Набор флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов burkholderia mallei методом амплификации дифференцирующих фрагментов днк



Набор флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов burkholderia mallei методом амплификации дифференцирующих фрагментов днк
Набор флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов burkholderia mallei методом амплификации дифференцирующих фрагментов днк

 


Владельцы патента RU 2551227:

Федеральное казенное учреждение здравоохранения Волгоградский научно-исследовательский противочумный институт Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами. Разработанный набор гибридизационных зондов может быть использован для флуоресцентной детекции результатов типирования возбудителя сапа методом амплификации дифференцирующих фрагментов генома при осуществлении эпидемиологического надзора за сапной инфекцией и обеспечивает возможность одновременного анализа девяти DFR-локусов. 2 ил., 1 табл., 3 пр.

 

Изобретение относится к биотехнологии и молекулярной биологии и может быть использовано для детекции результатов амплификации дифференцирующих фрагментов ДНК при типировании возбудителя сапа специалистами референс-центров по мониторингу за возбудителями инфекционных болезней, национальных центров верификации диагностической деятельности, а также научно-исследовательских организаций эпидемиологического и микробиологического профиля.

Can - тяжелое антропозоонозное инфекционное заболевание, характеризующееся септицемией, образованием специфических гранулем, абсцессов в органах и тканях и высокой летальностью. Возбудитель сапа, Burkholderia mallei, отнесен к категории В потенциальных агентов биотерроризма центром по контролю и профилактике заболеваний США.

Необходимость исследований, направленных на диагностику и типирование штаммов В. mallei, связана с сохранением угрозы возникновения чрезвычайных биологических ситуаций, возможных террористических актов с использованием этого возбудителя. Генотипирование В. mallei, основанное на определении различий геномов штаммов данного вида, направлено на расследование вспышек, мониторинг природных очагов сапа, геномную паспортизацию и определение филогенетических связей штаммов.

Для типирования возбудителя сапа применяются различные молекулярно-генетические подходы. Однако мультилокусное сиквенс-типирование оказалось неэффективным для высококонсервативного генома В. mallei [Godoy D., Randle G., Simpson A.J. et al. Multilocus sequence typing and evolutionary relationships among the causative agents of melioidosis and glanders, Burkholderia pseudomallei and Burkholderia mallei / J. Clin. Microbiol. 2003; 41(5):20б8-79]. ПЦР со случайными праймерами, показав высокую дискриминирующую способность, характеризовалась низко и межлабораторной воспроизводимостью [Антонов В.А., Алтухова В.В., Савченко С.С., Замараев B.C., Илюхин В.И., Алексеев В.В. Использование мультилокусного сиквенс-типирования (MLST) и амплификации с произвольными праймерами (RAPD) для дифференциации штаммов возбудителя сапа/Молекулярная генетика, микробиология и вирусология, 2007; 3:3-9]. Большинство методов генотипирования включают обязательный этап постановки элекрофореза для детекции результатов, что увеличивает время проведения анализа.

Типирование на основе амплификации дифференцирующих фрагментов генома - DFR-анализ (different region), заключается в серии полимеразных цепных реакций с праймерами, фланкирующими вариабельные фрагменты ДНК-мишеней, присутствующих только у определенных штаммов. Для проведения реакций амплификации при DFR-типировании используются олигонуклеотидные праймеры, специфические для определенных штаммов возбудителя сапа. Праймеры комплементарны последовательностям ДНК на границах дифференцирующих фрагментов и ориентированы таким образом, что достраивание новой цепи ДНК протекает только между ними. В результате ПЦР происходит многократное увеличение числа копий (амплификация) специфического участка гена, катализируемое ферментом ДНК-полимеразой. Выбор дифференцирующего фрагмента и подбор праймеров играет важнейшую роль в специфичности амплификации, что сказывается на качестве проведения анализа исследуемых микроорганизмов.

