Олигопептиды imp-3 и содержащие их вакцины



Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины
Олигопептиды imp-3 и содержащие их вакцины

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2550695:

ОНКОТЕРАПИ САЙЕНС, ИНК. (JP)

Изобретение относится к олигопептидам, содержащим последовательность NLSSAEVVV (SEQ ID NO:6), в которой одна или две аминокислоты могут быть замещены, имеющим индуцибельность цитотоксических Т-клеток, их фармацевтическим композициям и применению для изготовления противораковых вакцин. 10 н. и 10 з.п. ф-лы, 6 ил., 1 табл., 1 пр.

 

Область техники, к которой относится изобретение

[0001]

Данное изобретение относится к области биологической науки, более конкретно, к области терапии рака. В частности, данное изобретение относится к новым олигопептидам, которые являются чрезвычайно эффективными в качестве противораковых вакцин, и лекарственным средствам для лечения и предотвращения опухолей.

Приоритет

Данная заявка испрашивает приоритет предварительной заявки на патент США № 61/265657, поданной 1 декабря 2009 года и предварительной заявки на патент США № 61/371434, поданной 6 августа 2010 года, полное содержание которых включено здесь посредством ссылки.

Уровень техники

[0002]

Было продемонстрировано, что CD8-положительные цитотоксические Т-лимфоциты (CTL) распознают эпитопные пептиды, произведенные из опухолеспецифических антигенов (TAA), обнаруживаемых на молекулах главного комплекса гистосовместимости (MHC) класса I, и затем убивают эти опухолевые клетки. Со времени открытия семейства антигенов меланомы (MAGE) в качестве первого примера TAA, были обнаружены другие TAA, первоначально посредством иммунологических подходов (NPL 1, Boon T, Int J Cancer 1993 May 8, 54(2): 177-80; NPL 2, Boon T & van der Bruggen P, J Exp Med 1996 Mar 1, 183(3): 725-9). Некоторые из этих TAA в настоящее время подвергаются клинической разработке в качестве иммунотерапевтических мишеней.

[0003]

Идентификация новых TAA, способных индуцировать сильные и специфические противоопухолевые иммунные реакции, гарантирует дальнейшее развитие, и продолжается клиническое исследование стратегий пептидной вакцинации для различных типов рака (NPL 3, Harris CC, J Natl Cancer Inst 1996 Oct 16, 88(20): 1442-55; NPL 4, Butterfield LH et al., Cancer Res 1999 Jul 1, 59(13): 3134-42; NPL 5, Vissers JL et al., Cancer Res 1999 Nov 1, 59(21): 5554-9; NPL 6, van der Burg SH et al., J Immunol 1996 May 1, 156(9): 3308-14; NPL 7, Tanaka F et al., Cancer Res 1997 Oct 15, 57(20): 4465-8; NPL 8, Fujie T et al., Int J Cancer 1999 Jan 18, 80(2): 169-72; NPL 9, Kikuchi M et al., Int J Cancer 1999 May 5, 81(3): 459-66; NPL 10, Oiso M et al., Int J Cancer 1999 May 5, 81(3): 387-94). К настоящему времени имелось несколько сообщений о клинических исследованиях с использованием этих полученных из опухолеспецифического антигена пептидов. К сожалению, до сих пор наблюдался низкий реальный уровень реакции в этих испытаниях противораковой вакцины (NPL 11, Belli F et al., J Clin Oncol 2002 Oct 15, 20(20): 4169-80; NPL 12, Coulie PG et al., Immunol Rev 2002 Oct, 188: 33-42; NPL 13, Rosenberg SA et al., Nat Med 2004 Sep, 10(9): 909-15). Таким образом, остается потребность в идентификации новых TAA, применимых в качестве иммунотерапевтических мишеней.

[0004]

Для этой цели, посредством анализа экспрессии генов с использованием кДНК-микроэррея (кДНК-микрочипа) в размере генома, содержащего 23040 генов, идентифицировали IMP-3 (мРНК-связывающий белок 3 инсулиноподобного фактора роста II) в качестве активируемого гена в раке легкого и пищевода (NPL 14, T. Kikuchi et al., Oncogene. 2003 Apr 10; 22(14): 2192-205, PTL 1, WO2004/031413, PTL 2, WO2007/013665, PTL 3, WO2007/013671). Наблюдали, что экспрессия IMP-3 является специфически активируемой в опухолевых клетках более чем 90% раковых пациентов, но не было экспрессии IMP-3 в других здоровых жизненно важных органах, за исключением яичка и плаценты. Кроме того, с использованием способа интерференции РНК было показано, что понижающая регуляция экспрессии IMP-3 подавляет рост клеток в экспрессирующих IMP-3 линиях раковых клеток. Предыдущая заявка, WO2006/090810, описывает пептиды, полученные из IMP-3 (также описанные как KOC1), имеющие специфическую CTL-индуцирующую активность против опухолевых клеток, экзогенно экспрессирующих KOC1 (IMP-3) и HLA-A24. Хотя эти пептиды могут быть пригодны для пациентов типа HLA-A24, остается потребность в отношении CTL-индуцирующих пептидов для пациентов с другим типом HLA.

СПИСОК ЦИТИРОВАНИЯ

Патентная литература

[0005]

[PTL 1] WO 2004/031413

[PTL 2] WO 2007/013665

[PTL 3] WO 2007/013671

[PTL 4] WO 2006/090810

Непатентная литература

[0006]

[NPL 1] Boon T, Int J Cancer 1993 May 8, 54(2): 177-80

[NPL 2] Boon T & van der Bruggen P, J Exp Med 1996 Mar 1, 183(3):725-9

[NPL 3] Harris CC, J Natl Cancer Inst 1996 Oct 16, 88(20): 1442-55

[NPL 4] Butterfield LH et al., Cancer Res 1999 Jul 1, 59(13):3134-42

[NPL 5] Vissers JL et al., Cancer Res 1999 Nov 1, 59(21): 5554-9

[NPL 6] van der Burg SH et al., J Immunol 1996 May 1, 156(9):3308-14

[NPL 7] Tanaka F et al., Cancer Res 1997 Oct 15, 57(20): 4465-8

[NPL 8] Fujie T et al., Int J Cancer 1999 Jan 18, 80(2): 169-72

[NPL 9] Kikuchi M et al., Int J Cancer 1999 May 5, 81(3): 459-66

[NPL 10] Oiso M et al., Int J Cancer 1999 May 5, 81(3): 387-94

[NPL 11] Belli F et al., J Clin Oncol 2002 Oct 15, 20(20): 4169-80

[NPL 12] Coulie PG et al., Immunol Rev 2002 Oct, 188: 33-42

[NPL 13] Rosenberg SA et al., Nat Med 2004 Sep, 10(9): 909-15

[NPL 14] T. Kikuchi et al., Oncogene. 2003 Apr 10; 22(14): 2192-205

Сущность изобретения

[0007]

Данное изобретение основано отчасти на обнаружении новых пептидов, которые могут служить в качестве мишеней иммунотерапии. Поскольку ТАА обычно воспринимаются иммунной системой как "свое" и, следовательно, часто не имеют природной иммуногенности, обнаружение подходящих мишеней является крайне важным. Принимая во внимание то, что IMP-3 был идентифицирован в качестве активируемого в таких типах рака, как рак легкого и рак пищевода, данное изобретение нацелено на белок IMP-3 (SEQ ID NO:22), кодируемый геном GenBank Accession No. NM_006547.2 (SEQ ID NO:21), для последующего анализа. В частности, для этого исследования были выбраны продукты гена IMP-3, содержащие эпитопные пептиды, которые индуцируют неожиданно сильные CTL-реакции, специфические для этих соответствующих молекул. В контексте данного изобретения, мононуклеарные клетки периферической крови (PBMC), полученные из здорового донора, стимулировали с использованием пептидов данного изобретения. Были установлены CTL, которые специфически распознают HLA-A2 (A*0201)-положительные клетки-мишени, импульсно обработанные соответствующими пептидами, и были идентифицированы HLA-A2 (A*0201)-рестриктированные эпитопные пептиды, которые могут индуцировать сильные и специфические иммунные реакции против IMP-3, экспрессируемого на поверхности опухолевых клеток. Взятые вместе, эти результаты демонстрируют, что IMP-3 является в высокой степени иммуногенным, и его эпитопы являются эффективными мишенями для противоопухолевой иммунотерапии.

[0008]

Таким образом, целью данного изобретения является обеспечение олигопептидов, имеющих CTL-индуцибельность, а также аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6. Кроме того, данное изобретение рассматривает модифицированные пептиды, имеющие аминокислотную последовательность SEQ ID NO:1, 3, 5 или 6, где одна, две или несколько аминокислот мутированы или изменены по меньшей мере одной мутацией, выбранной из группы, состоящей из замены, делеции, инсерции и добавления, пока полученные модифицированные олигонуклеотиды сохраняют CTL-индуцибельность исходных пептидов.

[0009]

При введении субъекту эти олигопептиды презентируются на поверхности антигенэкспрессирующих клеток для индукции нацеливания CTL на соответствующие пептиды. Таким образом, целью данного изобретения является обеспечение антигенпрезентирующих клеток и экзосом, которые презентируют любой из этих пептидов, а также способов индуцирования антигенпрезентирующих клеток, ассоциированных с ними.

[0010]

Противоопухолевая иммунная реакция индуцируется введением этих IMP-3-олигопептидов или полинуклеотидов, кодирующих эти олигопептиды, а также экзосом и антигенпрезентирующих клеток, которые презентируют такие IMP-3-олигопептиды. Таким образом, еще одной целью данного изобретения является обеспечение фармацевтических агентов или фармацевтических композиций, содержащих эти олигопептиды или полинуклеотиды, кодирующие их, или ассоциированных экзосом и антигенпрезентирующих клеток, в качестве их активных ингредиентов. Эти фармацевтические агенты или фармацевтические композиции данного изобретения находят конкретное применение в качестве вакцин.

[0011]

Дополнительной целью данного изобретения является обеспечение способов по меньшей мере для одной цели, выбранной из группы, состоящей из лечения, профилактики (т.е. предотвращения) рака (опухолей) и предотвращения его послеоперационного рецидива, а также способов индуцирования CTL, способов индуцирования противоопухолевого иммунитета, причем такие способы включают в себя стадию введения IMP-3-олигопептидов, экзосом или антигенпрезентирующих клеток, презентирующих IMP-3-полипептиды или фармацевтические агенты или композиции данного изобретения, субъекту, нуждающемуся в этом. Кроме того, CTL данного изобретения находят также применение в качестве вакцин против рака. Примеры рака-мишени включают в себя, но не ограничиваются ими, рак легкого и рак пищевода.

[0012]

Более конкретно, данное изобретение обеспечивает следующее:

[1] Выделенный олигопептид, содержащий аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:1, 3, 5 и 6,

[2] Выделенный олигопептид, содержащий аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:1, 3, 5 и 6, где 1, 2 или несколько аминокислот заменены, делетированы, инсертированы и/или добавлены, где этот олигопептид дополнительно имеет индуцибельность цитотоксических Т-лимфоцитов (CTL),

[3] Олигопептид по [2], где этот олигопептид имеет одну или обе из следующих характеристик:

(a) вторая аминокислота от N-конца является лейцином или метионином, и

(b) С-концевая аминокислота является валином или лейцином,

[4] Выделенный полинуклеотид, кодирующий олигопептид по любому из [1]-[3],

[5] Способ индуцирования антигенпрезентирующей клетки, имеющей CTL-индуцибельность, с использованием олигопептида, представленного в любом из [1]-[3],

[6] Способ по [5], где этот способ предусматривает стадию, выбранную из группы, состоящей из:

(a) контактирования антигенпрезентирующей клетки с олигопептидом по любому из [1]-[3], и

(b) введения полинуклеотида, кодирующего олигопептид по любому из [1]-[3], в антигенпрезентирующую клетку,

[7] Способ по [5] или [6], где эта антигенпрезентирующая клетка экспрессирует по меньшей мере один HLA-A2-антиген на ее поверхности,

[8] Способ индуцирования CTL с использованием олигопептида, по любому из [1]-[3],

[9] Способ по [8], где этот способ предусматривает стадию, выбранную из группы, состоящей из:

(a) контактирования CD8-положительной T-клетки с антигенпрезентирующей клеткой и/или экзосомой, которая презентирует комплекс олигопептида по любому из [1]-[3] и HLA-антигена на ее поверхности, и

(b) введения полинуклеотида, кодирующего полипептид, который способен образовывать связывание субъединицы Т-клеточного рецептора (TCR) с комплексом олигопептида по любому из [1]-[3] и HLA-антигена на антигенпрезентирующей клеточной поверхности, в CD8-положительную Т-клетку,

[10] Способ по [9], где HLA-антигеном является HLA-A2,

[11] Выделенный CTL, который нацелен на олигопептид по любому из [1]-[3],

[12] CTL по [11], где указанный CTL способен связываться с комплексом олигопептида по любому из [1]-[3] и HLA-антигена на клеточной поверхности,

[13] CTL по [12], где указанным HLA-антигеном является HLA-A2,

[14] Выделенный CTL, который индуцируется с использованием олигопептида по любому из [1]-[3],

[15] CTL по [14], где указанный CTL индуцируется способом по любому из [8]-[10],

[16] Выделенная антигенпрезентирующая клетка, которая презентирует на ее поверхности комплекс HLA-антигена и олигопептида по любому из [1]-[3],

[17] Антигенпрезентирующая клетка по [16], где этим HLA-антигеном является HLA-A2,

[18] Антигенпрезентирующая клетка по [16] или [17], где указанная антигенпрезентирующая клетка индуцируется любым способом по [5]-[7],

[19] Способ индуцирования иммунной реакции против рака в субъекте, предусматривающий стадию введения этому субъекту вакцины, содержащей по меньшей мере один активный ингредиент, выбранный из группы, состоящей из:

(a) одного или более олигопептидов по любому из [1]-[3] или его иммунологически активного фрагмента;

(b) одного или более полинуклеотидов, кодирующих олигопептид по любому из [1]-[3] или его иммунологически активный фрагмент;

(c) одного или более выделенных CTL по любому из [11]-[15]; и

(d) одной или более выделенных антигенпрезентирующих клеток по любому из [16]-[18],

[20] Способ по [19], где указанный субъект является HLA-A2-положительным,

[21] Фармацевтический агент для лечения и/или профилактики рака и/или предотвращения его послеоперационного рецидива, где этот агент содержит фармацевтически приемлемый носитель и по меньшей мере один активный ингредиент, выбранный из группы, состоящей из:

(a) одного или более олигопептидов по любому из [1]-[3] или его иммунологически активного фрагмента;

(b) одного или более полинуклеотидов, кодирующих олигопептид по любому из [1]-[3], или его иммунологически активный фрагмент;

(c) одной или более антигенпрезентирующих клеток, презентирующих комплекс олигопептида по одному из [1]-[3] и HLA-антигена; и

(d) одного или более CTL, который способен связываться с комплексом олигопептида по [1]-[3] и HLA-антигена на клеточной поверхности,

[22] Фармацевтический агент для индуцирования CTL, где этот агент содержит фармацевтически приемлемый носитель и по меньшей мере один активный ингредиент, выбранный из группы, состоящей из:

(a) одного или более олигопептидов по любому из [1]-[3] или его иммунологически активного фрагмента;

(b) одного или более полинуклеотидов, кодирующих олигопептид по любому из [1]-[3] или его иммунологически активный фрагмент;

(c) одной или более антигенпрезентирующих клеток, презентирующих комплекс олигопептида по одному из [1]-[3] и HLA-антигена,

[23] Фармацевтический агент по [21] или [22], где этот фармацевтический агент готовят для введения субъекту, который является HLA-A2-положительным,

[24] Фармацевтический агент по [21]-[23], который является вакциной,

[25] Применение активного ингредиента, выбранного из группы, состоящей из:

(a) одного или более олигопептидов по любому из [1]-[3];

(b) одного или более полинуклеотидов, кодирующих олигопептид по любому из [1]-[3], в экспрессируемой форме;

(c) одной или более антигенпрезентирующих клеток, презентирующих комплекс олигопептида по любому из [1]-[3] и HLA-антигена на ее поверхности; и

(d) одного или более CTL, который способен связываться с комплексом олигопептида по любому из [1]-[3] и HLA-антигена на клеточной поверхности, для изготовления фармацевтической композиции или агента для лечения рака, и

[26] Применение по [25], где эти фармацевтическая композиция или агент получают в виде состава для введения субъекту, который является HLA-A2-положительным,

[27] Выделенный олигопептид, содержащий аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:1, 3, 5 и 6, для применения в лечении и/или профилактике рака и/или предотвращении его послеоперационного рецидива в субъекте, который является HLA-A2-положительным,

[28] Выделенный олигопептид, содержащий аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:1, 3, 5 и 6, где 1, 2 или несколько аминокислот являются замененными, делетированными, инсертированными и/или добавленными, где дополнительно этот олигопептид имеет индуцибельность цитотоксического Т-лимфоцита (CTL), для применения в лечении и/или профилактике рака и/или предотвращении его послеоперационного рецидива в субъекте, который является HLA-A2-положительным, и

[29] Олигопептид по [28], где этот олигопептид имеет одну или обе из следующих характеристик:

(a) вторая аминокислота от N-конца является лейцином или метионином, и

(b) С-концевая аминокислота является валином или лейцином.

[0013]

Кроме вышеописанного, другие объекты и признаки данного изобретения будут более очевидными при чтении следующего подробного описания вместе с сопутствующими фигурами и примерами. Однако, должно быть понятно, что как предыдущий раздел «Сущность изобретения», так и последующий раздел «Подробное описание» являются иллюстративными вариантами и не ограничивают это изобретение или другие, альтернативные варианты осуществления данного изобретения. В частности, хотя это изобретение описано здесь со ссылкой на ряд конкретных вариантов осуществления, должно быть понятно, что это описание является иллюстративным и не должно пониматься как ограничивающее это изобретение. Различные модификации и применения могут приходить на ум квалифицированным в данной области специалистам, без отклонения от сущности и объема данного изобретения, описанного прилагаемой формулой изобретения. Подобным образом, другие цели, признаки, эффекты и преимущества данного изобретения будут очевидными из раздела «Сущность изобретения» и некоторых описанных ниже вариантов осуществления и будут вполне очевидными для квалифицированных в данной области специалистов. Такие цели, признаки, эффекты и преимущества будут очевидными из вышеописанного вместе с сопутствующими примерами, данными, фигурами и всеми обоснованными выводами, сделанными из них, отдельно или с учетом включенных здесь ссылок.

