Пример 3. Анализ клеточного ингибирования IL-17A

IL-17A вызывает продукцию IL-6 в фибробластах дозо-зависимым образом (Yao et al. (1995) Immunity, 3, p.811-821). Ингибиторные активности указанных IL-17A-связывающих полипептидов, полученных на основе Fyn SH3 и слитых белков, тестировали путем стимулирования фибробластов кожи человека рекомбинантным IL-17A в отсутствии или присутствии различных концентраций Fyn SH3-мутантов или химеры IL-17A рецептор человека Fc. Супернатанты клеточных культур отбирали после 24 ч стимуляции и анализировали на IL-6 с помощью ELISA. В дополнении, выполняли колориметрический тест, используя реагент ХТТ для демонстрации, что клетки являлись жизнеспособными после 24 ч инкубации с только IL-17A, или с IL-17A и ингибиторными IL-17А-связывающими полипептидами изобретения, полученными на основе Fyn SH3 или с IL-17A и IL-17R-Fc-химерой. Только жизнеспособные и метаболически активные клетки способны восстанавливать соль тетразолия ХТТ до окрашенных оранжевым цветом соединений формазана (Scudiero, et al.(1988). Cancer Res. 48, p.4827-4833).

Методы

Для удаления эндотоксинов, указанные белковые растворы фильтровали трижды через мембрану Acrodisc Mustang E (VWR). После фильтрации, уровни эндотоксинов белковых растворов, содержащих ингибиторные IL-17А-связывающие полипептиды изобретения, полученными на основе Fyn SH3 составляли менее 0,1 единиц эндотоксина/мл, как определено с помощью теста с лизатом амебоцитов Limulus (Limulus amebocyte lysate, LAL) (PYROGENT Single test Gel Clot LAL Assay (Lonza)).

400 мкл клеточной суспензии, содержащей около 1×104 нормальных фибробластов кожи человека (PromoCell, NHDF-c, С12300), распределяли на лунку (24-луночный планшет, Nunc or TPP) и культивировали в течение 24 часов при 37°С (среда: питательная среда для культивирования фибробластов С-23010, Fibroblast Growth Medium C-23010, PromoCell). Супернатант удаляли и после смешивания различных концентраций IL-17A-связывающих полипептидов изобретения, полученных на основе Fyn SH3 или химерой IL-17A рецептор Fc (RnD Systems) с IL-17A (RnD Systems), содержащего среду (итоговая концентрация 50 нг/мл), добавляли 350 мкл соответствующего раствора на лунку (соотношение смешения между ингибиторным раствором и IL-17А-содержащей среды составляло 1:3). В качестве положительного контроля PBS смешивали с IL-17A, содержащим среду ("без ингибитора"), в соотношении 1:3 и в качестве отрицательного контроля PBS смешивали только со средой ("без IL-17A") в соотношении 1:3. Для определения IL-6-продукции, зависимой от IL-17A, использовали среду, содержащую IL-17A (итоговые концентрации IL-17A: 10, 25 и 50 нг/мл), и смешивали с PBS в соотношении 3:1. Через 24 часа инкубации при 37°С супернатант удаляли и концентрацию IL-6 определяли с помощью ELISA в соответствии с инструкциями производителя (набор IL-6 ELISA, R&D Systems). Непосредственно после удаления супернатанта добавляли ХТТ-содержащую среду (набор для пролиферации клеток - Cell Proliferation Kit II, Roche) и определяли жизнеспособность клеток в соответствии с инструкциями производителя.

Процент ингибирования IL-17A определяли по следующей формуле:

Ингибирование (%) = 100- (A450-650 нм(образец)-A450-650 нм(отр .контроль) × 100) (A450-650 нм(пол .контроль)-A450-650 нм(отр .контроль))

Результаты

Нормальные фибробласты кожи человека (NHDF) инкубировали с IL-17A при различных концентрациях. Фигура 4 (а) показывает IL-17A дозо-зависимую индукцию IL-6. На следующем этапе NHDF-клетки инкубировали с IL-17A (50 нг/мл) и различными концентрациями указанных IL-17А-связывающие полипептиды изобретения, полученных на основе Fyn SH3 или химерой IL-17A рецептор-Fc (Фигура 4(b)). Согласно наблюдениям, оба клона 2С1 (SEQ ID NOD:107) и Е4 (SEQ ID NO:57) ингибировали IL-17А-индуцированную продукцию IL-6 со значением IC50 около 1 нМ и 6 нМ, соответственно. Химера IL-17A рецептор-Fc имела установленное значение IC50, составляющее 500 пМ (R&D Systems). В этом эксперименте, было получено значение около 1 нМ. Анализ отображает репрезентативный результат трех независимых экспериментов. Для дополнительной демонстрации, что ингибирование IL-6-продукции являлось следствием специфической нейтрализации IL-17A, клетки инкубировали с Fyn SH3 wt-доменом (Grabulovski et al. (2007) JBC, 282, p.3196-3204) в качестве белка, не обладающего связывающей специфичностью в отношении IL-17A (Фигура 4 (с)). Как предполагалось, не наблюдали ингибирования продукции IL-6, тогда как клон 2С1 (SEQ ID NOD:107) был способен ингибировать IL-17А-вызванную продукцию IL-6. На Фигуре 4(d) представлен анализ ХТТ, подтверждающий, что все клетки жизнеспособны после инкубации с IL-17А-связывающими полипептидами изобретения, полученными на основе Fyn SH3 (в концентрации 750 нМ) и IL-17-рецептором (10 нМ) в течение 24 часов.

Пример 4. Стабильность

Ключевым аспектом любого биологического соединения, предназначенного для терапевтического применения, является его стабильность и устойчивость к агрегации при хранении в растворе. IL-17А-связывающие полипептиды изобретения, полученные на основе Fyn SH3, являются особенно подходящими лекарственными средствами и диагностическими кандидатами, поскольку они имеют подтвержденную стабильность при хранении при 4°С или при -20°С в течение, по меньшей мере, 6 месяцев в образце, физиологического раствора, забуференном фосфатами.

Методы

Белковые растворы IL-17А-связывающих полипептидов изобретения хранили в течение 6 месяцев при 4°С и при -20°С после очистки. Для анализа белковой стабильности и состояния агрегации, белковые растворы фильтровали (Millex GP, 0,22 µm, Millipore) и осуществляли гель-хроматография (SEC) на системе AKTA FPLC, используя колонку Superdex 75 Short (5/150) (GE Healthcare)

Результаты

Полученный на основе Fyn SH3Fyn IL-17А-связующий полипептид G3 (SEQ ID NO:34) продуцировался с выходом экспрессии 123 мг/л и элюировался главным образом как единичный пик из гель-хроматографической колонки (см. Фигура 5).

Стабильность и агрегационпую устойчивость G3 (SEQ ID NO:34) оценивали путем хранения белка при 4°С и -20°С в PBS. Через 6 месяцев определяли состояние белка путем гель-хроматографии. Измерения не показали каких-либо признаков агрегации или деградации. Профили элюции через 6 месяцев хранения показаны на Фигуре 6.

Пример 5. Время полужизни in vivo

Время полужизни in vivo слитого белка изобретения E4-Fc (SEQ ID NO:117) определяли путем измерения концентраций E4-Fc (SEQ ID NO:117) в мышиной сыворотке в разные моменты времени после однократной внутривенной инъекции с помощью ELISA.

