Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта



Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта

 


Владельцы патента RU 2551234:

КьюРНА,Инк.,US (US)

Изобретение относится к области молекулярной биологии и медицины. Предложено применение олигонуклеотида длиной 10-30 нуклеотидов, который специфически направлен на природный антисмысловой транскрипт сиртуина 1 (SIRT1), для профилактики или лечения связанного с сиртуином 1 (SIRT1) заболевания или расстройства, где указанный олигонуклеотид повышает экспрессию сиртуина 1 (SIRT1), и где природный антисмысловой транскрипт обладает нуклеотидной последовательностью с любой из SEQ ID NO:2-5. 5 н. и 14 з. п. ф-лы, 20 ил., 4 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА

Настоящая заявка заявляет приоритет предварительной заявки США № 61/119965, поданной 4 декабря 2008 года, и предварительной заявки США № 61/157255, поданной 4 марта 2009 года, и предварительной заявки США № 61/259072, поданной 6 ноября 2009 года, указанные заявки включены в описание во всей полноте посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Варианты воплощения изобретения включают в себя олигонуклеотиды, модулирующие экспрессию и/или функции SIRT1 и ассоциированных молекул.

УРОВЕНЬ ТЕХНИКИ

Гибридизация ДНК-РНК и РНК-РНК является важной во многих аспектах функционирования нуклеиновой кислоты, включая репликацию, транскрипцию и трансляцию ДНК. Гибридизация также является главным способом в ряде способов, с помощью которых либо обнаруживают определенную нуклеиновую кислоту, либо изменяют ее экспрессию. Антисмысловые нуклеотиды, например, нарушают экспрессию генов путем гибридизации с РНК-мишенью, препятствуя, таким образом, сплайсингу, транскрипции, трансляции и репликации РНК. Антисмысловая ДНК обладает тем дополнительным свойством, что гибриды ДНК-РНК служат в качестве субстрата для расщепления рибонуклеазой H, активность которой показана в большинстве клеточных типов. Антисмысловые молекулы могут быть доставлены в клетки, как в случае с олигодезоксинуклеотидами (ODN), или они могут быть экспрессированы из эндогенных генов в виде молекул РНК. Недавно FDA одобрило применение антисмыслового лекарственного препарата, VITRAVENETM (для лечения цитомегаловирусного ретинита), что отражает терапевтическое применение антисмысловых соединений.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее краткое изложение предоставляется, чтобы выразить в краткой форме природу и сущность изобретения. Краткое изложение предоставляется с пониманием, что оно не будет использоваться для интерпретации или ограничения объема или смысла формулы изобретения.

В одном варианте воплощения изобретение предоставляет способы ингибирования действия природного антисмыслового транскрипта с помощью антисмыслового олигонуклеотида (олигонуклеотидов), направленного на какой-либо участок природного антисмыслового транскрипта, что приводит к активации соответствующего смыслового гена. В описании также предусматривается, что ингибирование природного антисмыслового транскрипта может быть достигнуто с помощью siРНК, рибозимов и малых молекул, которые рассматривают в объеме настоящего изобретения.

Один вариант воплощения предоставляет способ модулирования функции и/или экспрессии полинуклеотида SIRT1 в клетках или тканях пациента in vivo или in vitro, включающий в себя взаимодействие указанных клеток или тканей с антисмысловым олигонуклеотидом длиной 5-30 нуклеотидов, где указанный олигонуклеотид характеризуется по меньшей мере 50% идентичностью последовательности с обратным комплементом полинуклеотида, включающим в себя 5-30 последовательных нуклеотидов в положениях нуклеотидов с 1 по 1028 SEQ ID NO:2 или нуклеотидов с 1 по 429 SEQ ID NO:3, или нуклеотидов с 1 по 156 SEQ ID NO:4, или нуклеотидов с 1 по 593 SEQ ID NO:5 (фиг.11) модулирование посредством этого функции и/или экспрессии полинуклеотида SIRT1 в клетках или тканях пациента in vivo или in vitro.

В другом предпочтительном варианте воплощения олигонуклеотид воздействует на природную антисмысловую последовательность полинуклеотидов SIRT1, например, полинуклеотидов, представленных в SEQ ID NO:2-5, и на их варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные последовательности. Примеры антисмысловых олигонуклеотидов приведены в виде SEQ ID NO:6-47.

Другой вариант воплощения предоставляет способ модулирования функции и/или экспрессии полинуклеотида SIRT1 в клетках или тканях пациента in vivo или in vitro, включающий в себя взаимодействие указанных клеток или тканей с антисмысловым олигонуклеотидом длиной 5-30 нуклеотидов, где указанный олигонуклеотид характеризуется по меньшей мере 50% идентичностью последовательности с обратным комплементом антисмысловой последовательности полинуклеотида SIRT1; модулирование посредством этого функции и/или экспрессии полинуклеотида SIRT1 в клетках или тканях пациента in vivo или in vitro.

Другой вариант воплощения включает в себя способ модулирования функции и/или экспрессии полинуклеотида SIRT1 в клетках или тканях пациента in vivo или in vitro, включающий в себя взаимодействие указанных клеток или тканей с антисмысловым олигонуклеотидом длиной 5-30 нуклеотидов, где указанный олигонуклеотид характеризуется по меньшей мере 50% идентичностью последовательности со антисмысловым олигонуклеотидом для антисмыслового полипептида SIRT1; модулирование посредством этого функции и/или экспрессии полинуклеотида SIRT1 в клетках или тканях пациента in vivo или in vitro.

В предпочтительном варианте воплощения композиция включает в себя один или более антисмысловых олигонуклеотидов, которые связываются со смысловыми и/или антисмысловыми полинуклеотидами SIRT1.

В другом предпочтительном варианте воплощения олигонуклеотиды включают в себя один или более модифицированных или замещенных нуклеотидов.

В другом предпочтительном варианте воплощения олигонуклеотиды включают в себя одну или более модифицированных связей.

В еще одном варианте воплощения модифицированные нуклеотиды включают в себя модифицированные основания, содержащие фосфоротиоат, метилфосфонат, пептидные нуклеиновые кислоты, или молекулы закрытой нуклеиновой кислоты (LNA). Предпочтительно модифицированные нуклеотиды представляют собой молекулы закрытой нуклеиновой кислоты, включая α-L-LNA.

В другом предпочтительном варианте воплощения олигонуклеотиды вводят пациенту подкожно, внутримышечно, внутривенно или внутрибрюшинно.

В другом предпочтительном варианте воплощения олигонуклеотиды вводят в виде фармацевтической композиции. Схема лечения включает в себя по меньшей мере однократное ведение антисмысловых соединений пациенту; однако, указанное лечение может быть изменено для включения многократных доз в течение периода времени. Лечение может быть скомбинировано с одним или более другими типами терапии.

В другом предпочтительном варианте воплощения олигонуклеотиды инкапсулируют в липосоме.

Другие аспекты описаны ниже.

ВКЛЮЧЕНИЕ В ОПИСАНИЕ ИЗОБРЕТЕНИЯ СВЕДЕНИЙ ПУТЕМ ССЫЛКИ

Все публикации, патенты и патентные заявки, упомянутые в описании, включены посредством ссылки в том же объеме, как если бы каждая отдельная публикация, патент или патентная заявка специфически и по отдельности указаны как включенные посредством ссылки.

КРАТКОЕ ОПИСАНИЕ ФИГУР

Новые признаки изобретения изложены с подробностями в прилагаемой формуле изобретения. Наилучшее понимание признаков и преимуществ настоящего изобретения может быть получено с помощью ссылки на следующее подробное описание, которое предлагает пояснительные примеры осуществления изобретения, в которых используются принципы изобретения, и сопровождающихся чертежами, из которых:

На фиг.1 представлены результаты анализа ПЦР в реальном масштабе времени олигонуклеотидов, предназначенных для SIRT-антисмысловой последовательности CV396200. Результаты показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки одной из siРНК, предназначенных для sirtas (sirtas_5, P=0,01). В тех же самых образцах уровни sirtas РНК существенно снижались после обработки sirtas_5, но не изменялись после обработки sirtas_6 и sirtas_7, которые также не оказывали эффекта на уровни мРНК SIRT1 (фиг.1B). Sirtas_5, sirtas 6 и sirtas_7 представляют собой SEQ ID NO:29, 30 и 31 соответственно.

На фиг.2 представлены результаты олигонуклеотидной прогулки по антисмысловой последовательности SIRT CV396200. Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки тремя антисмысловыми олигонуклеотидами, предназначенными для sirtas. С CUR-0292 по CUR-309 соответствуют SEQ ID NO:6-23 соответственно.

На фиг.3 представлены результаты для PS, LNA и 2'О Me модифицированных олигонуклеотидов в клетках HepG2 (фиг.3A) и Vero76 (фиг.3B). Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки сконструированными с включением группировок PS, LNA, 2'О Me и 2'О Me антисмысловыми олигонуклеотидами к антисмысловой последовательности SIRT1. Уровни мРНК SIRT1 в клетках Verо также возрастали через 48 часов после обработки PS- и LNA-модифицированными антисмысловыми олигонуклеотидами к антисмысловой последовательности SIRT1. Полосы, обозначенные как CUR-0245, CUR-0736, CUR-0688, CUR-0740 и CUR-0664, представляют собой SEQ ID NO:24-28, соответственно.

На фиг.4 представлены результаты ПЦР образцов биопсии жировой ткани обезьян. Результаты анализа ПЦР в реальном масштабе времени показывают увеличение уровней мРНК SIRT1 в образцах биопсии жировой ткани обезьян, получавших дозы CUR-963, олигонуклеотида, предназначенного для SIRT1-антисмысловой последовательности CV396200.1. CUR-963 соответствует SEQ ID NO:25.

На фиг.5 представлены результаты ПЦР первичных гепатоцитов печени обезьяны. Результаты анализа ПЦР в реальном масштабе времени показывают увеличение уровней мРНК SIRT1 после обработки CUR-0245, олигонуклеотидом против антисмысловой последовательности SIRT1. Полоса, обозначенная как CUR-0245, соответствует SEQ ID NO:24.

На фиг.6 представлены результаты для олигонуклеотидов, предназначенных для SIRT-антисмысловой последовательности CV396200. Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают в присутствии одного из олигонуклеотидов, предназначенных для SIRT1-антисмысловой последовательности CV396200. Полосы, обозначенные как CUR-1230, CUR-1231, CUR-1232 и CUR-1233, соответствуют SEQ ID NO:32-35.

На фиг.7 представлены результаты, полученные с олигонуклеотидами, предназначенными для SIRT-антисмысловой последовательности CV428275. Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают в присутствии двух олигонуклеотидов, предназначенных для SIRT1-антисмысловой последовательности CV428275. Полосы, обозначенные как CUR-1302, CUR-1304, CUR-1303 и CUR-1305, соответствуют SEQ ID NO:36-39.

На фиг.8 представлены результаты анализа ПЦР в реальном режиме времени. Результаты показывают, значительное увеличение уровней мРНК SIRT1 в клетках HepG2 через 48 часов после обработки одним из олигонуклеотидов, предназначенных для SIRT-антисмысловой последовательности BE717453. Полосы, обозначенные как CUR-1264, CUR-1265 и CUR-1266, представляют собой SEQ ID NO:40-42 соответственно.

На фиг.9 представлены результаты анализа ПЦР в реальном режиме времени. Результаты показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки тремя олигонуклеотидами, предназначенными для SIRT1-антисмысловой последовательности AV718812. Полосы, обозначенные как CUR-1294, CUR-1297, CUR-1295, CUR-1296 и CUR-1298, представляют собой SEQ ID NO:43-47 соответственно.

На фиг.10 представлены SEQ ID NO:1: сиртуин Homo sapiens (гомолог регуляции 2 сайленсинга информации по типу скрещивания) 1 (S. cerevisiae) (SIRT1), мРНК (регистрационный номер NCBI: NM_012238.3) и SEQ ID NO:1a показывает геномную последовательность SIRT (экзоны показаны заглавными буквами, интроны показаны строчными буквами).

На фиг.11 представлены:

SEQ ID NO:2: расширенная природная антисмысловая последовательность (CV396200 - расширенная);

SEQ ID NO:3: природная антисмысловая последовательность (CV428275);

SEQ ID NO:4: природная антисмысловая последовательность (BE717453);

SEQ ID NO:5: природная антисмысловая последовательность (AV718812).

На фиг.12 показаны SEQ ID NO:6-23, * указывает фосфоротиоатную связь.

На фиг.13 показаны SEQ ID NO:24-28, * указывает фосфоротиоатную связь, + указывает LNA и m указывает 2'О Me.

На фиг.14 показаны SEQ ID NO:29-31, антисмысловая последовательность двухцепочечных тестируемых олигонуклеотидов, предназначенных для SIRT-антисмысловой последовательности CV396200, которые представляют собой sirtas_5, sirtas_6 и sirtas_7 соответственно.

На фиг.15 показаны SEQ ID NO:32, 33, 34 и 35, предназначенные для SIRT1-антисмысловой последовательности CV396200.

На фиг.16 показаны SEQ ID NO:36, 37, 38 и 39, предназначенные для SIRT1-антисмысловой последовательности CV428275.

На фиг.17 представлены SEQ ID NO:40, 41 и 42 предназначенные для SIRT1-антисмысловой последовательности BE717453.

На фиг.18 представлены SEQ ID NO:43, 44, 45, 46 и 47 предназначенные для SIRT1-антисмысловой последовательности AV718812.

На фиг.19 представлены SEQ ID NO:48-51. SEQ ID NO:38 соответствует экзону 4 природной SIRT1-антисмысловой последовательности CV396200, SEQ ID NO:49, 50 и 51 соответствуют последовательности прямого праймера, последовательности обратного праймера и репортерной последовательности соответственно.

На фиг.20 представлена SEQ ID NO:52, которая соответствует CUR-962, * указывает фосфоротиоатную связь и + указывает LNA.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Отдельные аспекты изобретения описаны ниже со ссылкой на примеры практического применения для иллюстрации. Следует понимать, что многочисленные конкретные детали, зависимости и способы изложены для обеспечения полного понимания изобретения. Специалист в данной области техники, однако, легко определит, что изобретение может быть применено на практике без одной или более специфических деталей или с применением других способов. Настоящее изобретение не ограничивается последовательностью действий или событий, поскольку некоторые действия могут происходить в другом порядке и/или одновременно с другими действиями или событиями. Кроме того, не все иллюстративные действия или события необходимы для воплощения методологии в соответствии с настоящим изобретением.

Предполагается, что все гены, названия генов, и продукты генов, раскрытые в описании, соответствуют гомологам из других видов, для которых применимы композиции и способы, раскрытые в описании. Таким образом, термины включают в себя, но без ограничения гены и продукты генов человека и мыши. Следует понимать, что если раскрыт ген или продукт гена из определенного вида, указанное раскрытие является только иллюстративным, и не должно интерпретироваться как ограничение, если только контекст, в котором он появляется, не указывает ясно другое. Таким образом, например, для генов, раскрытых в описании, которые в некоторых вариантах осуществления изобретения относятся к последовательностям нуклеиновых кислот млекопитающих и последовательностям аминокислот млекопитающих, подразумевается, что они охватывают гомологичные и/или ортологичные гены и продукты генов из других животных, включая, но без ограничения других млекопитающих, рыб, амфибий, рептилий и птиц. В предпочтительных вариантах осуществления изобретения гены или последовательности нуклеиновых кислот являются человеческими.

Определения

Терминология, применяемая в настоящем документе, используется только с целью описания определенных вариантов воплощения и не предназначена для ограничения изобретения. Применяемые в описании формы единственного числа предназначены также для включения множественных форм, если только не в контексте не указано иное. Кроме того, в тех случаях, когда термины "включающий в себя", "включает в себя", "имеющий", "имеет", "с", или их варианты применяют в подробном описании и/или в формуле, предполагается, что указанные термины являются инклюзивными сходным образом с термином "содержащий".

Термин "примерно" или "приблизительно" означает в пределах допустимой погрешности для конкретной величины, как определяет специалист в данной области техники, которая будет зависеть в частности от того, как величину измеряют или определяют, т.е. от ограничений системы измерения. Например, "приблизительно" может означать в пределах 1 или более чем 1 стандартного отклонения на практике в данной области техники. Альтернативно, "приблизительно" может означать диапазон до 20%, предпочтительно до 10%, более предпочтительно до 5% и еще более предпочтительно до 1% указанного значения. Альтернативно, в особенности с учетом биологических систем и процессов, термин может означать в пределах порядка величины, предпочтительно в пределах 5-кратного, и более предпочтительно в пределах 2-кратного значения величины. В случае если конкретные значения описаны в заявке и в формуле изобретения, и если не утверждается другое, следует исходить из того, что термин "приблизительно" означает в пределах допустимой погрешности для конкретной величины.

Применяемый в описании термин "мРНК" означает известный в настоящее время транскрипт (транскрипты) мРНК гена-мишени, и любые другие транскрипты, которые могут быть выявлены.

Под "антисмысловыми олигонуклеотидами" или "антисмысловым соединением" подразумевается молекула РНК или ДНК, которая связывается с другой РНК или ДНК (РНК-мишень, ДНК-мишень). Например, если антисмысловое соединение представляет собой РНК-олигонуклеотид, оно связывается с другой РНК-мишенью посредством РНК-РНК взаимодействий и изменяет активность РНК-мишени (Eguchi et al., 1991 Ann. Rev. Biochem. 60, 631-652). Антисмысловой олигонуклеотид может активировать или подавлять экспрессию и/или функции определенного полинуклеотида. Определение предназначено для включения любой чужеродной молекулы РНК или ДНК, которая полезна с терапевтической, диагностической или другой точки зрения. Указанные молекулы включают в себя, например, молекулы антисмысловых РНК или ДНК, интерферирующую РНК (РНКi), микроРНК, молекулы РНК ловушки, siРНК, ферментативную РНК, терапевтические редактирующие РНК, и РНК-агониста и РНК-антагониста, антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешней вспомогательной последовательности (EGS), альтернативные сплайсеры, праймеры, зонды, и другие олигомерные соединения, которые гибридизуются по меньшей мере с частью нуклеиновой кислоты-мишени. По существу указанные соединения могут быть представлены в форме одноцепочечных, двухцепочечных, частично одноцепочечных, или циклических олигомерных соединений.