Краткое описание фигур

[0014]

Различные аспекты и применения данного изобретения станут очевидными квалифицированному в данной области специалисту после рассмотрения краткого описания фигур и подробного описания данного изобретения и его предпочтительных вариантов осуществления, которые следуют далее.

[0015]

[Фиг.1]

Фиг.1 изображает результаты анализа IFN-гамма ELISPOT на CTL, которые были индуцированы в HLA-A2-трансгенных мышах. CTL, стимулированные пептидами (SEQ ID NO:3, 5 и 6), показывали сильные IFN-гамма-продуцирующие реакции в сравнении с контролями (верхняя панель). Столбики ошибок представляют стандартное отклонение (SD). Статистически значимые различия указаны звездочками (*P<0,05). Показаны также примерные фотографии подсчетов ELISPOT лунок в трех повторностях (нижняя панель). Эти CTL обнаруживали 203-226 пятен на лунку в ответ на BM-DC, импульсно подаваемый с пептидом SEQ ID NO:6 (панели с левой стороны), тогда как они обнаруживали 74-105 пятен на лунку в присутствии BM-DC без загрузки пептидом (панели с правой стороны).

[0016]

[Фиг.2]

Фиг.2 состоит из ряда диаграмм в виде столбцов, изображающих результаты анализа IFN-гамма ELISPOT на CTL человека (здорового донора 1). CTL человека, стимулированные пептидами SEQ ID NO:1, 3, 5 и 6, показывали сильные продуцирующие IFN-гамма реакции против Т2-клеток, импульсно обработанных родственными пептидами, в сравнении с Т2-клетками, импульсно обработанными посторонним пептидом ВИЧ (P<0,05). Столбики ошибок представляют SD.

[0017]

[Фиг.3]

Фиг.3 состоит из ряда графиков распределения (A) и линейных графиков (B), изображающих индукцию IMP-3-специфических CTL человека из CD8+ T-клеток HLA-A2-положительных пациентов с раком легкого и здоровых доноров. Часть (A) представляет результаты анализа FACS (с использованием клеточного сортера с возбуждением флуоресценции) для детектирования экспрессии CD107a на клеточной поверхности CTL человека здорового донора 1 или пациента 1 с раком легкого после стимуляции пептидом SEQ ID NO:1, 3 или 6. CTL, стимулированные этим пептидом, окрашивались FITC (флуоресцеинизотиоцианат)-конъюгированным анти-CD107a-антителом (верхняя панель), или FITC-конъюгированным антимышиным IgG1 в качестве контроля (средняя панель). В качестве отрицательного контроля стимуляции, CTL стимулировали пептидом ВИЧ и окрашивали FITC-конъюгированным анти-CD107a-антителом (нижняя панель). Экспрессию CD107a детектировали на CTL, когда их стимулировали пептидом SEQ ID NO:1, 3 или 6 в сравнении с контролем. Часть (B) изображает цитотоксичность IMP-3-специфических CTL против T2-клеток, импульсно обработанных родственными IMP-3-произведенными пептидами. Цитотоксичность CTL против Т2-клеток, импульсно обработанных пептидом SEQ ID NO:1 (белый треугольник; левая и средняя панели) или пептидом SEQ ID NO:6 (белый треугольник; правая панель), и Т2-клеток, импульсно обработанных посторонними пептидами HIV-A2 (черные треугольники) в анализе высвобождения 51Cr. Каждая величина представляет процент специфического лизиса, рассчитанного на основе средних величин анализа с тремя повторностями.

[0018]

[Фиг.4]

Фиг.4 состоит из ряда диаграмм в виде столбцов (A) и линейных (B) графиков, изображающих IMP-3-специфические CTL из PBMC трех пациентов с раком легкого. Часть (A) изображает CTL, индуцированные из PBMC пациента 14 стимуляцией пептидом SEQ ID NO:5, и пациент 103 с пептидом SEQ ID NO:6 показал существенное продуцирование IFN-гамма против Т2-клеток, импульсно обработанных родственными пептидами, в сравнении с Т2-клетками, импульсно обработанными посторонним пептидом ВИЧ. Статистически значимые различия указаны звездочками (*P<0,05). Столбики ошибок представляют SD. Часть (B) изображает CTL, индуцированные из PBMC пациента 4 с пептидом SEQ ID NO:3, и пациент 3 с пептидом SEQ ID NO:5 показал цитотоксическую активность против Т2-клеток, импульсно обработанных родственными пептидами, в сравнении с Т2-клетками, импульсно обработанными посторонним пептидом ВИЧ.

[0019]

[Фиг.5A-C]

Фиг.5 состоит из ряда линейных графиков, изображающих результаты анализа высвобождения 51Cr с использованием CTL и линий опухолевых клеток, эндогенно экспрессирующих IMP-3. Часть (A) представляет цитотоксические активности CTL, индуцированных из PBMC здорового донора 2 стимуляцией пептидами SEQ ID NO:1, 3, 5 и 6. Эти CTL показывали цитотоксическую активность против PANC-1 (IMP-3+, HLA-A2+), но не показывали цитотоксическую активность против MCF7 (IMP-3-, HLA-A2+) и A549 (IMP-3+, HLA-A2-). Часть (B) представляет цитотоксические активности CTL, индуцированные из PBMC пациента 14 с раком легкого, стимуляцией пептидами SEQ ID NO:3 и 5, и пациента 4 пептидом SEQ ID NO:6, которые детектировали анализом высвобождения 51Cr. Эти CTL обнаруживали цитотоксическую активность против PANC-1 (IMP-3+, HLA-A2+), но не обнаруживали цитотоксическую активность против MCF7 (IMP-3-, HLA-A2+) и A549 (IMP-3+, HLA-A2-). Часть (C) представляет цитотоксические активности IMP-3-специфических CTL против MCF7/IMP3 (белый кружок; MCF7-клетки, трансфицированные геном IMP-3) или MCF7 (черный кружок), анализированные с использованием анализа высвобождения 51Cr.

[0020]

[Фиг.5D]

Часть (D) представляет цитотоксические активности IMP-3-специфических CTL против SW620 (белый треугольник), SKHep1 (белый ромб), MCF7 (черный кружок) или A549 (черный ромб), анализированные анализом высвобождения 51Cr. Линии CTL, генерированные из здоровых доноров стимуляцией либо пептидом SEQ ID NO:1, либо пептидом SEQ ID NO:6, проявляли цитотоксическую активность против SW620, SKHep1, но не против A549 (HLA-A2-, IMP-3+) или клеток MCF7 (HLA-A2+, IMP-3-).

[0021]

[Фиг.6A-B]

Фиг.6 состоит из ряда диаграмм в виде столбцов (A, B, D) и линейных графиков (C), изображающих ингибирование CTL-реакций анти-HLA класса I-mAb (W6/32, IgG2a) или анти-HLA-A2-mAb. Активности CTL, индуцированные из PBMC пациента 14 с раком легкого стимуляцией пептидами SEQ ID NO:1, 3, 5 и 6, детектировали анализом IFN-гамма ELISPOT (A). Продуцирование IFN-гамма, опосредованное этими CTL, заметно ингибировалось W6/32, в то время как ингибирование продуцирования IFN-гамма не детектировали обработкой анти-HLA-DR-mAb (H-DR-1, IgG2a). Столбики ошибок представляют SD. Статистически значимые различия указаны звездочками (*P<0,05). Показаны продуцирование IFN-гамма (B) и цитотоксичность (C и D), опосредованные CTL. Белый кружок, PANC1; черный кружок, PANC1+W6/32; квадрат, PANC1+контрольное mAb. Столбцы показывают продуцирование IFN-гамма (B) или цитотоксичность (D), когда генерированные линии CTL сокультивировали с PANC1 (белые столбцы), PANC1+контрольное mAb (белые столбцы) или PANC1+блокирующие mAb (черные столбцы). Показаны репрезентативные данные из двух независимых экспериментов со сходными результатами. Статистически значимые различия в (B) указаны звездочками.

[0022]

[Фиг.6C-D]

Фиг.6C-D является продолжением фиг.6A-B.

Описание вариантов осуществления

[0023]

Хотя любые способы и материалы, подобные или эквивалентные способам и материалам, описанным здесь, могут быть использованы в практике или тестировании вариантов осуществления данного изобретения, теперь описываются предпочтительные способы, устройства и материалы. Однако перед описанием этих материалов и способов должно быть понятно, что данное изобретение не ограничивается описанными здесь конкретными размерами, формами, размерностями, методологиями, протоколами и т.д., так как они могут варьироваться в соответствии с рутинным экспериментированием и оптимизацией. Должно быть также понятно, что терминология, используемая в этом описании, предназначена только для цели описания конкретных версий или вариантов осуществления и не предназначена для ограничения объема данного изобретения, который будет ограничиваться только прилагаемой формулой изобретения.

[0024]

Раскрытие каждой публикации, патента или заявки на патент, упоминаемых в этом описании изобретения, специально включено здесь посредством ссылки в полном виде. Однако ничто здесь не должно пониматься как признание того, что это изобретение не дает права на датирование задним числом такого раскрытия на основании предыдущего изобретения.

Если нет другого определения, все технические и научные термины, используемые здесь, имеют то же самое значение, что и значение, обычно понимаемое специалистом, квалифицированным в области, к которой принадлежит данное изобретение. В случае противоречия данное изобретение, в том числе определения, будут служить контролем. Кроме того, эти материалы, способы и примеры являются только иллюстративными и не предназначены для ограничения.

[0025]

I. Определения

Слова, употребляемые в единственном числе, обозначают в данном контексте "по меньшей мере один", если нет других указаний. Термины "полипептид", "пептид" и "белок" используются здесь взаимозаменяемо для ссылки на полимер аминокислотных остатков. Эти термины относятся к аминокислотным полимерам, в которых один или более аминокислотных остатков являются модифицированными остатками или не встречающимися в природе остатками, такими как искусственный химический миметик соответствующей природно-встречающейся аминокислоты, а также к природно-встречающимся аминокислотным полимерам.

[0026]

Термин "олигопептид", используемый иногда в этом описании, используется для ссылки на пептид, который имеет длину 20 остатков или менее, обычно 15 остатков или менее и обычно состоит из приблизительно 8 - приблизительно 11 остатков, часто из 9 или 10 остатков. Во всем этом описании термин "пептид" используется в том же самом значении, что и термин "олигопептид" если нет других указаний.

[0027]

Термин "аминокислота" в данном контексте относится к природно-встречающимся и синтетическим аминокислотам, а также аминокислотным аналогам и аминокислотным миметикам, которые имеют функцию, сходную с функцией природно-встречающихся аминокислот. Природно-встречающимися аминокислотами являются аминокислоты, кодируемые генетическим кодом, а также аминокислоты, модифицированные после трансляции в клетках (например, гидроксипролин, гамма-карбоксиглутамат и О-фосфосерин). Фраза "аналог аминокислот" относится к соединениям, которые имеют одну и ту же базовую химическую структуру (альфа-углерод, связанный с водородом, карбоксигруппа, аминогруппа и R-группа), что и природно-встречающаяся аминокислота, но имеют модифицированную R-группу или модифицированные скелеты макромолекулы (например, гомосерин, норлейцин, метионин, сульфоксид, метионинметилсульфоний). Фраза "аминокислотный миметик" относится к химическим соединениям, которые имеют различные структуры, но сходные функции с обычными аминокислотами.

Аминокислоты могут называться здесь их обычно известными трехбуквенными символами или однобуквенными символами, рекомендуемыми IUPAC-IUB Biochemical Nomenclature Commission.

Термины "ген", "полинуклеотиды", "нуклеотиды" и "нуклеиновые кислоты" используются здесь взаимозаменяемо, если нет других указаний, и подобно аминокислотам называются их общепринятыми однобуквенными кодами.

[0028]

Термины "агент" и "композиция" используются здесь взаимозаменяемо в отношении продукта, включающего в себя указанные ингредиенты в указанных количествах, а также любого продукта, который происходит, прямо или косвенно, из комбинации указанных ингредиентов в указанных количествах. Такие термины в отношении определения "фармацевтические" предназначены для включения в себя продукта, в том числе активного ингредиента (активных ингредиентов), и любого инертного ингредиента (инертных ингредиентов), которые составляет этот носитель, а также любого продукта, который происходит, прямо или косвенно, из объединения, комплексообразования или агрегации любых двух или нескольких из этих ингредиентов, или диссоциации одного или более из этих ингредиентов, или из других типов реакций или взаимодействий одного или более из этих ингредиентов. Таким образом, в контексте данного изобретения, термины "фармацевтический агент" и "фармацевтическая композиция" используются взаимозаменяемо в отношении любого агента, вещества или композиции, приготовленных смешиванием продукта данного изобретения и фармацевтически или физиологически приемлемого носителя. Фраза "фармацевтически приемлемый носитель" или "физиологически приемлемый носитель", обозначает в данном контексте фармацевтически или фармакологически приемлемый материал, композицию, вещество или носитель, включающие в себя, но не ограничивающиеся ими, жидкий или твердый наполнитель, разбавитель, эксципиент, растворитель или инкапсулирующий материал, участвующий в несении или транспорте удерживаемых субъектом полифармакофоров из одного органа, или части тела, в другой орган, или в другую часть тела.

Фармацевтические агенты или композиции данного изобретения находят особое применение в качестве вакцин. В контексте данного изобретения, фраза "вакцина" (также называемая "иммуногенной композицией") относится к веществу, которое имеет функцию индуцирования противоопухолевого иммунитета после инокуляции в животных.

[0029]

Термин "активный ингредиент" относится здесь к веществу в агенте или композиции, которое является биологически или физиологически активным. В частности, в фармацевтическом агенте или композиции, "активный ингредиент" относится к веществу, которое обнаруживает целевой фармакологический эффект. Например, в случае фармацевтических агентов или композиций для применения в лечении или предотвращении рака, активные ингредиенты в этих агентах или композициях могут приводить по меньшей мере к одному биологическому или физиологическому действию на раковые клетки и/или ткани прямо или опосредованно. Предпочтительно, такое действие может включать в себя уменьшение или ингибирование роста раковых клеток, повреждение или убивание раковых клеток и/или тканей и т.д. Обычно косвенным действием активных ингредиентов является индуцирование CTL, распознающих или убивающих раковые клетки. Перед приготовлением "активный ингредиент" называют также "нерасфасованным продуктом" (“ин балк”-продуктом), "лекарственным веществом" или "техническим продуктом".

[0030]

Если нет других указаний, термин "рак" относится к типам рака, сверхэкспрессирующим ген IMP-3, примеры которых включают в себя, но не ограничиваются ими, рак легкого и рак пищевода.

Если нет других указаний, термины "цитотоксический Т-лимфоцит", "цитотоксическая Т-клетка" и "CTL" используются здесь взаимозаменяемо и, если не оговорено иное, относятся к подгруппе Т-лимфоцитов, которые способны распознавать не-свои клетки (например, опухолевые клетки, инфицированные вирусом клетки) и индуцировать смерть таких клеток.

Если нет других указаний, термин "набор" используется в данном контексте в отношении комбинации реагентов и других материалов. Здесь обсуждается, что этот набор может включать в себя микроэррей (микрочип) чип, маркер и т.д. У авторов нет намерения ограничения термина "набор" конкретной комбинацией реагентов и/или материалов. При применении здесь, в контексте субъекта или пациента, фраза "HLA-A2-положительный" означает, что этот субъект или пациент гомозиготно или гетерозиготно имеет ген HLA-A2-антигена, и HLA-A2-антиген экспрессируется в клетках этого субъекта или пациента в виде HLA-антигена.

[0031]

В той степени, в которой способы и композиции данного изобретения находят применение в контексте "лечения" рака, лечение считается "эффективным", если оно приводит к клинической эффективности, такой как уменьшение экспрессии гена IMP-3 или уменьшение в размере, распространенности или метастатическом потенциале рака в этом субъекте. При профилактическом применении лечения "эффективное" означает, что лечение задерживает или предотвращает образование рака или предотвращает или облегчает клинический симптом рака. Эффективность определяют вместе с использованием любого известного способа для диагностики или лечения конкретного типа опухоли.

[0032]

В той степени, в которой способы и композиции данного изобретения находят применение в контексте "предотвращения" и "профилактики" рака, такие термины используются здесь взаимозаменяемо в отношении любой активности, которая уменьшает летальность и болезненность, связанные с этим заболеванием. Предотвращение и профилактика могут осуществляться "при первичном, вторичном и третичном уровнях предотвращения". В то время как первичные предотвращение и профилактика избегают развития заболевания, вторичный и третичный уровни предотвращения и профилактики включают в себя активности, нацеленные на предотвращение и профилактику развития заболевания и появление симптомов, а также уменьшение отрицательного действия уже установившегося заболевания посредством восстановления функции и уменьшения связанных с заболеванием осложнений. Альтернативно, предотвращение и профилактика могут включать в себя широкий диапазон профилактических способов лечения, нацеленных на облегчение тяжести конкретного нарушения, например, уменьшением пролиферации и метастазирования опухолей.

[0033]

В контексте данного изобретения лечение и/или профилактика рака и/или предотвращение послеоперационного рецидива включают в себя любую из следующих стадий, таких как хирургическое удаление раковых клеток, ингибирование роста раковых клеток, обратное развитие или регресс опухоли, индукцию ремиссии и уменьшение или ингибирование метастазирования. Эффективное лечение и/или профилактика рака уменьшает смертность и улучшает прогноз индивидуумов, имеющих рак, уменьшает уровни опухолевых маркеров в крови и ослабляет детектируемые симптомы, сопутствующие раку. Например, эффективное лечение включает в себя уменьшение или улучшение симптомов, и/или профилактика включает в себя 10%, 20%, 30% или большее уменьшение, или достижение стабильного состояния заболевания.