Методы

Клонирование и экспрессия E4-Fc (SEQ ID NO:117) описаны в Примере 2. 200 мкл 3,3 мкМ (0,22 мг/мл) раствора E4-Fc (SEQ ID NO:117) инъецировали внутривенно 5 мышам (C57BL/6, Charles River). Через 7 минут, 20 минут, 1, 2, 4, 8, 24 и 48 ч около 20 мкл крови отбирали из подкожной вены с помощью капилляра Microvette СВ 300 (Sarstedt). Образцы крови центрифугировали в течение 10 мин при 9500×g и сыворотку хранили при -20° до осуществления анализа ELISA. Используя серии разведении E4-Fc (SEQ ID NO:117) с известными концентрациями, определяли концентрацию E4-Fc (SEQ ID NO:117) в сыворотке с помощью ELISA: 50 мкл биотинилированного IL-17A (30 нМ) (R&D Systems, биотинилированный, используя NHS-PEO4-биотин (Pierce) в соответствии с инструкциями производителя) добавляли к стрептавидин-покрытым лункам (Reactibind, Pierce) и после блокировки PBS, 4% молоко (Rapilait, Migros, Switzerland), добавляли 45 мкл PBS, 4% молоко и 5 мкл сыворотки. После инкубации в течение 1 ч и отмывки, связывание Fc-слитых белков детектировали с помощью конъюгата белок A-HRP (Sigma). Активность пероксидазы определяли путем добавления субстрата QuantaRed enhanced chemifluorescent HRP (Pierce). Интенсивность флуоресценции измеряли через 5-10 мин при длине волны 544 нм (возбуждение) и 590 нм (эмиссия). Из концентраций E4-Fc (SEQ ID NO:117), определенных в сыворотке ((n≥3 на момент времени, за исключением последнего момента времени: n=1) в разные моменты времени и полученный наклон k фазы элиминации (нанесенные на полулогарифмической шкале), рассчитывали время полужизни E4-Fc (SEQ ID NO:117), используя формулу t1/2=ln2/-k.

Результаты

Время полужизни слитого белка изобретения E4-Fc (SEQ ID NO:117), как рассчитано из фазы элиминации (бета фаза, 4 последних момента времени), составляло 50,6 часов (см. Фигура 7).

Пример 6. ELISA для определения связывающей специфичности IL-17A-связывающих полипептидов и слитых белков

Методы

Белком-мишенью IL-17F человека (R&D systems), мышиным IL-17A (R&D Systems), TNF-альфа человека (Thermo Scientific), IL-6 человека (R&D Systems), бычьим сывороточным альбумином (Sigma) и овальбумином (Sigma) покрывали планшет MaxiSorp (Nunc) в течение всей ночи (100 мкл каждой мишени в концентрации 5 мкг/мл). Лунки промывали трижды с помощью PBS и после блокировки 200 мкл PBS, 4% молоко (Rapilait, Migros) и стадией отмывки PBS (как выше), к лункам добавляли 50 мкл 2С1 (SEQ ID No:107) в итоговой концентрации 50 нМ вместе с 50 мкл анти-myc антителом 9Е10 (собственного производства, с оптической плотностью основного раствора OD=2 и разведенного 1:250 в PBS, 2% молоко). После инкубации лунки промывали трижды с помощью PBS и к лункам добавляли 100 мкл анти-мышиного-HRP-иммуноконъюгата (Sigma), разведенного 1:1000 в PBS, 2% молоко. 96-луночный планшет инкубировали в течение 1 ч при комнатной температуре (RT) и затем промывали трижды с помощью PBS, 0,1% Tween с последующим трехкратным промыванием только PBS. Выполняли колориметрическое детектирование путем добавления 100 мкл субстрата ВМ blue POD (Roche) и реакцию останавливали 60 мкл 1 М H2SO4.

Результаты

Клон 2С1 (SEQ ID No:107) связывает IL-17A человека высоко специфичным образом и не реагирует перекрестно с любыми другими тестируемыми белками, что показано посредством ELISA (Фигура 8). Небольшой сигнал выше фонового наблюдали для IL-17F, но если 2С1 использовали в качестве зонда для IL-17F-покрытого чипа BIAcore, детектируемое связывание не обнаруживалось (данные не показаны).

Пример 7. Полипептид изобретения, полученный на основе Fyn SH3, специфично и с высокой аффинностью связывает IL-17A человека и макаки.

Методы

а) Специфичность

Для определения связывающей специфичности IL-17А-связывающих полипептидов изобретения, использовали следующие белки-мишени (больше белков-мишеней по сравнению с Примером 6):

- IL-17А человека (R & D Systems)

- IL-17В человека (Peprotech)

- IL-17С человека (R & D Systems)

- IL-17D человека (Peprotech)

- IL-17E человека (Peprotech)

- IL-17F человека (Abd Serotec)

- IL-17А мыши (R & D Systems)

- IL-17А крысы (Akron Biotech)

- IL-17А собаки (R & D Systems)

- IL-17A макаки (macaca fascicularis) (собственного производства, продуцируемый в E.coli, без сигнального пептида, с C-концевым глициновым остатком с последующей меткой hexa-his, ренатурированный из телец включения, SEQ ID NO:129)

- внешний домен В фибронектина (собственного производства продуцируемый в E.coli; см. Carnemolla et al. (1996) Int J Cancer, 68(3), p.397-405)

- IL-6 человека (R & D Systems)

- TNF альфа человека (Thermo Scientific)

- Овальбумин (Sigma)

- BSA (бычий сывороточный альбумин Sigma)

Белками-мишенями покрывали планшет MaxiSorp (Nunc) в течение ночи (100 мкл каждой мишени при концентрации 10 мкг/мл). Лунки промывали трижды с помощью PBS и после блокировки 200 мкл PBS, 4% молоко (Rapilait, Migros) в течение 1 часа при комнатной температуре и последующей стадии отмывки PBS (как выше), к лункам добавляли 50 мкл полипептида изобретения 2С1 (SEQ ID No:107), полученного на основе Fyn SH3 в итоговой концентрации 80 нМ вместе с 50 мкл анти-myc антитела 9Е10 (собственного производства, с оптической плотностью основного раствора OD=2 и разведенного 1:250 в PBS, 2% молоко). После инкубации лунки промывали трижды с помощью PBS и к лункам добавляли 100 мкл анти-мышиного-HRP-иммуноконъюгата (Sigma), разведенного 1:1000 в PBS, 2% молоко. 96-луночный планшет инкубировали в течение 1 ч при комнатной температуре и затем отмывали трижды с помощью PBS, 0,1% Tween с последующей трехкратной отмывкой только PBS. Колориметрическое детектирование выполняли путем добавления 100 мкл субстрата ВМ blue POD (Roche) и реакцию останавливали 60 мкл 1 М H2SO4.

b) Измерения аффинности к IL-17A макаки

Измерения аффинности осуществляли, используя устройство BIAcore 3000 (Biacore). Для анализа взаимодействия между IL-17A макаки и полипептидом изобретения 2С1 (SEQ ID NO:107), полученным на основе Fyn SH3, СМ5-чип (Biacore) покрывали 6900 резонансных единиц IL-17A макаки. Подвижным буфером являлся HBS-EP (Biacore). Взаимодействия измеряли при скорости потока 20 мкл/мин и инъекции различных концентраций IL-17А-связующего полипептида изобретения 2С1 (SEQ ID NO:107), полученного на основе Fyn SH3. Все кинетические данные взаимодействия (отдельные kon/koff) оценивали, используя программное обеспечение BIA evaluation 3.2RC1.

Результаты

Полипептид изобретения 2С1 (SEQ ID No:107), полученный на основе Fyn SH3, связывает IL-17A человека и макаки высоко специфичным образом и не реагирует перекрестно с любыми другими тестируемыми белками, что показано посредством ELISA (Фигура 9).