В контексте настоящего изобретения термин "олигонуклеотид" относится к олигомеру или полимеру рибонуклеиновой кислоты (РНК) или дезоксирибонуклеиновой кислоты (ДНК) или к их миметикам. Термин "олигонуклеотид", также включает в себя линейные или циклические олигомеры природных и/или модифицированных мономеров или связей, включая дезоксирибонуклеозиды, рибонуклеозиды, их замещенные и альфа-аномерные формы, пептидные нуклеиновые кислоты (PNA), закрытые нуклеиновое кислоты (LNA), фосфоротиоат, метилфосфонат и т.п. Олигонуклеотиды способны к специфическому связыванию с полинуклеотидом-мишенью с помощью регулярной структуры мономер-мономерных взаимодействий, таких как образование пар оснований по Уотсону-Крику, Хугстину или с помощью обратного хугстиновского типа спаривания оснований или т.п.

Олигонуклеотид может быть "химерным", а именно может включать в себя различные области. В контексте настоящего изобретения "химерные" соединения представляют собой олигонуклеотиды, которые содержат два или более химических областей, например, область (области) ДНК, область (области) РНК, область (области) PNA и т.д. Каждая химическая область образована по меньшей мере одной мономерной единицей, т.е. нуклеотидом в случае олигонуклеотидного соединения. Указанные олигонуклеотиды обычно включают в себя по меньшей мере одну область, где олигонуклеотид модифицирован, так чтобы он демонстрировал одно или более желаемые свойства. Желаемые свойства олигонуклеотида включают в себя, но без ограничения, например, повышенную устойчивость к нуклеазной деградации, повышенное клеточное поглощение, и/или повышенную аффинность связывания с нуклеиновой кислотой-мишенью. Различные участки олигонуклеотида могут, соответственно, обладать различными свойствами. Химерные олигонуклеотиды настоящего изобретения могут быть образованы как смешанные структуры двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеотидов и/или олигонуклеотидных аналогов, как описано выше.

Олигонуклеотид может быть образован из областей, которые могут быть соединены в "регистр", то есть когда мономеры соединены последовательно, как в нативной ДНК, или соединены с помощью спейсеров. Спейсеры предназначены для образования ковалентного “мостика” между участками, и в предпочтительных случаях имеют длину не более 100 атомов углерода. Спейсеры могут обладать различными функциональными свойствами, например, могут иметь положительный или отрицательный заряд, обладать свойствами связывания с определенными нуклеиновыми кислотами (интеркаляторами, веществами, связывающимися по бороздкам молекулы ДНК, токсинами, флуорофорами и т.д.), могут являться липофильными, вызывая образование определенных вторичных структур, как например, аланин-содержащие пептиды, которые индуцируют альфа-спирали.

Применяемые в описании "SIRT1" и "сиртуин 1" включают в себя всех членов семейства, мутантов, аллели, фрагменты, виды, кодирующие и некодирующие последовательности, смысловые и антисмысловые полинуклеотидные цепи и т.д.

Применяемый в описании "SIRT1" относится к гомологу регулятора 2 сайленсинга информации по типу скрещивания и является членом семейства белка сиртуиновой деацетилазы. Аминокислотная последовательность SIRT1 может быть найдена по номеру регистрации в GenBank, регистрационный номер NP.sub.--08509. SIRT1 является человеческим гомологом белка дрожжей Sir2 и проявляет NAD-зависимую деацетилазную активность.

Применяемые в описании формулировки сиртуин 1, SIRT1, сиртуин, гомолог 1 регулятора 2 сайленсинга информации по типу скрещивания, hSIR2, hSIRT1, NAD-зависимая деацетилаза сиртуин-1, SIR2L1, SIR2-подобный белок 1, рассматриваются как аналогичные в литературе и используются взаимозаменяемо в настоящей заявке.

Применяемый в описании термин "олигонуклеотид, специфичный для" или "олигонуклеотид, который воздействует на" относится к олигонуклеотиду, обладающему последовательностью (i), способной к образованию стабильного комплекса с частью гена-мишени, или (ii) способной к образованию стабильного дуплекса с частью транскрипта мРНК гена-мишени. Стабильность комплексов и дуплексов может быть определена с помощью теоретических расчетов и/или с помощью анализов in vitro. Типичные анализы для определения стабильности гибридизации комплексов и дуплексов описаны в примерах ниже.

Применяемый в описании термин "нуклеиновая кислота-мишень" охватывает ДНК, РНК (включая пре-мРНК и мРНК) транскрибируемую из указанной ДНК, и также кДНК полученную из такой РНК, кодирующие, некодирующие последовательности, смысловые или антисмысловые полинуклеотиды. Специфическая гибридизация олигомерного соединения с его нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты. Указанная модуляция функции нуклеиновой кислоты-мишени с помощью соединений, которые специфически гибридизуются с ней, обычно обозначается как "антисмысловая". Функции ДНК, которые модулируют, включают в себя, например, репликацию и транскрипцию. Функции РНК, которые затрагиваются, включают в себя все витальные функции такие как, например, транслокация РНК к месту трансляции белка, трансляция белка из РНК, сплайсинг РНК для получения одного или более видов мРНК, и каталитическая активность, в которой участвует РНК или которая облегчается с помощью РНК. Общим эффектом такого воздействия на функционирование нуклеиновой кислоты-мишени является модуляция экспрессии кодированного продукта или олигонуклеотидов.

РНК-интерференция "РНКi" опосредуется молекулами двухцепочечной РНК (dsРНК), которая обладает сайт-специфической гомологией со своими "мишенями" - последовательностями нуклеиновой кислоты (Caplen, N. J., et al. (2001) Proc. Natl. Acad. Sci. USA 98:9742-9747). В определенных вариантах осуществления настоящего изобретения медиаторы представляют собой "малые интерферирующие" РНК-дуплексы (siРНК), состоящие из 5-25 нуклеотидов. Получают siРНК путем процессинга dsРНК с помощью фермента РНКазы, известного как Dicer (Bernstein, E., et al. (2001) Nature 409:363-366). Продукты двухцепочечной siРНК участвуют в мультибелковом комплексе siРНК, называемом RISC (РНК Induced Silencing Complex). Вне связи с какой-либо конкретной теорией считают далее, что RISC направляется к нуклеиновой кислоте-мишени (соответствующей мРНК), где дуплекс siРНК взаимодействует специфичным образом с последовательностью и опосредует каталитическое расщепление (Bernstein, E., et al. (2001) Nature 409:363-366; Boutla, A., et al. (2001) Curr. Biol. 11:1776-1780). Малые интерферирующие РНК, которые могут быть использованы в соответствии с настоящим изобретением, могут быть синтезированы и применены согласно способам, которые хорошо известны в данной области техники, и которые знакомы специалисту в данной области техники. Малые интерферирующие РНК для применения в способах настоящего изобретения соответственно включают в себя от приблизительно 1 до приблизительно 50 нуклеотидов (nt). В примерах неограничивающих вариантов осуществления изобретения siРНК могут включать в себя от приблизительно 5 до приблизительно 40 nt, от приблизительно 5 до приблизительно 30 nt, от приблизительно 10 до приблизительно 30 nt, от приблизительно 15 до приблизительно 25 nt или приблизительно 20-25 нуклеотидов.

Отбор подходящих олигонуклеотидов облегчается при использовании компьютерных программ, которые автоматически выравнивают последовательности нуклеиновых кислот и показывают области идентичности или гомологии. Указанные программы используют для сравнения полученных последовательностей нуклеиновых кислот, например, при проведении поиска в базах данных, таких как GenBank или при секвенировании продуктов ПЦР. Сравнение последовательностей нуклеиновых кислот ряда биологических видов обеспечивает селекцию последовательностей нуклеиновых кислот, которые демонстрируют подходящую степень идентичности между видами. В случае генов, которые не были секвенированы, осуществляют саузерн-блоттинг, чтобы определить степень идентичности между генами видов-мишеней и других видов. При выполнении саузерн-блоттинга в условиях различной степени жесткости, как хорошо известно в данной области техники, можно получить приблизительный показатель идентичности. Указанные процедуры позволяют провести отбор олигонуклеотидов, которые демонстрируют высокую степень комплементарности с последовательностями нуклеиновой кислоты-мишени у субъекта, которые должны контролироваться и низкую степень комплементарности с соответствующими последовательностями нуклеиновых кислот других видов. Специалисту в данной области техники понятно, что существует значительная широта выбора подходящих областей генов для применения в настоящем изобретении.

Под "ферментной РНК" подразумевают молекулу РНК с ферментативной активностью (Cech, (1988) J. American. Med. Assoc. 260, 3030-3035). Ферментные нуклеиновые кислоты (рибозимы) действуют путем первичного связывания с РНК-мишенью. Такое связывание происходит с помощью связывающей мишень части ферментной нуклеиновой кислоты, которая расположена в непосредственной близости от ферментной части молекулы, которая способствует расщеплению РНК-мишени. Таким образом, ферментная нуклеиновая кислота сначала распознает и затем связывается с РНК-мишенью путем спаривания оснований, и после связывания с соответствующим сайтом, действует, ферментативно расщепляя РНК-мишень.

Под "РНК-ловушкой" подразумевают молекулу РНК имитирует природный домен связывания для лиганда. Таким образом, РНК-ловушка конкурирует с природной связывающей мишенью за связывание специфического лиганда. Например, показано, что избыточная экспрессия РНК транс-активации ответа (TAR) ВИЧ может действовать в качестве "ловушки" и эффективно связывать tat белок ВИЧ, предотвращая тем самым его связывание с последовательностями TAR, кодированными в РНК ВИЧ (Sullenger et al. (1990) Cell, 63, 601-608). Описанное выше является специфическим примером. Специалистам в данной области техники понятно, что это только один пример, и могут быть разработаны другие варианты осуществления с применением способов, широко известных в данной области техники.

Применяемый в описании термин "мономеры" обычно указывает мономеры, связанные фосфодиэфирными связями или их аналогами с образованием олигонуклеотидов, отличающихся по размеру от нескольких мономерных единиц, например, от приблизительно 3-4, до приблизительно нескольких сотен мономерных единиц. Аналоги фосфодиэфирных связей включают в себя: фосфоротиоат, фосфородитиоат, метилфосфонаты, фосфоселенат, фосфорамидат и т.п., которые более подробно описаны ниже.

Термин "нуклеотид" включает в себя природные и синтетические нуклеотиды. Специалисту в данной области техники должно быть понятно, что различные нуклеотиды, которые ранее рассматривали как "синтетические", впоследствии были обнаружены в природе. Таким образом, "нуклеотиды" включают в себя не только молекулы, содержащие известные пуриновые и пиримидиновые гетероциклы, но также их гетероциклические аналоги и таутомеры. Иллюстративные примеры типов нуклеотидов представляют собой молекулы, содержащие аденин, гуанин, тимин, цитозин, урацил, пурин, ксантин, диаминопурин, 8-оксо-N6-метиладенин, 7-деазаксантин, 7-деазагуанин, N4,N4-этаноцитозин, N6,N6-этано-2,6-диаминопурин, 5-метилцитозин, 5-(C3-C6)-алкинилцитозин, 5-фторурацил, 5-бромурацил, псевдоизоцитозин, 2-гидрокси-5-метил-4-триазолпиридин, изоцитозин, изогуанин, инозин и "синтетические" нуклеотиды, описанные в Benner et al., патент США № 5432272. Термин "нуклеотид" предназначен для включения каждого и всех примеров, а также их аналогов и таутомеров. Особый интерес представляют нуклеотиды, содержащие аденин, гуанин, тимин, цитозин и урацил, которые рассматриваются как природные нуклеотиды, в отношении терапевтического и диагностического применения у человека. Нуклеотиды включают в себя природные 2'-дезокси и 2'-гидрокси-сахара, которые описаны, например, в Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992) as well as their analogs.

"Аналоги" в применении к нуклеотидам включают в себя синтетические нуклеотиды, содержащие модифицированные молекулы оснований и/или модифицированные молекулы сахаров (смотрите, например, описанные в целом Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, (1997) Nucl. Acid. Res., 25(22), 4429-4443, Toulme, J.J., (2001) Nature Biotechnology 19:17-18; Manoharan M., (1999) Biochemica et Biophysica Acta 1489:117-139; Freier S. M., (1997) Nucleic Acid Research, 25:4429-4443, Uhlman, E., (2000) Drug Discovery & Development, 3: 203-213, Herdewin P., (2000) Antisense & Nucleic Acid Drug Dev., 10:297-310); 2'-O, 3'-C-связанные [3.2.0] бициклоарабинонуклеозиды (смотрите, например, N.K Christiensen., et al., (1998) J. Am. Chem. Soc, 120: 5458-5463; Prakash TP, Bhat B. (2007) Curr Top Med Chem. 7(7):641-9; Eun Jeong Cho, Joo-Woon Lee, Andrew D. Ellington Applications of Aptamers as Sensors Annual Review of Analytical Chemistry, July 2009, Vol. 2, Pages 241-264). Указанные аналоги включают в себя синтетические нуклеотиды, предназначенные для усиления связывающих свойств, например стабильности дуплекса или триплекса, специфичности или тому подобного.

Применяемый в описании термин "гибридизация" означает спаривание главным образом комплементарных цепей олигомерных соединений. Механизм спаривания включает в себя образование водородных связей, в контексте данного изобретения “гибридизация” означает образование водородных связей, которое может представлять собой образование водородных связей по Уотсону-Крику, Хугстину (Hoogsteen) и обратное связывание водородными связями по Хугстину между комплементарными нуклеозидными или нуклеотидными основаниями (нуклеотидами) цепей олигомерных соединений. Например, аденин и тимин являются комплементарными нуклеотидами, которые спариваются путем образования водородных связей. Гибридизация может происходить в различных условиях.

Антисмысловое соединение является "способным к специфической гибридизации" если связывание соединения с нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты-мишени, таким образом, что вызывает модуляцию функции и/или активности, и имеется достаточная степень комплементарности, чтобы избежать неспецифического связывания антисмыслового соединения с нецелевыми последовательностями нуклеиновой кислоты в условиях, в которых желательно осуществление специфического связывания, а именно в физиологических условиях в случае тестов in vivo или терапевтического лечения, и в условиях, в которых исследования проводят в случае тестов in vitro.

Применяемая в описании фраза "жесткие условия гибридизации" или "жесткие условия" относится к условиям, при которых соединение изобретения будет гибридизироваться со своей последовательностью-мишенью, но только с очень небольшим количеством других последовательностей. Жесткие условия зависят от последовательности и будут различными в различных обстоятельствах, и в контексте настоящего изобретения "жесткие условия", при которых олигомерные соединения гибридизуются с последовательностью-мишенью, определяются природой и составом олигомерных соединений и тестами, в которых их изучают. В целом жесткие условия гибридизации включают в себя низкие концентрации (<0,15 M) солей неорганических катионов, таких как Na++ или K++ (т.e. с низкой ионной силой), температуру более чем на 20-25ºC ниже Tm комплекса олигомерное соединение: последовательность-мишень, и присутствие денатурирующих реагентов, таких как формамид, диметилформамид, диметилсульфоксид или детергент додецилсульфат натрия (SDS). Например, скорость гибридизации уменьшается на 1,1% для каждого 1% формамида. Пример жестких условий гибридизации представляет собой 0,1× буфер хлорида натрия и цитрата натрия (SSC)/0,1% (масс/об) SDS при 60ºC в течение 30 минут.

Термин "комплементарный", применяемый в описании, относится к способности точного спаривания между двумя нуклеотидами одной или двух олигомерных цепей. Например, если нуклеиновое основание в определенном положении антисмыслового соединения способно образовывать водородные связей с нуклеиновым основанием в определенном положении нуклеиновой кислоты-мишени, при этом указанная нуклеиновая кислота-мишень, представляет собой ДНК, РНК или олигонуклеотидную молекулу, то положение, в котором образуется водородное связывание между олигонуклеотидом и нуклеиновой кислотой-мишенью, рассматривают как комплементарное положение. Олигомерное соединение и следующая ДНК, РНК или олигонуклеотидная молекула комплементарны друг другу, если достаточное число комплементарных положений в каждой молекуле занято нуклеотидами, которые могут образовывать водородные связи друг с другом. Таким образом, "способный к специфической гибридизации" и "комплементарный" являются терминами, которые используют, чтобы показать достаточную степень точного спаривания или комплементарности с помощью достаточного числа нуклеотидов, так что между олигомерным соединением и нуклеиновой кислотой-мишенью возникает стабильное и специфическое связывание.

Как понимают в данной области техники, последовательность олигомерного соединения не должна быть на 100% комплементарной со своей нуклеиновой кислотой-мишенью, чтобы быть способной к специфической гибридизации. Кроме того, олигонуклеотид может гибридизоваться через один или более сегментов, так что промежуточные или соседние сегменты не вовлекаются в событие гибридизации (например, петлевая структура, несоответствие или шпилечная структура). Олигомерные соединения настоящего изобретения составляют по меньшей мере приблизительно 70%, или по меньшей мере 75%, или по меньшей мере 80%, или по меньшей мере 85%, или по меньшей мере 90%, или по меньшей мере 95%, или по меньшей мере 99% комплементарности последовательности с участком-мишенью в пределах последовательности нуклеиновой кислоты-мишени, на которую они направлены. Например, антисмысловое соединение, в котором 18 из 20 нуклеотидов антисмыслового соединения комплементарны участку-мишени, и соответственно специфически гибридизуются, представляют собой 90 процентов комплементарности. В данном примере оставшиеся некомплементарные нуклеотиды могут быть сгруппированы или рассеяны комплементарными нуклеотидами и не обязательно должны быть сопряжены друг с другом или с комплементарными нуклеотидами. В связи с этим антисмысловое соединение длиной 18 нуклеотидов, содержащее 4 (четыре) некомплементарных нуклеотида, которые фланкируются двумя областями полной комплементарности с нуклеиновой кислотой-мишенью, будет обладать 77,8% общей комплементарности с нуклеиновой кислотой-мишенью и, таким образом, будет попадать под действие настоящего изобретения. Процент комплементарности антисмыслового соединения с областью нуклеиновой кислоты-мишени может быть определен обычным способом с применением программ BLAST (basic local alignment search tools) и программ PowerBLAST, известных в данной области техники (Altschul et al., (1990) J. MoI. Biol, 215, 403-410; Zhang and Madden, (1997) Genome Res., 1, 649-656). Процентная гомология, идентичность последовательности или комплементарность, могут быть определены, например, с помощью программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), используя стандартную настройку, которая использует алгоритм Smith и Waterman (Adv. Appl. Math., (1981) 2, 482-489).