[0034]

В контексте данного изобретения термин "антитело" относится к иммуноглобулинам и их фрагментам, которые являются специфически реактивными в отношении указанного белка или его пептида. Антитело может включать в себя антитела человека, приматизированные антитела, химерные антитела, биспецифические антитела, гуманизированные антитела, антитела, слитые с другими белками или радиоактивной меткой, и фрагменты антител. Кроме того, антитело используется здесь в самом широком смысле и конкретно охватывает интактные моноклональные антитела, поликлональные антитела, мультиспецифические антитела (например, биспецифические антитела), образованные по меньшей мере из двух интактных антител, и фрагменты антител, при условии, что они проявляют желаемую биологическую активность. "Антитело" обозначает все классы (например, IgA, IgD, IgE, IgG и IgM).

[0035]

II. Пептиды

Для демонстрации, что пептиды, происходящие из IMP-3, функционируют как антиген, распознаваемый цитотоксическими T-лимфоцитами (CTL), пептиды, произведенные из IMP-3 (SEQ ID NO:22), анализировали для определения, были ли они HLA-A2-рестриктированными (ex. A*0201 и A*0206), с которыми обычно встречаются аллели HLA (Date Y et al., Tissue Antigens 47: 93-101, 1996; Kondo A et al., J Immunol 155: 4307-12, 1995; Kubo RT et al., J Immunol 152: 3913-24, 1994). Кандидаты HLA-A2-связывающих пептидов, произведенные из IMP-3, идентифицировали на основе из аффинностей связывания с HLA-A2. После стимуляции in vitro Т-клеток дендритными клетками (DC), нагруженными этими пептидами, CTL были успешно установлены с использованием этих пептидов, в частности, пептидов SEQ ID NO:1, 3, 5 и 6.

[0036]

Эти установленные CTL обнаруживают сильную специфическую CTL-активность против клеток-мишеней, импульсно обработанных соответствующими пептидами, а также клеток, экспрессирующих HLA-A*0201 и IMP-3. Эти результаты демонстрируют здесь, что IMP-3 является антигеном, распознаваемым CTL, и что эти пептиды могут быть эпитопными пептидами IMP-3, рестриктированными по HLA-A2 (ex. A*0201 и A*0206).

Поскольку ген IMP-3 сверхэкспрессируется в большинстве раковых тканей, таких как рак легкого и рак пищевода, он является хорошей мишенью для иммунотерапии. Таким образом, данное изобретение обеспечивает олигопептиды, такие как нонапептиды (пептиды, состоящие из девяти аминокислотных остатков) и декапептиды (пептиды, состоящие из десяти аминокислотных остатков), соответствующие CTL-распознаваемым эпитопам IMP-3. Особенно предпочтительные примеры олигопептидов данного изобретения включают в себя пептиды, имеющие аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6.

[0037]

В основном программы пакета программного обеспечения, доступные в настоящее время в Интернете, такие как описанные в Parker KC et al., J Immunol 1994 Jan 1, 152(1): 163-75, могут быть использованы для расчета аффинностей связывания между различными пептидами и HLA-антигенами in silico. Аффинность связывания с HLA-антигенами может быть измерена, как описано, например, в ссылке Parker KC et al., J Immunol 1994 Jan 1, 152(1): 163-75; и Kuzushima K et al., Blood 2001, 98(6): 1872-81. Способы определения аффинности связывания описаны, например, в Journal of Immunological Methods, 1995, 185: 181-190 и Protein Science, 2000, 9: 1838-1846. Таким образом, данное изобретение включает в себя пептиды IMP-3, которые связываются с HLA-антигенами, идентифицированными с использованием таких известных программ.

[0038]

Олигопептиды данного изобретения могут быть фланкированы дополнительными аминокислотными остатками, пока полученный пептид сохраняет его CTL-индуцибельность. Такие пептиды, имеющие CTL-индуцибельность, имеют обычно менее приблизительно 40 аминокислот, часто менее приблизительно 20 аминокислот, обычно менее приблизительно 15 аминокислот. Конкретные аминокислотные последовательности, фланкирующие олигопептиды данного изобретения (например, олигопептиды, состоящие из аминокислотной последовательности, выбранной из SEQ ID NO:1, 3, 5 и 6), не ограничиваются и могут состоять из аминокислот любого типа, пока это не ухудшает CTL-индуцибельность исходного пептида. Таким образом, данное изобретение обеспечивает также пептиды, имеющие CTL-индуцибельность и аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6.

[0039]

Обычно модификация одной, двух или нескольких аминокислот в белке не будет влиять на функцию этого белка, и в некоторых случаях, будет даже увеличивать желаемую функцию исходного белка. Действительно, было известно, что модифицированные пептиды (то есть пептиды, состоящие из аминокислотной последовательности, в которой один, два или несколько аминокислотных остатков были модифицированы (то есть заменены, делетированы, добавлены и/или инсертированы) в сравнении с исходной ссылочной последовательностью), сохраняют биологическую активность исходного пептида (Mark et al., Proc Natl Acad Sci USA 1984, 81:5662-6; Zoller and Smith, Nucleic Acids Res 1982, 10:6487-500; Dalbadie-McFarland et al., Proc Natl Acad Sci USA 1982, 79:6409-13). Таким образом, в одном варианте осуществления олигопептиды данного изобретения могут иметь как CTL-индуцибельность, так и аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6, где одна, две или несколько аминокислот добавлены, инсертированы, делетированы и/или заменены.

[0040]

Специалисты с квалификацией в данной области признают, что индивидуальные дополнения или замены к аминокислотной последовательности, которые изменяют одну аминокислоту или небольшой процент аминокислот, имеют тенденцию приведения к сохранению свойств боковой цепи исходной аминокислоты. Таким образом, они обычно называются "консервативными заменами" или "консервативными модификациями", в которых изменение белка приводит к модифицированному белку, имеющему свойства и функции, аналогичные исходному белку. Таблицы консервативных замен, обеспечивающих функционально сходные аминокислоты, известны в данной области техники. Примеры характеристик боковых цепей аминокислот, которые являются желательными для сохранения, включают в себя, например, гидрофобные аминокислоты (A, I, L, M, F, P, W, Y, V), гидрофильные аминокислоты (R, D, N, C, E, Q, G, H, K, S, T) и боковые цепи, имеющие следующие функциональные группы или характеристики в общем: алифатическую боковую цепь (G, A, V, L, I, P); гидроксильную группу, содержащую боковую цепь (S, T, Y); атом серы, содержащий боковую цепь (C, M); карбоксильную кислоту и амидсодержащую боковую цепь (D, N, E, Q); основание, содержащее боковую цепь (R, K, H) и соединение ароматическое ряда, содержащее боковую цепь (H, F, Y, W).

Кроме того, следующие восемь групп, каждые, содержат аминокислоты, которые являются приемлемыми в данной области техники в качестве консервативных замен друг друга:

1) аланин (A), глицин (G);

2) аспарагиновая кислота (D), глутаминовая кислота (E);

3) аспарагин (N), глутамин (Q);

4) аргинин (R), лизин (K);

5) изолейцин (I), лейцин (L), метионин (M), валин (V);

6) фенилаланин (F), тирозин (Y), триптофан (W);

7) серин (S), треонин (T); и

8) цистеин (C), метионин (M) (смотрите, например, Creighton, Proteins 1984).

[0041]

Считается также, что такие консервативно модифицированные пептиды являются пептидами данного изобретения. Однако пептиды данного изобретения не ограничиваются этим и могут включать в себя неконсервативные модификации, пока этот модифицированный пептид сохраняет CTL-индуцибельность исходного пептида. Кроме того, модифицированные пептиды не должны исключать CTL-индуцибельные пептиды полиморфных вариантов, межвидовых гомологов и аллелей IMP-3.

[0042]

Для сохранения необходимой CTL-индуцибельности, можно модифицировать (инсертировать, делетировать, добавить и/или заменить) небольшое число (например, 1, 2 или несколько) или небольшой процент аминокислот. Здесь термин "несколько" означает 5 или менее аминокислот, например, 4 или 3 или менее. Процент аминокислот, которые должны быть модифицированы, составляет предпочтительно 20% или менее, более предпочтительно 15% или менее, даже более предпочтительно 10% или менее или 1-5%.

[0043]

При использовании в контексте иммунотерапии, пептиды данного изобретения должны быть презентированы на поверхности клетки или экзосомы, предпочтительно в виде комплекса с HLA-антигеном. Таким образом, предпочтительно выбирать пептиды, которые не только индуцируют CTL, но также и имеют высокую аффинность связывания с HLA-антигеном. С этой целью пептиды могут быть модифицированы заменой, инсерций, делецией и/или добавлением аминокислотных остатков для получения модифицированного пептида, имеющего улучшенную аффинность связывания. Кроме пептидов, которые природно представлены, поскольку регулярность последовательностей пептидов, представляемых посредством связывания с HLA-антигенами, уже известна (J Immunol 1994, 152: 3913; Immunogenetics 1995, 41: 178; J Immunol 1994, 155: 4307), в иммуногенные пептиды изобретения могут быть введены модификации, основанные на такой регулярности.

[0044]

Например, может быть желательной замена второй аминокислоты от N-конца лейцином или метионином, и/или аминокислоты C-конца валином или лейцином для увеличения аффинности связывания HLA-A24. Таким образом пептиды, имеющие аминокислотные последовательности SEQ ID NO:1, 3, 5 и 6, где вторая аминокислота от N-конца аминокислотной последовательности SEQ ID NO заменена лейцином или метионином и/или где C-концевая аминокислотная последовательность SEQ ID NO заменена валином или лейцином, включены в данное изобретение.

[0045]

Замены могут быть введены не только в концевых аминокислотах, но также и в положении потенциального распознавания TCR пептидов. Несколько исследований продемонстрировали, что замены аминокислот в пептиде могут быть равными или лучшими, чем в исходном пептиде, например CAP1, p53(264-272), Her-2/neu(369-377) или gp100(209-217) (Zaremba et al. Cancer Res. 57, 4570-4577, 1997, T.K. Hoffmann et al.,. J Immunol. (2002) Feb 1; 168 (3):1338-47., S.O. Dionne et al., Cancer Immunol Immunother. (2003) 52: 199-206 и S.O. Dionne et al., Cancer Immunology, Immunotherapy (2004) 53, 307-314).

Данное изобретение рассматривает также добавление аминокислот к описанным здесь последовательностям. Например, одна, две или несколько аминокислот могут также быть добавлены к N- и/или C-концу описанных пептидов. Такие модифицированные пептиды, имеющие высокую аффинность связывания с HLA-антигеном, и сохраняющие CTL-индуцибельность, также включены в данное изобретение.

[0046]

Однако, когда пептидная последовательность идентична части аминокислотной последовательности эндогенного или экзогенного белка, имеющего отличающуюся функцию, могут быть индуцированы побочные эффекты, такие как аутоиммунные нарушения и/или аллергические симптомы против конкретных веществ. Таким образом, предпочтительно сначала провести поиски гомологии с использованием доступных баз данных во избежание ситуаций, в которых последовательность пептида совпадает с аминокислотной последовательностью другого белка. Когда из поисков гомологии становится ясно, что не существует пептида с такими малыми отличиями, как 1 или 2 аминокислоты, в сравнении с пептидом-мишенью, этот пептид-мишень может быть модифицирован для увеличения его аффинности связывания с HLA-антигенами и/или для увеличения его CTL-индуцибельности без какой-либо угрозы в отношении таких побочных эффектов.

[0047]

Хотя ожидается, что пептиды, имеющие высокую аффинность связывания с HLA-антигенами, как описано выше, являются высоко эффективными, кандидатные пептиды, которые выбраны в соответствии с присутствием высокой аффинности связывания в качестве индикатора, исследуются дополнительно на присутствие CTL-индуцибельности. Здесь фраза "CTL-индуцибельность" указывает на способность пептида индуцировать цитотоксические лимфоциты (CTL) при презентации его на антигенпрезентирующих клетках. Далее, "CTL-индуцибельность" включает в себя способность пептида индуцировать активацию CTL, пролиферацию CTL, стимулировать лизис CTL клетками-мишенями и увеличивать продуцирование IFN-гамма CTL.

[0048]

Подтверждение CTL-индуцибельности достигается индуцированием антигенпрезентирующих клеток, несущих MHC-антигены человека (например, B-лимфоцитов, макрофагов и дендритных клеток (DC)), или более конкретно DC, полученных из мононуклеарных лейкоцитов периферической крови человека, и после стимуляции этими пептидами, смешиванием с CD8-положительными клетками, и затем измерением IFN-гамма, продуцируемого и высвобождаемого CTL, в сравнении с клетками-мишенями. В качестве реакционной системы могут быть использованы трансгенные животные, которые были получены для экспрессии HLA-антигена человека (например, такие, как описанные в BenMohamed L, Krishnan R, Longmate J, Auge C, Low L, Primus J, Diamond DJ, Hum Immunol 2000, 61 (8): 764-79, Related Articles, Books, Linkout Induction of CTL response by minimal epitope vaccine in HLA A*0201/DR1 transgenic mice: dependence on HLA class II restricted T(H) response). Например, эти клетки-мишени могут быть помечены радиоактивной меткой 51Cr и т.п., и цитотоксическая активность может быть рассчитана из радиоактивности, высвобождаемой из этих клеток-мишеней. Альтернативно, CTL-индуцибельность может быть оценена измерением продуцирования и высвобождения IFN-гамма CTL в присутствии антигенпрезентирующих клеток (APC), которые несут иммобилизированные пептиды, и визуализацией зоны ингибирования на этой среде с использованием моноклональных анти-IFN-гамма-антител.

[0049]

В результате исследования CTL-индуцибельности пептидов как описано выше, было обнаружено, что пептиды, которые имеют высокую аффинность связывания с HLA-антигеном, необязательно имеют высокую CTL-индуцибельность. Однако было обнаружено, что из тех пептидов, которые были идентифицированы и оценены, олигопептиды, выбранные из пептидов, имеющих аминокислотную последовательность SEQ ID NO:1, 3, 5 и 6, проявляли особенно высокую CTL-индуцибельность, а также высокую аффинность связывания с HLA-антигеном. Таким образом, эти пептиды иллюстрируются как предпочтительные варианты осуществления данного изобретения.

[0050]

Кроме вышеописанных модификаций, пептиды данного изобретения могут также быть связаны с другими веществами, пока полученный связанный пептид сохраняет необходимую CTL-индуцибельность исходного пептида. Примеры подходящих веществ включают в себя, но не ограничиваются ими: пептиды, липиды, сахара и цепи сахаров, ацетильные группы, природные и синтетические полимеры и т.д. Эти пептиды могут содержать модификации, такие как гликозилирование, окисление боковой цепи или фосфорилирование и т.д., при условии, что эти модификации не разрушают биологическую активность исходного пептида. Эти типы модификаций могут быть выполнены для придания дополнительных функций (например, функции нацеливания и функция доставки) или для стабилизации этого полипептида.

[0051]

Например, в данной области техники, известно, что для увеличения стабильности полипептида in vivo вводят D-аминокислоты, миметики аминокислот или неприродные аминокислоты; эта концепция может быть также адаптирована к рассматриваемым полипептидам. Стабильность полипептида может анализироваться рядом способов. Например, пептидазы и различные биологические среды, такие как плазма и сыворотка человека, могут быть использованы для теста на стабильность (смотрите, например, Verhoef et al., Eur J Drag Metab Pharmacokin 1986, 11: 291-302).

[0052]

Далее, пептиды данного изобретения могут быть связаны с другими пептидами посредством спейсеров или линкеров. Примеры других пептидов включают в себя, но не ограничиваются ими, CTL-индуцибельные пептиды, полученные из других TAA. Альтернативно, два или более пептида данного изобретения могут быть связаны посредством спейсеров или линкеров. Пептиды, связанные через спейсеры или линкеры, могут быть одинаковыми или могут отличаться друг от друга. Тип спейсеров и линкеров не ограничивается конкретно и включает в себя спейсеры и линкеры, состоящие из пептидов, более предпочтительно спейсеры и линкеры, состоящие из пептидов, имеющих один или более сайтов расщепления, которые способны к расщеплению ферментами, такими как пептидазы, протеазы и протеасомы. Примеры спейсеров и линкеров включают в себя, но не ограничиваются ими: AAY (P.M. Daftarian et al., J Trans Med 2007, 5:26), AAA, NKRK (R.P.M. Sutmuller et al., J Immunol. 2000, 165: 7308-7315) или один или более остатков лизина (S. Ota et al., Can Res. 62, 1471-1476, K.S. Kawamura et al., J Immunol. 2002, 168:5709-5715). Данное изобретение рассматривает пептиды, связанные с другими пептидами посредством спейсеров или линкеров.

[0053]

Когда пептиды данного изобретения включают в себя остаток цистеина, эти пептиды имеют тенденцию к образованию димеров посредством дисульфидного мостика между SH-группами остатков цистеина. Таким образом, димеры пептида данного изобретения также включены в пептиды данного изобретения.

Здесь пептиды данного изобретения могут быть также описаны как "пептид (пептиды) IMP-3", "полипептид (полипептиды) IMP-3" или "олигопептид IMP-3".

[0054]

III. Получение IMP-3-пептидов

Пептиды данного изобретения могут быть получены с использованием известных способов. Например, пептиды могут быть получены синтетически, с использованием технологии рекомбинантных ДНК или химического синтеза. Пептиды данного изобретения могут быть синтезированы индивидуально или в виде более длинных полипептидов, состоящих из двух или более пептидов. Затем эти пептиды могут быть выделены, то есть, очищены или выделены таким образом, чтобы быть по существу свободными от других природно-встречающихся белков клетки-хозяина и их фрагментов или любых других химических веществ.

[0055]

Пептиды данного изобретения могут также содержать модификации, такие как гликозилирование, окисление боковой цепи или фосфорилирование, при условии, что такие модификации не разрушают биологическую активность исходного пептида. Другие иллюстративные модификации включают в себя введение D-аминокислот или других аминокислотных миметиков, которые могут использоваться, например, для увеличения периода полувыведения из сыворотки этих пептидов.