Аффинность мономерного полипептида изобретения 2С1 (SEQ ID NO:107), полученного на основе Fyn SH3, для IL-17A макаки измеряли с помощью Biacore, используя IL-17A макаки, продуцируемый в E.coli (ренатурированный из телец включения). Обнаружили, что 2С1 связывает IL-17A макаки с константой равновесия диссоциации (KD) 11 нМ (Фигура 10).

Пример 8. Экспрессия полученных на основе Fyn SH3 полипептидов изобретения, слитых с Fc-частью и с модифицированной Fc-частью антитела человека IgG1 в клетках млекопитающих.

Полипептид изобретения 2С1 (SEQ ID NO:107), полученный на основе Fyn SH3, был генетически слит с Fc-частыо IgG1 (2C1-Fc, SEQ ID NO:130) и экспрессирован в клетках HEK EBNA. Полипептид изобретения 2С1 (SEQ ID NO:107), полученный на основе Fyn SH3, также был клонирован слитам с модифицированной Fc-частью IgG1 человека, содержащей мутации L234A (аланин вместо лейцина в аминокислотном положении 234) и L235A и экспрессирован в клетках HEK EBNA (2C1-Fc(LALA), SEQ ID NO:131). Кроме того, были продуцированы следующие четыре варианта слитого белка 2C1-Fc(LALA) с линкерами разной длины между полипептидом изобретения, полученным на основе Fyn SH3 и Fc-частью:

- (SEQ ID NO:132) "2C1-m5E-Fc(LALA)"; удлинение шарнирной области за счет 5 аминокислот: EPKSS-линкер

- (SEQ ID NO:133) "2C1-m5-Fc(LALA)"; удлинение на 5 аминокислот, GGGGS-линкер

- (SEQ ID NO:134) "2C1-m10-Fc(LALA)"; удлинение на 10 аминокислот, GGGGS)2-линкер

- (SEQ ID NO:135) "2C1-m15-Fc(LALA)"; удлинение на 15 аминокислот, (GGGGS)3-линкер

Методы

Клонирование "2C1-Fc"; полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) сливали с Fc-частью антитела человека IgG1 (SEQ ID NO:130):

Ген, кодирующий клон 2С1 (SEQ ID NO:107), использовали в качестве матрицы и амплифицировали, используя праймеры SB3 (5' CGA ATT CGG GAG TGA CAC TCT TTG TGG ССС 3', SEQ ID NO:136) и SB4 (5' GAA GAT CTC TGG ATA GAG TCA ACT GGA GCC 3', SEQ ID NO:137), вводя сайты рестрикции EcoRI и BglII. Полученный ПЦР-продукт расщепляли с помощью EcoRI и BglII и клонировали в предварительно дважды расщепленный вектор pFUSE-hIgG1-Fc2 (Invivogen), Для клонирования этого Fc-слияния в рСЕР4-вектор (Invitrogen), полученный вектор pFUSE, содержащий ген, кодирующий слитый 2C1-Fc, использовали в качестве матрицы и амплифицировали с праймерами SB5 (5' ССС AAG CTT GGG ATG GGC TAC AGG ATG САА CTC CTG ТС 3', SEQ ID NO:138) и SB6 (5' CGG GAT CCT CAT TTA ССС GGA GAC AGG GAG 3', SEQ ID NO:139), вводя сайты рестрикции HindIII и BamHI. После расщепления с HindIII/BamHI, вставку лигировали с предварительно дважды расщепленным вектором рСЕР4, получая плазмиду, содержащую генетическую информацию SEQ ID NO:130.

Клонирование "2C1-Fc(LALA)": полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) сливали с модифицированной Fc-частью антитела человека IgG1 (L234A, L235A) (получая SEQ ID NO:131)

Вышеупомянутую плазмиду, содержащую генетическую информацию 2C1-Fc (SEQ ID NO:130), использовали в качестве матрицы для двух реакций ПЦР. В первой реакции, использовали праймеры SB5 и SB7 (5' ACT GAC GGT ССС ССС GCG GCT TCA GGT GCT GGG CAC 3', SEQ ID NO:140). Во второй ПЦР использовали праймеры SB8 (5' GCC GCG GGG GGA CCG TCA GTC ТТС CTC ТТС СС 3', SEQ ID NO:141) и SB6. Выполняли ПЦР-сборку с двумя фрагментами в качестве матриц, полученный ПЦР-продукт расщепляли с помощью BamHI и HindIII и лигировали с расщепленным рСЕР4-вектором, как описано выше.

Клонирование "2C1-m5E-Fc(LALA)" (SEQ ID NO:132); полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) сливали с помощью EPKSS-линксра из 5 аминокислот с модифицированной Fc-частью антитела человека IgG1 (L234A, L235A)

Вышеупомянутую плазмиду, содержащую генетическую информацию 2С1-Fc(LALA) (SEQ ID NO:131), использовали в качестве матрицы для двух ПЦР. В первой реакции использовали праймеры SB5 и "Ba_2C1_R_EPKSS" (5' GCT GCT TTT CGG TTC CTG GAT AGA GTC AAC TGG AGC CAC 3', SEQ ID NO:142). Во второй реакции использовали праймеры SB6 и "Ba_Hinge_F_EPKSS" (5' GAA CCG AAA AGC AGC GAC AAA ACT CAC АСА TGC CCA CCG 3', SEQ ID NO:143). Осуществляли ПЦР-сборку с обоими фрагментами в качестве матриц, полученный ПЦР-продукт расщепляли с помощью BamHI и HindIII и лигировали с расщепленным рСЕР4-вектором, как описано выше.

Клонирование "2C1-m5-Fc(LALA)" (SEQ ID NO:133): полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) сливали с помощью GGGGS-линкера из 5 аминокислот с модифицированной Fc-частью антитела человека IgG1 (L234A, L235A)

Вышеупомянутую плазмиду, содержащую генетическую информацию 2С1-Fc(LALA) (SEQ ID NO:131), использовали в качестве матрицы для двух ПЦР. В первой реакции использовали праймеры SB5 и 47c.fo (5' TGA ACC GCC TCC ACC CTG GAT AGA GTC AAC TGG AGC CAC 3', SEQ ID NO:144). Во второй реакции использовали праймеры SB6 и "Ba_Hinge_F_5aaGS-линкер" (5' GGT GGA GGC GGT TCA GAC AAA ACT CAC АСА TGC CCA CCG 3', SEQ ID NO:145). Осуществляли ПЦР-сборку с обоими фрагментами в качестве матриц, полученный ПЦР-продукт расщепляли с помощью BamHI и HindIII и лигировали с расщепленным рСЕР4-вектором, как описано выше.

Клонирование "2C1-m10-Fc(LALA)" (SEQ ID NO:134): полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) сливали с помощью линкера из 10 аминокислот (GGGGS)z с модифицированной Fc-частью антитела человека IgG1 (L234A, L235A)

Вышеупомянутую плазмиду, содержащую генетическую информацию 2С1-Fc(LALA) (SEQ ID NO:131), использовали в качестве матрицы для двух ПЦР. В первой реакции использовали праймеры SB5 и 47b.fo (5' AGA GCC ACC TCC GCC TGA ACC GCC TCC ACC CTG GAT AGA GTC AAC TGG AGC CAC 3', SEQ ID NO:146). Во второй реакции использовали праймеры SB6 и "Ba_Hinge_F_10aaGS-линкер" (5' GGT GGA GGC GGT TCA GGC GGA GGT GGC TCT GAC AAA ACT CAC АСА TGC CCA CCG 3', SEQ ID NO:147). Осуществляли ПЦР-сборку с обоими фрагментами в качестве матриц, полученный ПЦР-продукт расщепляли с помощью BamHI и HindIII и лигировали с расщепленным рСЕР4-вектором, как описано выше.