Применяемый в описании термин "температурная точка плавления (Tm)" относится к температуре, при определенных значениях ионной силы, pH, и концентрации нуклеиновой кислоты, при которой 50% олигонуклеотидов, комплементарных последовательности-мишени, равновесно гибридизуются с последовательностью-мишенью. Обычно жесткие условия будут представлять собой такие, в которых концентрация соли составляет по меньшей мере от приблизительно 0,01 до 1,0 М концентрации ионов Na (или других солей) при значении pH от 7,0 до 8,3 и температура равна по меньшей мере приблизительно 30ºC для коротких олигонуклеотидов (например, от 10 до 50 нуклеотидов). Жесткие условия также могут быть достигнуты при добавлении дестабилизирующих агентов, таких как формамид.

Применяемая в описании "модуляция" означает либо увеличение (стимуляцию), либо снижение (ингибирование) экспрессии гена.

Термин "вариант", если используется в контексте полинуклеотидной последовательности, может включать в себя полинуклеотидную последовательность, относящуюся к гену дикого типа. Указанное определение также может включать в себя, например, "аллельные", "сплайс", "видовые" или "полиморфные" варианты. Сплайс-вариант может обладать значительной идентичностью с референсной молекулой, но обычно будет содержать большее или меньшее число полинуклеотидов в результате альтернативного сплайсинга экзонов во время процессинга мРНК. Соответствующий полипептид может нести дополнительные функциональные домены, или указанные домены могут отсутствовать. Видовые варианты представляют собой полинуклеотидные последовательности, которые изменяются от одного вида к другому. Относительно конкретной полезности, в изобретении используются варианты продуктов генов дикого типа. Варианты могут быть получены в результате по меньшей мере одной мутации в последовательности нуклеиновой кислоты и могут приводить к образованию измененных мРНК или полипептидов, структура или функция которых могут быть изменены или не изменены. Любой указанный природный или рекомбинантный ген может не иметь, иметь одну или много аллельных форм. Часто встречающиеся мутационные изменения, которые приводят к образованию вариантов, обычно относят к природным делециям, добавлениям или заменам нуклеотидов. Каждый из указанных типов изменений может происходить отдельно или в комбинации с другими, один или более раз в данной последовательности.

Получаемые полипептиды, в целом, обладают значительной аминокислотной идентичностью друг с другом. Полиморфный вариант представляет собой вариацию в полинуклеотидной последовательности конкретного гена среди субъектов данного вида. Полиморфные варианты также могут охватывать "однонуклеотидные полиморфизмы" (SNP) или одноосновные мутации, в которых полинуклеотидная последовательность отличается по одному основанию. Наличие SNP может служить признаком, например, определенной популяции с предрасположенностью к болезненному состоянию, который представляет собой подверженность в сравнении с устойчивостью к заболеванию.

Производные полинуклеотидов включают в себя нуклеиновые кислоты, подвергнутые химической модификации, например, замещению атома водорода алкильной, ацильной или аминогруппой. Производные, например производные олигонуклеотидов, могут включать в себя не встречающиеся в природе части, такие как измененные сахарные составляющие или измененные связи между сахарными составляющими. Примерами вышеуказанного являются фосфоротиоат и другие серосодержащие соединения, которые известны в данной области техники. Производные нуклеиновых кислот также могут содержать метки, включая радионуклеотиды, ферменты, флуоресцентные агенты, хемилюминесцентные агенты, хромогенные агенты, субстраты, кофакторы, ингибиторы, магнитные частицы и т.п.

"Производный" полипептид или пептид представляет собой полипептид или пептид, который модифицирован, например, с помощью гликозилирования, пегилирования, фосфорилирования, сульфатирования, восстановления/алкилирования, ацилирования, химического присоединения или мягкой обработки формалином. Производное также может быть модифицировано, так чтобы оно содержало детектируемую метку, непосредственно или опосредованно, включая, но без ограничения радиоизотопную, флуоресцентную и ферментную метку.

Применяемый в описании термин "животное" или "пациент" включает в себя, например, человека, овцу, лося, оленя, чернохвостого оленя, норку, млекопитающих, обезьян, лошадей, крупный рогатый скот, свиней, коз, собак, кошек, крыс, мышей, птиц, цыплят, рептилий, рыб, насекомых и паукообразных.

Термин "млекопитающее" распространяется на теплокровных млекопитающих, которым обычно оказывается медицинская помощь (например, человек и домашние животные). Примеры включают в себя домашнюю кошку, собаку, лошадь, корову и человека.

Термин "проводить лечение" или "лечение" охватывает лечение болезненного состояния у млекопитающего, и включает в себя: (a) предотвращение появления болезненного состояния у млекопитающего, в особенности, если указанное млекопитающее предрасположено к болезненному состоянию, но оно еще не диагносцировано у него как имеющееся; (b) сдерживание болезненного состояния, например, путем прекращения его развития; и/или (c) смягчение болезненного состояния, например, вызывая регрессию болезненного состояния до достижения желаемого конечного показателя. Лечение также включает в себя облегчение симптома заболевания (например, уменьшение боли или дискомфорта), где указанное улучшение состояния может непосредственно воздействовать являться или не воздействовать на заболевание (например, на причину, передачу, экспрессию и т.д.).

Термин "нейродегенеративные заболевания" относится к широкому спектру заболеваний и нарушений центральной и периферической нервной системы, включая, например, болезнь Паркинсона, болезнь Хантингтона, болезнь Альцгеймера, боковой амиотрофический склероз (ALS), слабоумие, рассеянный склероз и другие заболевания и нарушения, ассоциированные с гибелью нервных клеток.

Термин "метаболические заболевания" относится к широкому спектру заболеваний и нарушений эндокринной системы, включая, например, резистентность к инсулину, диабет, ожирение, нарушение толерантности к глюкозе, высокий уровень холестерина в крови, гипергликемию, дислипидемию и гиперлипидемию.

Полинуклеотидные и олигонуклеотидные композиции и молекулы

"Белок SIRT1" относится к члену семейства sir2 сиртуина деацетилаз. В одном варианте воплощения белок SIRT1 включает в себя Sir2 дрожжей (регистрационный номер в базе GenBank P53685), Sir-2.1 C. elegans (регистрационный номер в базе GenBank NP.sub.--501912), SIRT1 человека (регистрационный номер в базе GenBank NM.sub.--012238 и NP.sub.--036370 (или AF083106)).

"Сиртуины" SIRT1 представляют собой белки, которые содержат домен SIR2, домен, определяемый как аминокислотные последовательности, которые подсчитывают в виде совпадений в семействе Pfam "SIR2"-PF02146 (помещено в Приложении). Указанное семейство обозначается в базе данных INTERPRO как описание INTERPRO (запись IPR003000). Чтобы установить присутствие домена "SIR2" в белковой последовательности и произвести определение какой конкретный профиль имеет полипептид или белок, представляющий интерес, может быть произведен поиск аминокислотной последовательности белка по сравнению с базой данных Pfam HMM (например, база данных Pfam, выпуск 9), используя стандартные параметры (http://www.sanger.ac.uk/Software/Pfam/HMM_search). Домен SIR2 индексируется в Pfam как PF02146 и в INTERPRO как описание INTERPRO (запись IPR003000). Описание базы данных Pfam можно найти в "The Pfam Protein Families Database" Bateman A et al. (2002) Nucleic Acids Research 30(l):276-280 и Sonhammer et al. (1997) Proteins 28(3):405-420, и подробное описание HMM можно найти, например, в Gribskov et al. (1990) Meth. Enzymol. 183:146-159; Gribskov et al. (1987) Proc. Natl. Acad. Sci. USA 84:4355-4358; Krogh et al. (1994) J. MoI. Biol. 235:1501-1531; и Stultz et al. (1993) Protein Sci. 2:305-314.

Мишени

В одном варианте воплощения мишени включают в себя последовательности нуклеиновых кислот сиртуина 1 (SIRT1), включающие в себя без ограничения смысловые и/или антисмысловые некодирующие и/или кодирующие последовательности, ассоциированные с SIRT1.

В предпочтительных вариантах осуществления изобретения антисмысловые олигонуклеотиды используются для предотвращения или лечения заболеваний или нарушений, ассоциированных с сиртуином 1 (SIRT1). Сиртуины (SIRT) представляют собой белок-модифицирующие ферменты, которые представлены повсеместно во всех организмах. SIRT1 представляет собой гомолог у млекопитающих дрожжевого никотинамидадениндинуклеотид-зависимого деацетилазного регулятора 2 “молчащей” информации (известного как Sir2), который является наиболее хорошо охарактеризованным членом семейства SIRT. SIRT1 регулирует физиологию клеток адипоцитного происхождения. Модуляторы активности SIRT1 могут быть использованы для облегчения, лечения или предотвращения заболеваний и нарушений, ассоциированных с физиологией жировой ткани, например, с ожирением, заболеванием, связанным с ожирением, или с метаболическими нарушениями жирового обмена.

SIRT1 регулирует продолжительность жизни в нескольких модельных организмах и участвует в нескольких процессах в клетках млекопитающих, включая клеточную выживаемость, дифференцировку и метаболизм. Индукция SIRT1, либо с помощью SIRT-активирующих соединений, таких как ресвератрол, либо с помощью метаболического регулирования, ассоциированного с ограничением калорий, может обладать нейропротективными свойствами и, таким образом, препятствовать нейродегенеративному процессу, способствуя, таким образом, долголетию (Han SH, (2009) J Clin Neurol. Sep; 5(3): 120-5; Michan S, et al. (2007) Biochem J. 404(1): 1-13).

Имеется несколько отчетов, которые подтверждают защитную роль SIRT1 в отношении аксонов нервной системы. Аксональная дегенерация является главным морфологическим признаком, наблюдаемым при периферических нейропатиях и нейродегенеративных заболеваниях, таких как болезнь Альцгеймера (AD) и боковой амиотрофический склероз (Fischer LR, et al. (2004) Exp Neurol 185:232-240; Stokin GB, et al. (2005) Science 307:1282-1288). Аксональная дегенерация обычно имеет место на ранней стадии дегенеративных процессов и часто предшествует или тесно коррелирует с клиническими симптомами, такими как снижение когнитивных способностей (Yamamoto H, et al. (2007) Mol Endocrinol. 21 (8): 1745-1755).

В предпочтительном варианте воплощения олигонуклеотиды являются специфическими в отношении полинуклеотидов SIRT1, которые включают в себя без ограничения некодирующие области. Мишени SIRT1 включают в себя варианты SIRT1; мутанты SIRT1, включая SNP; некодирующие последовательности SIRT1; аллели, фрагменты и т.п. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу РНК.

В соответствии с вариантами осуществления изобретения молекула нуклеиновой кислоты-мишени не ограничивается полинуклеотидами SIRT1 в чистом виде, но распространяется на любые изоформы, рецепторы, гомологи, некодирующие области и т.п. SIRT1.

В другом предпочтительном варианте воплощения олигонуклеотид воздействует на природную антисмысловую последовательность (природная антисмысловая последовательность для кодирующих и некодирующих областей) SIRT1-мишеней, включая без ограничения их варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные последовательности. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу РНК или ДНК.

В другом предпочтительном варианте воплощения олигомерные соединения настоящего изобретения также включают в себя варианты, в которых различные основания представлены в одном или более нуклеотидных положений соединения. Например, если первый нуклеотид представляет собой аденин, могут быть созданы варианты, которые содержат тимидин, гуанозин, цитидин или другие природные или искусственные нуклеотиды в указанном положении. Указанные варианты могут быть осуществлены в любом из положений антисмыслового соединения. Указанные соединения затем тестируют с применением описанных в настоящем документе методов, чтобы определить их способность ингибировать экспрессию нуклеиновой кислоты-мишени.

В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность антисмыслового соединения и мишени составляет от приблизительно 50% до приблизительно 60%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляют от приблизительно 60% до приблизительно 70%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляют от приблизительно 70% до приблизительно 80%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляют от приблизительно 80% до приблизительно 90%. В некоторых вариантах осуществления изобретения гомология идентичность последовательности или комплементарность составляют приблизительно 90%, приблизительно 92%, приблизительно 94%, приблизительно 95%, приблизительно 96%, приблизительно 97%, приблизительно 98%, приблизительно 99% или приблизительно 100%.

Антисмысловое соединение является способным к специфической гибридизации, если связывание соединения с нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты-мишени таким образом, что вызывает потерю активности, и имеется достаточная степень комплементарности, чтобы избежать неспецифического связывания антисмыслового соединения с последовательностями нецелевой нуклеиновой кислоты в условиях, в которых желательно проведение специфического связывания. Указанные условия включают в себя, например, физиологические условия в случае тестов in vivo или терапевтического лечения, и условия, в которых выполняют исследования в случае тестов in vitro.

Антисмысловое соединение, ДНК, РНК, химерное, замещенное и т.д., является способным к специфической гибридизации, если связывание соединения с молекулой-мишенью ДНК или РНК препятствует нормальному функционированию целевой ДНК или РНК, таким образом, что вызывает утрату ее свойств, и имеется достаточная степень комплементарности, чтобы избежать неспецифического связывания антисмыслового соединения с нецелевыми последовательностями в условиях, в которых желательно проведение специфического связывания, а именно в физиологических условиях в случае тестов in vivo или терапевтического лечения, и в случае тестов in vitro, в условиях, в которых выполняют тесты.

В другом предпочтительном варианте воплощения направленное воздействие на SIRT1, включая без ограничения, антисмысловые последовательности, которые идентифицированы и раскрыты с применением, например, ПЦР, гибридизации и т.д., одну или более последовательностей, представленных в SEQ ID NO:6-47, и т.п., модулирует экспрессию или функцию SIRT1. В одном варианте воплощения экспрессия или функция активируются по сравнению с контролем. В другом предпочтительном варианте воплощения экспрессия или функция подавляется по сравнению с контролем.

В другом предпочтительном варианте воплощения олигонуклеотиды включают в себя последовательности нуклеиновых кислот, представленные в SEQ ID NO:6-47, включая антисмысловые последовательности, которые идентифицированы и раскрыты, с применением, например, ПЦР, гибридизации и т.д. Указанные олигонуклеотиды могут включать в себя один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают в себя фосфоротиоат, фосфородитиоат или т.п. В другом предпочтительном варианте воплощения нуклеотиды включают в себя производное фосфора. Производное фосфора (или модифицированная фосфатная группа), которое может быть прикреплено к сахару или к аналогу сахарной части в модифицированных олигонуклеотидах настоящего изобретения, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, фосфат алкана, фосфоротиоат и т.п. Получение упомянутых выше фосфатных аналогов и их включение в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды, по существу, также известно и нет необходимости описывать указанные процессы в настоящем документе.

Специфичность и чувствительность антисмыслового соединения также закладывается специалистами в данной области техники для терапевтических целей. Антисмысловые олигонуклеотиды применяются в качестве терапевтических агентов в лечении болезненных состояний животных и человека. Антисмысловые олигонуклеотиды вводили людям безопасным и эффективным образом, и в настоящее время многочисленные клинические испытания находятся в процессе реализации. Таким образом установили, что олигонуклеотиды могут представлять собой полезные терапевтические формы, которые могут сконфигурированы для применения в схемах лечения для лечения клеток, тканей и животных, в особенности человека.

В вариантах осуществления настоящего изобретения олигомерные антисмысловые соединения, в особенности олигонуклеотиды, связываются с молекулами нуклеиновой кислоты-мишени и модулируют экспрессию и/или функцию молекул, кодируемых геном-мишенью. Функции ДНК, которые подвергаются воздействию, включают в себя, например, репликацию и транскрипцию. Функции РНК, которые подвергаются воздействию, включают в себя все жизненные функции, такие как, например, транслокация РНК к сайту трансляции белка, трансляция белка из РНК, сплайсинг РНК с образованием одного или более видов мРНК, и каталитическую активность, в которую может быть вовлечена РНК или которой может способствовать РНК. Функции могут быть активированы или ингибированы, в зависимости от желаемых функций.

Антисмысловые соединения включают в себя антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешней вспомогательной последовательности (EGS), альтернативные сплайсеры, праймеры, зонды и другие олигомерные соединения, которые гибридизуются по меньшей мере с частью нуклеиновой кислоты-мишени. По существу, указанные соединения могут быть введены в форме одноцепочечных, двухцепочечных, частично одноцепочечных или циклических олигомерных соединений.

Направленное воздействие антисмыслового соединения на определенную молекулу нуклеиновой кислоты в контексте настоящего изобретения может представлять собой многоступенчатый процесс. Процесс обычно начинается с идентификации нуклеиновой кислоты-мишени, функция которой подвергается модуляции. Указанная нуклеиновая кислота-мишень может представлять собой, например, клеточный ген (или мРНК, транскрибируемая из гена) экспрессия которого ассоциирована с определенным нарушением или болезненным состоянием, или молекулу нуклеиновой кислоты инфекционного агента. В настоящем изобретении нуклеиновая кислота-мишень кодирует сиртуин 1 (SIRT1).

Процесс направленного воздействия также обычно включает в себя определение по меньшей мере одного целевого участка, сегмента или сайта в пределах нуклеиновой кислоты-мишени при антисмысловом взаимодействии, которое происходит таким образом, что результатом будет желаемый эффект, например, модуляция экспрессии. В контексте настоящего изобретения термин "область" определяют как часть нуклеиновой кислоты-мишени, характеризующуюся по меньшей мере одной идентифицируемой структурой, функцией или свойством. В пределах участков нуклеиновых кислот-мишеней находятся сегменты. "Сегменты" определяют как меньшие части или субчасти участков в пределах нуклеиновой кислоты-мишени. "Сайты", используемые в настоящем изобретении, определены как положения в пределах нуклеиновой кислоты-мишени.

В предпочтительном варианте воплощения антисмысловые олигонуклеотиды связываются с природными антисмысловыми последовательностями сиртуина 1 (SIRT1) и модулируют экспрессию и/или функцию сиртуина 1 (SIRT1) (SEQ ID NO:1). Примеры антисмысловых последовательностей включают в себя SEQ ID NO:2-5.