Детекция продуктов амплификации с использованием специальных флуоресцентных меток позволит отказаться от стадии электрофореза, что не только сократит время проведения анализа, но и снизит риск перекрестной контаминации продуктами ПЦР и, соответственно, уменьшит риск ложноположительных результатов. Поскольку регистрация результатов проводится непосредственно в процессе реакции амплификации, весь анализ можно проводить в одной-двух комнатах лаборатории силами одного сотрудника. Этот подход позволит проводить автоматическую интерпретацию полученных результатов и снимет проблему субъективно и оценки электрофореграмм. Существует несколько флуоресцентных технологий, различающихся по способам генерации репортерной флуоресценции. В данном изобретении предлагаются зонды с комплементарными концевыми последовательностями по типу «молекулярных маяков».

Наиболее близким аналогом изобретения является схема генотипирования с использованием амплификации дифференцирующих фрагментов для возбудителя мелиоидоза, предложенная Kwanjit Duangsonk с соавторами в 2006 г. [Use of a Variable Amplicon Typing Scheme Reveals Considerable Variation in the Accessory Genomes of Isolates of Burkholderia pseudomallei, Kwanjit Duangsonk, Daniel Gal, Mark Mayo, C. Anthony Hart, Bart J. Currie, and Craig Winstanley]. Однако данная схема не эффективна для типирования возбудителя сапа, в ней также не разработана флуоресцентная детекция результатов.

Целью настоящего изобретения является разработка набора флуоресцентно-меченых олигонуклеотидных зондов для детекции результатов DFR-типирования штаммов возбудителя сапа методом полимеразной цепной реакции в реальном времени.

Цель достигается конструированием специфичных олигонуклеотидов, имеющих структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладающих комплементарностью к дифференцирующим фрагментам генома В. mallei:

BmVATIp 5′(ROX)-CCGCGAGCACGCTCTCGACCGAGCGCACGCGG-(BHQ2)3′,

комплементарный фрагменту локуса ВМА0577 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT1-Ch1s/BmVAT1-Ch1as;

BmVAT2p 5′ (FAM)-CGCGCTCGCCGCCTATCCGCTCGTGCTGCGCG-(BHQ 1)3′, комплементарный фрагменту локуса ВМА0958 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT2-Ch1s/BmVAT2-Ch1as;

BmVAT3p 5′(ROX)-ACAGCGTCGTCGACGACCGCGGGCCGCTCT-(BHQ2)3′, комплементарный фрагменту локуса ВМА2089 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT3-Ch1s/BmVAT3-Chlas;

BmVAT4p 5′(HEX)-ACGTCGCGCCCCGCGCCGCAACCGACGT-(BHQ2)3′, комплементарный фрагменту локуса ВМА2262 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT4-Ch1s/BmVAT4-Chlas;

BmVAT5p 5′(HEX)-CCCGAATTTCTCGCGCTCAATCCGTTCGGG-(BHQ2)3′, комплементарный фрагменту локуса ВМАА0107 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT5-Ch2s/BmVAT5-Ch2as;

BmVAT6p 5′(Cy5)-ACCGAGTTAGTTCCGTTCCTTCGGT-(BHQ2)3′, комплементарный фрагменту локуса ВМАА0416 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT6-Ch2s/BmVAT6-Ch2as;

BmVAT7p 5′(HEX)-CTTGCCTACATCATCGAAAAGCTGGGCAAG-(BHQ2)3′, комплементарный фрагменту локуса ВМАА0871 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT7-Ch2s/BmVAT7-Ch2as;

BmVATSp 5′(ROX)-CCGCGATGCTGGTTTGCATGCGCCGCCGCGG-(BHQ2)3′, комплементарный фрагменту локуса ВМА10247_А0137 генома В. mallei NCTC 10247, фланкированному праймерами BmVAT8-Ch2s/BmVAT8-Ch2as;