Клонирование "2C1-m15-Fc(LALA)" (SEQ ID NO:135); полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) сливали с помощью линкера из 15 аминокислот (GGGGS)3 с модифицированной Fc-частью антитела человека IgG1 (L234A, L235A)

Вышеупомянутую плазмиду, содержащую генетическую информацию 2С1-Fc(LALA) (SEQ ID NO:131), использовали в качестве матрицы для двух ПЦР. В первой реакции использовали праймеры SB5 и 47.fo.corr (5' TGA TCC GCC АСС GCC AGA GCC АСС TCC GCC TGA АСС GCC TCC АСС CTG GAT AGA GTC AAC TGG AGC САС 3', SEQ ID NO:148). Во второй реакции использовали праймеры SB6 и "Ba_Hinge_F_15aaGS-линкер" (5' GGT GGA GGC GGT TCA GGC GGA GGT GGC TCT GGC GGT GGC GGA TCA GAC AAA ACT САС АСА TGC CCA CCG 3', SEQ ID NO:149). Осуществляли ПЦР-сборку с обоими фрагментами в качестве матриц, полученный ПЦР-продукт расщепляли с помощью BamHI и HindIII и лигировали с расщепленным рСЕР4-вектором, как описано выше.

Для экспрессии слитых белков, соответствующие плазмиды очищали, используя набор, не содержащий эндотоксин, Megaprep (Qiagen), и использовали для временной трансфекции HEK EBNA-клеток (АТСС No CRL-10852). HEK EBNA-клетки высеивали при 30% конфлюэнтности за 24 часа до трансфекции. Среду заменяли на DMEM/5% FCS/penstrep (Invitrogen) непосредственно перед трансфекцией. 60 мкг ДНК использовали для трансфекции 150 см2 адгезивных клеток. ДНК и PEI (25 кДа от Polysciences) смешивали в соотношении 1:3 и перемешивали на вортексе в течение 10 сек. Затем, смесь ДНК/PEI инкубировали при RT в течение 10 минут и потом добавляли к HEK EBNA-клеткам. Через 24 часа среду заменяли CD-CHO/HT/L-глутамин/Penstrep (Invitrogen) и инкубировали при 37°C с 5% СО2. Через 96 часов собирали супернатант клеточной культуры.

Для очистки белка, супернатант клеточной культуры использовали в аффинной колонке белок А-сефароза. Потом, колонку промывали PBS с последующей элюцией белка, используя 0,1 М глицина, рН 2,7. Затем элюированный белок подвергали диализу в PBS. При необходимости, осуществляли вторую стадию очистки для удаления эндотоксинов с помощью Triton-X114 (Magalhaes et al. (2007) J Pharm Pharmaceut Sci, 10(3), p.388-404).

Результаты

Производные Fyn SH3 слитые с Fc по изобретению могут быть экспрессированы и очищены. Фигура 11 показывает анализ SDS PAGE Fc-слитых белков.

Пример 9. Полипептиды изобретения, полученные на основе Fyn SH3 стабильны в сыворотке человека

Белковые лекарственные средства должны быть стабильными в сыворотке в течение определенного периода времени для того, чтобы быть способными вызывать фармакодинамические эффекты у пациентов. В этом примере, тестировали сывороточную стабильность 2C1-Fc (SEQ ID NO:130).

Методы

Готовили раствор из 3 мл сыворотки человека (Sigma), содержащий 10 мкг/мл 2C1-Fc (SEQ ID NO:130) и помещали в инкубатор при 37°С, 200 мкл образца отбирали в определенный момент времени и замораживали при -20°С до конца эксперимента. Через 5 дней, осуществляли ELISA с собранными образцами, используя 2С1-Fc-образец (SEQ ID NO:130), который хранили при 4°С в PBS в качестве контрольного стандарта.

Для осуществления ELISA, IL-17A (R&D Systems) наносили на планшет MaxiSorp (Nunc) на всю ночь (100 мкл из 5 мкг/мл). Лунки промывали трижды с помощью PBS и после блокировки 200 мкл PBS, 4% молоко (Rapilait, Migros) и стадии отмывки PBS (как выше), добавляли 100 мкл тестируемых образцов, содержащих 2C1-Fc (SEQ ID NO:130) (при указанных концентрациях), разведенного в PBS, 2% молоко. После инкубации, лунки промывали трижды с помощью PBS, с последующим добавлением 100 мкл Белок A-HRP (Sigma), разведенного 1:1000 в PBS, 2% молоко. 96-луночный планшет инкубировали в течение 1 ч при RT и затем отмывали трижды с помощью PBS, 0,1% Tween с последующим трехкратным отмыванием только PBS. Колориметрическое детектирование выполняли путем добавления 100 мкл субстрата ВМ blue POD (Roche) и реакцию останавливали 60 мкл 1 М H2SO4.

Результаты

После 5-дневного периода хранения в сыворотке человека при 37°С 2C1-Fc (SEQ ID NO:130) был способен связывать свою мишень IL-17A, по существу также как 2C1-Fc (SEQ ID NO:130), который хранился в PBS при 4°С, что показывает, что 2C1-Fc (SEQ ID NO:130) является стабильным в сыворотке человека при 37°С (Фигура 12).

Пример 10. Полипептиды изобретения, полученные на основе Fyn SH3, ингибируют IL-17A in vitro

В этом анализе указанные полипептиды изобретения, полученные на основе Fyn SH3, тестировали на их способность ингибировать IL-17A in vitro. Клеточный анализ аналогичен клеточному анализу, описанному в Примере 3 данного изобретения, за исключением того, что IL-17A использовали при более низкой концентрации 1 нг/мл (по сравнению с 50 нг/мл в Примере 3) вместе с TNF альфа (50 пг/мл).

Методы

Уровни эндотоксина тестируемых IL-17А-связывающих полипептидов изобретения, полученных на основе Fyn SH3, составляли менее чем 0,1 единиц эндотоксина/мл, как определено с помощью теста с лизатом амебоцитов Limulus (LAL, PYROGENT Single test Gel Clot LAL Assay (Lonza)).

Нормальные фибробласты кожи человека (NHDF, PromoCell Inc., NHDF-c, С12300) использовали для клеточного анализа ингибирования IL-17A. Добавление IL-17A человека (R&D Systems) в комбинации с фактором некроза опухоли-α человека (TNF-α, Thermo Fisher Scientific) к среде клеточных культур индуцирует продукцию IL-6 у клеток NHDF дозо-зависимым образом. IL-6, высвобождающийся в среду клеточных культур (PromoCell, C-23010), количественно определяли в супернатанте клеточных культур с помощью ELISA, используя коммерчески доступный набор для ELISA (R&D Systems, DuoSet ELISA System kit (DY206)).