[0056]

Пептид данного изобретения может быть получен посредством химического синтеза, основанного на выбранной аминокислотной последовательности. Примеры способов обычного пептидного синтеза, которые могут быть приспособлены к этому синтезу, включают в себя, но не ограничиваются ими:

(i) Peptide Synthesis, Interscience, New York, 1966;

(ii) The Proteins, Vol. 2, Academic Press, New York, 1976;

(iii) Peptide Synthesis (in Japanese), Maruzen Co., 1975;

(iv) Basics and Experiment of Peptide Synthesis (in Japanese), Maruzen Co., 1985;

(v) Development of Pharmaceuticals (second volume) (in Japanese), Vol. 14 (peptide synthesis), Hirokawa, 1991;

(vi) WO99/67288; и

(vii) Barany G. & Merrifield R.B., Peptides Vol. 2, "Solid Phase Peptide Synthesis", Academic Press, New York, 1980, 100-118.

[0057]

Альтернативно, эти пептиды могут быть получены путем применения любых известных способов генетической инженерии для получения пептидов (например, Morrison J, J Bacteriology 1977, 132:349-51; Clark-Curtiss & Curtiss, Methods in Enzymology (eds. Wu et al.) 1983, 101:347-62). Например, сначала, подходящий вектор, несущий полинуклеотид, кодирующий пептид-мишень, в экспрессируемой форме (например, справа от регуляторной последовательности, соответствующей последовательности промотора), готовят и трансформируют в подходящую клетку-хозяина. Затем эту клетку-хозяина культивируют для получения представляющего интерес пептида. Этот пептид может также быть получен in vitro посредством адаптирования к системе трансляции in vitro.

[0058]

IV. Полинуклеотиды

Данное изобретение обеспечивает также полинуклеотид, который кодирует любой из вышеупомянутых пептидов данного изобретения. Эти полинуклеотиды включают в себя полинуклеотиды, полученные из природно-встречающегося гена IMP-3 (GenBank Accession No NM_006547.2 (SEQ ID NO:21)), а также полинуклеотиды, имеющие их консервативно модифицированную нуклеотидную последовательность. Здесь фраза "консервативно модифицированная нуклеотидная последовательность" относится к последовательностям, которые кодируют идентичные или по существу идентичные аминокислотные последовательности. Вследствие вырожденности генетического кода, большое количество функционально идентичных нуклеиновых кислот кодируют любой конкретный белок. Например, кодоны GCA, GCC, GCG и GCU, все, кодируют аминокислоту аланин. Таким образом, в каждом положении, где аланин указан кодоном, этот кодон может быть изменен на любой из соответствующих описанных кодонов без изменения кодируемого полипептида. Такие вариации нуклеиновых кислот являются "молчащими вариациями", которые являются одной разновидностью консервативно модифицированных вариаций. Каждая последовательность нуклеиновой кислоты здесь, которая кодирует пептид, также описывает каждую возможную молчащую вариацию этой нуклеиновой кислоты. Квалифицированному в данной области специалисту будет понятно, что каждый кодон в нуклеиновой кислоте (за исключением AUG, который обычно является единственным кодоном для метионина, и TGG, который обычно является единственным кодоном для триптофана) может быть модифицирован для получения функционально идентичной молекулы. Таким образом, каждая молчащая вариация нуклеиновой кислоты, которая кодирует пептид, полностью описана в каждой раскрытой последовательности.

[0059]

Полинуклеотид данного изобретения может состоять из ДНК, РНК и их производных. Как хорошо известно в данной области техники, ДНК подходящим образом состоит из оснований, таких как природно-встречающиеся основания A, T, C и G и Т заменен на U в РНК. Квалифицированному в данной области специалисту будет понятно, что основания, не встречающиеся в природе, могут быть также включены в полинуклеотиды.

Полинуклеотид данного изобретения может кодировать многочисленные пептиды данного изобретения с промежуточными аминокислотными последовательностями или без промежуточных аминокислотных последовательностей между ними. Например, промежуточная аминокислотная последовательность может обеспечивать сайт расщепления (например, последовательность, распознаваемую ферментом) полинуклеотида или транслированных пептидов. Кроме того, этот полинуклеотид может включать любые дополнительные последовательности в кодирующую последовательность, кодирующую пептид данного изобретения. Например, этот полинуклеотид может быть рекомбинантным полинуклеотидом, который включает в себя регуляторные последовательности, требуемые для экспрессии этого пептида, или может быть экспрессирующим вектором (плазмидой) с маркерными генами и т.п. Обычно такие рекомбинантные полинуклеотиды могут быть получены манипуляцией полинуклеотидами посредством обычных рекомбинантных способов с использованием, например, полимераз и эндонуклеаз.

[0060]

Как рекомбинантные способы, так и способы химического синтеза могут быть использованы для получения полинуклеотидов данного изобретения. Например, полинуклеотид может быть получен инсертированием в подходящий вектор, который может экспрессироваться при трансфицировании в компетентную клетку. Альтернативно, полинуклеотид может быть амплифицирован с использованием ПЦР-способов или экспрессии в подходящих хозяевах (смотрите, например, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1989). Альтернативно, полинуклеотид может быть синтезирован с использованием твердофазных способов, как описано в Beaucage SL & Iyer RP, Tetrahedron 1992, 48:2223-311; Matthes et al., EMBO J 1984, 3:801-5.

Векторы, содержащие полинуклеотид данного изобретения, и клетки-хозяева, несущие эти векторы, также включены в данное изобретение.

[0061]

V. Экзосомы

Данное изобретение дополнительно обеспечивает внутриклеточные пузырьки, называемые экзосомами, которые презентируют комплексы, образованные между пептидами данного изобретения и HLA-антигенами, на их поверхности. Экзосомы могут быть получены, например, с использованием способов, подробно описанных в Japanese Patent Application Kohyo Publocations Nos. Hei 11-510507 и W099/03499, и могут быть получены с использованием APC, полученных из пациентов, которые подвергаются лечению и/или предотвращению. Экзосомы данного изобретения могут быть инокулированы в качестве вакцины аналогично инокуляции пептидов данного изобретения.

[0062]

Тип HLA-антигенов, содержащихся в этих комплексах, должен соответствовать типу HLA-антигенов субъекта, требующего лечения и/или профилактики. Применение типа HLA-A2, который является высокоэкспрессируемым среди японцев и индивидуумов, принадлежащих к Индо-Европейской (европеоидной) расе, является благоприятным для получения эффективных результатов, и подтипы, такие как HLA-A2 (A*0201 и A*0206), также находят применение. Обычно в клинике тип HLA-антигена пациента, требующего лечения, исследуется заранее, что позволяет сделать подходящий выбор пептидов, имеющих высокие уровни аффинности связывания с конкретным антигеном или имеющих CTL-индуцибельность, посредством презентации антигена. Кроме того, для получения пептидов, имеющих как высокую аффинность связывания, так и CTL-индуцибельность, замена, инсерция, делеция или добавление 1, 2 или нескольких аминокислот могут быть выполнены на основании аминокислотной последовательности природно-встречающегося неполного пептида IMP-3.

При использовании антигена HLA-A2 (A*0201) для экзосомы данного изобретения, пептиды, имеющие последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6, находят конкретное применение.

[0063]

VI. Антигенпрезентирующие клетки (APC)

Данное изобретение обеспечивает также выделенные антигенпрезентирующие клетки (APC), которые презентируют на их поверхности комплексы, образованные между HLA-антигенами и пептидами данного изобретения. APC, которые получены контактированием с пептидами данного изобретения или введением полинуклеотидов, кодирующих пептиды данного изобретения в экпрессируемой форме, могут быть получены из пациентов, которые подвергаются лечению и/или предотвращению заболевания, и могут применяться в качестве вакцины сами по себе или в сочетании с другими лекарственными средствами, включающими в себя пептиды данного изобретения, экзосомы или цитотоксические T-клетки.

[0064]

APC не ограничиваются конкретным видом клеток и включают в себя дендритные клетки (DC), клетки Лангерганса, макрофаги, B-клетки и активированные T-клетки, которые, как известно, презентируют белковые антигены на их клеточной поверхности таким образом, что они могут распознаваться лимфоцитами. Поскольку DC является репрезентативной APC, имеющей самое сильное CTL-индуцирующее действие среди APC, DC находят применение в качестве APC данного изобретения.

[0065]

Например, APC могут быть получены индуцированием DC из моноцитов периферической крови и затем контактированием (стимулированием) их с пептидами данного изобретения in vitro, ex vivo или in vivo. При введении пептидов данного изобретения субъектам, APC, которые презентируют пептиды данного изобретения, индуцируются в теле этого субъекта. Фраза, "индуцирование APC" включает в себя контактирование (стимулирование) клетки с пептидами данного изобретения или нуклеотидами, кодирующими такие пептиды, для презентирования комплексов, образованных между HLA-антигенами и пептидами данного изобретения на клеточной поверхности. Таким образом, APC данного изобретения могут быть получены путем сбора APC из субъекта после введения пептидов данного изобретения субъекту. Альтернативно, APC данного изобретения могут быть получены контактированием APC, собранных из субъекта, с пептидом данного изобретения.

[0066]

APC данного изобретения могут сами по себе вводиться субъекту для индуцирования иммунной реакции против рака в субъекте, например, в виде вакцины. APC данного изобретения могут также вводиться в комбинации с другими лекарственными средствами, включающими в себя пептиды, экзосомы или CTL данного изобретения. Введение ex vivo может включать в себя стадии:

a: сбора APC из первого субъекта;

b: контактирования APC из стадии a с пептидом; и

c: введения APC, нагруженных пептидом, второму субъекту.

[0067]

Первый субъект и второй субъект могут быть одним и тем же индивидуумом или они могут быть разными индивидуумами. Альтернативно, согласно данному изобретению, обеспечено применение пептидов данного изобретения для приготовления фармацевтического агента или композиции индуцированием антигенпрезентирующих клеток. Кроме того, данное изобретение обеспечивает способ или процесс приготовления фармацевтического агента или композиции для индуцирования антигенпрезентирующих клеток, где этот способ включает в себя стадию смешивания или приготовления пептида данного изобретения с фармацевтически приемлемым носителем. Кроме того, данное изобретение обеспечивает способ или процесс приготовления фармацевтического агента или композиции для лечения раковых заболеваний, включающих в себя рак легких и рак пищевода, где этот способ предусматривает стадию смешивания или приготовления пептида данного изобретения с фармацевтически приемлемым носителем. Далее, данное изобретение обеспечивает также пептиды данного изобретения для индуцирования антигенпрезентирующих клеток. APC, полученные на стадии b, могут вводиться субъекту в виде вакцины. Данное изобретение дополнительно обеспечивает эти пептиды для лечения раковых заболеваний, включающих в себя рак легких и рак пищевода.

[0068]

Согласно одному аспекту данного изобретения, APC данного изобретения имеют высокий уровень CTL-индуцибельности. В термине "высокий уровень CTL-индуцибельности" этот высокий уровень относится к уровню CTL-индуцибельности APC, которые не контактируют с пептидом или пептидами, которые не могут индуцировать CTL. Такие APC, имеющие высокий уровень CTL-индуцибельности, могут быть получены способом, который включает в себя стадию переноса генов, содержащих полинуклеотиды, которые кодируют пептиды данного изобретения, к APC in vitro. Введенные гены могут быть в форме ДНК или РНК. Примеры способов введения включают в себя, без конкретных ограничений, различные способы, традиционно выполняемые в этой области, такие как липофекция, электропорация и способ с использованием фосфата кальция. Более конкретно, это может быть выполнено, как описано в Cancer Res 1996, 56:5672-7; J Immunol 1998, 161:5607-13; J Exp Med 1996, 184:465-72; Published Japanese Translation of International Publication No 2000-509281. Посредством переноса этого гена в APC, этот ген подвергается транскрипции, трансляции и т.д. в этой клетке и затем полученный белок процессируется МНС класса I или класса II, и направляется посредством презентирующего пути для презентации этих пептидов.

[0069]

В одном предпочтительном варианте осуществления, APC данного изобретения презентируют на их поверхности комплекс HLA-антигена и олигопептида, имеющего аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6. Предпочтительно, APC данного изобретения несут HLA-A2-антиген на их поверхности. Другими словами, APC данного изобретения предпочтительно экспрессируют HLA-A2-антиген на их поверхности. Альтернативно, этот олигопептид для образования комплекса с HLA-антигеном, может быть олигопептидом, имеющим аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6, где одна, две или несколько аминокислот заменены, инсертированы, делетированы и/или добавлены; например, вторая аминокислота от N-конца может быть заменена лейцином или метионином и/или C-концевая аминокислота может быть заменена валином или лейцином.

[0070]

VII. Цитотоксические T-клетки (цитотоксические T-лимфоциты: CTL)

Цитотоксическая T-клетка, индуцированная против любого из пептидов данного изобретения, усиливает иммунную реакцию, поражая опухолеассоциированный эндотелий in vivo, и таким образом может быть использована в качестве вакцин, аналогично пептидам per se. Таким образом, данное изобретение обеспечивает также цитотоксические T-клетки, которые специфически индуцированы или активированы любым из рассматриваемых пептидов.

Такие цитотоксические T-клетки могут быть получены (1) введением пептида данного изобретения субъекту и затем сбором цитотоксических T-клеток из субъекта, или (2) контактированием (стимулированием) полученных из субъекта APC и CD8-положительных клеток или мононуклеарных лейкоцитов периферической крови с пептидами данного изобретения in vitro и затем выделением цитотоксических T-клеток.

[0071]

Цитотоксические T-клетки, которые были индуцированы стимуляцией с APC, которые презентируют пептиды данного изобретения, могут быть получены из пациентов, которые подлежат лечению и/или профилактике, и могут вводиться сами по себе или в комбинации с другими лекарственными средствами, включающими в себя пептиды данного изобретения или экзосомы с целью регулирующих эффектов. Полученные цитотоксические T-клетки действуют специфически против клеток-мишеней, презентируя пептиды данного изобретения, или, например, те же самые пептиды, использованные для индукции. Другими словами, полученные цитотоксические T-клетки способны распознавать комплекс, образованный между HLA-антигеном и пептидом данного изобретения на поверхности клетки-мишени и связываться с ним посредством Т-клеточного рецептора и затем атаковать клетку-мишень для индуцирования смерти этой клетки-мишени. Эти клетки-мишени могут быть клетками, которые эндогенно экспрессируют IMP-3, или клетками, которые трансфицированы геном IMP-3; и клетки, которые презентируют пептид данного изобретения на клеточной поверхности благодаря стимуляции пептидом, могут также служить в качестве мишеней атаки активированного CTL. В одном предпочтительном варианте осуществления, эти клетки-мишени несут HLA-A2-антиген на их поверхности и презентируют комплекс, образованный между HLA-A2 и пептидом данного изобретения на их поверхности.

[0072]

VIII. T-клеточный рецептор (TCR)

Данное изобретение обеспечивает также композицию, содержащую последовательность нуклеиновой кислоты, кодирующую полипептид, который способен к образованию субъединицы Т-клеточного рецептора (TCR), и способы ее применения. Субъединицы TCR, альфа и бета, обладают способностью образования TCR, которые придают специфичность Т-клеткам против опухолевых клеток, презентирующих IMP-3. При помощи известных способов в данной области техники последовательность нуклеиновой кислоты альфа и бета цепей TCR, экпрессированных в CTL, индуцированных одним или несколькими пептидами данного изобретения, может быть выделена и использована для конструирования подходящих векторов, которые могут быть посредниками высоко эффективных переносов генов в первичные лимфоциты человека (W02007/032255 и Morgan RA et al., J Immunol, 171, 3287 (2003)). Например, способ ПЦР является предпочтительным для анализа TCR. Праймерами ПЦР для анализа могут быть, например, 5'-R праймеры (5'-gtctaccaggcattcgcttcat-3') в качестве праймеров 5'-стороны (SEQ ID NO:23) и 3-TRa-C-праймеры (5'-tcagctggaccacagccgcagcgt-3'), специфические в отношении C-района и альфа-цепи TCR (SEQ ID NO:24), 3-TRb-C1-праймеры (5'-tcagaaatcctttctcttgac-3'), специфические в отношении С1-района бета цепи TCR (SEQ ID NO:25), или 3-TRbeta-C2-праймеры (5'-ctagcctctggaatcctttctctt-3'), специфические в отношении C2-района бета цепи TCR (SEQ ID NO:26) в качестве праймеров 3'-стороны, но не ограничивающиеся ими. Примерные векторы включают в себя, но не ограничиваются ими, ретровирусные векторы. Преимущественно, это изобретение обеспечивает готовую композицию, делающую возможной быструю модификацию собственных Т-клеток пациента (или Т-клеток другого млекопитающего) для быстрого и легкого получения модифицированных Т-клеток, имеющих превосходные свойства убивания раковых клеток. Эти производные TCR могут связывать клетки-мишени, презентирующие IMP-3-пептид, с высокой авидностью и произвольно опосредовать эффективное убивание клеток-мишеней, презентирующих IMP-3-пептид, in vivo и in vitro.

[0073]

Нуклеиновые кислоты, кодирующие субъединицы TCR, могут быть включены в подходящие векторы, например, ретровирусные векторы. Эти векторы хорошо известны в этой области техники. Нуклеиновые кислоты или векторы, содержащие их, могут быть успешно перенесены в Т-клетку, например, Т-клетку из пациента. Преимущественно, изобретение обеспечивает готовую композицию, позволяющую проводить быструю модификацию собственных Т-клеток пациента (или Т-клеток другого млекопитающего) для быстрого и легкого получения модифицированных Т-клеток, имеющих превосходные свойства убивания раковых клеток.

[0074]

Специфический TCR является рецептором, способным специфически распознавать комплекс пептида данного изобретения и HLA-молекулы, придавая Т-клетке специфическую активность против клетки-мишени, когда TCR находится на поверхности этой Т-клетки. Специфическое распознавание вышеупомянутого комплекса может быть подтверждено любыми известными способами, и предпочтительные способы включают в себя, например, анализ тетрамеров с использованием молекулы HLA и пептида данного изобретения, и ELISPOT-анализ. Посредством проведения ELISPOT-анализа, можно подтвердить, что Т-клетка, экпрессирующая TCR на клеточной поверхности, распознает клетку посредством TCR и что этот сигнал передается внутриклеточно. Подтверждение, что вышеупомянутый комплекс может придавать Т-клеточную цитотоксическую активность, когда комплекс существует на поверхности Т-клетки, может также быть проведено известным способом. Предпочтительный способ включает в себя, например, определение цитотоксической активности против HLA-положительной клетки-мишени, например, анализ высвобождения хрома.