BmVAT9p 5′(Cy5)-CGATCGCTGTATTCCATGCCGTCGATCG-(BHQ2)3′, комплементарный фрагменту локуса ВМА10247_А1008 генома В. mallei NCTC 10247, фланкированному праймерами BmVAT9-Ch2s/BmVAT9-Ch2as;

где:

FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 492 нм, а длина волны флуоресценции 520 нм. HEX - флуоресцентный краситель, длина волны поглощения которого составляет 535 нм, а длина волны флуоресценции 556 нм. ROX - карбокси-Х-родамин, флуоресцентный краситель, длина волны поглощения которого составляет 580 нм, а длина волны флуоресценции 605 нм. Cy5 - флуоресцентный краситель, длина волны поглощения которого составляет 649 нм, а длина волны флуоресценции 670 нм. BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм. BHQ2 - гаситель флуоресценции с диапазоном гашения 550-650 нм.

Характеристика флуоресцентно-меченых олигонуклеотидных зондов и ДНК-мишеней для их гибридизации.

Основываясь на данных, представленных в базе GenBank NCBI (National Center for Biotechnology Information), были подобраны олигонуклеотиды по типу «молекулярного маяка», обладающие активностью гибридизационных зондов к фрагментам генома возбудителя сапа, фланкированным праймерами BmVAT1-Ch1s/BmVAT1-Ch1as, BmVAT2-Ch1s/BmVAT2-Ch1as, BmVAT3-Ch1s/BmVAT3-Ch1as, BmVAT4-Ch1s/BmVAT4-Ch1as, BmVAT5-Ch2s/BmVAT5-Ch2as, BmVAT6-Ch2s/BmVAT6-Ch2as, BmVAT7-Ch2s/BmVAT7-Ch2as, BmVAT8-Ch2s/BmVAT8-Ch2as, BmVAT9-Ch2s/BmVAT9-Ch2as. Характеристика набора зондов и соответствующие мишени в геноме В. mallei приведены в таблице 1.

Апробация зондов была осуществлена на наборе штаммов возбудителя сапа коллекционного центра ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора. Было продемонстрировано, что разработанный набор гибридизационных зондов может быть использован для флуоресцентной детекции продуктов амплификации дифференцирующих фрагментов ДНК возбудителя сапа, что позволяет определять генетический профиль исследуемых штаммов В. mallei. Данный подход отличается легкостью детекции, использованием стандартного оборудования для проведения ПЦР и быстротой получения результата.

Примеры конкретного выполнения

Пример 1. Алгоритм конструирования флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов возбудителя сапа методом амплификации дифференцирующих фрагментов ДНК.

На основе анализа in silico нуклеотидных последовательностей фрагментов дифференциации возбудителя сапа, фланкированных праймерами BmVAT1-Ch1s/BmVAT1-Ch1as, BmVAT2-Ch1s/BmVAT2-Ch1as, BmVAT3-Ch1s/BmVAT3-Ch1as, BmVAT4-Ch1s/BmVAT4-Ch1as, BmVAT5-Ch2s/BmVAT5-Ch2as, BmVAT6-Ch2s/BmVAT6-Ch2as, BmVAT7-Ch2s/BmVAT7-Ch2as, BmVAT8-Ch2s/BmVAT8-Ch2as, BmVAT9-Ch2s/BmVAT9-Ch2as, с помощью программы UGENE v1.5. (Унипро, Россия) сконструированы гибридизационные зонды (таблица).

Полученные олигонуклеотиды были проанализированы с помощью компьютерной программы Vector NTI Express v.1.1.2 (Life Technologies, США) на предмет образования вторичных структур с соответствующими праймерами, и показана их теоретическая пригодность для успешной флуоресцентной детекции результатов реакций амплификации.

Пример 2. Детекция продуктов амплификации дифференцирующих фрагментов ДНК с помощью разработанного набора зондов для типирования штаммов возбудителя сапа.