104 нормальных фибробластов кожи человека (PromoCell, NHDF-c, С12300) распределяли на лунку (24-луночный планшет, Nunc или ТРР) и культивировали в течение 24 часов при 37°С (среда: Fibroblast Growth Medium C-23010, PromoCell). Супернатант удаляли и после смешивания различных концентраций IL-17А-связывающих полипептидов изобретения, полученных на основе Fyn SH3, или химеры IL-17A рецептор-Fc (RnD Systems) с IL-17A (RnD Systems) и TNF-альфа (Thermo Scientific), содержащего среду (1 нг/мл итоговой IL-17А-концентрации и 50 пг/мл TNF-альфа), добавляли 350 мкл соответствующего раствора на лунку, трижды (соотношение смешения между ингибиторным раствором и цитокин-содержащей средой составляло 1:23). Контрольные лунки включали инкубирование без полипептидов, полученных на основе Fyn SH3 (PBS только), один IL-17A, один TNF-α и только среда. Через 24 часа инкубации при 37°С супернатант удаляли и ELISA-поглощение (зависимое от IL-6-концентрации) определяли с помощью ELISA в соответствии с инструкциями производителя (IL-6 ELISA kit, R&D Systems).

Результаты

NHDF-клетки инкубировали с постоянной концентрацией IL-17A (1 нг/мл) и TNF-альфа (50 пг/мл) и с различными концентрациями коммерчески доступной химеры IL-17A рецептор-Fc- или с различными концентрациями следующих полипептидов изобретения, полученных на основе Fyn SH3:

- 2C1 (SEQ ID NO:107)

- 2C1-Fc (SEQ ID NO:130)

- 2C1-Fc(LALA) (SEQ ID NO:131)

- 2C1-m5E-Fc(LALA) (SEQ ID NO:132)

- 2C1-m5-Fc(LALA) (SEQ ID NO:133)

- 2C1-m10-Fc(LALA) (SEQ ID NO:134)

- 2C1-m15-Fc(LALA) (SEQ ID NO:135)

Таблица III показывает средние значения IC50, полученные от нескольких клеточных анализов, проводимых с указанными полипептидами изобретения, полученными на основе Fyn SH3. Наилучшее значение IC50 (0,11 нМ) было получено с 2C1-m15-Fc(LALA) (SEQ ID NO:135).

Таблица III
Средние значения IC50, полученные от нескольких клеточных анализов для полипептидов изобретения, полученных на основе Fyn SH3
IC50-значение (нМ) Стандартное отклонение Количество клеточных анализов
2C1 (SEQ ID NO:107) 2,31 0,08 3
2C1-Fc (SEQ ID NO:130) 1,13 0,3 4
2C1-Fc(LALA) (SEQ ID NO:131) 1,09 0,53 4
2C1-m5E-Fc(LALA) (SEQ ID NO:132) 0,72 0,3 4
2C1-m5-Fc(LALA) (SEQ ID NO:133) 1,45 n.d. 2
2C1-m10-Fc(LALA) (SEQ ID NO:134) 0,27 0,13 6
2C1-m15-Fc(LALA) (SEQ ID NO:135) 0,11 0,02 3
химера IL-17A-Рецептор-Fc (R&D Systems) 0,61 0,38 6

Пример 11. Время полужизни 2C1-Fc(LALA) in vivo (SEQ ID NO:131)

Время полужизни in vivo слитого белка изобретения 2C1-Fc(LALA) (SEQ ID NO:

131) определяли путем измерения концентраций 2C1-Fc(LALA) (SEQ ID NO:131) в мышиной сыворотке в разные моменты времени после однократной внутривенной инъекции.

Методы

Раствор 2C1-Fc(LALA) (SEQ ID NO:131) (0,2 мг/мл) инъецировали внутривенно 5 мышам (C57BL/6, Charles River), 200 мкл на мышь. После определенных временных точек отбирали около 20 мкл крови из подкожной вены с помощью капилляра Microvette CB 300 (Sarstedt). Образцы крови центрифугировали в течение 10 мин при 9500×g и сыворотку хранили при -20° до осуществления анализа ELISA. Используя серии разведении 2С1-Fc(LALA) (SEQ ID NO:131) с известными концентрациями, определяли концентрацию 2C1-Fc(LALA) (SEQ ID NO:131) в сыворотке с помощью ELISA: 50 мкл биотинилированного IL-17A (30 нМ) (R&D Systems, биотинилирован, используя NHS-PEO4-биотин (Pierce) в соответствии с инструкциями производителя) добавляли к стрептавидин-покрытым лункам (Reactibind, Pierce) и после блокировки PBS, 4% молоко (Rapilait, Migros, Switzerland), добавляли 45 мкл PBS, 4% молоко и 5 мкл образца сыворотки. После инкубации в течение 1 ч и промывания, связывание Fc-слитых белков детектировали с помощью конъюгата белок A-HRP (Sigma). Активность пероксидазы детектировали путем добавления субстрата QuantaRed enhanced chemifluorescent HRP (Pierce). Интенсивность (флуоресценции измеряли через 5-10 мин при длине волны 544 нм (возбуждение) и 590 им (эмиссия). Из концентраций 2C1-Fc(LALA) (SEQ ID NO:131), определенных в сыворотке (количество мышей n=5 на момент времени) в разные моменты времени и полученный наклон k фазы элиминации (нанесенные на полулогарифмической шкале), рассчитывали время полужизни 2C1-Fc(LALA) (SEQ ID NO:131), используя формулу t1/2=ln2/-k.

Результаты

Время полужизни слитого белка изобретения 2C1-Fc(LALA) (SEQ ID NO:131), как вычислено из фазы элиминации (бета фаза, 4 последних момента времени), составляло 53 часа (см. Фигура 13).

Пример 12. Полипептиды изобретения, полученные на основе Fyn SH3, нейтрализуют IL-17A человека in vivo

IL-17A человека способен связывать и стимулировать мышиный IL-17-рецептор, приводя к повышению и последующей секреции мышиного хемокина KC (CXCL1) (Allan В. et al. (2007) WO2007/070750, Eli Lilly, US). Наблюдаемые уровни KC через 2 часа после подкожной инъекции IL-17A (3 мкг) составляли между 500 и 1000 пг/мл в сыворотке, по сравнению с около 100 пг/мл основного уровня KC.

Методы

a) In vivo нейтрализация IL-17A, используя мономерный полипептид изобретения 2С1 (SEQ ID NO:107), полученный на основе Fyn SH3

Полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) (17 мкг) был введен мышам линии C57BL/6 (подкожно) совместно с 3 мкг IL-17A человека (R&D Systems), и через 2 часа после инъекции отбирали образцы крови из подкожной вены с помощью капилляра Microvette CB 300 (Sarstedt). Образцы крови центрифугировали в течение 10 мин при 9500×g и сыворотку хранили при -20°С до осуществления анализа ELISA. Уровни KC в сыворотке определяли, используя коммерчески доступной набор Quantikine mouse CLCL1/KC (R&D Systems). Контрольные группы включали мышей, инъецированных IL-17A и доменом Fyn SH3 wt (см., Grabulovski et al. (2007) JBC, 282, p.3196-3204) в качестве белка, с другой специфичностью связывания, PBS только, только IL-17A, только полученный на основе Fyn SH3 полипептид изобретения 2С1 (SEQ ID NO:107) или мышам давали только белок Fyn SH3 wt.

b) In vivo нейтрализация с использованием слитого 2C1-Fc (SEQ ID NO:130):

Полученный на основе Fyn SH3 полипептид изобретения 2C1-Fc (SEQ ID NO:130) (44 мкг/мышь) инъецировали внутривенно мышам линии C57BL/6. Через 20-60 минут инъецировали подкожно IL-17A человека (R&D Systems) в расчете 3 мкг/мышь и через 2 часа после инъекции IL-17A отбирали образцы крови из подкожной вены с помощью капилляра Microvette CB 300 (Sarstedt). Образцы крови центрифугировали в течение 10 мин при 9500×g и сыворотку хранили при -20°С до осуществления анализа ELISA. Уровни KC в сыворотке определяли, используя коммерчески доступный набор Quantikine mouse CLCL1/KC (R&D Systems). Контрольные группы включали мышей, инъецированных PBS (внутривенно) и IL-17A (подкожно), только PBS (внутривенно и подкожно), и полученный на основе Fyn SH3 полипептид изобретения 2C1-Fc (SEQ ID NO:130) внутривенно с последующим введением PBS (подкожно).