В другом предпочтительном варианте воплощения антисмысловые олигонуклеотиды связываются с одним или более сегментами полинуклеотидов сиртуина 1 (SIRT1) и модулируют экспрессию и/или функцию сиртуина 1 (SIRT1). Сегменты включают в себя по меньшей мере пять последовательных нуклеотидов смысловых или антисмысловых полинуклеотидов сиртуина 1 (SIRT1).

В другом предпочтительном варианте воплощения антисмысловые олигонуклеотиды являются специфичными для природных антисмысловых последовательностей сиртуина 1 (SIRT1), где связывание олигонуклеотидов с природными антисмысловыми последовательностями сиртуина 1 (SIRT1) модулирует экспрессию и/или функцию сиртуина 1 (SIRT1).

В другом предпочтительном варианте воплощения олигонуклеотидные соединения включают в себя последовательности, представленные в SEQ ID NO:6-47, антисмысловые последовательности, которые идентифицированы и раскрыты с применением, например, ПЦР, гибридизации и т.д. Указанные олигонуклеотиды могут включать в себя один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают в себя фосфоротиоат, фосфородитиоат или т.п. В другом предпочтительном варианте воплощения нуклеотиды включают в себя производное фосфора. Производное фосфора (или модифицированная фосфатная группа), которое может быть прикреплено к сахару или к аналогу сахарной части в модифицированных олигонуклеотидах настоящего изобретения, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, фосфат алкана, фосфоротиоат и т.п. Получение упомянутых выше фосфатных аналогов и их включение в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды, по существу, также известно и нет необходимости описывать указанные процессы в настоящем документе.

Поскольку, как известно в данной области техники, кодон инициации трансляции представляет собой обычно 5'-AUG (в транскрибируемых молекулах мРНК; 5'-ATG в соответствующей молекуле ДНК), кодон инициации трансляции также обозначается как "AUG кодон", "стартовый кодон" или "AUG стартовый кодон". Меньшая часть генов имеет кодон инициации трансляции, характеризующийся последовательностью РНК 5'-GUG, 5'-UUG или 5'-CUG; и показано, что 5'-AUA, 5'-ACG и 5'-CUG функционируют in vivo. Таким образом, термины "кодон инициации трансляции" и "стартовый кодон" могут включать в себя много последовательностей кодонов, даже если аминокислота инициатор в каждом случае представляет собой обычно метионин (у эукариот) или формилметионин (у прокариот). Эукариотические и прокариотические гены могут иметь два или более альтернативных стартовых кодона, любой из которых может быть использован предпочтительно для инициации трансляции в определенном типе клеток или ткани или при определенном наборе условий. В контексте изобретения "стартовый кодон" и "кодон инициации трансляции" относятся к кодону или кодонам, которые применяются in vivo для инициации трансляции мРНК, транскрибируемой из гена, кодирующего сиртуин 1 (SIRT1), независимо от последовательности (последовательностей) указанных кодонов. Кодон терминации трансляции (или "стоп кодон") гена может иметь одну из трех последовательностей, а именно 5'-UAA, 5'-UAG и 5'-UGA (соответствующие последовательности ДНК представляют собой 5'-TAA, 5'-TAG и 5'-TGA, соответственно).

Термины "область стартового кодона" и "область кодона инициации трансляции" относятся к части такой мРНК или гена, которая включает в себя от приблизительно 25 до приблизительно 50 соседних нуклеотидов в любом направлении (т.е. 5' или 3') от кодона инициации трансляции. Аналогичным образом, термины "область стоп-кодона" и "область кодона терминации трансляции" относится к части мРНК или гена, которая включает в себя от приблизительно 25 до приблизительно 50 соседних нуклеотидов в любом направлении (т.е. 5' или 3') от кодона терминации трансляции. Таким образом, "область стартового кодона" (или "область кодона инициации трансляции") и "область стоп-кодона" (или "область кодона терминации трансляции") представляют собой все участки, которые по существу подвергаются воздействию в качестве мишеней антисмысловых соединений настоящего изобретения.

Открытая рамка считывания (ORF) или "кодирующая область", которая известна в данной области техники для обозначения области между кодоном инициации трансляции и кодоном терминации трансляции, также представляет собой область, которая может представлять собой по существу мишень. В контексте настоящего изобретения область-мишень представляет собой внутригенную область, включающую в себя кодон инициации трансляции или кодон терминации трансляции открытой рамки считывания (ORF) гена.

Другая область-мишень включает в себя 5'-нетранслируемую область (5'UTR), известную в данной области техники для обозначения части мРНК в 5'-направлении от кодона инициации трансляции, и таким образом включающую в себя нуклеотиды между 5'-сайтом кэпирования и кодоном инициации трансляции мРНК (или соответствующими нуклеотидами гена). Еще одна область-мишень включает в себя 3'-нетранслируемую область (3'UTR), известную в данной области техники для обозначения части мРНК в 3'-направлении от кодона терминации трансляции, и, таким образом включающую в себя нуклеотиды между кодоном терминации трансляции и 3'-концом мРНК (или соответствующими нуклеотидами гена). Сайт кэпирования на 5'-конце мРНК включает в себя остаток N7-метилированного гуанозина соединенный с 5'-наибольшим остатком мРНК при помощи 5'-5' трифосфатного мостика. Считают, что кэп-область на 5'-конце мРНК включает в себя кэп-структуру на 5'-конце как таковую, а также первые 50 нуклеотидов, прилегающих к кэп-сайту. Область-мишень настоящего изобретения представляет собой кэп-область на 5'-конце.

Несмотря на то, что некоторые эукариотические транскрипты мРНК транслируются непосредственно, многие из них содержат одну или более области, известные как "интроны", которые удаляются из транскрипта перед тем, как он транслируется. Оставшиеся (и соответственно транслируемые) области известны как "экзоны" и они соединяются друг с другом с образованием непрерывной последовательности мРНК. В одном варианте воплощения направленное воздействие на сайты сплайсинга, т.е. интрон-экзонные сочленения или экзон-интронные сочленения, являются особенно полезными в ситуациях, где в заболевание вовлечен аберрантный сплайсинг или где в заболевание вовлечен сверхсинтез определенного продукта сплайсинга. Граница аберрантного слияния, обусловленного реаранжировкой или делецией, является другим вариантом воплощения сайта-мишени. Транскрипты мРНК, полученные с помощью процесса сплайсинга двух (или более) мРНК из различных генетических источников, известны как "слитые транскрипты". Интроны могут быть подвергнуты воздействию по существу с применением антисмысловых соединений, направленных, например, на ДНК или пре-мРНК.

В другом предпочтительном варианте воплощения антисмысловые олигонуклеотиды связываются с кодирующими и/или некодирующими областями полинуклеотида-мишени и модулируют экспрессию и/или функции молекулы-мишени.

В другом предпочтительном варианте воплощения антисмысловые олигонуклеотиды связываются с природными антисмысловыми полинуклеотидами и модулируют экспрессию и/или функции молекулы-мишени.

В другом предпочтительном варианте воплощения антисмысловые олигонуклеотиды связываются со смысловыми полинуклеотидами и модулируют экспрессию и/или функции молекулы-мишени.

Альтернативные транскрипты РНК могут быть получены из той же самой геномной области ДНК. Указанные альтернативные транскрипты широко известны как "варианты". Более конкретно, "пре-мРНК варианты" представляют собой транскрипты, полученные из одной и той же геномной ДНК, которые отличаются от других транскриптов, полученных из той же самой геномной ДНК по положению старта или по положению окончания и содержат интронную и экзонную последовательность.

После удаления одной или более области экзона или интрона, или их частей во время сплайсинга, варианты пре-мРНК дают "варианты мРНК" меньшего размера. Таким образом, варианты мРНК представляют собой процессированные варианты пре-мРНК, и каждый уникальный вариант пре-мРНК всегда должен давать уникальный вариант мРНК в результате сплайсинга. Указанные варианты мРНК также известны как "альтернативные сплайс-варианты". Если не происходит сплайсинга варианта пре-мРНК, то вариант пре-мРНК идентичен варианту мРНК.

Варианты могут быть получены с помощью применения альтернативных сигналов для старта или окончания транскрипции. Пре-мРНК и мРНК могут нести более чем один стартовый кодон или стоп-кодон. Варианты, образованные из пре-мРНК или мРНК, в которых используют альтернативные стартовые кодоны, известны как "альтернативные стартовые варианты" такой пре-мРНК или мРНК. Транскрипты, в которых используют альтернативный стоп-кодон, известны как "альтернативные стоп-варианты" такой пре-мРНК или мРНК. Один специфический тип альтернативного стоп-варианта представляет собой "polyA вариант", при котором произведенные множественные транскрипты возникают в результате альтернативной селекции одного из "polyA стоп-сигналов" с помощью механизма транскрипции, производя, таким образом, транскрипты, которые оканчиваются в уникальных polyA сайтах. В контексте изобретения типы вариантов, описанных в настоящем документе, также представляют собой варианты воплощения нуклеиновых кислот-мишеней.

Участки на нуклеиновой кислоте-мишени, с которыми гибридизуются антисмысловые соединения, определяют как часть области-мишени по меньшей мере из 5 нуклеиновых оснований, на которую направлено активное антисмысловое соединение.

Несмотря на то, что специфические последовательности определенных показательных сегментов-мишеней указаны в описании, специалисту в данной области техники понятно, что они служат для иллюстрации и описывают определенные варианты воплощения в объеме настоящего изобретения. Дополнительные сегменты могут быть легко выявлены специалистом в данной области техники в сете настоящего раскрытия.

Сегменты-мишени длиной 5-100 нуклеотидов, включающие в себя участок по меньшей мере из пяти (5) последовательных нуклеотидов, выбранные из иллюстративных предпочтительных сегментов-мишеней, также рассматривают, как подходящие для направленного воздействия.

Сегменты-мишени могут включать в себя последовательности ДНК или РНК, которые содержат по меньшей мере 5 последовательных нуклеотидов от 5'-конца одного из иллюстративных предпочтительных сегментов-мишеней (остальные нуклеотиды представляют собой непрерывный участок той же самой ДНК или РНК, начинающийся непосредственно выше 5'-конца сегмента-мишени и продолжающийся до конца ДНК или РНК, содержит от приблизительно 5 до приблизительно 100 нуклеотидов). Аналогичным образом предпочтительные сегменты-мишени представлены последовательностями ДНК или РНК, которые включают в себя по меньшей мере 5 последовательных нуклеотидов с 3'-конца одного из иллюстративных предпочтительных сегментов-мишеней (остальные нуклеотиды, представляют собой непрерывный участок той же самой ДНК или РНК, начинающийся непосредственно выше 3'-конца сегмента-мишени и продолжающийся до конца ДНК или РНК, содержит от приблизительно 5 до приблизительно 100 нуклеотидов). Специалист в данной области техники, “вооруженный” сегментами-мишенями, проиллюстрированными в описании, сможет идентифицировать другие предпочтительные сегменты-мишени без проведения неоправданных экспериментов.

После того как идентифицированы один или более целевых областей, сегментов или сайтов, выбирают антисмысловые соединения, которые достаточно комплементарны мишени, т.е. гибридизуются достаточно хорошо и с достаточной специфичностью, чтобы получить желаемый эффект.

В вариантах воплощения изобретения олигонуклеотиды связываются с антисмысловой цепью определенной мишени. Олигонуклеотиды имеют в длину по меньшей мере 5 нуклеотидов и могут быть синтезированы так что каждый олигонуклеотид воздействует на перекрывающиеся последовательности такие, что олигонуклеотиды синтезируются для перекрывания всей длины полинуклеотида-мишени. Мишени также включают в себя кодирующие и некодирующие области.

В одном варианте воплощения является предпочтительным воздействовать на специфические нуклеиновые кислоты антисмысловыми олигонуклеотидами. Направленное воздействие антисмыслового соединения на определенную нуклеиновую кислоту является многоступенчатым процессом. Процесс обычно начинается с определения последовательности нуклеиновой кислоты, функцию которой нужно модулировать. Это может быть, например, клеточный ген (или мРНК, транскрибируемая из гена), экспрессия которого ассоциирована с определенным нарушением или болезненным состоянием, или некодирующий полинуклеотид, такой как, например, некодирующая РНК (ncРНК).

РНК могут быть классифицированы как (1) мессенджерные РНК (мРНК), которые транслируются в белки, и (2) некодирующие белок РНК (ncРНК). ncРНК включают в себя микроРНК, антисмысловые транскрипты и другие Единицы Транскрипции (TU), содержащие с высокой плотностью стоп-кодоны и не имеющие какой-либо обширной "открытой рамки считывания". Многие ncРНК, по-видимому, начинаются от сайтов инициации в 3'-концевых нетранслируемых областях (3'UTR) кодирующих белки локусов. Зачастую ncРНК являются редкими, и по меньшей мере половина ncРНК, которые были секвенированы в ходе проекта FANTOM, выглядели неполиаденилированными. Большинство исследователей по понятным причинам сосредоточили свое внимание на полиаденилированных мРНК, которые процессируются и направляются в цитоплазму. Недавно было показано, что набор неполиаденилированных ядерных РНК может быть очень большим, и что многие такие транскрипты возникают из так называемых межгенных областей (Cheng, J. et al. (2005) Science 308 (5725), 1149-1154; Kapranov, P. et al. (2005). Genome Res 15 (7), 987-997). Механизм, с помощью которого ncРНК могут регулировать экспрессию генов, представляет собой спаривание оснований с транскриптами-мишенями. РНК, которые функционируют с помощью спаривания оснований, могут быть классифицированы как (1) цис-кодированные РНК, которые кодируются с той же самой генетической локализацией, но на противоположной цепи по отношению к РНК, на которые они воздействуют, и таким образом они демонстрируют превосходную комплементарность со своей мишенью, и (2) транс-кодированные РНК, которые кодируются с хромосомной локализацией, отличающейся от локализации РНК, на которые они воздействуют, и обычно они не демонстрируют высокой способности спаривания оснований со своими мишенями.

Вне связи с какой-либо теорией, нарушение антисмыслового полинуклеотида антисмысловыми олигонуклеотидами, описанными здесь, может изменять экспрессию соответствующих смысловых информационных РНК. Однако указанная регуляция может быть дискордантной (антисмысловой нокдаун приводит к увеличению информационной РНК) или конкордантной (антисмысловой нокдаун приводит к сопутствующему уменьшению информационной РНК). В таких случаях антисмысловые олигонуклеотиды могут быть нацелены на перекрывающиеся или неперекрывающиеся части антисмыслового транскрипта, что приводит к его нокдауну или разрушению. Кодирующие, а также некодирующие антисмысловые последовательности могут быть нацелены аналогичным образом и каждая из двух категорий способна регулировать соответствующие смысловые транскрипты конкордантным или дискордантным способом. Стратегии, которые применяют при идентификации новых олигонуклеотидов для применения против мишени, могут быть основаны на нокдауне антисмысловых РНК-транскриптов с помощью антисмысловых олигонуклеотидов или с помощью любых других способов модулирования заданной мишени.

Стратегия 1: В случае дискордантной регуляции, нокдаун антисмыслового транскрипта увеличивает экспрессию (смыслового) гена обычного типа. Если указанный второй ген кодирует известную или предполагаемую мишень лекарства, то нокдаун его антисмыслового аналога предположительно мог бы имитировать действие агониста рецептора или ферментного стимулятора.

Стратегия 2: В случае согласованной регуляции, может быть одновременно проведен нокдаун антисмыслового и смыслового транскрипта и, таким образом достигнуто синергичное уменьшение экспрессии (смыслового) гена обычного типа. Если, например, антисмысловой олигонуклеотид используют для достижения нокдауна, то указанная стратегия может быть использована для нанесения одного антисмыслового олигонуклеотида, направленного на смысловой транскрипт, и другого антисмыслового олигонуклеотида для соответствующего антисмыслового транскрипта, или одного совершенно симметричного антисмыслового олигонуклеотида, который воздействует, перекрывая одновременно смысловой и антисмысловой транскрипты.

Согласно настоящему изобретению антисмысловые соединения включают в себя антисмысловые олигонуклеотиды, рибозимы, олигонуклеотиды внешней вспомогательной последовательности (EGS), соединения siРНК, одно- или двухцепочечные соединения РНК интерференции (РНКi), такие как соединения siРНК, и другие олигомерные соединения, которые гибридизуются по меньшей мере с частью нуклеиновой кислоты-мишени и модулируют ее функцию. По существу, они могут представлять собой ДНК, РНК, ДНК-подобные, РНК-подобные соединения или их смеси, или могут являться миметиками одного или более из указанных соединений. Указанные соединения могут быть одноцепочечными, двухцепочечными, циклическими или шпилечными олигомерными соединениями и могут содержать структурные элементы, такие как внутренние или концевые утолщения, несоответствия или петли. Антисмысловые соединения получают обычным способом в линейной форме, но они могут быть соединены или получены иным образом в циклической и/или разветвленной форме. Антисмысловые соединения могут включать в себя конструкции такие как, например, две цепи, гибридизированные с образованием полностью или частично двухцепочечного соединения, или одна цепь с достаточной самокомплементарностью, что позволяет гибридизацию и образование полностью или частично двухцепочечного соединения. Две цепи могут быть соединены внутри, оставляя свободными 3'- или 5'-концы, или могут быть соединены с образованием непрерывной шпилечной структуры или петли. Шпилечная структура может содержать липкий конец на 5'- или 3'-конце, создавая удлинение одноцепочечного характера. Двухцепочечные соединения дополнительно могут включать в себя “липкие” концы. Другие модификации могут включать в себя содержащие сопряженные двойные связи группы, присоединенные к одному из концов, к нуклеотидам в выбранных положениях, к положениям в сахарной части или к одной из межнуклеозидных связей. Альтернативно две цепи могут быть соединены с помощью части, не являющейся нуклеиновой кислотой, или с помощью линкерной группы. Если соединение образовано только из одной цепи, dsРНК может принимать форму самокомплементарной молекулы шпилечного типа, которая складывается с образованием дуплекса. Таким образом, dsРНК могут быть полностью или частично двухцепочечными. Специфическая модуляция экспрессии гена может быть достигнута с помощью стабильной экспрессии шпилек dsРНК в трансгенных клеточных линиях, несмотря на то, что в некоторых вариантах осуществления изобретения экспрессия или функция гена активируется. Если соединение образовано из двух цепей, или из одной цепи, которая принимает форму самокомплементарной молекулы шпилечного типа, сложенной с образованием дуплекса, две цепи (или образующие дуплекс области одной цепи) являются комплементарными цепями РНК, которые формируют пары на основе уотсон-криковского взаимодействия.