Материалом для исследования являлись чистые культуры возбудителя сапа, предварительно идентифицированные до вида. Обеззараживание исследуемых проб проводили добавлением раствора мертиолята натрия до конечной концентрации 0,01% и прогреванием в течение 40 мин при температуре 56°С (МУ 4.2.2831-11 Лабораторная диагностика сапа). Выделение ДНК из чистых культур возбудителя сапа осуществляли с помощью метода лизиса гуанидинизотиоцианатом и переосаждения ДНК с изопропанолом («АмплиПрайм РИБО-преп», ФБУН ЦНИИ Эпидемиологии Роспотребнадзора).

В состав реакционных смесей, помимо анализируемой ДНК, входили комплементарные дифференцирующим фрагментам ДНК В. mallei олигонуклеотидные зонды, прямой и обратный праймеры, дезоксирибонуклеозидтрифосфаты, буферный раствор и фермент ДиаТак-полимераза (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора). Амплификацию продолжительностью 45 циклов проводили в объеме 25 мкл с использованием «горячего старта», который обеспечивался прослойкой воска.

Анализ продуктов ПНР осуществляли в режиме реального времени на приборе «DT Lite» (ЗАО «НПФ ДНК-технология», Россия). Регистрацию результатов проводили в табличной и графической форме. Результат амплификации каждого DFR фрагмента считался положительным, в случае если кривая накопления флуоресценции по заданному каналу пересекала пороговую линию на участке характерного экспоненциального подъема флуоресценции, на цикле, не превышающем граничное значение Ct (рис.1.). Рисунок 1 отображает график нарастания флуоресцентных кривых, полученных при амплификации ДНК штаммов возбудителя сапа с праймерами BmVAT3-Ch1s/BmVAT3-Ch1as (1 - В. mallei Muksuwar - 11, 2 - В. mallei Zagreb, 3 - В. mallei Bogor - 37).

Пример 3. Анализ результатов типирования штаммов возбудителя сапа из коллекции ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора методом амплификации дифференцирующих фрагментов ДНК с детекцией в реальном времени.

Для составления генетического профиля исследуемых штаммов В. mallei проводили амплификацию по девяти DFR-локусам с детекцией в реальном времени с помощью разработанного набора зондов. Для дальнейшего анализа результаты ПЦР конвертировали в двоичную матрицу, в которой наличие ампликона обозначалось «1I», а его отсутствие - «0».

Затем с помощью компьютерных программ провели сравнение DFR-паттернов 14 коллекционных штаммов возбудителя сапа с DFR-типами 4 аннотированных штаммов из GeneBank, определенными in silico. Кластерный анализ провели с использованием метода Neighbor-Joining и категорического коэффициента. Результатом обработки данных DFR-анализа являлась дендрограмма, изображенная на рисунке 2, отображающая генетические расстояния или эволюционные взаимоотношения между исследуемыми штаммами. Применение данного подхода позволило разделить 18 исследуемых штаммов В. mallei на 11 генотипов.

Таким образом, разработанный набор гибридизационных зондов может быть использован для флуоресцентной детекции результатов типированкя возбудителя сапа методом амплификации дифференцирующих фрагментов генома. Данный подход обеспечивает возможность одновременного анализа девяти DFR-локусов, характеризуется легкостью интерпретации, быстротой получения результата, использованием стандартного оборудования и будет полезен в осуществлении эпидемиологического надзора за сапной инфекцией.