Результаты

После подкожной инъекции IL-17A человека мышам животные сверхэкспрессировали хемокин, называемый KC. Повышенные уровни KC в сыворотке мышей можно измерить с помощью ELISA. Инъекция полипептидных производных Fyn SH3 по изобретению предотвращает активацию KC.

a) мышам (C57BL/6) вводили подкожно IL-17A совместно с мономерным полипептидом 2С1, полученным на основе Fyn SH3 (SEQ ID NO:107). Из-за ингибиторных свойств, полученного на основе Fyn SH3 полипептида изобретения 2С1 (SEQ ID NO:107), уровни КС не повышались в этой группе, они оставались низкими, почти сравнимыми с основными уровнями. Для демонстрации того, что ингибирование продукции KC осуществлялось благодаря специфической IL-17А-нейтрализации, мышам вводили совместно IL-17A и Fyn SH3-домен дикого типа (который не обладает аффинностью связывания с IL-17A); у этих мышей, уровни KC были такими же высокими, как и в группе, которая получала только IL-17A. Фигура 14 показывает результаты, полученные из этого эксперимента.

b) Во втором эксперименте острого воспаления, полученный на основе Fyn SH3 полипептид изобретения 2C1-Fc (SEQ ID NO:130) инъецировали внутривенно, с последующей подкожной инъекцией IL-17A. Как выше указано в а), полипептидное производное Fyn SH3 изобретения предотвращает повышение уровней KC в сыворотке. Фигура 15 показывает ингибирование IL-17A посредством 2C1-Fc (SEQ ID NO:130) in vivo.

1. Полипептид, содержащий аминокислотную последовательность, которую выбирают из группы, состоящей из:
(i) SEQ ID NO: 39, 57 или 107
(ii) аминокислотной последовательности, имеющей, по меньшей мере, 80%, предпочтительно, по меньшей мере, 90%, более предпочтительно, по меньшей мере, 95% идентичность аминокислотной последовательности с (i);
(iii) фрагмента или функционального производного (i), получаемого за счет замещения, добавления и/или удаления, не более чем 5 аминокислот,
где указанный полипептид связывается с IL-17A и где, необязательно, полипептид является мультимером.

2. Полипептид по п. 1, имеющий специфическую аффинность связывания с IL-17А человека, предпочтительно с KD от 10-7 до 10-12 М, более предпочтительно от 10-8 до 10-12 М, наиболее предпочтительно менее чем 10-12 М.

3. Полипептид по п. 1, который выбирают из группы, состоящей из SEQ ID NO: 1-119 или их функциональных производных.

4. Полипептид по п. 2, который выбирают из группы, состоящей из SEQ ID NO: 1 -119 или их функциональных производных.

5. Слитый белок для применения в фармацевтике и диагностике, содержащий полипептид по любому из пп. 1-4, слитый с фармацевтически и/или диагностически активным компонентом, где, необязательно, полипептид является мультимером.

6. Слитый белок по п. 5, в котором указанным компонентом является цитокин, который предпочтительно выбирают из группы, состоящей из IL-2, IL-12, TNF-альфа, IFN альфа, IFN-бета, IFN-гамма, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, В70, TNF-бета, LT-бета, CD-40-лиганда, Fas-лиганда, TGF-бета, IL-1-альфа и 1b-1бета.

7. Слитый белок по п. 5, в котором указанным компонентом является токсическое соединение, предпочтительно низкомолекулярное органическое соединение или полипептид, более предпочтительно токсичное соединение выбирают из группы, состоящей из калихемицина, майтансиноида, неокарциностатина, эсперамицина, динемицина, кедарцидина, мадуропептина, доксорубицина, даунорубицина, ауристатина, А-цепи рицина, модеккина, укороченного экзотоксина A Pseudomonas, дифтерийного токсина и рекомбинантного гелонина.

8. Слитый белок по п. 5, в котором указанным компонентом является хемокин, который предпочтительно выбирают из группы, состоящей из IL-8, GRO-альфа, GRO-бета, GRO-гамма, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1-альфа/бета, BUNZO/STRC33, I-TAC, BLC/BCA-1, MIP-1-альфа, MIP-1-бета, MDC, ТЕСК, TARC, RANTES, НСС-1, НСС-4, DC-CK1, MIP-3-альфа, MIP-3-бета, МСР-1-5, эотаксин, эотаксин-2,1-309, MPIF-1, 6Ckine, СТАСК, МЕС, лимфотактин и фракталкин.

9. Слитый белок по п. 5, в котором указанным компонентом является флуоресцентный краситель, предпочтительно компонент, выбираемый из красителей Alexa Fluor или Су.

10. Слитый белок по п. 5, в котором указанным компонентом является фотосенсибилизатор, предпочтительно фототоксичный красный флуоресцентный белок KillerRed или гематопорфирин.

11. Слитый белок по п. 5, в котором указанным компонентом является прокоагулянтный фактор, предпочтительно тканевый фактор.

12. Слитый белок по п. 5, в котором указанным компонентом является фермент для активации пролекарств, причем фермент предпочтительно выбирают из группы, состоящей из карбоксипептидаз, глюкуронидаз и глюкозидаз.

13. Слитый белок по п. 5, в котором указанным компонентом является радионуклеид либо из группы гамма-излучающих изотопов, предпочтительно 99mTc, 123I, 111In, либо из группы излучателей позитронов, предпочтительно 18F, 64Cu, 68Ga, 86Y, 124I, или из группы бета-излучателей, предпочтительно 131I, 90Y, 177Lu, 67Cu, либо из группы альфа-излучателей, предпочтительно 213Bi, 211At.

14. Слитый белок по п. 5, в котором указанным компонентом является функциональный Fc-домен, предпочтительно функциональный Fc-домен человека, более предпочтительно содержащий мультимерные, предпочтительно димерные полипептиды из любых пп. 1-4.

15. Полипептид, связывающийся с IL-17A, содержащий полипептид по любому из пунктов 1-4 и компонент, модулирующий время полужизни в сыворотке, предпочтительно компонент, который выбирают из группы, состоящей из полиэтиленгликоля (ПЭГ), иммуноглобулина и альбуминсвязывающих пептидов.

16. Слитый белок для применения в фармацевтике и диагностике, содержащий слитый белок по любому из пп. 5-14 и компонент, модулирующий время полужизни в сыворотке, предпочтительно компонент, который выбирают из группы, состоящей из полиэтиленгликоля (ПЭГ), иммуноглобулина и альбуминсвязывающих пептидов.