После введения в систему соединения изобретения могут выявить действие одного или более ферментов или структурных белков, чтобы произвести расщепление, или другую модификацию нуклеиновой кислоты-мишени или могут действовать через механизмы захвата. В целом, нуклеиновые кислоты (включая олигонуклеотиды) могут быть описаны как "ДНК-подобные" (т.е. обычно содержащие один или более 2'-дезоксисахаров и, обычно, основания T, а не U) или "РНК-подобные" (т.е. обычно содержащие один или более 2'-гидроксил или 2'-модифицированные сахара и, обычно основания U, а не T). Спирали нуклеиновых кислот могут принимать более чем один тип структуры, чаще всего A- и B-формы. Считают, в целом, что олигонуклеотиды, которые обладают структурой B-формы, являются "ДНК-подобными" и олигонуклеотиды, которые обладают структурой A-формы, являются "РНК-подобными". В некоторых (химерных) вариантах осуществления антисмысловое соединение может содержать области, обладающие как A-формой, так и B-формой.

В другом предпочтительном варианте воплощения желаемые олигонуклеотиды или антисмысловые соединения включают в себя по меньшей мере одно из перечисленного ниже: антисмысловую РНК, антисмысловую ДНК, химерные антисмысловые олигонуклеотиды, антисмысловые олигонуклеотиды, содержащие модифицированные связи, интерферирующие РНК (РНКi), короткую интерферирующую РНК (siРНК); микроинтерферирующую РНК (miРНК); малую временную РНК (stРНК); или короткую шпилечную РНК (shРНК); малые РНК, индуцирующие активацию гена (small RNA-induced gene activation) (РНКa); малые активирующие РНК (saРНК), или их комбинации.

Также dsРНК может активировать экспрессию гена, механизм, который обозначен как "активация гена, индуцированная малой РНК" или РНКа. Направленное воздействие dsРНК на промоторы генов вызывает мощную транскрипционную активацию ассоциированных генов. РНКa была продемонстрирована в клетках человека с применением синтетических dsРНК, названных "малые активирующие РНК" (saРНК). В настоящее время неизвестно, сохраняется ли РНКa в других организмах.

Обнаружено, что малые двухцепочечные РНК (dsРНК), такие как малые интерферирующие РНК (siРНК) и микроРНК (miРНК), являются триггером эволюционно консервативного механизма, известного как РНК интерференция (РНКi). Неизменно РНКi вызывает “молчание генов” посредством реконструкции хроматина тем самым подавляет транскрипцию, вызывает деградацию комплементарной мРНК, или блокирование трансляции белка. Однако в вариантах, подробно описанных в разделе “Примеры”, который представлен далее, показаны олигонуклеотиды которые увеличивают экспрессию и/или функцию полинуклеотидов сиртуина 1 (SIRT1) и кодируемых ими продуктов. Также dsРНК могут действовать в качестве малых активирующих РНК (saРНК). Вне связи с какой-либо теорией, с помощью направленного воздействия на последовательности в промоторах гена, saРНК вызывают экспрессию гена-мишени в явлении, обозначаемом как dsРНК-индуцированная транскрипционная активация (РНКa).

В другом варианте осуществления "предпочтительные сегменты-мишени", указанные в описании, могут быть применены в скрининге дополнительных соединений, которые модулируют экспрессию полинуклеотидов сиртуина 1 (SIRT1). "Модуляторы" представляют собой соединения, которые уменьшают или увеличивают экспрессию молекул нуклеиновой кислоты, кодирующей сиртуин 1 (SIRT1), и которые включают в себя по меньшей мере 5-нуклеотидную часть, которая комплементарна предпочтительному сегменту-мишени. Метод скрининга включает в себя стадии контактирования предпочтительного сегмента-мишени молекулы нуклеиновой кислоты, кодирующей полинуклеотиды сиртуина 1 (SIRT1), с одним или более модуляторами-кандидатами, и отбор одного или более модуляторов-кандидатов, которые снижают или увеличивают экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды сиртуина 1 (SIRT1), например, SEQ ID NO:6-47. После того, как показано, что модулятор-кандидат или модуляторы-кандидаты способны к модулированию (например, к снижению или увеличению) экспрессии молекулы нуклеиновой кислоты, кодирующей полинуклеотиды сиртуина 1 (SIRT1), модулятор может быть применен в других поисковых исследованиях функции полинуклеотидов сиртуина 1 (SIRT1), или может быть использован в качестве исследовательского, диагностического или терапевтического агента в соответствии с настоящим изобретением.

Направленное воздействие на антисмысловую последовательность предпочтительно модулирует функцию гена-мишени. Например, ген SIRT1 (регистрационный номер NM_012238.3; база данных геномов UCSC). В предпочтительном варианте воплощения мишень представляет собой антисмысловой полинуклеотид гена сиртуина 1. В предпочтительном варианте воплощения антисмысловой олигонуклеотид воздействует на смысловые и/или природные антисмысловые последовательности полинуклеотидов сиртуина 1 (SIRT1) (например, регистрационный номер NM_012238.3 SEQ ID NO:1, фиг.10), вариантов, аллелей, изоформ, гомологов, мутантов, производных, фрагментов и на их комплементарные последовательности. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу и мишени включают в себя кодирующие и некодирующие области антисмысловых и/или смысловых полинуклеотидов SIRT1.

Предпочтительные сегменты-мишени настоящего изобретения также могут быть соединены с соответствующими им комплементарными антисмысловыми соединениями настоящего изобретения с образованием стабильных двухцепочечных (дуплицированных) олигонуклеотидов.

В данной области техники показано, что такие двухцепочечные олигонуклеотидные молекулы модулируют целевую экспрессию и регулируют трансляцию, а также процессинг РНК посредством антисмыслового механизма. Кроме того, двухцепочечные молекулы могут подвергаться химическим модификациям (Fire et al., (1998) Nature, 391, 806-811; Timmons and Fire, (1998) Nature, 395, 854; Timmons et al., (2001) Gene, 263, 103-112; Tabara et al., (1998) Science, 282, 430-431; Montgomery et al., (1998) Proc. Natl Acad. Sci. USA, 95, 15502-15507; Tuschl et al., (1999) Genes Dev., 13, 3191-3197; Elbashir et al., (2001) Nature, 411, 494-498; Elbashir et al., (2001) Genes Dev. 15, 188-200). Например, показано, что такие двухцепочечные молекулы ингибируют мишень с помощью классической гибридизации антисмысловой цепи дуплекса с мишенью, инициируя таким образом ферментативное расщепление мишени (Tijsterman et al., (2002) Science, 295, 694-697).

В предпочтительном варианте воплощения антисмысловой олигонуклеотид направленно воздействует на полинуклеотиды сиртуина 1 (SIRT1) (например, регистрационный номер NM_012238.3), варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты и их комплементарные последовательности. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу.

В соответствии с вариантами воплощения изобретения молекула нуклеиновой кислоты-мишени не ограничивается только сиртуином 1 (SIRT1), но распространяется на любые изоформы, рецепторы, гомологи и т.п. молекулы сиртуина 1 (SIRT1).

В другом предпочтительном варианте воплощения олигонуклеотид воздействует на природную антисмысловую последовательность полинуклеотидов SIRT1, например, полинуклеотиды, представленные в SEQ ID NO:2-5, и на любые варианты, аллели, гомологи, мутанты, производные, фрагменты и их комплементарные последовательности. Примеры антисмысловых олигонуклеотидов представлены в SEQ ID NO:6-47.

В одном варианте воплощения олигонуклеотиды являются комплементарными или связываются с последовательностями нуклеиновых кислот антисмысловых соединений сиртуина 1 (SIRT1), включая без ограничения некодирующие смысловые и/или антисмысловые последовательности, ассоциированные с полинуклеотидами сиртуина 1 (SIRT1), и модулируют экспрессию и/или функцию молекул сиртуина 1 (SIRT1).

В другом предпочтительном варианте воплощения олигонуклеотиды комплементарны или связываются с последовательностями нуклеиновых кислот природного антисмыслового соединения SIRT1, представленными в SEQ ID NO:2-5 и модулируют экспрессию и/или функцию молекул SIRT1.

В предпочтительном варианте воплощения олигонуклеотиды включают в себя последовательности по меньшей мере из 5 последовательных нуклеотидов из SEQ ID NO:6-47, и модулируют экспрессию и/или функцию молекул сиртуина 1 (SIRT1).

Полинуклеотидные мишени включают в себя SIRT1, включая членов его семейства, варианты SIRT1; мутанты SIRT1, включая SNP; некодирующие последовательности SIRT1; аллели SIRT1; видовые варианты, фрагменты и т.п. Предпочтительно Олигонуклеотид представляет собой антисмысловую молекулу.

В другом предпочтительном варианте воплощения олигонуклеотид, направленно воздействующий на полинуклеотиды сиртуина 1 (SIRT1), включает в себя: антисмысловую РНК, РНК-интерференцию (РНКi), короткую интерферирующую РНК (siРНК); микроинтерферирующую РНК (miРНК); малую временную РНК (stРНК); или короткую шпилечную РНК (shРНК); активацию генов, индуцированную малой РНК (РНКa); или малую активирующую РНК (saРНК).

В другом предпочтительном варианте воплощения, направленное воздействие на полинуклеотиды сиртуина 1 (SIRT1), например, SEQ ID NO:6-47 модулирует экспрессию или функцию указанных мишеней. В одном варианте воплощения экспрессия или функция активируется по сравнению с контролем. В другом предпочтительном варианте воплощения экспрессия или функция подавляется по сравнению с контролем.

В другом предпочтительном варианте воплощения антисмысловые соединения включают в себя последовательности, представленные в SEQ ID NO:6-47. Указанные олигонуклеотиды могут включать в себя один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п.

В другом предпочтительном варианте воплощения SEQ ID NO:6-47 включают в себя один или более нуклеотидов LNA.

Модуляция желаемой нуклеиновой кислоты-мишени может быть осуществлена несколькими способами, известными в данной области техники, например с помощью антисмысловых олигонуклеотидов, siРНК и т.д. Ферментативные молекулы нуклеиновых кислот (например, рибозимы) представляют собой молекулы нуклеиновых кислот, способные катализировать одну или более множества реакций, включая способность многократно расщеплять другие отдельные молекулы нуклеиновых кислот специфичным в отношении последовательности нуклеиновых оснований образом. Указанные ферментативные молекулы нуклеиновых кислот могут быть использованы, например, чтобы воздействовать по существу на любой транскрипт РНК (Zaug et al., 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; и Jefferies et al., 17 Nucleic Acids Research 1371, 1989).

Благодаря своей специфичности к последовательности, транс-расщепляющие ферментативные молекулы нуклеиновых кислот, являются перспективными в качестве терапевтических агентов для лечения заболевания человека (Usman & McSwiggen, (1995) Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, (1995) J. Med. Chem. 38, 2023-2037). Ферментативные молекулы нуклеиновых кислот могут быть разработаны для расщепления специфических РНК-мишеней в пределах фона клеточной РНК. Указанное событие расщепления делает мРНК нефункциональной и прекращает экспрессию белка из указанной РНК. Таким образом, может быть селективно ингибирован синтез белка, ассоциированного с болезненным состоянием.

В целом, ферментные нуклеиновые кислоты с РНК-расщепляющей активностью действуют путем первичного связывания с РНК-мишенью. Указанное связывание происходит с помощью мишень-связывающей части ферментной нуклеиновой кислоты, которая располагается в непосредственной близости от ферментной части молекулы, которая расщепляет РНК-мишени. Таким образом, ферментная нуклеиновая кислота сначала распознает и потом связывается с РНК-мишенью путем комплементарного спаривания оснований, и после связывания с соответствующим сайтом, действует ферментативно и разрезает РНК-мишень. Оперативное расщепление указанной РНК-мишени будет нарушать ее способность управлять синтезом кодируемого белка. После того, как ферментная нуклеиновая кислота срязалась и разрезала свою РНК-мишень, она высвобождается из РНК для поиска другой мишени, и может повторно связываться и расщеплять новые мишени.

Некоторые подходы, такие как стратегии отбора (эволюции) in vitro (Orgel, (1979) Proc. R. Soc. London, B 205, 435) применяли для выделения новых катализаторов из нуклеиновых кислот, способных катализировать ряд реакций, таких как расщепление и связывание фосфодиэфирных связей и амидных связей, (Joyce, (1989) Gene, 82, 83-87; Beaudry et al., (1992) Science 257, 635-641; Joyce, (1992) Scientific American 267, 90-97; Breaker et al., (1994) TIBTECH 12, 268; Bartel et al., (1993) Science 261 :1411-1418; Szostak, (1993) TIBS 17, 89-93; Kumar et al., (1995) FASEB J., 9, 1183; Breaker, (1996) Curr. Op. Biotech., 1, 442).

Создание рибозимов, которые обладают оптимальной каталитической активностью, существенно способствовало бы любой стратегии, в которой используются РНК-расщепляющие рибозимы с целью регулирования экспрессии генов. Рибозим типа “головка молотка” (hammerhead), например, работает с каталитической скоростью (kcat) приблизительно 1 мин-1 в присутствии насыщенных (10 мМ) концентраций кофактора Mg2+. Искусственный рибозим "РНК-лигаза", как было показано, катализирует соответствующую реакцию самомодификации со скоростью приблизительно 100 мин-1. Кроме того, известно, что определенные модифицированные рибозимы типа “головка молотка”, которые обладают субстрат-связывающими группами, выполненными из ДНК, катализируют расщепление РНК с множественными скоростями оборота, которые приближаются к 100 мин-1. Наконец, замещение специфического остатка в каталитическом ядре “головки молотка” определенными нуклеотидными аналогами дает модифицированные рибозимы, которые показывают 10-кратное увеличение скорости каталитической реакции. Приведенные данные показывают, что рибозимы могут активировать химические трансформации со скоростями каталитических реакций, которые значительно выше, чем скорости, демонстрируемые in vitro большинством природных саморасщепляющихся рибозимов. Кроме того, возможно, что структуры определенных саморасщепляющихся рибозимов могут быть оптимизированы с получением максимальной каталитической активности, или что могут быть созданы совершенно новые РНК-мотивы, которые демонстрируют значительно более высокую скорость расщепления фосфодиэфирных связей РНК.

Межмолекулярное расщепление субстрата РНК с помощью РНК-катализатора, который соответствует модели “головки молотка” впервые было показано в 1987 г. (Uhlenbeck, O. C. (1987) Nature, 328: 596-600). Катализатор РНК восстанавливался и реагировал со многими молекулами РНК, что показывало, что он является истинным катализатором.

Каталитические РНК, созданные на основе мотива “головка молотка”, применяли для расщепления специфических последовательностей-мишеней, производя замены соответствующих оснований в каталитической РНК для поддержания необходимого спаривания оснований с последовательностями-мишенями (Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, O. C. (1987) Nature, 328: 596-600; Koizumi, M., et al. (1988) FEBS Lett., 228: 228-230). Указанное выше позволяет применение каталитической РНК для расщепления специфических последовательностей-мишеней и показывает, что каталитические РНК, созданные в соответствии с моделью “головка молотка”, возможно, могут расщеплять специфические субстратные РНК in vivo, (смотрите Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, O. C. (1987) Nature, 328: 596-600).

РНК интерференция (РНКi) стала мощным инструментом модулирования экспрессии генов у млекопитающих и в клетках млекопитающих. Указанный подход требует доставки малых интерферирующих РНК (siРНК) либо в виде самой РНК, либо в виде ДНК, с применением экспрессионной плазмиды или вируса и кодирующей последовательности малых шпилечных РНК, которые процессируются в siРНК. Указанная система позволяет эффективный транспорт пре-siРНК в цитоплазму, где они активны и обеспечивает применение регулируемых и тканеспецифичных промоторов для экспрессии генов.

В предпочтительном варианте воплощения олигонуклеотид или антисмысловое соединение включают в себя олигомер или полимер рибонуклеиновой кислоты (РНК) и/или дезоксирибонуклеиновой кислоты (ДНК), или их миметик, химеру, аналог или гомолог. Указанный термин включает в себя олигонуклеотиды, состоящие из природных нуклеотидов, сахаров и ковалентных межнуклеозидных (каркасных) связей, а также олигонуклеотиды, содержащие искусственные части, которые функционируют аналогичным образом. Указанные модифицированные или замещенные олигонуклеотиды предпочтительны по сравнению с природными формами благодаря желаемым свойствам, таким как, например, повышенное клеточное поглощение, усиленная аффинность в отношении нуклеиновой кислоты-мишени и повышенная устойчивость в присутствии нуклеаз.

Согласно настоящему изобретению олигонуклеотиды или "антисмысловые соединения" включают в себя антисмысловые олигонуклеотиды (например, РНК, ДНК, их миметик, химера, аналог или гомолог), рибозимы, олигонуклеотиды внешней вспомогательной последовательности (EGS), соединения siРНК, одно- или двухцепочечные соединения РНК интерференции (РНКi), такие как соединения siРНК, saРНК, aРНК и другие олигомерные соединения, которые гибридизуются по меньшей мере с частью нуклеиновой кислоты-мишени и модулируют ее функцию. По существу, они могут представлять собой ДНК, РНК, ДНК-подобные, РНК-подобные соединения или их смеси, или могут являться миметиками одного или более из указанных соединений. Указанные соединения могут быть одноцепочечными, двухцепочечными, циклическими или шпилечными олигомерными соединениями и могут содержать структурные элементы, такие как внешние или концевые утолщения, несоответствия или петли. Антисмысловые соединения получают обычным способом в линейной форме, но они могут быть соединены или получены иным образом в циклической и/или разветвленной форме. Антисмысловые соединения могут включать в себя конструкции такие как, например, две цепи, гибридизированные с образованием полностью или частично двухцепочечного соединения, или одна цепь с достаточной самокомплементарностью, что позволяет гибридизацию и образование полностью или частично двухцепочечного соединения. Две цепи могут быть соединены внутри, оставляя свободными 3'- или 5'-концы, или могут быть соединены с образованием непрерывной шпилечной структуры или петли. Шпилечная структура может содержать липкий конец на 5'- или 3'-конце, создавая удлинение одноцепочечного характера. Двухцепочечные соединения дополнительно могут включать в себя “липкие” концы. Другие модификации могут включать в себя содержащие сопряженные двойные связи группы, присоединенные к одному из концов, к нуклеотидам в выбранных положениях, к положениям в сахарной части или к одной из межнуклеозидных связей. Альтернативно две цепи могут быть соединены с помощью части, не являющейся нуклеиновой кислотой, или линкерной группы. Если соединение образовано только из одной цепи, dsРНК может принимать форму самокомплементарной молекулы шпилечного типа, которая складывается с образованием дуплекса. Таким образом, dsРНК могут быть полностью или частично двухцепочечными. Специфическая модуляция экспрессии гена может быть достигнута с помощью стабильной экспрессии шпилек dsРНК в трансгенных клеточных линиях (Hammond et al., (1991) Nat. Rev. Genet., 2, 110-119; Matzke et al., (2001) Curr. Opin. Genet. Dev., 11, 221-227; Sharp, (2001) Genes Dev., 15, 485-490). Если соединение образовано из двух цепей, или из одной цепи, которая принимает форму самокомплементарной молекулы шпилечного типа, сложенной с образованием дуплекса, две цепи (или образующие дуплекс области одной цепи) являются комплементарными цепями РНК, которые формируют пары на основе уотсон-криковского взаимодействия.