Характеристика набора флуоресцентно-меченых олигонуклеотидных зондов для DFR-типирования штаммов возбудителя сапа
Наименование зонда Последовательность Локус в геноме В. mallei Флуоресцентный краситель/гаситель флуоресценции
BmVAT1p CCGCGAGCACGCTCTCGACCGAGCGCACGCGG ВМА0577 ROX/BHQ2
BmVAT2p CGCGCTCGCCGCCTATCCGCTCGTGCTGCGCG ВМА0958 FAM/BHQ1
BmVAT3p ACAGCGTCGTCGACGACCGCGGGCCGCTCT ВМА2089 ROX/BHQ2
BmVAT4p ACGTCGCGCCCCGCGCCGCAACCGACGT ВМА2262 HEX/BHQ2
BmVAT5p CCCGAATTTCTCGCGCTCAATCCGTTCGGG ВМАА0107 HEX/BHQ2
BmVAT6p ACCGAGTTAGTTCCGTTCCTTCGGT ВМАА0416 Cy5/BHQ2
BmVAT7p CTTGCCTACATCATCGAAAAGCTGGGCAAG ВМАА0871 HEX/BHQ2
BmVAT8p CCGCGATGCTGGTTGCATGCGCCGCCGCGG ВМА10247_А0137 ROX/BHQ2
BmVAT9p CGATCGCTGTATTCCATGCCGTCGATCG ВМА10247_А1008 Cy5/BHQ2

Набор флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei методом амплификации дифференцирующих фрагментов ДНК, имеющих следующую структуру:
BmVAT1p 5'(ROX)-CCGCGAGCACGCTCTCGACCGAGCGCACGCGG-(BHQ2)3', комплементарный фрагменту локуса ВМА0577 генома В. mallei ACTC 23344, фланкированному праймерами BmVATl-Chls/BmVATl-Chlas;
BmVAT2p 5'(FAM)-CGCGCTCGCCGCCTATCCGCTCGTGCTGCGCG-(BHQ1)3', комплементарный фрагменту локуса ВМА0958 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT2-Chls/BmVAT2-Chlas;
BmVAT3p 5'(ROX)-ACAGCGTCGTCGACGACCGCGGGCCGCTCT-(BHQ2)3', комплементарный фрагменту локуса ВМА2089 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT3-Chls/BmVAT3-Chlas;
BmVAT4p 5'(HEX)-ACGTCGCGCCCCGCGCCGCAACCGACGT-(BHQ2)3', комплементарный фрагменту локуса ВМА2262 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT4-Chls/BmVAT4-Chlas;
BmVAT5p 5'(HEX)-CCCGAATTTCTCGCGCTCAATCCGTTCGGG-(BHQ2)3' комплементарный фрагменту локуса ВМАА0107 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT5-Ch2s/BmVAT5-Ch2as;
BmVAT6p 5'(Cy5)-ACCGAGTTAGTTCCGTTCCTTCGGT-(BHQ2)3', комплементарный фрагменту локуса ВМАА0416 генома В. mallei ACTC 23344, фланкированному праймерами Вт VA T6-Ch2s/Bm VA T6-Ch2as;
BmVAT7p 5'(HEX)-CTTGCCTACATCATCGAAAAGCTGGGCAAG-(BHQ2)3', комплементарный фрагменту локуса ВМАА0871 генома В. mallei ACTC 23344, фланкированному праймерами BmVAT7-Ch2s/BmVAT7-Ch2as;
BmVAT8p 5'(ROX)-CCGCGATGCTGGTTTGCATGCGCCGCCGCGG-(BHQ2)3' комплементарный фрагменту локуса ВМА10247А0137 генома В. mallei NCTC 10247, фланкированному праймерами BmVAT8-Ch2s/BmVAT8-Ch2as;
BmVAT9p 5'(Cy5)-CGATCGCTGTATTCCATGCCGTCGATCG-(BHQ2)3', комплементарный фрагменту локуса ВМА10247_А1008 генома В. mallei NCTC 10247, фланкированному праймерами BmVAT9-Ch2s/BmVAT9-Ch2as; где:
FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 492 нм, а длина волны флуоресценции 520 нм. HEX - флуоресцентный краситель, длина волны поглощения которого сотавляет 535 нм, а длина волны флуоресценции 556 нм, ROX - карбокси-Х-родамин, флуоресцентный краситель, длина волны поглощения которого сотавляет 580 нм, а длина волны флуоресценции 605 нм, Су5 - флуоресцентный краситель, длина волны поглощения которого сотавляет 649 нм, а длина волны флуоресценции 670 нм. BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм, BHQ2 - гаситель флуоресценции с диапазоном гашения 550-650 нм.