17. Слитый белок для применения в фармацевтике и диагностике, содержащий полипептид, который выбирают из группы, состоящей из SEQ ID NO: 1-116 или их функциональных производных и фармацевтически и/или диагностически активным компонентом, выбранным из цитокинов, таких как IL-2, IL-12, TNF-альфа, IFN-альфа, IFN-бета, IFN-гамма, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, В70, TNF-бета, LT-бета, CD-40-лиганд, Fas-лиганд, TGF-бета, IL-1-альфа и IL-1-бета, токсичных соединений, предпочтительно низкомолекулярных органических соединений или полипептидов, предпочтительно выбранных из группы, состоящей из калихемицина, майтансиноида, неокарциностатина, эсперамицина, динемицина, кедарцидина, мадуропептина, доксорубицина, даунорубицина, ауристатина, А-цепи рицина, модеккина, укороченного экзотоксина A Pseudomonas, дифтерийного токсина и рекомбинантного гелонина; хемокинов, которые предпочтительно выбирают из группы, состоящей из IL-8, GRO-альфа, GRO-бета, GRO-гамма, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1-альфа/бета, BUNZO/STRC33, I-TAC, BLC/BCA-1, MIP-1 альфа, MIP-1 бета, MDC, ТЕСК, TARC, RANTES, НСС-1, НСС-4, DC-CK1, MIP-3-альфа, MIP-3-бета, МСР-1-5, эотаксина, эотаксина-2, 1-309, MPIF-1, 6Ckine, СТАСК, МЕС, лимфотактина и фракталкина; флуоресцентных красителей, предпочтительно из групп Alexa Fluor или красителей Су; фотосенсибилизаторов, предпочтительно фототоксичного красного флуоресцентного белка KillerRed или гематопорфирина; прокоагулянтного фактора, предпочтительно тканевого фактора; фермента для активации пролекарств, предпочтительно выбираемого из группы, состоящей из карбоксипептидаз, глюкуронидаз и глюкозидаз; радионуклидов, либо из группы гамма-излучающих изотопов,
предпочтительно 99mTc, 123I, 111In, либо из группы излучателей позитронов, предпочтительно 18F, 64Cu, 68Ga, 86Y, 124I, либо из группы бета-излучателей, предпочтительно 131I, 90Y, 177Lu, 67Cu, либо из группы альфа-излучателей, предпочтительно 213Bi, 211At; функциональных Fc-доменов, предпочтительно одного или нескольких функциональных Fc-доменов человека.

18. Слитый белок по п. 17, который выбирают из группы, состоящей из SEQ ID NO: 117-119.

19. Полипептид по любому из пп. 1 - 4,15 или слитый белок по любому из пп. 5-14, 16-18, содержащий димер или тример полипептида по любому из пп. 1-4.

20. Изолированная и очищенная нуклеиновая кислота, кодирующая полипептид, связывающий IL-17A, содержащая нуклеиновую кислоту, кодирующую полипептид по пп. 1-4, 15 или 19.

21. Нуклеиновая кислота по п. 20, в которой указанная нуклеиновая кислота представляет собой ДНК, ПНК или РНК.

22. Нуклеиновая кислота, кодирующая слитый белок по любому из пп. 5-14, 16-19.

23. Нуклеиновая кислота по п. 22, в которой указанная нуклеиновая кислота представляет собой ДНК, ПНК или РНК.

24. Нуклеиновая кислота по любому из пп. 20-23, в которой указанная нуклеиновая кислота функционально связана с промотором, предпочтительно связана с промотором, который выбирают из группы прокариотических промоторов, состоящей из элемента Т5-промотор/1ас-оператор, элемента Т7-промотор/1ас-оператор, или из группы эукариотических промоторов, состоящей из hEFl-HTLV, CMV enh/hFerL-промотора.

25. Рекомбинантный вектор для продукции полипептидов или слитых белков по любому из пп. 1-19, содержащий нуклеиновую кислоту по любому из пп. 20-24, в котором вектор предпочтительно способен продуцировать полипептид или слитый белок по любому из пп. 1-19.

26. Рекомбинантный вектор по п. 25, который выбирают из группы, состоящей из pQE-векторов, рЕТ-векторов, pFUSE-векторов, pUC-векторов, YAC-векторов, фагмидных векторов, фаговых векторов, векторов, применяемых в генной терапии, таких как ретровирусы, аденовирусы, аденоассоциированные вирусы.

27. Клетка-хозяин для продукции полипептидов или слитых белков по любому из пп. 1-19, содержащая нуклеиновую кислоту и/или вектор по любому из вышеуказанных пунктов.

28. Фармацевтическая композиция для лечения IL-17A- и/или Th17-связанных заболеваний или медицинских состояний, содержащая полипептид или слитый белок по любому из пп. 1-19 в эффективном количестве.

29. Применение полипептида по любому из пп. 1-4, 15 или 19 для приготовления лекарственного средства, предпочтительно для лечения или профилактики заболевания или медицинского состояния, которое выбирают из группы, состоящей из IL-17A- и Th17 - связанных заболеваний или медицинских состояний.

30. Применение слитого белка по любому из пп. 5-14, 16-19 для приготовления лекарственного средства, предпочтительно для лечения или профилактики заболевания или медицинского состояния, которое выбирают из группы, состоящей из IL-17A- и Th17 - связанных заболеваний или медицинских состояний.

31. Применение по любому из пп. 29-30, в котором заболевание или медицинское состояние выбирают из воспалительных, аутоиммунных и/или связанных с потерей костной массы заболеваний и медицинских состояний.

32. Применение по любому из пп. 29-30, в котором заболевание или медицинское состояние выбирают из группы, состоящей из артрита, предпочтительно ревматоидного артрита, хронического прогрессирующего артрита, реактивного артрита, псориатического артрита, энтеропатического артрита и деформирующего артрита, ревматических заболеваний, спондилоартропатий, анкилозирующего спондилита, болезни Рейтера, гиперчувствительности (включая обе дыхательную гиперчувствительность и кожную гиперчувствительность), аллергий, системной красной волчанки, воспалительных поражений мышц, полихондрита, склеродемы, гранулематоза Вегенера, дерматомиозита, синдрома Стивена-Джонсона, хронического активного гепатита, миастении гравис, псориаза, идиопатического спру, аутоиммунного воспалительного заболевания кишечника, неспецифического язвенного колита, болезни Крона, синдрома раздраженной толстой кишки, эндокринной офтальмопатии, болезни Грейвса, саркоидоза, ишемии, системного склероза, рассеянного склероза, билиарного первичного цирроза печени, ювенильного диабета (сахарного диабета I типа), аутоиммунных гематологических поражений, гемолитической анемии, апластической анемии, врожденной апластической анемии, идиопатической тромбоцитопении, увеита (переднего и заднего), сухого кератоконъюнктивита, весеннего кератоконъюнктивита, интерстициального фиброза легких, гломерулонефрита (с и без нефротического синдрома), идиопатического нефротического синдрома или нефропатии минимальных изменений, опухолей, воспалительного заболевания кожи, воспаления роговицы, миозита, ослабления костных имплантатов, метаболических нарушений, атеросклероза, диабета и дислипидемии, потери костной массы, остеоартрита, остеопороза, парадонтоза, обструктивных или воспалительных заболеваний дыхательных путей, астмы, бронхита, пневмокониоза, эмфиземы легких, острых и сверхострых воспалительных реакций, заболеваний, в патогенез которых вовлечен 1b-17А-опосредованный TNF-альфа, острых инфекций, септицимии, септического шока, эндотоксического шока, синдрома расстройства дыхания у взрослых, менингита, пневмонии, тяжелых ожогов, кахексии, синдрома истощения, инсульта, герпетического стромального кератита и сухого кератита.