После введения в систему соединения изобретения могут выявить действие одного или более ферментов или структурных белков, чтобы произвести или другую модификацию нуклеиновой кислоты-мишени или могут действовать через механизмы захвата. В целом, нуклеиновые кислоты (включая олигонуклеотиды) могут быть описаны как "ДНК-подобные" (т.е. обычно содержащие один или более 2'-дезоксисахаров и, обычно, основание T, а не U) или "РНК-подобные" (т.е. обычно содержащие один или более 2'-гидроксил или 2'-модифицированные сахара и, обычно основания U, а не T). Спирали нуклеиновых кислот могут принимать более чем один тип структуры, чаще всего A- и B-формы. Считают, в целом, что олигонуклеотиды, которые обладают структурой B-формы, являются "ДНК-подобными" и олигонуклеотиды, которые обладают структурой A-формы, являются "РНК-подобными". В некоторых (химерных) вариантах осуществления антисмысловое соединение может содержать области A- и B-формы.

Антисмысловые соединения согласно настоящему изобретению могут включать в себя антисмысловую часть длиной от приблизительно 5 до приблизительно 80 нуклеотидов (а именно от приблизительно 5 до приблизительно 80 связанных нуклеозидов). Указанное выше относится к длине антисмысловой цепи или части антисмыслового соединения. Другими словами, одноцепочечное антисмысловое соединение изобретения включает в себя от приблизительно 5 до приблизительно 80 нуклеотидов, и двухцепочечное антисмысловое соединение изобретения (такое как dsРНК, например) включает в себя антисмысловую цепь или часть длиной от приблизительно 5 до приблизительно 80 нуклеотидов. Специалисту в данной области техники должно быть понятно, что указанное выше охватывает антисмысловые части длиной 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 нуклеотидов, или любой длины в указанных границах.

В одном варианте воплощения антисмысловые соединения изобретения содержат антисмысловые части длиной от 10 до 50 нуклеотидов. Специалисту в данной области техники должно быть понятно, что указанное выше включает в себя олигонуклеотиды, содержащие антисмысловые части длиной 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов, или любой длины в указанных границах. В некоторых вариантах осуществления изобретения олигонуклеотиды имеют в длину 15 нуклеотидов.

В одном варианте воплощения антисмысловые или олигонуклеотидные соединения изобретения содержат антисмысловые части длиной от 12 или 13 до 30 нуклеотидов. Специалисту в данной области техники должно быть понятно, что указанное выше включает в себя антисмысловые соединения, содержащие антисмысловые части длиной 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или любой длины в указанных границах.

В предпочтительном варианте воплощения введение по меньшей мере одного олигонуклеотида, направленно воздействующего на один или более полинуклеотидов сиртуина 1 (SIRT1), предотвращает или оказывает лечебное воздействие на заболевания, ассоциированные с нарушенной экспрессией или функцией полинуклеотидов сиртуина 1 (SIRT1) и кодируемых ими продуктов, или на другие связанные заболевания. Примеры заболеваний, которые можно лечить с помощью антисмысловых олигонуклеотидов, включают в себя: рак (например, рак молочной железы, колоректальный рак, CCL, CML, рак предстательной железы), нейродегенеративные заболевания (например, болезнь Альцгеймера (AD), болезнь Хантингтона ALS, болезнь Паркинсона, амиотрофический латеральный склероз, рассеянный склероз и нарушения, вызванные агрегацией полиглутамина); заболевание скелетной мускулатуры (например, мышечная дистрофия Дюшенна, атрофия скелетной мускулатуры, дистрофия Беккера или миотоническая дистрофия); метаболические заболевания (например, резистентность к инсулину, диабет, ожирение, нарушенная толерантность к глюкозе, повышенное содержание холестерина в крови, гипергликемия, дислипидемия и гиперлипемия); диабет зрелого возраста, диабетическую нефропатию, невропатию (например, сенсорная невропатия, вегетативная невропатия, двигательная невропатия, ретинопатия); заболевание костей (например, остеопороз), заболевание крови (например, лейкемия); заболевание печени (например, вследствие злоупотребления алкоголем или гепатита); ожирение; резорбцию кости, возрастную макулярную дистрофию, СПИД-ассоциированное слабоумие, ALS, паралич Белла, атеросклероз, заболевания сердца (например, сердечные аритмии, хроническая сердечная недостаточность с застойными явлениями, ишемический инсульт, коронарно-артериальное заболевание и кардиомиопатия), хроническое дегенеративное заболевание (например, заболевание сердечной мышцы), хроническую почечную недостаточность, диабет 2-го типа, язву, катаракту, пресбиопиию, гломерулонефрит, Синдром Гийена-Барре, геморрагический инсульт, ревматоидный артрит, воспалительное заболевание кишечника, SLE, болезнь Крона, остеоартрит, остеопороз, хроническое обструктивное заболевание легких (COPD), пневмонию, старение кожи и недержание мочи при напряжении. Другие примеры включают в себя заболевания и нарушения, ассоциированные с гибелью нервных клеток, старением или другим состоянием, характеризующимся нежелательной потерей клеток.

В другом предпочтительном варианте воплощения олигомерные соединения настоящего изобретения также включают в себя варианты, в которых разные основания представлены в одном или более нуклеотидных положений соединения. Например, если первый нуклеотид является аденозином, могут быть получены варианты, которые содержат тимидин, гуанозин или цитидин в указанном положении. Указанная процедура может быть выполнена для любого положения антисмыслового или dsРНК соединения. Указанные соединения затем тестируют с применением методов, описанных в настоящем документе для определения их способности ингибировать экспрессию нуклеиновой кислоты-мишени.

В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность антисмыслового соединения и мишени составляет от приблизительно 40% до приблизительно 60%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляет от приблизительно 60% до приблизительно 70%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляет от приблизительно 70% до приблизительно 80%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляет от приблизительно 80% до приблизительно 90%. В некоторых вариантах осуществления изобретения гомология, идентичность последовательности или комплементарность составляет приблизительно 90%, приблизительно 92%, приблизительно 94%, приблизительно 95%, приблизительно 96%, приблизительно 97%, приблизительно 98%, приблизительно 99% или приблизительно 100%.

В другом предпочтительном варианте воплощения антисмысловые олигонуклеотиды, такие как, например, молекулы нуклеиновой кислоты, представленные в SEQ ID NO:6-47, включают в себя одну или более замены или модификации. В одном варианте воплощения нуклеотиды замещают закрытыми нуклеиновыми кислотами (LNA).

В другом предпочтительном варианте воплощения олигонуклеотиды воздействуют на одну или более области молекул нуклеиновой кислоты, смысловые и/или антисмысловые, кодирующих и/или некодирующих последовательностей, ассоциированных с SIRT1, и последовательностей, представленных в SEQ ID NO:1-5. Также олигонуклеотиды направлены на перекрывающиеся области SEQ ID NO:1-5.

Определенные предпочтительные олигонуклеотиды настоящего изобретения представляют собой химерные олигонуклеотиды. "Химерные олигонуклеотиды" или "химеры" в контексте настоящего изобретения представляют собой олигонуклеотиды, которые содержат две или более отличающиеся химически области, каждая из которых состоит по меньшей мере из одного нуклеотида. Указанные олигонуклеотиды обычно содержат по меньшей мере одну область модифицированных нуклеотидов, которая придает одно или более полезные свойства (такие как, например, повышенная нуклеазная устойчивость, повышенный захват клетками, увеличенная аффинность связывания с мишенью) и область, которая является субстратом для ферментов, способных расщеплять гибриды РНК:ДНК или РНК:РНК. В качестве примера, РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет цепь РНК дуплекса РНК:ДНК. Активация РНКазы H, следовательно, приводит к расщеплению РНК-мишени, тем самым значительно увеличивая эффективность антисмысловой модуляции экспрессии гена. Поэтому сравнимые результаты часто могут быть получены с более короткими олигонуклеотидами, когда используют химерные олигонуклеотиды, по сравнению с фосфоротиоатными дезоксиолигонуклеотидами, гибридизующимися с той же самой областью-мишенью. Расщепление РНК-мишени может быть обнаружено обычным способом с помощью гель-электофореза и, в случае необходимости, с помощью ассоциированных методов гибридизации нуклеиновой кислоты, известных в данной области техники. В одном предпочтительном варианте осуществления химерный олигонуклеотид включает в себя по меньшей мере одну область, модифицированную для увеличения аффинности связывания с мишенью, и, обычно, область, которая играет роль субстрата для РНКазы H. Аффинность олигонуклеотида в отношении его мишени (в данном случае нуклеиновая кислота, кодирующая ras) определяют обычным способом с помощью измерения Tm пары олигонуклеотид/мишень, которая представляет собой температуру, при которой олигонуклеотид и мишень диссоциируют; диссоциацию определяют спектрофотометрически. Чем выше Tm, тем больше олигонуклеотида в отношении мишени.

Химерные антисмысловые соединения изобретения могут быть выполнены в виде комбинированных структур из двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеотидов и/или олигонуклеотидных миметиков, как описано выше. Указанные соединения также обозначают в данной области техники как гибриды или гапмеры. Соответствующие патенты США в которых описано получение указанных гибридных структур, включают в себя, но не ограничиваются, патентами США №№ 5013830, 5149797, 5220007, 5256775, 5366878, 5403711, 5491133, 5565350, 5623065, 5652355, 5652356 и 5700922, каждый из которых включен в описание посредством ссылки.

В другом предпочтительном варианте осуществления область олигонуклеотида, которую модифицируют, включает в себя по меньшей мере один нуклеотид, модифицированный в 2'-положении сахара, наиболее предпочтителен 2'-O-алкил, 2'-O-алкил-O-алкил или 2'-фтор-модифицированный нуклеотид. В других предпочтительных вариантах осуществления модификации РНК включают в себя 2'-фтор, 2'-амино и 2'O-метил модификации рибозы пиримидинов, остатки с удаленными азотистыми основаниями или инвертированное основание на 3'-конце РНК. Указанные модификации обычным способом включают в олигонуклеотиды, и указанные олигонуклеотиды, как показано, обладают более высокой Tm (т.е. более высокой аффинностью связывания с мишенью), чем 2'-дезоксиолигонуклеотиды против данной мишени. Эффект такой повышенной аффинности приводит к значительному усилению РНКi олигонуклеотидного ингибирования экспрессии гена. РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет РНК-цепь дуплексов РНК:ДНК; активация указанного фермента, следовательно, приводит к расщеплению РНК-мишени, и таким образом может значительно увеличить эффективность РНКi-ингибирования. Расщепление РНК-мишени может быть показано обычным способом с помощью гель-электрофореза. В другом предпочтительном варианте воплощения химерный олигонуклеотид также модифицируют для увеличения устойчивости к нуклеазе. Клетки содержат ряд экзо- и эндонуклеаз, которые могут разрушать нуклеиновые кислоты. Показано, что ряд нуклеотидных и нуклеозидных модификаций делает олигонуклеотид, в который они включены, более устойчивым к нуклеазному расщеплению, чем нативный олигодезоксинуклеотид. Нуклеазную устойчивость измеряют обычным способом путем инкубирования олигонуклеотидов с клеточными экстрактами или растворами изолированных нуклеаз и измерения протяженности интактного олигонуклеотида, остающегося с течением времени, обычно с помощью гель-электрофореза. Олигонуклеотиды которые были модифицированы с увеличением их нуклеазной устойчивости, сохраняются интактными в течение более длительного времени, чем немодифицированные олигонуклеотиды. Продемонстрирован ряд олигонуклеотидных модификаций для усиления или придания свойства устойчивости к нуклеазе. Олигонуклеотиды, которые содержат по меньшей мере одну фосфоротиоатную модификацию, являются в настоящее время более предпочтительными. В некоторых случаях олигонуклеотидные модификации которые увеличивают аффинность связывания с мишенью, также способны независимо увеличить устойчивость к нуклеазе. Некоторые полезные модификации можно найти в De Mesmaeker et al. (1995) Ace. Chem. Res., 28:366-374.

Конкретные примеры некоторых предпочтительных олигонуклеотидов, предусмотренных для данного изобретения, включают в себя олигонуклеотиды, содержащие модифицированные основные цепи, например, фосфоротиоаты, триэфиры фосфорной кислоты, метилфосфонаты, короткоцепочечные алкильные или циклоалкильные межсахарные связи или короткоцепочечные гетероатомные или гетероциклические межсахарные связи. Наиболее предпочтительными являются олигонуклеотиды с фосфоротиоатными основными цепями или основными цепями с гетероатомом и, в частности, с CH2-NH-O-CH2, СН,-N(СН3)-O-СН2 (известные как метилен(метилимино) или MMI основные цепи), СН2-O-N(СН3)-СН2, СН2-N(СН3)-N(СН3)-СН2 и О-N(СН3)-СН2-СН2 (где природная фосфодиэфирная основная цепь представлена в виде O-Р-O-СН). Амидные основные цепи, раскрытые De Mesmaeker et al. (1995) Ace. Chem. Res. 28:366-374 также являются предпочтительными. Также предпочтительными являются олигонуклеотиды, содержащие морфолиновые структуры в основной цепи (Summerton and Weller, Патент США № 5034506). В других предпочтительных вариантах осуществления таких как пептидная нуклеиновая кислота (PNA), фосфодиэфирная основная цепь олигонуклеотида заменена полиамидной основной цепью, нуклеотиды связываются непосредственно или косвенно с аза-атомами азота полиамидной части основной цепи (Nielsen et al. (1991) Science 254, 1497). Олигонуклеотиды также могут включать в себя одну или более замещенных сахарных группировок. Предпочтительные олигонуклеотиды включают в себя одну из следующих групп в положении 2': OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O(CH2)nCH3, O(CH2)nNH2 или O(CH2)nCH3, где n составляет от 1 до приблизительно 10; C1-C10 низший алкил, алкоксиалкокси, замещенный низший алкил, алкарил или аралкил; Cl; Br; CN; CF3; OCF3; O-, S- или N-алкил; O~, S-, или N-алкенил; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; гетероциклоалкил; гетероциклоалкарил; аминоалкиламино; полиалкиламино; замещенный силил; РНК-расщепляющая группа; репортерная группа; интеркалятор; а группа для улучшения фармакокинетических свойств олигонуклеотида; или группа для улучшения фармакодинамических свойств олигонуклеотида и другие заместители, обладающие сходными свойствами. Предпочтительная модификация включает в себя 2'-метоксиэтокси [2'-O-CH2CH2OCH3, также известный как 2'-O-(2-метоксиэтил)] (Martin et al., (1995) Helv. Chim. Acta, 78, 486). Другие предпочтительные модификации включают в себя 2'-метокси (2'-O-CH3), 2'-пропокси (2'-OCH2CH2CH3) и 2'-фтор (2'-F). Сходные модификации также могут быть произведены в других положениях олигонуклеотида, в особенности в 3'-положении сахара на 3'-концевом нуклеотиде и в 5'-положении 5'-концевого нуклеотида. Олигонуклеотиды также могут содержать миметики сахаров, такие как циклобутильные группировки, вместо пентофуранозильной группы.

Олигонуклеотиды также могут включать в себя дополнительно или альтернативно, модификации или замены нуклеотидных оснований (часто называемых просто "основания"). Применяемые в описании, "немодифицированные" или "природные" нуклеотиды включают в себя аденин (A), гуанин (G), тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеотиды включают в себя нуклеотиды, обнаруживаемые только в редких случаях или временно в природных нуклеиновых кислотах, например гипоксантин, 6-метиладенин, 5-Me пиримидины, особенно 5-метилцитозин (часто обозначаемый как 5-метил-2'-дезоксицитозин и часто обозначаемый в данной области техники как 5-Me-C), 5-гидроксиметилцитозин (HMC), гликозил HMC и гентобиозил HMC, а также синтетические нуклеотиды, например, 2-аминоаденин, 2-(метиламино)аденин, 2-(имидазолилалкил)аденин, 2-(аминоалкиламино)аденин или другие гетерозамещенные алкиладенины, 2-тиоурацил, 2-тиотимин, 5-бромурацил, 5-гидроксиметилурацил, 8-азагуанин, 7-деазагуанин, N6 (6-аминогексил)аденин и 2,6-диаминопурин (Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., (1987) et al. Nucl. Acids Res. 15:4513). Может быть включено "универсальное" основание, известное в данной области техники, например инозин. Показано, что 5-Me-C замены увеличивают стабильность двойной спирали нуклеиновой кислоты на 0,6-1,2ºC (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) и в настоящее время они являются предпочтительными заменами оснований.