[0075]

Данное изобретение обеспечивает также CTL, которые получают трансдукцией нуклеиновыми кислотами, кодирующими полипептиды субъединиц TCR, которые связываются с IMP-3-пептидом, например, SEQ ID NO:1, 3, 5 и 6 в контексте HLA-A2. Трансдуцированные CTL способны к хомингу к раковым клеткам in vivo и могут быть размножены известными способами культивирования in vitro (например, Kawakami et al., J Immunol., 142, 3452-3461 (1989)). Т-клетки данного изобретения могут использоваться для образования иммуногенной композиции, применимой в лечении или предотвращении рака в пациенте, нуждающемся в терапии или защите (WO2006/031221).

[0076]

IX. Фармацевтические агенты или композиции

Поскольку экспрессия IMP-3 в нескольких типах рака активируется в сравнении с нормальной тканью, пептиды данного изобретения или полинуклеотиды, кодирующих подобные пептиды, могут быть использованы для лечения и/или для профилактики рака или опухоли и/или предотвращения их послеоперационного рецидива. Таким образом, данное изобретение обеспечивает фармацевтический агент или композицию для лечения и/или предотвращения рака или опухоли, и/или предотвращения их послеоперационного рецидива, которые включают в себя в качестве активного ингредиента один или более пептидов данного изобретения или полинуклеотидов, кодирующих эти пептиды. Альтернативно, эти пептиды могут экспрессироваться на поверхности любых из вышеупомянутых экзосом или клеток, таких как APC, для использования в качестве фармацевтических агентов или композиции. Кроме того, вышеупомянутые цитотоксические Т-клетки, которые нацелены на любой из пептидов данного изобретения, также могут быть использованы в качестве активного компонента этих фармацевтических агентов или композиций. В контексте данного изобретения фраза "нацеливание на пептид" относительно активности цитотоксической Т-клетки указывает, что цитотоксическая Т-клетка распознает (т.е. связывается с ним), комплекс, образованный между HLA-антигеном и пептидом на поверхности клетки-мишени посредством ее T-клеточного рецептора и затем атакует эту клетку-мишень для индуцирования смерти этой клетки-мишени.

[0077]

В другом варианте осуществления данное изобретение обеспечивает также применение активного компонента, выбранного из:

(a) пептида данного изобретения,

(b) нуклеиновой кислоты, кодирующей такой пептид, как описано здесь, в экспрессируемой форме,

(c) APC данного изобретения, и

(d) цитотоксических Т-клеток данного изобретения

в приготовлении фармацевтической композиции или агента для лечения рака или опухоли.

[0078]

Альтернативно, данное изобретение обеспечивает дополнительно активный ингредиент, выбранный из:

(a) пептида данного изобретения,

(b) нуклеиновой кислоты, кодирующей такой пептид, как описано здесь, в экспрессируемой форме,

(c) APC данного изобретения, и

(d) цитотоксических Т-клеток данного изобретения

для применения в лечении рака или опухоли.

[0079]

Альтернативно, данное изобретение обеспечивает дополнительно способ или процесс для приготовления фармацевтической композиции или агента для лечения рака или опухоли, где этот способ или процесс предусматривает стадию образования фармацевтически или физиологически приемлемого носителя с активным ингредиентом, выбранным из:

(a) пептида данного изобретения,

(b) нуклеиновой кислоты, кодирующей такой пептид, как описано здесь, в экспрессируемой форме,

(c) APC данного изобретения, и

(d) цитотоксических Т-клеток данного изобретения

в качестве активных ингредиентов.

[0080]

В другом варианте осуществления данное изобретение обеспечивает также способ или процесс для приготовления фармацевтической композиции или агента для лечения рака или опухоли, где этот способ или процесс предусматривает стадию смешивания активного ингредиента с фармацевтически или физиологически приемлемым носителем, где этот активный ингредиент выбран из:

(a) пептида данного изобретения,

(b) нуклеиновой кислоты, кодирующей такой пептид, как описано здесь, в экспрессируемой форме,

(c) APC данного изобретения, и

(d) цитотоксических Т-клеток данного изобретения.

[0081]

Альтернативно, эти фармацевтическая композиция или агент данного изобретения могут быть использованы как для профилактики рака или опухоли, так и для предотвращения их послеоперационного рецидива.

[0082]

Фармацевтические агенты или композиции данного изобретения могут быть использованы для лечения и/или предотвращения раковых заболеваний или опухолей и/или предотвращения их послеоперационного рецидива в субъектах или пациентах, включающих в себя человека и любого другого млекопитающего, в том числе, но не только, мышь, крысу, морскую свинку, кролика, кошку, собаку, овцу, козу, свинью, рогатый скот, лошадь, обезьяну, бабуина и шимпанзе, в частности, коммерчески важных животных или одомашненных животных.

[0083]

Согласно данному изобретению, было обнаружено, что олигопептиды, имеющие аминокислотную последовательность, выбранную из SEQ ID NO:1, 3, 5 и 6, является HLA-пептидами с HLA-A2-рестриктированными эпитопными пептидами, которые могут индуцировать сильную и специфическую иммунную реакцию. Таким образом, эти фармацевтические агенты или композиции, которые включают в себя любой из этих олигопептидов, имеющих аминокислотные последовательности SEQ ID NO:1, 3, 5 или 6, являются особенно подходящими для введения субъектам, HLA-антиген которых представляет собой HLA-A2. В данном контексте фраза "субъекты, HLA-антиген которых представляет собой HLA-A2", имеет в виду субъектов, которые имеют гомозиготно или гетерозиготно ген HLA-A2, и HLA-A2 экспрессируется в клетках этих субъектов в виде HLA-антигена. Другими словами, субъекты являются HLA-A2-положительными. То же самое относится к фармацевтическим агентам или композициям, которые включают в себя полинуклеотиды, кодирующие любой из этих олигопептидов.

[0084]

Раковые заболевания или опухоли, которые подлежат лечению фармацевтическими агентами или композициями данного изобретения, не ограничиваются и включают в себя все виды рака или опухолей, в которых участвует IMP-3, в том числе, например, рак легких и рак пищевода. В частности, фармацевтические агенты или композиции данного изобретения предпочтительно применяются к раку поджелудочной железы.

[0085]

Эти фармацевтические агенты или композиции могут содержать, кроме вышеупомянутых активных ингредиентов, другие пептиды, которые обладают способностью индуцировать CTL против раковых клеток, другие полинуклеотиды, кодирующие эти другие пептиды, другие клетки, которые презентируют эти другие пептиды или т.п. Здесь, эти другие пептиды, которые обладают способностью индуцировать CTL против раковых клеток, иллюстрируются специфическими в отношении рака антигенами (например, идентифицированными TAA), но не ограничиваются ими.

[0086]

Если необходимо, фармацевтические агенты или композиции данного изобретения могут произвольно включать в себя другие терапевтические вещества в качестве активного ингредиента, пока это вещество не ингибирует противоопухолевое действие этого активного ингредиента, например, любой из этих пептидов. Например, композиции могут включать в себя противовоспалительные агенты, болеутоляющие средства, химиотерапевтические вещества и т.п. Кроме включения других терапевтических веществ в сам лекарственный препарат, лекарственные препараты данного изобретения могут также вводиться последовательно или одновременно с одним или несколькими другими фармакологическими агентами или композициями. Количества лекарственного средства и фармакологического агента или композиций зависит, например, от того, какой тип фармакологического агента (фармакологических агентов) или композиции (композиций) используется/используются, от подлежащего лечению заболевания и схемы и способов введения.

[0087]

Должно быть понятно, что кроме ингредиентов, конкретно упомянутых здесь, фармацевтические агенты или композиции данного изобретения могут включать в себя другие агенты или композиции, общепринятые в данной области техники, имеющие отношение к типу рассматриваемой композиции.

В одном варианте осуществления данного изобретения эти фармацевтические агенты или композиции могут быть включены в изделия и наборы, содержащие материалы, полезные для лечения патологических состояний подлежащего лечению заболевания, например, рака. Это изделие может включать в себя контейнер любого из этих фармацевтических агентов или композиций с этикеткой. Подходящие контейнеры включают в себя бутылки, флаконы и пробирки. Эти контейнеры могут быть выполнены из различных материалов, таких как стекло или пластик. Этикетка на контейнере должна указывать агент или композицию, которые используются для лечения или предотвращения одного или более состояний этого заболевания. Этикетка может также содержать инструкции в отношении введения и т.д.

[0088]

Кроме вышеописанного контейнера, набор, включающий в себя фармацевтический агент или композицию данного изобретения, может дополнительно произвольно включать в себя второй контейнер, содержащий фармацевтически приемлемый разбавитель. Он может дополнительно включать в себя другие материалы, желательные с коммерческой и пользовательской точки зрения, включающие в себя другие буферы, разбавители, фильтры, иглы, шприцы и вкладыши упаковки с инструкциями в отношении применения.

[0089]

Фармацевтические агенты или композиции могут при желании быть обеспечены в упаковке или дозирующем устройстве, которые могут содержать одну или несколько стандартных лекарственных форм, содержащих активный ингредиент. Эта упаковка может, например, включать в себя металлическую или пластиковую пленку, такую как блистерная упаковка. Эта упаковка или дозирующее устройство могут сопровождаться инструкциями для введения.

В другом варианте осуществления данного изобретения пептиды данного изобретения могут также вводиться в форме фармацевтически приемлемой соли. Предпочтительные примеры солей включают в себя соли со щелочным металлом, соли с металлом, соли с органическим основанием, соли с органической кислотой и соли с неорганической кислотой.

[0090]

(1) Фармацевтические агенты или композиции, содержащие пептиды в качестве активного ингредиента

Пептиды данного изобретения могут вводиться непосредственно в виде фармацевтического агента или композиций, или, если необходимо, могут быть приготовлены общепринятыми способами приготовления. В последнем случае, кроме пептидов данного изобретения, могут быть включены носители, эксципиенты и т.п., которые обычно используются для лекарственных средств, без особых ограничений. Примеры подобных носителей представляют собой стерилизованную воду, физиологический раствор, фосфатный буфер, культуральную жидкость и т.п. Кроме того, фармацевтические агенты или композиции могут содержать при необходимости, стабилизаторы, суспензии, консерванты, поверхностно-активные вещества и т.п. Фармацевтические агенты или композиции данного изобретения могут использоваться в противораковых целях.

[0091]

Пептиды данного изобретения могут быть получены в виде комбинации, состоящей из двух или более пептидов данного изобретения, для индуцирования CTL in vivo. Эта комбинация пептидов может иметь форму коктейля или может иметь коньюгированные стандартными способами пептиды. Например, пептиды могут быть химически связаны или экспрессированы в виде одной слитой полипептидной последовательности. Пептиды в комбинации могут быть одинаковыми или различными. Посредством введения пептидов данного изобретения, эти пептиды презентируются при высокой плотности HLA-антигенами на APC, затем индуцируются CTL, которые специфически воздействуют на комплекс, образованный между представленным пептидом и HLA-антигеном. Альтернативно, APC, которые презентируют любой из пептидов данного изобретения на их клеточной поверхности, которые могут быть получены стимулированием APC (например, DC), полученных из субъекта, пептидами данного изобретения, могут быть введены субъекту, и в результате CTL индуцируются в этом субъекте, и агрессивность в отношении раковых клеток, таких как клетки рака легкого и рака пищевода, может увеличиваться.

[0092]

Фармацевтические агенты или композиции для лечения и/или предотвращения рака или опухоли, которые включают в себя пептид данного изобретения в качестве активного ингредиента, могут также включать в себя адъювант, о котором известно, что он эффективно устанавливает клеточный иммунитет. Альтернативно, эти фармацевтические агенты или композиции могут вводиться с другими активными компонентами или вводиться путем представления в виде гранул. Адъювант относится к соединению, которое увеличивает иммунный реакцию против белка при введении вместе (или последовательно) с белком, имеющим иммунологическую активность. Адъюванты, обсуждаемые здесь, включают в себя адъюванты, описанные в литературе (Clin Microbiol Rev 1994, 7:277-89). Примеры подходящих адъювантов включают в себя, но не ограничиваются ими, фосфат алюминия, гидроксид алюминия, квасцы, холерный токсин, токсин сальмонеллы и т.п., но не ограничиваются ими.

Кроме того, могут быть удобным образом использованы липосомные композиции, гранулярные композиции, в которых пептид связан с гранулами с диаметром, равным нескольким микрометрам, и композиции, в которых липид связан с пептидом.

[0093]

В другом варианте осуществления данного изобретения пептиды данного изобретения могут быть также введены в форме фармацевтически приемлемой соли. Предпочтительные примеры этих солей включают в себя соли со щелочным металлом, соли с металлом, соли с органическим основанием, соли с органической кислотой и соли с неорганической кислотой. В данном контексте термин "фармацевтически приемлемая соль" относится к тем солям, которые сохраняют биологическую эффективность и свойства этого соединения и которые получены реакцией с неорганическими кислотами или основаниями, такими как хлористоводородная кислота, бромистоводородная кислота, серная кислота, азотная кислота, фосфорная кислота, метансульфоновая кислота, этансульфоновая кислота, п-толуолсульфоновая кислота, салициловая кислота и т.п. Примеры предпочтительных солей включают в себя соли со щелочным металлом, соли с металлом, соли с органическим основанием, соли с органической кислотой и соли с неорганической кислотой.

[0094]

В некоторых вариантах осуществления фармацевтические агенты или композиции данного изобретения могут дополнительно включать в себя компонент, который примирует CTL. Липиды были идентифицированы в качестве агентов или композиций, способных к примированию CTL in vivo против вирусных антигенов. Например, остатки пальмитиновой кислоты могут быть присоединены к эпсилон- и альфа-аминогруппам остатка лизина и затем связаны с пептидом данного изобретения. Липидированные пептиды могут быть затем либо введены непосредственно в мицелле или частице, включенной в липосому, либо эмульгированы в адъюванте. В качестве другого примера примирования липидом CTL-реакций, липопротеины E. coli, такие как трипальмитоил-S-глицерилцистеинилсерилсерин (P3CSS), могут быть использованы для примирования CTL при ковалентном присоединении к соответствующему пептиду (смотрите, например, Deres et al., Nature 1989, 342:561-4).

[0095]

Способ введения может быть пероральным способом, внутрикожной, подкожной, внутривенной инъекций или т.п., и системным введением или локальным введением вблизи участков-мишеней. Это введение быть выполнено одиночным введением или может быть усилено множественными введениями. Доза пептидов данного изобретения может корректироваться подходящим образом в соответствии с подлежащим лечению заболеванием, возрастом пациента, массой, способом введения и т.п., и равна обычно 0,001-1000 мг, например, 0,001-1000 мг, например, 0,1-10 мг, и может вводиться один раз в несколько дней - несколько месяцев. Специалист, с квалификацией в данной области техники, может соответствующим образом выбрать подходящую дозу.

[0096]

(2) Фармацевтические агенты или композиции, содержащие полинуклеотиды в качестве активных компонентов

Фармацевтические агенты или композиции данного изобретения могут также содержать нуклеиновые кислоты, кодирующие пептиды, описанные здесь, в экспрессируемой форме. Здесь фраза "в экспрессируемой форме" означает, что этот полинуклеотид, при введении в клетку, будет экспрессироваться in vivo в виде полипептида, который индуцирует противоопухолевый иммунитет. В иллюстрируемом варианте осуществления последовательность нуклеиновой кислоты представляющего интерес полинуклеотида включает в себя регуляторные элементы, необходимые для экспрессии этого полинуклеотида. Полинуклеотид (полинуклеотиды) могут быть оснащены таким образом, чтобы устойчиво инсертироваться в геном клетки-мишени (смотрите, например, Thomas KR & Capecchi MR, Cell 1987, 51:503-12 в отношении описания гомологичных рекомбинантных кассетных векторов). Смотрите, например, Wolff et al., Science 1990, 247:1465-8; патенты США с номерами: 5580859; 5589466; 5804566; 5739118; 5736524; 5679647; и WO 98/04720. Примеры технологий на основе ДНК-доставки включают в себя "голую ДНК", облегченную (бупивакаин-опосредованную, опосредованную полимерами, пептид-опосредованную) доставку, катионные липидные комплексы и доставку посредством частиц ("генную пушку") или опосредованную давлением доставку (смотрите, например, патент США № 5922687).

[0097]

Пептиды данного изобретения могут также экпрессироваться вирусными или бактериальными векторами. Примеры экспрессирующих векторов включают в себя аттенуированных вирусных хозяев, таких как коровья оспа или оспа птиц. Этот подход включает в себя использование вируса коровьей оспы, например, в качестве вектора для экспрессии нуклеотидных последовательностей, которые кодируют этот пептид. После введении в хозяина этот рекомбинантный вирус коровьей оспы экспрессирует иммуногенный пептид, и посредством этого индуцирует иммунную реакцию. Векторы коровьей оспы и способы, применимые в протоколах иммунизации, описаны, например, в патенте США № 4722848. Другим примером является BCG (Bacille Calmette Guerin). Векторы BCG описаны в Stover et al., Nature 1991, 351:456-60. Большое разнообразие других векторов, применимых для терапевтического введения или иммунизации, например, адено- и аденоассоциированные вирусные векторы, ретровирусные векторы, векторы Salmonella typhi, детоксифицированные векторы токсина сибирской язвы и т.п., будут очевидными. Смотрите, например, Shata et al., Mol Med Today 2000, 6:66-71; Shedlock et al., J Leukoc Biol 2000, 68:793-806; Hipp et al., In vivo 2000, 14:571-85.

[0098]

Доставка полинуклеотида в субъекта может быть или прямой, когда субъект непосредственно подвергается действию несущего полинуклеотид вектора, или опосредованной, когда, клетки сначала трансформируют представляющим интерес полинуклеотидом in vitro, затем эти клетки трансплантируют в этого субъекта. Эти два подхода известны, соответственно, как генная терапия in vivo и ex vivo.