33. Применение по п. 31, в котором заболевание или медицинское состояние выбирают из группы, состоящей из артрита, предпочтительно ревматоидного артрита, хронического прогрессирующего артрита, реактивного артрита, псориатического артрита, энтеропатического артрита и деформирующего артрита, ревматических заболеваний, спондилоартропатий, анкилозирующего спондилита, болезни Рейтера, гиперчувствительности (включая обе дыхательную гиперчувствительность и кожную гиперчувствительность), аллергий, системной красной волчанки, воспалительных поражений мышц, полихондрита, склеродемы, гранулематоза Вегенера, дерматомиозита, синдрома Стивена-Джонсона, хронического активного гепатита, миастении гравис, псориаза, идиопатического спру, аутоиммунного воспалительного заболевания кишечника, неспецифического язвенного колита, болезни Крона, синдрома раздраженной толстой кишки, эндокринной офтальмопатии, болезни Грейвса, саркоидоза, ишемии, системного склероза, рассеянного склероза, билиарного первичного цирроза печени, ювенильного диабета (сахарного диабета I типа), аутоиммунных гематологических поражений, гемолитической анемии, апластической анемии, врожденной апластической анемии, идиопатической тромбоцитопении, увеита (переднего и заднего), сухого кератоконъюнктивита, весеннего кератоконъюнктивита, интерстициального фиброза легких, гломерулонефрита (с и без нефротического синдрома), идиопатического нефротического синдрома или нефропатии минимальных изменений, опухолей, воспалительного заболевания кожи, воспаления роговицы, миозита, ослабления костных имплантатов, метаболических нарушений, атеросклероза, диабета и дислипидемии, потери костной массы, остеоартрита, остеопороза, парадонтоза, обструктивных или воспалительных заболеваний дыхательных путей, астмы, бронхита, пневмокониоза, эмфиземы легких, острых и сверхострых воспалительных реакций, заболеваний, в патогенез которых вовлечен 1b-17А-опосредованный TNF-альфа, острых инфекций, септицимии, септического шока, эндотоксического шока, синдрома расстройства дыхания у взрослых, менингита, пневмонии, тяжелых ожогов, кахексии, синдрома истощения, инсульта, герпетического стромального кератита и сухого кератита.



 

Похожие патенты:

Изобретение относится к биотехнологии. Представлено моноклональное антитело против интерлейкина-6 человека, содержащее гипервариабельные участки тяжелой цепи CDRH-1: GFSLSTSGMGVG; CDRH-2: HIWWDDDKYYNPSLKS; и CDRH-3: RANYGTSYDYGMDY; и гипервариабельные участки легкой цепи CDRL-1: KASQSVSDVLT; CDRL-2: YASNRYT; и CDRL-3: QQGYRSPYT.
Данное изобретение относится к области ветеринарной биотехнологии. Предложен штамм постоянной гибридомной линии клеток мыши Mus.musculus.

Изобретение относится к биохимии, в частности к моноклональному антителу человека, специфичному к альфа-токсину S. aureus.
Изобретение относится к биотехнологии и представляет собой штамм культивируемых гибридных клеток животного Mus musculus L. CCHFV Vd-3, депонированный в Государственную коллекцию патогенных микроорганизмов и клеточных культур «ГКПМ-ОБОЛЕНСК» под номером H-27, являющийся продуцентом моноклонального антитела 3H6/F2 к вирусу Крым-Конго геморрагической лихорадки (ККГЛ), пригодного для изготовления на его основе одного из компонентов набора реагентов для иммуноферментного выявления антигенов вируса ККГЛ в пробах биологического материала.
Изобретение относится к биотехнологии и представляет собой штамм культивируемых гибридных клеток животного Mus musculus L. CCHFV Vd-2, депонированный в Государственную коллекцию патогенных микроорганизмов и клеточных культур «ГКПМ-ОБОЛЕНСК» под номером H-26, являющийся продуцентом моноклонального антитела 1E2/E5 к вирусу Крым-Конго геморрагической лихорадки (ККГЛ), пригодного для изготовления на его основе одного из компонентов набора реагентов для иммуноферментного выявления антигенов вируса ККГЛ в пробах биологического материала.

Настоящее изобретение относится к области биотехнологии и медицины. Предложен способ создания антитела и его функциональных фрагментов, направленных против опухолевого антигена, экспрессируемого на поверхности опухоли, устойчивой по меньшей мере к одному противоопухолевому соединению, основанный на применении для иммунизации измельченного гомогената, и/или суспензии, и/или клеточного лизата, происходящих из такой опухоли.

Изобретение относится к области биотехнологии и иммунологии. Описано химерное рекомбинантное антитело, специфически связывающееся с эритропоэтином человека, характеризующееся следующими признаками: а) Kd=2,4×10-9 М, изоэлектрическая точка в диапазоне рН 7,5-8,0; б) последовательность тяжелой цепи SEQ ID NO:12; в) последовательность легкой цепи SEQ ID NO:14.

Изобретение относится к области иммунологии. Представлены два антитела против IL-21 человека.

Изобретение относится к биотехнологии и биофармакологии и предоставляет штаммы гибридных культивируемых клеток животных Mus musculus Sp2/0-BC/rhPC-4F10, Sp2/0-BC/rhPC-1C6, Sp2/0-BC/rhPC-3H6, - продуценты моноклональных антител, специфичных к протеину С человека.

Настоящее изобретение относится к области иммунологии. Предложено полностью человеческое моноклональное антитело, которое связывает инсулиноподобный фактор роста-II (IGF-II) и имеет перекрестную реактивность к IGF-I, а также его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии. Предложено выделенное антитело к белку ICOS человека с повышенной эффекторной функцией.

Представленная группа изобретений касается слитых белков, нуклеиновых кислот, кодирующих такие белки, экспрессирующей кассеты, обеспечивающей экспрессию нуклеиновой кислоты, вектора, включающего такую кассету, способа диагностики in vitro-боррелиоза, набора для такой диагностики, в которых используют упомянутые белки, а также вакцинной композиции для профилактики боррелиоза, включающей такие белки.

Настоящее изобретение относится к биотехнологии и представляет собой антитела против фактора роста нервов (ФРН). Настоящее изобретение также раскрывает фармацевтическую композицию для облегчения боли, ассоциированной с заболеванием или состоянием, при котором развитие или сохранение боли опосредовано ФРН, содержащую указанные антитела, а также набор для лечения связанного с ФРН заболевания, такого как, например, остеоартрит, нуклеиновые кислоты, кодирующие тяжелую или легкую цепь антитела, вектор экспрессии, клетку-хозяина для получения указанных антител, способ экспрессии указанных антител против ФРН, а также применение указанных антител в способе лечения боли и для получения лекарственного средства для лечения боли, ассоциированной с заболеванием или состоянием, при котором развитие или сохранение боли опосредовано ФРН.

Настоящее изобретение относится к области иммунологии. Предложено антитело, способное связываться с амплифицированным рецептором эпидермального фактора роста (EGFR) и с усеченным вариантом EGFR - de2-7 EGFR, и охарактеризованное последовательностями вариабельных доменов.

Настоящее изобретение относится к биотехнологии и представляет собой экспрессионную плазмиду без устойчивости к антибиотику, которая содержит полинуклеотид, кодирующий белок-репрессор cI.

Изобретение относится к области иммунологии. Предложены варианты модифицированного антитела к CD20 или его антигенсвязывающего фрагмента.

Изобретение относится к области биохимии, в частности к cпособу получения двухвалентного биспецифического антитела, который включает трансформацию клетки-хозяина векторами, содержащими молекулы нуклеиновых кислот, кодирующих первую легкую цепь и первую тяжелую цепь двухвалентного биспецифического антитела, и векторами, содержащими молекулы нуклеиновых кислот, кодирующих вторую легкую цепь и вторую тяжелую цепь двухвалентного биспецифического антитела, культивирование клетки-хозяина в условиях, которые обеспечивают синтез молекулы двухвалентного биспецифического антитела и выделение молекулы двухвалентного биспецифического антитела из указанной культуры.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.
Наверх