Другая модификация олигонуклеотидов по изобретению включает химическое связывание с олигонуклеотидом одной или более чем одной группировки или конъюгата, которые увеличивают активность, или поглощение клеткой олигонуклеотида. Такие группировки включают в себя без ограничения липидные группировки, такие как холестериновая группировка, холестерильная группировка (Letsinger et al., (1989) Proc. Natl. Acad. Sci. USA 86, 6553), холевая кислота (Manoharan et al. (1994) Bioorg. Med. Chem. Let. 4, 1053), тиоэфир, например гексил-S-тритилтиол (Manoharan et al. (1992) Ann. NY. Acad. Sci. 660, 306; Manoharan et al. (1993) Bioorg. Med. Chem. Let. 3, 2765), тиохолестерин (Oberhauser et al., (1992) Nucl. Acids Res. 20, 533), алифатическую цепь, например, додекандиольные или ундецильные остатки (Saison-Behmoaras et al. EMBO J. 1991, 10, 111; Kabanov et al. (1990) FEBS Lett. 259, 327; Svinarchuk et al. (1993) Biochimie 75, 49), фосфолипид, такой как дигексадецил-рац-глицерин или триэтиламмоний-1,2-ди-О-гексадецил-рац-глицеро-3Н-фосфонат (Manoharan et al. (1995) Tetrahedron Lett. 36, 3651; Shea et al. (1990) Nucl. Acids Res. 18, 3777), полиамин или полиэтиленгликолевую цепь (Manoharan et al. (1995) Nucleosides & Nucleotides, 14, 969) или адамантинуксусную кислоту (Manoharan et al. (1995) Tetrahedron Lett. 36, 3651). Олигонуклеотиды, содержащие липофильные группировки, и способы получения таких олигонуклеотидов известны в данной области техники, например патенты США №№ 5138045, 5218105 и 5459255.

Указанный олигонуклеотид необязательно модифицирован одинаково во всех положениях, и по существу более чем одна из упомянутых выше модификаций может быть включена в один олигонуклеотид или даже в один нуклеотид внутри олигонуклеотида. Настоящее изобретение также включает в себя олигонуклеотиды, которые являются химерными олигонуклеотидами, которые охарактеризованы в данном документе выше.

В другом варианте осуществления молекула нуклеиновой кислоты настоящего изобретения конъюгирована с другой молекулой, включая без ограничения нуклеотиды, лишенные азотистого основания, полиэфир, полиамин, полиамиды, пептиды, углеводы, липид или полиуглеводные соединения. Специалисту в данной области техники будет понятно, что указанные молекулы могут быть связаны с одним или более любых нуклеотидов, включая молекулу нуклеиновой кислоты в нескольких положениях в группе сахара, основания или в фосфатной группе.

Олигонуклеотиды, применяемые по настоящему изобретению, могут быть легко получены обычным путем с помощью хорошо известного метода твердофазного синтеза. Оборудование для такого синтеза продается несколькими производителями, включая Applied Biosystems. Также могут быть использованы любые другие средства для указанного синтеза; фактический синтез олигонуклеотидов входит в объем знаний специалиста в данной области техники. Он хорошо известен для применения сходных методов получения других олигонуклеотидов, таких как фосфоротиоатные и алкилированные производные. Он также хорошо известен для применения сходных методов и коммерчески доступных модифицированных амидитов и продуктов, полученных с применением стекла с контролируемыми порами (CPG), таких как биотин, флюоресцеин, акридин или псорален-модифицированные амидиты и/или CPG (доступный в Glen Research, Sterling VA) для синтеза флюоресцентно меченных, биотинилированных или других модифицированных олигонуклеотидов, таких как холестерин-модифицированные олигонуклеотиды.

Согласно изобретению применение модификаций, например, применение LNA-мономеров повышает эффективность, специфичность и продолжительность действия и расширяет пути введения олигонуклеотидов, содержащих общепринятые химические составляющие, такие как MOE, ANA, FANA, PS и т.д. (ссылка: Recent advances in the medical chemistry of antisense oligonucleotide by Uhlman, (2000) Current Opinions in Drug Discovery & Development Vol 3 No 2). Применение модификаций может быть осуществлено с помощью замены некоторых мономеров в обычных олигонуклеотидах LNA-мономерами. LNA-модифицированный олигонуклеотид может иметь размер, сходный с родительским соединением, или может быть больше, или предпочтительно меньше. Предпочтительно, LNA-модифицированные олигонуклеотиды содержат меньше, чем приблизительно 70%, более предпочтительно меньше чем приблизительно 60%, наиболее предпочтительно меньше чем приблизительно 50% LNA-мономеров, и их размеры составляют от приблизительно 5 до 25 нуклеотидов, более предпочтительно от приблизительно 12 до 20 нуклеотидов.

Предпочтительные модифицированные олигонуклеотидные основные цепи включают в себя, но без ограничения фосфоротиоаты, хиральные фосфоротиоаты, фосфородитиоаты, фосфотриэфиры, аминоалкилфосфотриэфиры, метил- и другие алкильные фосфонаты, включая 3'-алкиленфосфонаты и хиральные фосфонаты, фосфинаты, фосфорамидаты, включая 3'-аминофосфорамидаты и аминоалкилфосфорамидаты, тионофосфорамидаты, тионоалкилфосфонаты, тионоалкилфосфотриэфиры и боранфосфаты, имеющие нормальные 3'-5' связи, их 2'-5'-связанные аналоги и те, которые имеют противоположную ориентацию, где смежные пары нуклеотидных единиц связаны 3'-5' к 5'-3' или 2'-5' к 5'-2'. Также включены их различные соли, смешанные соли и свободные кислотные формы.

Соответствующие патенты США, в которых описано получение упомянутых выше фосфорсодержащих связей, включают в себя, но не ограничиваются патентами США №№ 3687808, 4469863, 4476301, 5023243, 5177196, 5188897, 5264423, 5276019, 5278302, 5286717, 5321131, 5399676, 5405939, 5453496, 5455233, 5466677, 5476925, 5519126, 5536821, 5541306, 5550111, 5563253, 5571799, 5587361 и 5625050, каждый из которых включен в описание посредством ссылки.

Предпочтительные модифицированные олигонуклеотидные основные цепи, которые не включают атом фосфора, здесь имеют основные цепи, которые образованы короткоцепочечными алкильными или циклоалкильными межнуклеозидными связями, смешанными межнуклеозидными связями гетероатома и алкила или циклоалкила или одной или более короткоцепочечными гетероатомными или гетероциклическими межнуклеозидными связями. Они включают те, которые имеют морфолино связи (образованные частично из сахарной части нуклеозида); силоксановые основные цепи; сульфидные, сульфоксидные и сульфоновые основные цепи; формацетильные и тиоформацетильные основные цепи; метиленформацетильные и тиоформацетильные основные цепи; алкенсодержащие основные цепи, сульфаматные основные цепи; метиленимино и метиленгидразино основные цепи; сульфонатные и сульфонамидные основные цепи; амидные основные цепи; и другие основные цепи, имеющие смешанные N, О, S и СН2 компонентные части.

Соответствующие патенты США, в которых описано получение упомянутых выше олигонуклеотидов, включают в себя, но не ограничиваются патентами США №№ 5034506, 5166315, 5185444, 5214134, 5216141, 5235033, 5264562, 5264564, 5405938, 5434257, 5466677, 5470967, 5489677, 5541307, 5561225, 5596086, 5602240, 5610289, 5602240, 5608046, 5610289, 5618704, 5623070, 5663312, 5633360, 5677437 и 5677439, каждый из которых включен в описание посредством ссылки.

В других предпочтительных олигонуклеотидных миметиках сахарную связь и межнуклеозидную связь, т.е. основную цепь нуклеотидных единиц, заменяют новыми группами. Структурные единицы оснований сохраняются для гибридизации с соответствующей мишенью, соединением из нуклеиновых кислот. Одно такое олигомерное соединение, олигонуклеотидный миметик, представляет собой олигонуклеотидный миметик, который, как было показано, имеет превосходные гибридизационные свойства, относят к пептидной нуклеиновой кислоте (PNA). В соединениях PNA сахарная основная цепь олигонуклеотида заменена амид-содержащей основной цепью, в частности аминоэтилглициновой основной цепью. Нуклеотидные основания сохранены и связаны непосредственно или косвенно с аза-атомами азота амидной части основной цепи. Соответствующие патенты США, в которых описано получение соединений PNA, включают в себя, но не ограничиваются патентами США №№ 5539082, 5714331 и 5719262, каждый из которых включен в описание посредством ссылки. Другие сведения о соединении PNA можно найти в Nielsen et al., Science, 1991, 254, 1497-1500.

В другом предпочтительном варианте воплощения изобретения олигонуклеотиды с фосфоротиоатными основными цепями и олигонуклеотиды с гетероатомными основными цепями, и в частности, -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2-, известной как метилен(метилимино) или MMI основная цепь, -CH2-O-N(CH3)-CH2-, -CH2N(CH3)-N(CH3)CH2- и -O-N(CH3)-CH2-CH2-, где нативная фосфодиэфирная основная цепь представлена в виде -O-P-O-CH2- упомянутого выше патента США № 5489677, и амидных основных цепей упомянутого выше патента США № 5602240. Также предпочтительными являются олигонуклеотиды, содержащие в основной цепи морфолиновые структуры упомянутого выше патента США № 5034506.

Модифицированные олигонуклеотиды также могут содержать одну или более замещенных сахарных группировок. Предпочтительные олигонуклеотиды включают в себя один из следующих заместителей в положении 2': OH; F; O-, S- или N-алкил; O-, S- или N-алкенил; O-, S- или N-алкинил; или O-алкил-O-алкил, где алкил, алкенил и алкинил могут быть замещены или незамещены с C по CO алкил или с C2 по CO алкенил и алкинил. Особенно предпочтительными являются O(CH2)nOmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 и O((CH2)nON(CH2)nCH3)2, где n и m могут составлять от 1 до приблизительно 10. Другие предпочтительные олигонуклеотиды включают в себя один из следующих заместителей в положении 2': от C до CO, (низший алкил, замещенный низший алкил, алкарил, аралкил, O-алкарил или O-аралкил, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино, полиалкиламино, замещенный силил, РНК-расщепляющая группа, репортерная группа, интеркалятор, группа, улучшающая фармакокинетические свойства олигонуклеотида или группа, улучшающая фармакодинамические свойства олигонуклеотида, и другие заместители, обладающие сходными свойствами. Предпочтительная модификация включает в себя группу 2'-метоксиэтокси (2'-O-CH2CH2OCH3, также известную как 2'-O-(2-метоксиэтил) или 2'-MOE) (Martin et al., (1995) Helv. CHm. Acta, 78, 486-504), т.е. алкоксиалкокси группу. Другая предпочтительная модификация включает в себя 2'-диметиламинооксиэтокси, т.е. группу O(CH2)2ON(CH3)2, также известную как 2'-DMAOE, как описано в примерах ниже, и 2'-диметиламиноэтоксиэтокси (также известную в данной области техники как 2'-O-диметиламиноэтоксиэтил или 2'-DMAEOE), т.е. 2'-O-CH2-O-CH2-N(CH2)2.

Другие предпочтительные модификации включают в себя 2'-метокси (2'-ОCH3), 2'-аминопропокси (2'-ОCH2CH2CH2NH2) и 2'-фтор (2'-F). Сходные модификации также могут быть осуществлены в других положениях олигонуклеотида, в частности в положении 3'-сахара 3'-концевого нуклеотида или в 2'-5' связанных олигонуклеотидов и в положении 5' 5'-концевого нуклеотида. Олигонуклеотиды также могут содержать миметики сахаров, такие как циклобутильные группировки вместо пентофуранозильного сахара. Соответствующие патенты США, в которых описано получение указанных модифицированных сахарных структур, включают в себя, но не ограничиваются патентами США №№ 4981957, 5118800, 5319080, 5359044, 5393878, 5446137, 5466786, 5514785, 5519134, 5567811, 5576427, 5591722, 5597909, 5610300, 5627053, 5639873, 5646265, 5658873, 5670633 и 5700920, каждый из которых включен в описание посредством ссылки.

Олигонуклеотиды также могут включать в себя модификации или замены нуклеиновых оснований (часто обозначаемых в данной области техники просто как "основание"). Применяемые в описании "немодифицированные" или "природные" нуклеотиды включают в себя пуриновые основания аденин (A) и гуанин (G), и пиримидиновые основания тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеотиды включают в себя другие синтетические и природные нуклеотиды, такие как 5-метилцитозин (5-me-C), 5-гидроксиметил цитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метил и другие алкильные производные аденина и гуанина, 2-пропил и другие алкильные производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галогенурацил и цитозин, 5-пропинилурацил и цитозин, 6-азоурацил, цитозин и тимин, 5-урацил (псевдо-урацил), 4-тиоурацил, 8-галоген, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные аденины и гуанины, 5-галоген, в особенности 5-бром, 5-трифторметил и другие 5-замещенные урацилы и цитозины, 7-метилгуанин и 7-метиладенин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин и 3-деазагуанин и 3-деазааденин.

Далее нуклеотиды включают в себя нуклеотиды, раскрытые в патенте США № 3687808, нуклеотиды, раскрытые в “The Concise Encyclopedia of Polymer Science And Engineering”, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, нуклеотиды, раскрытые Englisch et al., “Angewandle Chemie, International Edition”, 1991, 30, page 613, и нуклеотиды, раскрытые Sanghvi, Y. S., Chapter 15, Antisense Research and Applications', pages 289-302, Crooke, S. T. and Lebleu, B. ea., CRC Press, 1993. Некоторые из указанных нуклеотидов являются особенно полезными для увеличения аффинности связывания олигомерных соединений изобретения. Они включают в себя 5-замещенные пиримидины, 6-азапиримидины и N-2, N-6 и 0-6 замещенные пурины, содержащие 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин. Показано, что замещения 5-метилцитозина увеличивают стабильность двухцепочечной нуклеиновой кислоты на 0,6-1,2ºC (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) и являются в настоящее время предпочтительными заменами оснований, особенно, если они скомбинированы с 2'-O-метоксиэтил модификациями сахара.

Соответствующие патенты США, в которых описано получение упомянутых выше модифицированных нуклеотидов, а также других модифицированных нуклеотидов, включают в себя, но не ограничиваются, патентами США № 3687808, а также 4845205, 5130302, 5134066, 5175273, 5367066, 5432272, 5457187, 5459255, 5484908, 5502177, 5525711, 5552540, 5587469, 5596091, 5614617, 5750692 и 5681941, каждый из которых включен в описание посредством ссылки.

Другая модификация олигонуклеотидов изобретения включает в себя химическое связывание с олигонуклеотидом одной или более чем одной группировки или конъюгата, которые увеличивают активность, распределение в клетке или поглощение клеткой олигонуклеотида.

Указанные группировки включают в себя без ограничения липидные группировки, такие как холестериновая группировка (Letsinger et al., Proc. Natl. Acad. ScL USA, 1989, 86, 6553-6556), холевая кислота (Manoharan et al., (1994) Bioorg. Med. Chem. Let., 4, 1053-1060), тиоэфир, например, гексил-S-тритилтиол (Manoharan et al., (1992) Ann. N. Y. Acad. ScL, 660, 306-309; Manoharan et al., (1993) Bioorg. Med. Chem. Let., 3, 2765-2770), тиохолестерин (Oberhauser et al., (1992) Nucl Acids Res., 20, 533-538), алифатическую цепь, например, додекандиольные или ундецильные остатки (Kabanov et al., (1990) FEBS Lett., 259, 327-330; Svinarchuk et al., (1993) Biochimie 75, 49-54), фосфолипид, такой как дигексадецил-рац-глицерин или триэтиламмоний-1,2-ди-О-гексадецил-рац-глицеро-3Н-фосфонат (Manoharan et al., (1995) Tetrahedron Lett., 36, 3651-3654; Shea et al., (1990) Nucl. Acids Res., 18, 3777-3783), полиамин или полиэтиленгликолевую цепь (Mancharan et al., (1995) Nucleosides & Nucleotides, 14, 969-973) или адамантинуксусную кислоту, (Manoharan et al., (1995) Tetrahedron Lett., 36, 3651-3654), a пальмитильную группировку (Mishra et al., (1995) Biochim. Biophys. Acta, 1264, 229-237) или октадециламинную, или гексиламинокарбонил-трет-оксихолестериновую группировку (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277, 923-937).

Соответствующие патенты США, в которых описано получение указанных олигонуклеотидных конъюгатов, включают в себя, но не ограничиваются патентами США №№ 4828979, 4948882, 5218105, 5525465, 5541313, 5545730, 5552538, 5578717, 5580731, 5580731, 5591584, 5109124, 5118802, 5138045, 5414077, 5486603, 5512439, 5578718, 5608046, 4587044, 4605735, 4667025, 4762779, 4789737, 4824941, 4835263, 4876335, 4904582, 4958013, 5082830, 5112963, 5214136, 5082830, 5112963, 5214136, 5245022, 5254469, 5258506, 5262536, 5272250, 5292,73, 5317098, 5371241, 5391723, 5416203, 5451463, 5510475, 5512667, 5514785, 5565552, 5567810, 5574142, 5585481, 5587371, 559726, 5597696, 5599923, 5599928 и 5688941, каждый из которых включен в описание посредством ссылки.

Поиск новых лекарств

Соединения настоящего изобретения могут быть применены в области поиска новых лекарств и валидации мишени. Настоящее изобретение предусматривает применение соединений и предпочтительных сегментов-мишеней, идентифицированных здесь, в исследованиях по поиску новых лекарственных средств для выяснения зависимостей, существующих между полинуклеотидами сиртуина 1 (SIRT1) и болезненным состоянием, фенотипом, или состоянием. Указанные методы включают в себя обнаружение или модулирование полинуклеотидов сиртуина 1 (SIRT1), включая контактирование образца, ткани, клетки или организма с соединениями настоящего изобретения, измерение уровня нуклеиновой кислоты или белка полинуклеотидов сиртуина 1 (SIRT1) и/или a связанной фенотипической или химической конечной точки в какой-то момент после обработки, и при желании сравнение измеренного значения с необработанным образцом или образцом, обработанным другим соединением изобретения. Указанные методы могут быть осуществлены параллельно или в комбинации с другими экспериментами для определения функции неизвестных генов во время процесса валидации мишени или для определения валидности определенного продукта гена в качестве мишени для лечения или предотвращения определенного заболевания, состояния или фенотипа.

Оценка активации или ингибирования экспрессии гена

Перенос экзогенной нуклеиновой кислоты в клетку-хозяин или в организм-хозяин может быть оценен с помощью прямого определения присутствия нуклеиновой кислоты в клетке или организме. Такое определение может быть проведено с помощью нескольких методов, хорошо известных в данной области техники. Например, присутствие экзогенной нуклеиновой кислоты может быть обнаружено с помощью метода Саузерн-блоттинга или с помощью полимеразной цепной реакции (ПЦР) с использованием праймеров, которые специфически амплифицируют нуклеотидные последовательности, ассоциированные с нуклеиновой кислотой. Экспрессия экзогенных нуклеиновых кислот также может быть измерена с применением общепринятых методов, включающих в себя анализ экспрессии генов. Например, мРНК, полученная из экзогенной нуклеиновой кислоты, может быть обнаружена и определена количество с помощью метода Нозерн-блоттинга и ПЦР с обратной транскрипцией (ОТ-ПЦР).