В отношении общих обзоров способов генной терапии смотрите Goldspiel et al., Clinical Pharmacy 1993, 12: 488-505; Wu and Wu, Biotherapy 1991, 3: 87-95; Tolstoshev, Ann Rev Pharmacol Toxicol 1993, 33: 573-96; Mulligan, Science 1993, 260: 926-32; Morgan & Anderson, Ann Rev Biochem 1993, 62: 191-217; Trends in Biotechnology 1993, 11(5): 155-215. Способы, обычно известные в области технологии рекомбинантных ДНК, которые также могут использоваться для данного изобретения, описаны в Ausubel et al., Current Protocols in Molecular Biology, John Wiley&Sons, New York 1993; и Krieger, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, New York, 1990.

[0099]

Способ применения может быть пероральным способом, внутрикожной, подкожной, внутривенной инъекцией или т.п., и системное введение или локальное введение вблизи участков-мишеней находит применение. Введение может быть выполнено одиночным применением или усилено множественными введениями. Доза полинуклеотида в подходящем носителе или клеток, трансформированных с полинуклеотидом, кодирующим пептиды данного изобретения, может регулироваться соответственно заболеванию, которое подвергается лечению, возрасту пациента, массе, способу применения и подобному, и составляет обычно от 0,001 мг до 1000 мг, например, от 0,001 мг до 1000 мг, например, от 0,1 мг до 10 мг, и может применяться один раз каждые несколько дней - один раз каждые несколько месяцев. Специалист, квалифицированный в данной области техники, может соответственно выбрать подходящую дозу.

[0100]

X. Способы применения этих пептидов, экзосом, APC и CTL

Пептиды данного изобретения и полинуклеотиды, кодирующие такие пептиды, могут использоваться для индуцирования APC и CTL, а также для индуцирования иммунной реакции против рака или опухоли. Экзосомы и APC данного изобретения могут также использоваться для индуцирования CTL, а также для индуцирования иммунной реакции против рака или опухоли. Пептиды, полинуклеотиды, экзосомы и APC могут использоваться в комбинации с любыми другими соединениями, пока эти соединения не ингибируют их CTL-индуцибельность. Таким образом, любой из вышеупомянутых фармацевтических агентов или композиций данного изобретения могут применяться для индуцирования CTL, и, кроме того, фармацевтические агенты или композиции, включающие в себя пептиды и полинуклеотиды, могут также применяться для индуцирования APC, как обсуждается ниже. Далее, CTL данного изобретения могут также использоваться для индуцирования иммунной реакции против рака или опухоли.

[0101]

(1) Способ индуцирования антигенпрезентирующих клеток (APC)

Данное изобретение обеспечивает способы индуцирования APC с использованием пептидов данного изобретения или полинуклеотидов, кодирующих эти пептиды. Индукция APC может быть выполнена, как описано выше в разделе "VI. Антигенпрезентирующие клетки". Это изобретение обеспечивает также способ индуцирования APC, имеющих высокий уровень CTL-индуцибельности, индукция которых также упоминалась под пунктом "VI. Антигенпрезентирующие клетки" выше.

Предпочтительно, способы индуцирования APC включают в себя по меньшей мере одну стадию, выбранную из:

a: контактирования APC с пептидом данного изобретения, и

b: введения полинуклеотида, кодирующего полипептид данного изобретения, в экспрессируемой форме в APC.

Такие способы индуцирования APC предпочтительно выполняют in vitro или ex vivo. Для выполнения способов in vitro или ex vivo, APC могут быть получены из подлежащего лечению субъекта или других субъектов, HLA-антигены которых являются теми же самыми, что и HLA-антигены подлежащего лечению субъекта. В предпочтительном варианте осуществления, APC, индуцированные данными способами, несут антигены HLA-A2 на их поверхности.

[0102]

(2) Способ индуцирования CTL

Данное изобретение обеспечивает также способы индуцирования CTL с использованием пептидов данного изобретения, полинуклеотидов, кодирующих эти пептиды, или экзосом или APC- представляющих пептидов.

Данное изобретение обеспечивает также способы индуцирования CTL с использованием полинуклеотида, кодирующего полипептид, который способен образовывать субъединицу Т-клеточного рецептора (TCR), распознающую (то есть связывающуюся с ним) комплекс пептидов данного изобретения и HLA-антигенов. Предпочтительно, эти способы индуцирования CTL включают в себя по меньшей мере одну стадию, выбранную из:

a: контактирования CD8-положительной Т-клетки с антигенпрезентирующей клеткой и/или экзосомой, которая презентирует на ее поверхности комплекс HLA-антигена и пептида данного изобретения, и

b: введения полинуклеотида, кодирующего полипептид, который способен к образованию субъединицы TCR, распознающей комплекс пептида данного изобретения и HLA-антигена, в CD8-положительную T-клетку.

[0103]

При введении пептидов данного изобретения субъекту, CTL индуцируются в теле субъекта, и сила иммунной реакции, нацеленной на опухолеспецифический эндотелий, увеличивается. Альтернативно, пептиды и полинуклеотиды, кодирующие эти пептиды, могут быть использованы для терапевтического способа ex vivo, в котором APC, полученные из субъекта, и CD8-положительные клетки или мононуклеарные лейкоциты периферической крови контактируют (стимулируются) с пептидами данного изобретения in vitro, и, после индуцирования CTL, активированные CTL клетки возвращают в субъекта. Например, этот способ может включать в себя стадии:

a: сбора APC из субъекта,

b: контактирования этого пептида с APC стадии a,

c: смешивания APC из стадии b с CD8+ T-клетками и со-культивирование для индуцирования CTL, и

d: сбора CD8+ T-клеток из сокультуры стадии с.

[0104]

Альтернативно, согласно данному изобретению, обеспечено применение пептидов данного изобретения для приготовления фармацевтического агента или композиции, индуцирующих CTL. Кроме того, данное изобретение обеспечивает способ или процесс для приготовления фармацевтического агента или композиции, индуцирующих CTL, где этот способ предусматривает стадию смешивания или образования пептида данного изобретения с фармацевтически приемлемым носителем. Далее, данное изобретение обеспечивает также пептид данного изобретения для индуцирования CTL.

[0105]

CD8+ Т-клетки, имеющие цитотоксическую активность, полученные на стадии d, могут быть введены субъекту в качестве вакцины. APC для смешивания с CD8+ T-клетками на вышеупомянутой стадии c могут быть также получены переносом генов, кодирующих эти пептиды, в APC, как описано подробно выше в разделе "VI. Антигенпрезентирующие клетки"; но не ограничиваются ими. Таким образом, любые APC или экзосомы, которые эффективно презентируют данные пептиды T-клеткам, могут быть использованы для данного способа.

[0106]

(3) Способ индуцирования иммунной реакции

Данное изобретение обеспечивает дополнительно способы индуцирования иммунной реакции против рака, такого как рак легких и рак пищевода, в субъекте. Эти способы предусматривают введение вакцины данного изобретения, которая включает в себя:

(a) один или более олигопептидов данного изобретения или их иммунологически активный фрагмент;

(b) один или более полинуклеотидов, кодирующих эти олигопептиды, или иммунологически активный фрагмент (a);

(c) один или более выделенных CTL данного изобретения;

(d) одну или несколько выделенных антигенпрезентирующих клеток данного изобретения; или

(e) одну или несколько T-клеток, выделенных и трансформированных кодирующим TCR геном.

[0107]

В контексте данного изобретения рак, сверхэкспрессирующий IMP-3, может лечиться этими активными компонентами. Примеры таких типов рака включают в себя, но не ограничиваются ими, рак легкого и рак пищевода. Таким образом, перед введением вакцин или фармацевтических композиций, содержащих эти активные ингредиенты, предпочтительно подтвердить, увеличен ли уровень экспрессии IMP-3 в подлежащих лечению раковых клетках или тканях, в сравнении с нормальными клетками того же самого органа. Таким образом, в одном варианте осуществления, данное изобретение обеспечивает способ лечения рака, сверхэкспрессирующего IMP-3, который может предусматривать стадии:

i) определения уровня экспрессии IMP-3 в раковых клетках или ткани (тканях)), полученных из субъекта с подлежащим лечению раком;

ii) сравнения этого уровня экспрессии IMP-3 с нормальным контролем; и

iii) введения по меньшей мере одного компонента, выбранного из (a)-(d), описанных выше, субъекту с раком, сверхэкспрессирующим IMP-3 в сравнении с нормальным контролем. Альтернативно, данное изобретение может обеспечивать вакцину или фармацевтическую композицию, которая включает в себя по меньшей мере один компонент, выбранный из (a)-(d), описанных выше, для применения во введении субъекту, имеющему рак, сверхэкспрессирующий IMP-3. Другими словами, данное изобретение обеспечивает далее способ идентификации субъекта, подлежащего лечению полипептидом IMP-3 данного изобретения, причем такой способ предусматривает стадию определения уровня экспрессии IMP-3 в полученных из субъекта раковых клетках или ткани (тканях), причем увеличение этого уровня в сравнении с уровнем нормального контроля этого гена указывает на то, что этот субъект имеет рак, который может лечиться полипептидом IMP-3 данного изобретения. Способы лечения рака данного изобретения описаны более подробно ниже.

[0108]

Любая полученная из субъекта клетка или ткань может быть использована для определения экспрессии IMP-3, пока эта клетка или ткань включает в себя продукт транскрипции или трансляции IMP-3, являющийся мишенью. Примеры подходящих проб включают в себя, но не ограниваются ими, ткани и жидкости тела, такие как кровь, слюна и моча. Предпочтительно, проба клеток или ткани, полученных из субъекта, содержит клеточную популяцию, включающую в себя эпителиальную клетку, более предпочтительно раковую эпителиальную клетку, полученную из ткани, которая предположительно является раковой. Далее, в случае необходимости, эта клетка может быть очищена из полученных тканей и жидкостей тела, и затем использована в качестве пробы, полученной из субъекта.

Субъект, подлежащий лечению данным способом, является предпочтительно млекопитающим. Примерные млекопитающие включают в себя, но не ограничиваются ими, например, человека, примата не человека, мышь, крысу, собаку, кошку, лошадь и корову.

[0109]

Согласно данному изобретению, определяют уровень экспрессии IMP-3 в раковых клетках или тканях, полученных из субъекта. Этот уровень экспрессии может быть определен по уровню продукта транскрипции с использованием способов, известных в данной области техники. Например, мРНК IMP-3 может быть количественно определена с использованием зондов способами гибридизации (например, Нозерн-гибридизации). Это детектирование может проводиться на чипе или микроэррее. Применение микроэррея является предпочтительным для детектирования уровня экспрессии IMP-3. Специалисты, квалифицированные в этой области техники, могут приготовить такие зонды с использованием информации последовательности IMP-3. Например, в качестве зондов может быть использована кДНК IMP-3. Если необходимо, эти зонды могут быть помечены подходящей меткой, такой как красители, флуоресцентные вещества и изотопы, и уровень экспрессии этого гена может быть детектирован в виде интенсивности гибридизуемых меток.

[0110]

Кроме того, продукт транскрипции IMP-3 (например, SEQ ID NO:21) может быть количественно определен с использованием праймеров способами детектирования на основе амплификации (например, ОТ-ПЦР). Такие праймеры могут быть получены на основе доступной информации последовательности этого гена.

Конкретно, зонд или праймер, используемые для данного способа, гибридизуются при строгих, умеренно строгих условиях или при условиях низкой строгости с мРНК IMP-3. В данном контексте, фраза, "строгие условия (гибридизации)" относится к условиям, при которых зонд или праймер будет гибридизоваться с его последовательностью-мишенью, но не с другими последовательностями. Строгие условия являются последовательность-зависимыми и будут различаться при различных обстоятельствах. Специфическая гибридизация более длинных последовательностей наблюдается при более высоких температурах, чем гибридизация более коротких последовательностей. Обычно, температура строгих условий выбирается таким образом, что она приблизительно на 5 градусов Цельсия ниже температуры тепловой точки плавления (Тм) для конкретной последовательности при определенных ионной силе и pH. Тм является температурой (при определенных ионной силе, pH и концентрации нуклеиновой кислоты), при которой 50% зондов, комплементарных их последовательности-мишени, гибридизуются с последовательностью-мишенью в равновесном состоянии. Поскольку эти последовательности-мишени обычно присутствуют в избытке, при Тм, 50% этих зондов являются занятыми в равновесном состоянии. Обычно, строгими условиями являются условия, при которых концентрация соли меньше, чем приблизительно 1,0 М ион натрия, обычно приблизительно 0,01-1,0 М ион натрия (или других солей) при pH 7,0-8,3 и температура равна по меньшей мере приблизительно 30 градусам по Цельсию для коротких зондов и праймеров (например, 10-50 нуклеотидов) и по меньшей мере приблизительно 60 градусам по Цельсию для более длинных зондов и праймеров. Строгие условия могут также быть достигнуты добавлением дестабилизирующих агентов, таких как формамид.

[0111]

Зонды и праймеры могут иметь определенные размеры. Эти размеры могут находиться в диапазоне по меньшей мере 10 нуклеотидов, по меньшей мере 12 нуклеотидов, по меньшей мере 15 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 25 нуклеотидов, по меньшей мере 30 нуклеотидов, и эти зонды и праймеры могут находиться в диапазоне размеров 5-10 нуклеотидов, 10-15 нуклеотидов, 15-20 нуклеотидов, 20-25 нуклеотидов и 25-30 нуклеотидов.

Альтернативно, продукт трансляции может детектироваться для диагностики данного изобретения. Например, может быть определено количество белка IMP-3 (SEQ ID NO:22). Способы определения количества белка в продукте трансляции включает в себя способы иммуноанализа, которые используют антитело, специфически распознающее рассматриваемый белок. Антитело может быть моноклональным или поликлональным. Кроме того, любой фрагмент или любая модификация (например, химерное антитело, scFv, Fab, F(ab')2, Fv и т.д.) антитела могут быть использованы для детектирования, пока этот фрагмент или модифицированное антитело сохраняет способность связывания с белком IMP-3. Способы получения этих видов антител для детектирования белков хорошо известны в этой области техники, и любой способ может использоваться в данном изобретении для получения таких антител и их эквивалентов.

[0112]

В качестве другого способа детектирования уровня экспрессии гена IMP-3, основанного на его продукте трансляции, может быть измерена интенсивность окрашивания посредством иммуногистохимического анализа с использованием антитела против белка IMP-3. А именно, в данном измерении сильное окрашивание указывает на увеличенное присутствие/увеличенный уровень этого белка и, в то же самое время, на высокий уровень экспрессии гена IMP-3.

Уровень экспрессии гена-мишени, например, гена IMP-3, в раковых клетках может быть определен как увеличенный, если этот уровень увеличивается выше контрольного уровня (например, уровня в нормальных клеткам) гена-мишени, например, на 10%, 25% или 50%; или увеличивается более чем в 1,1 раза, более чем в 1,5 раза, более чем в 2,0 раза, более чем в 5,0 раз, более чем в 10,0 раз или более.

[0113]

Этот контрольный уровень может быть определен в то же самое время, что и в раковых клетках, с использованием пробы (проб), собранных ранее и сохраненных, из субъекта/субъектов, состояние болезни которого/которых (ракового или неракового) известно. Кроме того, нормальные клетки, полученные из незлокачественных областей органа, который имеет подлежащий лечению рак, могут использоваться в качестве нормального контроля. Альтернативно, уровень контроля может быть определен статистическим способом, основанным на результатах, полученных анализом ранее определенного уровня (ранее определенных уровней) экспрессии гена IMP-3 в пробах из субъектов, состояния болезни которых известны. Кроме того, этот контрольный уровень может быть получен из базы данных картин (паттернов) экспрессии из ранее тестированных клеток. Кроме того, согласно одному аспекту данного изобретения, уровень экспрессии гена IMP-3 в биологической пробе можно сравнить с многочисленными контрольными уровнями, определенными из множественных ссылочных проб. Предпочтительно использовать контрольный уровень, определенный для ссылочной пробы, полученной из типа ткани, сходного с типом ткани биологической пробы, полученной из субъекта. Кроме того, предпочтительно использовать стандартную величину уровней экспрессии гена IMP-3 в популяции с известным состоянием болезни. Эта стандартная величина может быть получена любым способом, известным в данной области техники. Например, диапазон среднего +/-2 S.D. или среднего +/-3 S.D. может быть использован в качестве этой стандартной величины.

[0114]

В контексте данного изобретения контрольный уровень, определенный из биологической пробы, которая, как известно, является нераковой, называют "нормальным контрольным уровнем". С другой стороны, если этот контрольный уровень определен из раковой биологической пробы, его называют "раковым контрольным уровнем". Различие между уровнем экспрессии пробы и контрольным уровнем может быть нормализовано относительно уровня экспрессии контрольных нуклеиновых кислот, например, генов домашнего хозяйства, уровни экспрессии которых, как известно, не различаются в зависимости от ракового или неракового состояния клетки. Примерные контрольные гены включают в себя, но не ограничиваются ими, гены бета-актина, глицеральдегид-3-фосфатдегидрогеназы и рибосомного белка P1.

Когда уровень экспрессии гена IMP-3 является увеличенным в сравнении с нормальным контрольным уровнем или является сходным/эквивалентным относительно ракового контрольного уровня, этот субъект может диагностироваться как имеющий подлежащий лечению рак.

[0115]

Более конкретно, данное изобретение обеспечивает способ (i) диагностирования наличия у субъекта подлежащего лечению рака, и/или (ii) отбора субъекта для лечения рака, предусматривающий стадии:

a) определения уровня экспрессии IMP-3 в раковых клетках или ткани (тканях), полученных из субъекта, который предположительно имеет подлежащий лечению рак;

b) сравнения этого уровня экспрессии IMP-3 с нормальным контрольным уровнем;

c) диагностирования субъекта как имеющего подлежащий лечению рак, если этот уровень экспрессии IMP-3 является увеличенным в сравнении с нормальным контрольным уровнем; и

d) отбора субъекта для лечения рака, если этот субъект диагностирован как имеющий подлежащий лечению рак, на стадии c).