 

Похожие патенты:

Изобретение относится к биотехнологии, а именно к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei.

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу.

Изобретение относится к области биотехнологии, а именно к способу воздействия на пролиферативный статус клеток. Предложенное изобретение может быть использовано в медицине в области лечения онкологических заболеваний, в иммунологии, в геронтологии и косметологии.

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1.

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав: амплификацию ДНК вируса и оценку проведения реакции.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Группа изобретений относится к области биохимии. Предложено устройство для забора нуклеиновой кислоты, применение устройства для забора нуклеиновой кислоты, набор для амплификации нуклеиновой кислоты, а также способ амплификации нуклеиновой кислоты.

Изобретение относится к области биохимии, в частности к способу выявления соматических мутаций в гене PI3K, ответственных за чувствительность опухоли к таргетной терапии, с помощью технологии ДНК-биочипов.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности вереска обыкновенного (Calluna vulgaris (L.) Hull.).

Изобретение относится к биотехнологии, в частности к способу выделения микроРНК из биологических жидкостей, содержащих экзосомы. Способ включает последовательное центрифугирование, ультрафильтрацию и ультрацентрифугирование культуральной конденсированной среды.
Изобретение относится к пищевой микробиологии, в частности к получению питательной среды для определения в кондитерских изделиях, микроорганизмов, вырабатывающих липазы.

Изобретение относится к электрохимическим методам анализа, а именно к иммуноанализу, в частности к определению содержания патогенных микроорганизмов в различных объектах и средах.
Изобретение относится к медицине и может быть использовано для выявления продуцирующих уреазу микроорганизмов, в частности Helicobacter pylori. Для этого проводят экспресс-анализ на диагностических дисках для определения уреазной активности образцов.

Группа изобретений относится к биохимии. Предложен способ получения стандартного образца мутности бактерийных взвесей, стандартный образец мутности бактерийных взвесей, применение стандартного образца мутности бактерийных взвесей, а также набор, содержащий стандартный образец мутности бактерийных взвесей.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.

Изобретение относится к биотехнологии, в частности к определению содержания микроорганизмов в различных объектах и средах. Способ предусматривает конъюгацию бактерий с электрохимической меткой, в качестве которой используют Fe0, MgFe2O4 или Fe3O4, осуществляемую в водной среде при заданных параметрах.
Изобретение относится к области медицинской микробиологии и биотехнологии, в частности к микробиологической лабораторной диагностике инфекционных болезней. Питательная среда содержит триптон, дрожжевой экстракт, глюкозу, хлорид натрия, эритроциты человека 0(I) группы Rh(+), сульфат железа(II), агар «Дифко» и дистиллированную воду при заданных соотношениях компонентов.
Изобретение относится к биотехнологии и может быть использовано при бактериологических исследованиях по выделению и идентификации бактерий рода Klebsiella, производстве питательных сред для этих исследований.
Изобретение относится к биотехнологии и может быть использовано для диагностики неспецифических инфекционных заболеваний мочеполовой системы. Питательная среда содержит питательный агар, сухой, из каспийской кильки, парааминобензойную кислоту, трис-(оксиметил) аминометан (трис-буфер), салицин, нейтральный красный, L-триптофан, 5-бром-4-хлор-3-индолил β-D-глюкуронид циклогексиламмонийной соли, 2-нитрофенил β-D-галактопиранозид и дистиллированную воду в заданном соотношении компонентов.

Группа изобретений относится к области биотехнологии и направлена на идентификацию микроорганизмов в тестируемом образце. В одном варианте способ идентификации неизвестного микроорганизма включает получение тестируемого образца, который может содержать неизвестный микроорганизм.

Изобретение относится к биотехнологии, а именно к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei.
Наверх