[0116]

Альтернативно, такой способ включает стадии:

a) определения уровня экспрессии IMP-3 в раковых клетках или ткани (тканях), полученных из субъекта, который предположительно имеет подлежащий лечению рак;

b) сравнения уровня экспрессии IMP-3 с раковым контрольным уровнем;

c) диагностирования субъекта как имеющего подлежащий лечению рак, если этот уровень экспрессии IMP-3 является сходным или эквивалентным относительно ракового контрольного уровня; и

d) отбор субъекта для лечения рака, если субъект диагностирован как имеющий подлежащий лечению рак, на стадии c).

[0117]

Данное изобретение обеспечивает также набор для определения субъекта, страдающего от рака, который может лечиться полипептидом IMP-3 данного изобретения, который может быть также быть применим в оценивании и/или мониторинге эффективности конкретной противораковой терапии, более конкретно иммунотерапии рака. Иллюстративные примеры подходящих типов рака включают в себя, но не ограничиваются ими, рак легкого и рак пищевода. Более конкретно, этот набор предпочтительно включает в себя по меньшей мере, один реагент для детектирования экспрессии гена IMP-3 в полученной из субъекта раковой клетки, причем такой реагент выбран из группы:

(a) реагента для детектирования мРНК гена IMP-3;

(b) реагента для детектирования белка IMP-3; и

(c) реагента для детектирования биологической активности белка IMP-3.

[0118]

Примеры реагентов, подходящих для детектирования мРНК гена IMP-3 включают в себя нуклеиновые кислоты, которые специфически связываются с мРНК IMP-3 или идентифицируют мРНК IMP-3, такие как олигонуклеотиды, имеющие последовательность, комплементарную части мРНК IMP-3. Эти виды олигонуклеотидов иллюстрируются праймерами и зондами, которые являются специфическими в отношении мРНК IMP-3. Эти виды олигонуклеотидов могут быть получены на основе способов, хорошо известных в этой области техники. Если необходимо, реагент для детектирования мРНК IMP-3 может быть иммобилизован на твердом матриксе. Кроме того, в этом наборе может быть включен более чем один реагент для детектирования мРНК IMP-3.

[0119]

С другой стороны, примеры реагентов, подходящих для детектирования белка IMP-3, включают в себя антитела к белку IMP-3. Это антитело может быть моноклональным или поликлональным. Кроме того, любой фрагмент или модификация (например, химерное антитело, scFv, Fab, F(ab')2, Fv и т.д.) этого антитела может использоваться в качестве этого реагента, пока этот фрагмент или модифицированное антитело сохраняют способность связывания с белком IMP-3. Способы получения этих видов антител для детектирования белков хорошо известны в данной области техники, и любой способ может быть использован в данном изобретении для получения таких антител и их эквивалентов. Кроме того, это антитело может быть меченым генерирующими сигнал молекулами, образованием прямой связи или способом непрямого мечения. Метки и способы для мечения антител и детектирования связывания антител с их мишенями хорошо известны в данной области техники, и любые метки и способы могут быть использованы для данного изобретения. Кроме того, в этом наборе может быть включен более чем один реагент для детектирования белка IMP-3.

[0120]

Этот набор может содержать более чем один из вышеупомянутых реагентов. Например, пробы ткани, полученные из субъектов без рака или страдающих от рака, могут служить в качестве контрольных реагентов. Набор данного изобретения может дополнительно включать в себя другие материалы, желательные с коммерческой и пользовательской точки зрения, в том числе буферы, разбавители, фильтры, иглы, шприцы и вкладыши упаковки (например, написанные, в виде магнитной ленты, CD-ROM и т.д.) с инструкциями для применения. Эти реагенты и т.п. могут храниться в контейнере с этикеткой. Подходящие контейнеры включают в себя бутылки, флаконы и тест-пробирки. Эти контейнеры могут быть выполнены из различных материалов, таких как стекло или пластик.

[0121]

В качестве одного варианта осуществления данного изобретения, когда этот реагент является зондом против мРНК IMP-3, этот реагент может быть иммобилизован на твердом матриксе, таком как пористая полоска, для образования по меньшей мере одного участка детектирования. Зона измерения или детектирования этой пористой полоски может включать в себя множество участков, каждый из которых содержит нуклеиновую кислоту (зонд). Тест-полоска может также включать в себя участки для отрицательных и/или положительных контролей. Альтернативно, контрольные участки могут быть расположены на полоске, отдельной от этой тест-полоски. Необязательно, эти различные участки детектирования могут содержать различное количество иммобилизованных нуклеиновых кислот, то есть более высокое количество в первом участке детектирования и меньшие количества в последующих участках. После добавления тест-пробы, количество участков, демонстрирующих детектируемый сигнал, обеспечивает количественный показатель количества мРНК IMP-3, присутствующего в этой пробе. Эти участки детектирования могут быть иметь конфигурацию любой удобно детектируемой формы и находятся обычно в форме столбика или точки, охватывающих ширину тест-полоски.

[0122]

Этот набор данного изобретения может дополнительно включать в себя пробу положительного контроля или пробу стандарта IMP-3. Проба положительного контроля данного изобретения может быть изготовлена сбором IMP-3-положительных проб и оцениванием их уровня IMP-3. Альтернативно, очищенный белок или полинуклеотид IMP-3 может быть добавлен к клеткам, которые не экспрессируют IMP-3, для образования положительной пробы или пробы стандарта IMP-3. В данном изобретении очищенный IMP-3 может быть рекомбинантным белком. Уровень IMP-3 пробы положительного контроля является, например, большим, чем величина точки отсечения.

Следующие примеры представлены для иллюстрации данного изобретения и для помощи специалисту с обычной квалификацией в данной области в его выполнении и применении. Эти примеры ни в коем случае не предназначены для ограничения объема данного изобретения.

ПРИМЕРЫ

[0123]

МАТЕРИАЛЫ И СПОСОБЫ

Мыши

Трансгенные (Tg) мыши по антигену (HLA)-A2 лейкоцита человека; мыши с двойным нокаутом H-2Db и beta2m, с введенным одноцепочечным генным конструктом человека beta2m-HLA-A2.1 (HLA-A*0201, альфа 1, альфа 2)-H-2Db (альфа-3-трансмембранным цитоплазматическим) были генерированы в Department SIDA-Retrovirus, Unity d'Immunite Cellulaire Antivirale, Institute Pasteur, France и любезно предоставлены доктором F.A. Lemommier. Этих мышей содержали в Center for Animal Resources and Development of Kumamoto University, и с ними обращались в соответствии с руководящими принципами ухода за животными Kumamoto University.

[0124]

Клеточные линии

PANC1, A549, Lu99, MCF7, SW620, SKHep1 и T2, TAP-дефектную и HLA-A2 (A*0201)-положительную клеточную линию приобретали в Riken Cell Bank, Tsukuba, Япония. Экспрессию IMP-3 определяли анализом полимеразной цепной реакции с обратной транскрипцией.

[0125]

Пробы крови

Исследования, проведенные с использованием мононуклеарных клеток периферической крови (PBMC), выделенных из HLA-A2-положительных доноров, были одобрены Institutional Review Board of Kumamoto University, Kumamoto, Япония. Пробы крови 4 пациентов с раком легких, обозначенных как пациент 1, пациент 3 и пациент 4, пациент 14 и пациент 103, получали во время рутинных диагностических процедур после получения официально подписанных информированных согласий пациентов в Kumamoto University Hospital. Пробы крови получали также из HLA-A2 (A*0201)-положительных здоровых доноров, обозначенных как донор-1, донор-2 и донор-3, после получения письменного информированного согласия. Все пробы были анонимными, пронумерованными случайным образом и хранились при -80 градусах Цельсия до использования.

[0126]

Выбор кандидатов пептидов, полученных из IMP-3

Пептиды, полученные из IMP-3, которые могут, предположительно, связываться с молекулой HLA-A2 (A*0201), были прогнозированы с использованием программы прогнозирования связывания "BIMAS" (http://www-bimas.cit.nih.gov/molbio/hla_bind) (Parker et al., J Immunol 1994, 152 (1):163-75, Kuzushima et al., Blood 2001, 98 (6):1872-81). Эти пептиды и HLA-A2 (A*0201)-рестриктированный пептид ВИЧ, (SLYNTYATL), синтезировали с чистотой >95% при помощи American Peptide Company, Sannyvale, CA, США.

[0127]

Индукция CTL IMP-3-реактивной мыши

Мышей HLA-A2 Tg иммунизировали 5×105 дендритными клетками, полученными из сингенного костного мозга (BM-DC), импульсно обработанными кандидатными пептидами in vivo в день 7 и 14. В день 21, CD4--клетки селезенки, выделенные из этих иммунизированных мышей, стимулировали BM-DC, импульсно обработанными каждым пептидом в течение 6 дней. Продуцирование IFN-гамма детектировали твердофазным иммуноферментным анализом (ELISPOT).

[0128]

Индукция IMP-3-реактивных CTL человека

PBMC из гепаринизированной крови HLA-A2 (A*0201)-положительных доноров, выделяли центрифугированием в градиенте плотности Ficoll-Conray для генерирования полученных из периферических моноцитов DC. Эти DC импульсно обрабатывали 20 мкг/мл кандидатных пептидов в присутствии 4 мкг/мл бета2-микроглобулина (Sigma-Aldrich, St. Louis, MO, USA) в течение 2 часов при 37 градусах по Цельсию в AIM-V (Invitrogen Japan, Tokyo, Japan), содержащей 2% инактивированную нагреванием аутологическую плазму. Затем эти клетки затем облучали (40 Гр) и инкубировали с CD8+ T-клетками. Эти культуры помещали в 24-луночные планшеты, каждая лунка содержала 1×105 DC, импульсно обработанных пептидами, 2×106 CD8+ T-клеток и 5 нг/мл рекомбинантного IL-7 человека (Wako, Osaka, Japan) в 2 мл AIM-V с 2% аутологической плазмой. После 2 дней эти культуры дополняли рекомбинантным IL-2 человека (PeproTech, Rocky Hill, NJ, USA) до конечной концентрации 20 МЕ/мл. В дни 7 и 14 проводили две дополнительные еженедельные стимуляции загруженными пептидом аутологическими DC с использованием той же самой процедуры. Спустя шесть дней после последней стимуляции, антигенспецифические реакции индуцированных CTL исследовали с использованием анализа IFN-гамма ELISPOT и анализа высвобождения 51Cr. Для анализа IFN-гамма ELISPOT CTL (1×105 клеток на лунку) стимулировали T2 (1×104 на лунку), импульсно обработанными родственными пептидами или посторонним пептидом ВИЧ. Для анализа высвобождения 51Cr, CTL сокультивировали с T2-клетками, импульсно обработанными пептидом, или раковыми клетками в качестве клеток-мишеней (5×103 на лунку) при указанном отношении эффектор/мишень, и стандартный анализ высвобождения 51Cr выполняли как описано ранее (Komori H и др., Clin Cancer Res. 2006 May 1; 12 (9):2689-97).

[0129]

Анализ экспозиции CD107a (LAMP-1; мембранного белка 1, ассоциированного с лизосомами) на клеточной поверхности CTL

Экспозицию CD107a на клеточной поверхности CTL после стимуляции антигеном детектировали с использованием анти-CD107a-антитела. IMP-3-пептид-специфические CTL стимулировали когнатным (родственным) пептидом или посторонним пептидом ВИЧ в присутствии FITC-коньюгированных анти-CD107a-mAb или IgG1 мыши в качестве контроля. Эти CTL культивировали в течение 5 часов при 37 градусах по Цельсию и затем окрашивали PE-коньюгированными анти-CD8-mAb человека. Все пептиды использовали в конечной концентрации 1 мкг/мл. Показанные события регулируются в отношении CD8+ T клеток.

[0130]

Ингибирование CTL-реакций моноклональным анти-HLA-класса I-антителом

Ингибирование HLA-класса I выполняли, как описано ранее (Komori H и др., Clin Cancer Res. 2006 May 1; 12 (9):2689-97). Конкретно, после инкубирования клеток-мишеней Lu99 с анти-HLA класса I-mAb (W6/32, IgG2a) или анти-HLA-DR-mAb (HLA-класс II mAb) (H-DR-1, IgG2a), соответственно, в течение 1 часа, клетки Lu99 сокультивировали с CTL, полученными из пациентов с раком легких стимуляцией с родственными пептидами.

[0131]

Статистический анализ

Двухсторонний критерий Стьюдента использовали для оценивания статистической значимости различий данных, полученных IFN-гамма ELISPOT анализом. Считали, что величина P<0,05 является значимой. Статистический анализ выполняли с использованием коммерческого пакета статистического программного обеспечения (SPSS для Windows, версия 11.0, Chicago, IL, USA А).

[0132]

РЕЗУЛЬТАТЫ

Прогнозирование HLA-A2-связывающих пептидов, полученных из IMP-3

Таблица 1 демонстрирует HLA-A2 (A*0201)-связывающие пептиды IMP-3 в порядке самой высокой аффинности связывания (таблица 1). Отбирали в целом 20 пептидов с потенциальной HLA-A2 (A*0201)-связывающей способностью.

[0133]

Таблица 1
HLA-A2 (А*0201)-связывающие пептиды, полученные из IMP-3

[0134]

Индукция IMP-3-реактивных и HLA-A2-рестриктированных CTL с использованием HLA-A2-трансгенных мышей

Для тестирования, какой из этих пептидов может индуцировать пептид-реактивные цитотоксические T-лимфоциты (CTL), CD4--клетки селезенки из HLA-A2 (A*0201)-трансгенных (Tg) мышей, дважды иммунизированных 9-мерными пептидами, стимулировали in vitro, как описано в «Материалах и способах». Было обнаружено, что CD4--клетки селезенки, стимулированные пептидами IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6), продуцировали IFN-гамма в ответ на сингенные BM-DC, импульсно обработанные родственными пептидами. В сравнении с продуцированием IFN-гамма против только одних BM-DC, эти CD4--клетки селезенки распознавали антигенпрезентирующие клетки и продуцировали IFN-гамма (P<0,05) (фиг.1). Эти результаты показали, что пептиды IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6) могли индуцировать CTL, имеющие сильную активность продуцирования IFN-гамма в HLA-A2 Tg мыши.

[0135]

Индукция IMP-3-реактивных и HLA-А2-рестриктированных CTL человека

IMP-3-реактивные CTL генерировали из PBMC HLA-A2 (A*0201)-положительного здорового донора, стимуляцией PBMC пептидами IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6). Продуцирование IFN-гамма против импульсно обработанных пептидами T2-клеток исследовали с использованием анализа IFN-гамма ELISPOT. Эти CTL проявляли сильное продуцирование IFN-гамма против T2-клеток, импульсно обработанных родственными IMP-3 пептидами, со значимым различием в сравнении с продуцированием IFN-гамма против T2-клеток, импульсно обработанных посторонним пептидом ВИЧ (P<0,05) (фиг.2). Эти результаты указывают на то, что пептиды IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6) могли индуцировать CTL человека, специфические в отношении этих пептидов. Кроме того, анализировали экспозицию CD107a на клеточной поверхности CTL, специфических в отношении пептидов IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3) и IMP-3-515-523 (SEQ ID NO:6), для испытания цитолитической активности. Эти CTL стимулировали пептидом IMP-3-552-560 (SEQ ID NO:3) и окрашивали анти-CD107a-mAb или IgG мыши в качестве контроля (фиг.3A). CTL, стимулируемые посторонним пептидом ВИЧ, также окрашивали анти-CD107a-mAb (правая панель). CD8+/CD107a+-клетки детектировали в 5,7% всех CD8+-клеток стимуляцией пептидом IMP-3-552-560 (SEQ ID NO:3) (левая панель). В качестве неспецифического сигнала, окрашивание с IgG мыши детектировали в 0,7% клеток, и CD8+/CD107a+-клетки детектировали в 1,5% клеток, стимулированных пептидом ВИЧ, в качестве отрицательного контроля (средняя и правая панели). Поскольку CD107a обычно не презентируется на клеточной поверхности CTL, но экспонируется только во время активной дегрануляции (M. Betts., J Immunol Methods 2003 Oct 1; 281 (1-2):65-78), этот результат указывает на то, что CTL проявляют цитотоксическую активность в ответ на пептид IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3) и IMP-3-515-523 (SEQ ID NO:6). Цитотоксическую активность против T2-клеток, импульсно обработанных пептидом, исследовали с использованием анализа высвобождения 51Cr (фиг.3B). CTL, индуцированные из PBMC здоровых доноров, проявляли цитотоксическую активность в отношении T2-клеток, импульсно обработанных пептидом IMP-3-199-207 (SEQ ID NO:1) или пептидом IMP-3-515-523 (SEQ ID NO:6), но не в отношении T2-клеток, импульсно обработанных посторонним пептидом ВИЧ-A2. Эти результаты указывают на то, что эти CTL обладают пептид-специфической цитотоксичностью.

[0136]

Индукция IMP-3-реактивных и HLA-A2-рестриктированных CTL из PBMC пациента с раком легкого

IMP-3-специфические CTL индуцировали из PBMC HLA-A2 (A*0201)-положительных пациентов с раком легкого, стимуляцией пептидами IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6). На фиг.4A, CTL из пациентов с раком легкого, обозначенных как пациент 14 и пациент 103, показали продуцирование IFN-гамма против T2-клеток, импульсно обработанных пептидом IMP-3-26-34 (SEQ ID NO:5) (левая панель) и пептидом IMP-3-515-523 (SEQ ID NO:6) (правая панель), соответственно. В сравнении с T2-клетками, импульсно обработанными посторонним пептидом ВИЧ, эти клетки значимо проявляли сильную активность продуцирования IFN-гамма, специфическую в отношении этих пептидов (*P<0,05). Анализ высвобождения 51Cr выявил, что CTL из PBMC двух других пациентов с раком легких, обозначенных как пациент 4 и пациент 3, показали цитотоксическую активность в отношении T2-клеток, импульсно обработанных пептидом IMP-3-552-560 (SEQ ID NO:3) (левая панель) и пептидом IMP-3-26-34 (SEQ ID NO:5) (правая панель), без обнаружения цитотоксической активности в отношении T2-клеток, импульсно обработанных посторонним пептидом ВИЧ (фиг.4B). Эти результаты указывают на то, что эти пептиды индуцируют CTL, специфические в отношении пептидов, не только с использованием PBMC здоровых доноров, но также с использованием PBMC из пациентов с раком легких.

[0137]

Цитотоксическая активность CTL против IMP-3 и HLA-A2-положительных линий раковых клеток

Способность убивать линии раковых клеток человека, экспрессирующих как IMP-3, так и HLA-A2 (A*0201), исследовали с использованием анализа высвобождения 51Cr. Как показано на фиг.5А, CTL, индуцируемые из PBMC здорового донора 2 стимуляцией пептидом IMP-3-552-560 (SEQ ID NO:3), пептидом IMP-3-26-34 (SEQ ID NO:5), пептидом IMP-3-515-523 (SEQ ID NO:6) и пептидом IMP-3-199-207 (SEQ ID NO:1), показали цитотоксическую активность против PANC-1, экспрессирующих как IMP-3, так и HLA-A2 (A*0201). С другой стороны, CTL не показали цитотоксической активности против MCF7, экспрессирующих HLA-A2 (A*0201), но не IMP-3, или А549, экспрессирующих IMP-3, но не HLA-A2 (A*0201). Кроме того, CTL, индуцируемые из PBMC пациентов с раком легких, обозначенных как пациент 14 и пациент 4, стимуляцией пептидами, имеющими пептид IMP-3-552-560 (SEQ ID NO:3), пептид IMP-3-26-34 (SEQ ID NO:5), пептид IMP-3-515-523 (SEQ ID NO:6), также показали цитотоксическую активность против PANC-1 (IMP-3+, HLA-A2+), без проявления цитотоксической активности против MCF7 (IMP-3-, HLA-A2+) и А549 (IMP-3+, HLA-A2-) (фиг.5B). Линии CTL, полученные из здоровых доноров стимуляцией пептидами IMP-3-199-207 (SEQ ID NO:1) или IMP-3-515-523 (SEQ ID NO:6), проявляли цитотоксичность против клеток MCF7/IMP-3 (клеток MCF7, трансфицированных геном IMP-3; HLA-A2+, IMP-3+), но не против клеток MCF7 (HLA-A2+, IMP-3-) (фиг.5С). Линии CTL, полученные из здоровых доноров стимуляцией либо IMP-3-199-207 (SEQ ID NO:1), либо IMP-3-515-523 (SEQ ID NO:6), проявляли цитотоксическую активность против SW620, SKHep1, но не против А549 (HLA-A2-, IMP-3+) или клеток MCF7 (HLA-A2+, IMP-3-) (фиг.5D).

[0138]

Ингибирование CTL-реакций моноклональным анти-HLA-класса I-антителом

Для подтверждения, что индуцированные CTL распознают клетки-мишени, HLA-класса I-рестриктированным образом, анализ ингибирования выполняли с использованием моноклонального антитела против HLA-класса I (W6/32, IgG2a), HLA-DR (H-DR-1, IgG2a), анти-HLA-A2-mAb (BB7.2) для блокирования антигенспецифических реакций этих CTL. На фиг.6A ингибирование продуцирования IFN-гамма при помощи CTL, генерированных из пациента с раком легких 14, посредством стимуляции пептидом IMP-3-552-560 (SEQ ID NO:3) (левая панель), пептидом IMP-3-26-34 (SEQ ID NO:5) (средняя панель) или пептидом IMP-3-515-523 (SEQ ID NO:6) (правая панель), исследовали с использованием анализа IFN-гамма ELISPOT. Продуцирование IFN-гамма против клеток Lu99 значимо ингибировалось обработкой W6/32, но не обработкой H-DR-1 (*P<0,05). Эти результаты ясно указывают на то, что эти CTL распознавали клетки-мишени, экспрессирующие IMP-3, HLA-класса I-рестриктированным образом. Кроме того, продуцирование IFN-гамма и цитотоксичность значимо ингибировались блокированием mAb против HLA-класса I и HLA-A2, но не контрольным анти-HLA-класса II-mAb (фиг.6B-D). Эти результаты ясно указывают на то, что эти пептиды природно процессировались из белка IMP-3 в раковых клетках и презентировались в контексте HLA-A2 для распознавания индуцированными пептидами CTL.

[0139]

Анализ гомологии между антигенными пептидами IMP3 и другими белками

CTL, стимулированные пептидами IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6), показали значимую и специфическую активность CTL. Этот результат может быть обусловлен тем фактом, что последовательности пептидов IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6) являются гомологичными в отношении пептидов, полученных из других молекул, о которых известно, что они сенсибилизируют иммунную систему человека. Для исключения этой возможности, выполняли анализы гомологии для этих пептидных последовательностей с использованием в качестве запросов алгоритм BLAST (http://www.ncbi.nlm.nih.gov/blast/blast.cgi), который не выявил последовательностей со значимой гомологией с этими пептидными последовательностями. Эти результаты анализов гомологии указывают на то, что последовательности пептидов MP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6) являются уникальными и, следовательно, мало вероятно, насколько известно авторам данного изобретения, что эти молекулы вызывают непреднамеренные иммунологические реакции на некоторые посторонние молекулы.

[0140]

В заключение можно сказать, что пептиды IMP-3-199-207 (SEQ ID NO:1), IMP-3-552-560 (SEQ ID NO:3), IMP-3-26-34 (SEQ ID NO:5) и IMP-3-515-523 (SEQ ID NO:6) были идентифицированы как новые HLA-A2 (A*0201)-рестриктированные эпитопные пептиды, происходящие из IMP-3, и было продемонстрировано, что эти пептиды применимы в качестве противораковых вакцин для HLA-A2 (A*0201)-положительных пациентов с экспрессирующими IMP-3 опухолями.

Промышленная применимость

[0141]

Данное изобретение идентифицирует новые TAA, в частности, ТАА, которые индуцируют сильные и специфические противоопухолевые иммунные реакции. Такие TAA гарантируют дальнейшее развитие клинических применений стратегий пептидной вакцинации в случае рака.

Все патенты, заявки на патент и публикации, цитируемые здесь, включены посредством ссылки.

Хотя это изобретение было описано подробно и со ссылкой на его конкретные варианты осуществления, должно быть понятно, что предшествующее описание является примерным и пояснительным по характеру и предназначено для иллюстрации данного изобретения и его предпочтительных вариантов осуществления. Посредством рутинного экспериментирования специалист, квалифицированный в данной области техники, поймет, что различные изменения и модификации могут быть произведены в этом изобретении без отклонения от сущности и объема данного изобретения. Таким образом, предполагается, что это изобретение определяется не приведенным выше описанием, а следующими пунктами формулы изобретения и их эквивалентами.

1. Выделенный олигопептид, имеющий менее чем 15 аминокислот, причем данный пептид выбран из группы, состоящей из:
(a) олигопептида, содержащего аминокислотную последовательность SEQ ID NO: 6, и
(b) олигопептида, содержащего аминокислотную последовательность SEQ ID NO: 6, в которой 1 или 2 аминокислоты являются замещенными, где дополнительно этот олигопептид имеет индуцибельность цитотоксических Т-лимфоцитов (CTL).

2. Олигопептид по п. 1, где этот олигопептид имеет одну или обе из следующих характеристик:
(a) вторая аминокислота от N-конца аминокислотной последовательности SEQ ID NO: 6 заменена метионином, и
(b) С-концевая аминокислота аминокислотной последовательности SEQ ID NO: 6 заменена лейцином.

3. Олигопептид по п. 1 или 2, где пептид представляет собой нонапептид или декапептид.

4. Олигопептид по п. 3, где олигопептид состоит из аминокислотной последовательности SEQ ID NO: 6.

5. Выделенный полинуклеотид, кодирующий олигопептид по любому из пп. 1-4.

6. Способ индуцирования антигенпрезентирующей клетки, имеющей CTL-индуцибельность, где этот способ предусматривает стадию, выбранную из группы, состоящей из:
(a) контактирования антигенпрезентирующей клетки с олигопептидом по любому из пп. 1-4 и
(b) введения полинуклеотида, кодирующего олигопептид по любому из пп. 1-4, в антигенпрезентирующую клетку.

7. Способ по п. 6, где эта антигенпрезентирующая клетка экспрессирует по меньшей мере один HLA-A2-антиген на ее поверхности.

8. Способ индуцирования CTL, где этот способ предусматривает стадию, выбранную из группы, состоящей из:
(a) контактирования CD8-положительной Т-клетки с антигенпрезентирующей клеткой, которая презентирует комплекс олигопептида по любому из пп. 1-4 и HLA-антигена на ее поверхности,
(b) контактирования CD8-положительной Т-клетки с экзосомой, которая презентирует комплекс олигопептида по любому из пп. 1-4 и HLA-антигена на ее поверхности; и
(c) введения полинуклеотида, кодирующего полипептид, который способен образовывать субъединицу Т-клеточного рецептора (TCR), связывающуюся с комплексом олигопептида по любому из пп. 1-4 и HLA-антигена на клеточной поверхности, в CD8-положительную Т-клетку.

9. Способ по п. 8, где этим HLA-антигеном является HLA-A2.

10. Выделенный CTL, индуцированный способом по п. 8 или 9.

11. Выделенная антигенпрезентирующая клетка, которая презентирует на ее поверхности комплекс HLA-антигена и олигопептида по любому из пп. 1-4.

12. Антигенпрезентирующая клетка по п. 11, где HLA-антигеном является HLA-A2.

13. Антигенпрезентирующая клетка по п. 11 или п. 12, где указанная антигенпрезентирующая клетка индуцируется способом по п. 6 или 7.

14. Способ индуцирования иммунного ответа против рака в субъекте, предусматривающий стадию введения этому субъекту вакцины, содержащей по меньшей мере один активный ингредиент из группы, состоящей из:
(a) одного или более олигопептидов по любому из пп. 1-4;
(b) одного или более полинуклеотидов, кодирующих олигопептид по любому из пп. 1-4;
(c) одного или более выделенных CTL по п. 10; и
(d) одной или более выделенных антигенпрезентирующих клеток по любому из пп. 11-13.

15. Способ по п. 14, где указанный субъект является HLA-A2-положительным.

16. Фармацевтическая композиция или агент для лечения и/или профилактики рака и/или предотвращения его послеоперационного рецидива, где эти фармацевтическая композиция или агент содержат фармацевтически приемлемый носитель и по меньшей мере один активный ингредиент, выбранный из группы, состоящей из:
(a) одного или более олигопептидов по любому из пп. 1-4;
(b) одного или более полинуклеотидов, кодирующих по меньшей мере один олигопептид по любому из пп. 1-4;
(c) одной или более антигенпрезентирующих клеток, презентирующих комплекс олигопептида по любому из пп. 1-4 и HLA-антигена на его поверхности; и
(d) одного или более CTL по п. 10 и HLA-антигена на клеточной поверхности.

17. Фармацевтическая композиция или агент для индуцирования CTL, где эти фармацевтическая композиция или агент содержат фармацевтически приемлемый носитель и по меньшей мере один активный ингредиент, выбранный из группы, состоящей из:
(a) одного или более олигопептидов по любому из пп. 1-4;
(b) одного или более полинуклеотидов, кодирующих по меньшей мере один олигопептид по любому из пп. 1-4;
(c) одной или более антигенпрезентирующих клеток, презентирующих комплекс олигопептида по любому из пп. 1-4 и HLA-антигена на ее поверхности.

18. Фармацевтическая композиция или агент по п. 16 или п. 17, где этот фармацевтический агент готовят для введения субъекту, который является HLA-A2-положительным.

19. Применение активного ингредиента, выбранного из группы, состоящей из:
(a) одного или более олигопептидов по любому из пп. 1-4;
(b) одного или более полинуклеотидов, кодирующих олигопептид по любому из пп. 1-4, в экспрессируемой форме;
(c) одной или более антигенпрезентирующих клеток, презентирующих комплекс олигопептида по любому из пп. 1-4 и HLA-антигена на ее поверхности; и
(d) одного или более CTL по п. 10 и HLA-антигена на клеточной поверхности, для изготовления фармацевтической композиции или агента для лечения рака.

20. Применение по п. 19, где эту фармацевтическую композицию или агент получают в виде состава для введения субъекту, который является HLA-A2-положительным.



 

Похожие патенты:

Изобретение относится к биотехнологии и предоставляет собой способ получения полезных метаболитов с использованием бактерии семейства Enterobacteriaceae, в частности бактерии, принадлежащей к роду Escherichia, которая модифицирована таким образом, что она содержит генетическую экспрессионную систему, включающую транскрипционный аппарат, регулируемый белком типа LysR, и модифицированную таким образом, что самоиндуцируемая положительная регуляция по типу обратной связи указанной системы опосредована коиндуктором.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242).

Изобретение относится к биохимии. Изобретение обеспечивает способ одновременной (мультиплексной) амплификации и флуоресцентного маркирования ДНК нескольких сегментов генома микобактерий туберкулезного комплекса (Mycobacterium tuberculosis, M.

Группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии. Представлена рекомбинантная плазмида pCFP10-DBD, состоящая из искусственного бактериального оперона химерного белка, включающего промоторную область раннего промотора бактериофага Т5, ген химерного белка, состоящий из последовательности белкового антигена CFP10 из Mycobacterium tuberculosis, слитой с последовательностью декстрансвязывающего домена (DBD) декстрансукразы Leuconostoc citreum KM20, и терминатор транскрипции, бактериального оперона бета-лактамазы и бактериального участка инициации репликации типа ColE1.

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз.

Изобретение относится к области биотехнологии, конкретно к созданию конъюгатов магнитная частица - нуклеиновая кислота, и может быть использовано для молекулярно-генетической диагностики.

Изобретение относится к области биотехнологии, в частности к способам получения ферментных препаратов. Изобретение касается термостабильной двухдоменной лакказы бактерии Streptomyces griseoflavus Ac-993 со щелочным оптимумом активности, последовательности ДНК, кодирующей данный фермент, и способа получения фермента, включающий клонирование в клетках бактерии Escherichia coli гена фермента, продукцию фермента в клетках Escherichia coli, внесение ионов меди в среду для культивирования рекомбинантного штамма для образования активного фермента, получение ферментного препарата методами металлхелатной хроматографии и гельфильтрации.

Группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии и представляет собой рекомбинантную плазмиду pESAT6-CFP10-DBD, рекомбинантный штамм Escherichia coli M15 [pREP4, pESAT6-CFP10-DBD], способ получения, иммобилизации, концентрирования и очистки рекомбинантного белка ESAT6-CFP10-DBD на декстране, рекомбинантный белок ESAT6-CFP10-DBD с молекулярной массой 26,4 кДа, иммуногенную композицию, содержащую белок ESAT6-CFP10-DBD, иммобилизованный на декстране, специфически активирующую Т-лимфоциты, синтезирующие ИФН-гамма при стимуляции антигенами микобактерий.

Изобретение относится к биохимии, в частности к молекулярной биологии, биотехнологии, генной инженерии. Изобретение представляет собой оптимизированные последовательности ДНК, кодирующие легкую и тяжелую цепь моноклонального антитела, предназначенные для синтеза антитела в рекомбинантных CHO-S клетках, и способ получения данного антитела в указанных клетках.

Предложены гетеромерные пептиды на основе имидазо[4,5-е]бензо[1,2-с;3,4-с′]дифуроксана, ингибирующие агрегацию тромбоцитов: , где R=Phe-Ile-Ala-Asp-Thr; Arg-Tyr-Gly-Asp-Arg; Lys-Ile-Ala-Asp-Asp; His-Ile-Gly-Asp-Asp.

Изобретение относится к равномерномеченному дейтерием или тритием His-Phe-Arg-Trp-Pro-Gly-Pro, который может быть использован в аналитической химии и биологических исследованиях.

Настоящее изобретение относится к модифицированным опиорфинным пептидам в качестве новых ингибиторов металло-эктопептидаз. 4 н.

Группа изобретений относится к области фармацевтики и медицины и касается пептидов или полипептидов, индуцирующих образование антител, направленных на альфа-синуклеин in vivo для получения лекарственных средств для профилактики и/или лечения синуклеинопатий.

Настоящее изобретение относится к области иммунологии. Предложены варианты олигопептида, выделенные из белка RAB6KIFL (KIFL20A), которые способны индуцировать цитотоксические Т-лимфоциты (CTL) в составе комплекса с молекулой HLA-A*0201.

Изобретение относится пептидным вакцинам против рака. Представлены эпитопные пептиды, полученные из гена ТТК, которые вызывают развитие CTL, фармацевтические композиции, содержащие в качестве активных ингредиентов указанные пептиды или полинуклеотиды, кодирующие указанные пептиды.

Изобретение относится к новому способу химического превращения пептидной цепи в тиоэфир пептида. Группу -C(=X)-R1 вводят в тиоловую группу остатка цистеина, и затем полученный пептид в органическом растворителе реагирует с соединением, имеющим замещаемую группу, представленную формулой: -NH-C(=Y)NHR3, и группа -NH-C(=Y)NHR3 связывается в реакции присоединения с карбоксильной группой пептидной связи на N-концевой стороне остатка цистеина, посредством чего пептидную связь расщепляют и фрагмент пептида на С-концевой стороне вырезают.

Изобретение относится к области медицины и ветеринарии и может быть использовано как эффективное средство адресной доставки комплексов ДНК с молекулярными конъюгатами в определенные органы и ткани млекопитающих.

Изобретение относится к радиофармацевтическому средству формулы (Iа) или (Iв), представляющему собой комплекс циклического октапептида, содержащего хелатирующую группу, с радионуклидами 111In, 90Y, 177Lu.

Изобретение относится к области генной инженерии и может быть использовано для регулирования проницаемости метан-продуцирующей клетки. Получают полипептид, который способен проникать в метан-продуцирующую клетку и повышать ее проницаемость, характеризующийся аминокислотной последовательностью SEQ ID NO:117, 118 или 119 или по меньшей мере 90% идентичностью к указанной последовательности или по меньшей мере 15 последовательно расположенными аминокислотами указанной последовательности.

Изобретение относится к новым химическим соединениям общей формулы I, в которых LA, LB, LC, цикл A, цикл B, RA, RB, RC, RD, RE и RF имеют значения, указанные в формуле изобретения. Соединения формулы (I) являются ингибиторами протеинкиназ.
Наверх