Экспрессия РНК из экзогенной нуклеиновой кислоты также может быть обнаружена с помощью измерения ферментативной активности или активности репортерного белка. Например, антисмысловая модуляторная активность может быть измерена косвенно в виде уменьшения или увеличения экспрессии нуклеиновой кислоты-мишени как индикатора, что экзогенная нуклеиновая кислота производит РНК-эффектор. С учетом сохранения последовательности могут быть разработаны и применены праймеры для амплификации кодирующих областей генов-мишеней. Сначала наиболее высоко экспрессированная кодирующая область из каждого гена может быть использована для построения модельного контрольного гена, хотя может быть использована любая кодирующая или некодирующая область. Каждый контрольный ген собирают, вставляя каждую кодирующую область между репортерной кодирующей областью и ее поли(A) сигналом. Указанные плазмиды продуцируют мРНК с репортерным геном, расположенным в части гена в 3'-5' направлении, и с потенциальной мишенью РНКi, расположенной в 3'-концевой некодирующей области. Эффективность индивидуальных антисмысловых олигонуклеотидов оценивают по модуляции репортерного гена. Репортерные гены, применяемые в методах настоящего изобретения, включают в себя ацетогидроксикислую синтазу (AHAS), щелочную фосфатазу (AP), бета-галактозидазу (LacZ), бета-глюкуронидазу (GUS), хлорамфеникол-ацетилтрансферазу (CAT), зеленый флуоресцентный белок (GFP), красный флуоресцентный белок (RFP), желтый флуоресцентный белок (YFP), синий флуоресцентный белок (CFP), пероксидазу из хрена (HRP), люциферазу (Luc), нопалинсинтазу (NOS), октопинсинтазу (OCS) и их производные. Имеются многочисленные селектируемые маркеры, которые придают устойчивость к ампициллину, блеомицину, хлорамфениколу, гентамицину, гигромицину, канамицину, линкомицину, метотрексату, фосфинотрицину, пуромицину и тетрациклину. Методы для определения модуляции репортерного гена хорошо известны в данной области техники, и включают в себя, но без ограничения, флуориметрические методы (например, флуоресцентная спектроскопия, флуоресцентная сортировка клеток (FACS), флуоресцентная микроскопия), определение чувствительности к антибиотикам.

Наборы, реагенты для исследования, диагностические средства и лекарства

Соединения настоящего изобретения могут быть использованы для диагностики, лечения и профилактики и в качестве научных реагентов и компонентов наборов. Кроме того, антисмысловые олигонуклеотиды, которые способны ингибировать экспрессию генов с высокой специфичностью, часто используются специалистами в данной области техники для выявления функции определенных генов, или чтобы отличать функции разных участников биологического пути.

В отношении применения в наборах и в диагностике в различных биологических системах, соединения настоящего изобретения либо отдельно, либо в комбинации с другими соединениями или лекарственными средствами используются в качестве инструментов в дифференциальных и/или комбинаторных анализах для выявления паттернов экспрессии части или полного набора генов, экспрессированных в клетках и тканях.

Применяемый в описании термин "биологическая система" или "система" определяют как любой организм, клетка, клеточная культура или ткань, которая экспрессирует, или создается компетентной для экспрессии продуктов генов сиртуина 1 (SIRT1). Термин включает в себя без ограничения человека, трансгенных животных, клетки, клеточные культуры, ткани, ксенотрансплантаты, трансплантаты и их комбинации.

В качестве неограничивающего примера, паттерны экспрессии в клетках или тканях, обработанных одним или более антисмысловыми соединениями, сравнивают с контрольными клетками или тканями, необработанными антисмысловыми соединениями, и полученные паттерны анализируют на дифференциальные уровни экспрессии генов, к которым они относятся, например, в отношении связи с заболеванием, сигнального пути, клеточной локализации, уровня экспрессии, размера, структуры или функции рассматриваемых генов. Указанные анализы могут быть выполнены в стимулированных или нестимулированных клетках и в присутствии или без других соединений, которые влияют на паттерны экспрессии.

Примеры методов анализа экспрессии генов, известные в данной области техники, включают в себя ДНК-чипы или микрочипы (Brazma and ViIo, (2000) FEBS Lett., 480, 17-24; Celis, et al., (2000) FEBS Lett., 480, 2-16), SAGE (серийный анализ экспрессии генов) (Madden, et al., (2000) Drug Discov. Today, 5, 415-425), READS (амплификация ферментов реастрикции расщепляемых кДНК) (Prashar and Weissman, (1999) Methods Enzymol., 303, 258-72), TOGA (общий анализ экспрессии генов) (Sutcliffe, et al., (2000) Proc. Natl. Acad. Sci. U.S.A., 97, 1976-81), белковые чипы и протеомики (Celis, et al., (2000) FEBS Lett., 480, 2-16; Jungblut, wt al., Electrophoresis, 1999, 20, 2100-10), секвенирование маркер экспрессируемой последовательности (EST) (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. BiotechnoL, 2000, 80, 143-57), метод субтрактивных РНК-отпечатков пальцев (SuRF) (Fuchs, et al., (2000) Anal. Biochem. 286, 91-98; Larson, et al., (2000) Cytometry 41, 203-208), субтрактивное клонирование, дифференциальный дисплей (DD) (Jurecic and Belmont, (2000) Curr. Opin. Microbiol 3, 316-21), геномная гибридизация (Carulli, et al., (1998) J. Cell Biochem. Suppl, 31, 286-96), технологии FISH (флуоресцентная гибридизация in situ) (Going and Gusterson, (1999) Eur. J. Cancer, 35, 1895-904) и методы масс-спектрометрии (To, Comb. (2000) Chem. High Throughput Screen, 3, 235-41).

Соединения изобретения являются полезными для исследования и диагностики, поскольку указанные соединения гибридизуются с нуклеиновыми кислотами, кодирующими сиртуин 1 (SIRT1). Например, олигонуклеотиды, которые гибридизуются с такой эффективностью и в таких условиях, как раскрытые в описании в качестве модуляторов сиртуина 1 (SIRT1), являются эффективными праймерами или зондами в условиях, способствующих амплификации или обнаружению гена, соответственно. Указанные праймеры и зонды являются полезными в методах, требующих специфического обнаружения молекул нуклеиновой кислоты, кодирующих сиртуин 1 (SIRT1), и в амплификации указанных молекул нуклеиновой кислоты для обнаружения, или для применения в других исследованиях сиртуина 1 (SIRT1). Гибридизация антисмысловых олигонуклеотидов, в особенности праймеров и зондов изобретения с нуклеиновой кислотой, кодирующей сиртуин 1 (SIRT1), может быть обнаружена с помощью способов, известных в данной области техники. Такие способы могут включать в себя конъюгирование фермента с олигонуклеотидом, введение радиоактивной метки в олигонуклеотид или любые другие подходящие способы обнаружения. Также могут быть получены наборы с использованием таких способов для обнаружения уровня сиртуина 1 (SIRT1) в образце.

Специфичность и чувствительность антисмыслового соединения также закладывается специалистами в данной области техники для терапевтических применений. Антисмысловые соединения используются в качестве терапевтических агентов в лечении болезненных состояний у животных, включая человека. Антисмысловые олигонуклеотидные лекарственные препараты уже эффективно и безопасно вводили людям, и в настоящее время проводятся многочисленные клинические испытания. Таким образом, установлено, что антисмысловые соединения могут являться полезными терапевтическими агентами, которые могут быть выполнены с возможностью применения в схемах лечения, предназначенных для лечения клеток, тканей и животных, в особенности человека.

В отношении лечения животного, предпочтительно человека, предположительно имеющего заболевание или нарушение, которое может быть подвергнуто лечению путем модулирования экспрессии полинуклеотидов сиртуина 1 (SIRT1), лечат путем введения антисмысловых соединений по настоящему изобретению. Например, в одном неограничивающем варианте осуществления методы включают в себя стадию введения животному, которое нуждается в лечении, терапевтически эффективного количества модулятора сиртуина 1 (SIRT1). Модуляторы сиртуина 1 (SIRT1) настоящего изобретения эффективно модулируют активность белка сиртуина 1 (SIRT1) или модулируют экспрессию белка сиртуина 1 (SIRT1). В одном варианте воплощения активность или экспрессия сиртуина 1 (SIRT1) у животного ингибируется на приблизительно 10% по сравнению с контролем. Предпочтительно, активность или экспрессия сиртуина 1 (SIRT1) у животного ингибируется на приблизительно 30%. Более предпочтительно активность или экспрессия сиртуина 1 (SIRT1) у животного ингибируется на 50% или более. Таким образом, олигомерные соединения модулируют экспрессию мРНК сиртуина 1 (SIRT1) по меньшей мере на 10%, по меньшей мере на 50%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% по сравнению с контролем.

В одном варианте воплощения активность или экспрессию сиртуина 1 (SIRT1) и/или у животного возрастает на приблизительно 10% по сравнению с контролем. Предпочтительно, активность или экспрессия сиртуина 1 (SIRT1) у животного возрастает на приблизительно 30%. Более предпочтительно, активность или экспрессия сиртуина 1 (SIRT1) у животного возрастает на 50% или больше. Таким образом, олигомерные соединения модулируют экспрессию мРНК сиртуина 1 (SIRT1) по меньшей мере на 10%, по меньшей мере на 50%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% по сравнению с контролем.

Например, уменьшение экспрессии сиртуина 1 (SIRT1) может быть измерено в сыворотке крови, в крови в жировой ткани, печени или в любой другой жидкости организма, ткани или органе животного. Предпочтительно, клетки, содержащиеся в указанных жидкостях, тканях или органах, которые анализируют, содержат молекулу нуклеиновой кислоты, кодирующую пептиды сиртуина 1 (SIRT1) и/или белок сиртуина 1 (SIRT1) как таковой.

Соединения изобретения могут быть использованы в фармацевтических композициях путем добавления эффективного количества соединения к соответствующему фармацевтически приемлемому растворителю или носителю. Применение соединений и методов изобретения также может быть полезным профилактически.

Конъюгаты

Другая модификация олигонуклеотидов по изобретению включает химическое связывание с олигонуклеотидом одной или более чем одной группировки или конъюгата, которые увеличивают активность, распределение в клетке или поглощение клеткой олигонуклеотида. Указанные группировки или конъюгаты могут включать в себя конъюгированные группы, ковалентно связанные с функциональными группами, такими как первичные или вторичные гидроксильные группы. Конъюгированные группы изобретения включают в себя интеркаляторы, репортерные молекулы, полиамины, полиамиды, полиэтиленгликоли, полиэфиры, группы, которые усиливают фармакодинамические свойства олигомеров, и группы, которые усиливают фармакокинетические свойства олигомеров. Типичные конъюгированные группы включают в себя холестерины, липиды, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флюоресцеин, родамины, кумарины и красители. Группы, которые усиливают фармакодинамические свойства, в контексте настоящего изобретения, включают в себя группы, которые улучшают поглощение, увеличивают устойчивость к деградации и/или усиливают последовательность-специфическую гибридизацию с нуклеиновой кислотой-мишенью. Группы, которые усиливают фармакокинетические свойства, в контексте настоящего изобретения включают в себя группы, которые улучшают поглощение, распределение, метаболизм или экскрекцию соединений настоящего изобретения. Показательные конъюгированные группы раскрыты в международной патентной заявке № PCT/US92/09196, зарегистрированной 23 октября 1992 года, и патентной заявке США № 6287860, которые включены в описание посредством ссылки. Конъюгированные группировки включают в себя, но без ограничения, липидные группировки, такие как холестериновая группировка, холевая кислота, тиоэфир, например, гексил-5-тритилтиол, тиохолестерин, алифатическую цепь, например, додекандиольные или ундецильные остатки, фосфолипид, такой как дигексадецил-рац-глицерин или триэтиламмоний-1,2-ди-О-гексадецил-рац-глицеро-3Н-фосфонат, полиамин или полиэтиленгликолевую цепь, или адамантинуксусную кислоту, пальмитильную группировку или октадециламинную, или гексиламинокарбонилоксихолестериновую группировку. Олигонуклеотиды изобретения также могут быть конъюгированы с активными лекарственными субстанциями, например, с аспирином, варфарином, фенилбутазоном, ибупрофеном, супрофеном, фенбуфеном, кетпрофеном, (S)-(+)-пранопрофеном, карпрофеном, дансилсаркозином, 2,3,5-трийодбензойной кислотой, флуфенамовой кислотой, фолиновой кислотой, бензотиадиазидом, хлортиазидом, диазепином, индометацином, барбитуратом, цефалоспорином, лекарственным сульфамидным препаратом, противодиабетическим препаратом, антибактериальным препаратом или антибиотиком.

Соответствующие патенты США, в которых описано получение таких олигонуклеотидных конъюгатов, включают в себя, но не ограничиваются, патенты США №№ 4828979, 4948882, 5218105, 5525465, 5541313, 5545730, 5552538, 5578717, 5580731, 5580731, 5591584, 5109124, 5118802, 5138045, 5414077, 5486603, 5512439, 5578718, 5608046, 4587044, 4605735, 4667025, 4762779, 4789737, 4824941, 4835263, 4876335, 4904582, 4958013, 5082830, 5112963, 5214136, 5082830, 5112963, 5214136, 5245022, 5254469, 5258506, 5262536, 5272250, 5292873, 5317098, 371241, 5391723, 5416203, 5451463, 5510475, 5512667, 5514785, 5565552, 5567810, 5574142, 5585481, 5587371, 5595726, 5597696, 5599923, 5599928 и 5688941.

Композиции

Соединения изобретения также могут быть смешаны, инкапсулированы, конъюгированы или иным образом ассоциированы с другими молекулами, молекулярными структурами или смесями соединений, например с липосомами, молекулами, направленно воздействующими на рецепторы, с пероральными, ректальными, топическими или другими композициями, чтобы содействовать поглощению, распределению и/или абсорбции. Соответствующие патенты США, в которых описано получение таких композиций, способствующих поглощению, распределению и/или абсорбции, включают в себя, но не ограничиваются патентами США №№ 5108921, 5354844, 5416016, 5459127, 5521291, 5543165, 5547932, 5583020, 5591721, 4426330, 4534899, 5013556, 5108921, 5213804, 5227170, 5264221, 5356633, 5395619, 5416016, 5417978, 5462854, 5469854, 5512295, 5527528, 5534259, 5543152, 5556948, 5580575 и 5595756, каждый из которых включен в описание посредством ссылки.

Хотя антисмысловые олигонуклеотиды необязательно должны быть введены в контексте вектора, чтобы модулировать целевую экспрессию и/или функцию, воплощения изобретения относятся к конструкциям вектора экспрессии, предназначенным для экспрессии антисмысловых олигонуклеотидов, включающим в себя промоторы, гибридные последовательности промотора гена, и обладают сильной конститутивной промоторной активностью, или промоторной активностью, которая может быть вызвана в желаемом случае.

В одном варианте осуществления практическое использование изобретения включает в себя введение по меньшей мере одного из упомянутых выше антисмысловых олигонуклеотидов с помощью подходящей системы доставки нуклеиновой кислоты. В одном варианте воплощения указанная система включает в себя невирусный вектор, функционально связанный с полинуклеотидом. Примеры таких невирусных векторов включают в себя олигонуклеотид сам по себе (например, любую одну или более из SEQ ID NO:6-47) или в комбинации с подходящим белковой, полисахаридной или липидной композицией.

Дополнительно, подходящие системы доставки нуклеиновой кислоты включают в себя вирусный вектор, обычно последовательность по меньшей мере одного из перечисленных ниже вирусов: аденовирус, аденоассоциированный вирус (AAV), хелперзависимый аденовирус, ретровирус или комплекс гемагглютинирующий японский вирус (HVJ) - липосома. Предпочтительно, вирусный вектор включает в себя сильный эукариотический промотор, функционально связанный с полинуклеотидом, например, цитомегаловирусный (CMV) промотор.

Кроме того, предпочтительные векторы включают в себя вирусные векторы, гибридные белки и химические конъюгаты. Ретровирусные векторы включают в себя вирусы мышиного лейкоза Молони и вирусы на основе HIV. Один предпочтительный вирусный вектор на основе HIV включает в себя по меньшей мере два вектора, где гены gag и pol происходят из генома HIV и ген env получают из другого вируса. ДНК-вирусные векторы являются предпочтительными. Указанные векторы включают в себя покс-векторы, такие как векторы на основе ортопокс вируса или вируса птичьей оспы, векторы на основе вируса герпеса, такие как вектор на основе вируса простого герпеса I (HSV) [Geller, A.I. et al., (1995) J. Neurochem, 64: 487; Lim, F., et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, A.I. et al., (1993) Proc Natl. Acad. ScL: U.S.A.:90 7603; Geller, A.I., et al., (1990) Proc Natl. Acad. Sci USA: 87:1149], аденовирусные векторы [LeGal LaSalle et al., Science, 259:988 (1993); Davidson, et al., (1993) Nat. Genet. 3: 219; Yang, et al., (1995) J. Virol. 69: 2004] и аденовирус-ассоциированные векторы [Kaplitt, M.G., et al., (1994) Nat. Genet. 8:148].

Антисмысловые соединения изобретения включают в себя любые фармацевтически приемлемые соли, сложные эфиры или соли таких эфиров, или любое другое соединение, которое после введение животному, включая человека, способно предоставить (непосредственно или косвенно) биологически активный метаболит или его остаток.

Термин "фармацевтически приемлемые соли" относится к физиологически и фармацевтически приемлемым солям соединений изобретения: т.е. солям, которые сохраняют желаемую биологическую активность родительского соединения и вызывают нежелательных токсикологических эффектов. В отношении олигонуклеотидов, предпочтительные примеры фармацевтически приемлемых солей и их применение дополнительно описаны в патенте США № 6287860, который включен в описание посредством ссылки.

Настоящее изобретение также включает в себя фармацевтические композиции и препараты, которые содержат антисмысловые соединения изобретения. Фармацевтические композиции настоящего изобретения могут быть введены несколькими путями в зависимости от того, желательно ли местное или системное лечение, и от области, которая должна быть обработана. Введение может быть местным (включая внутриглазное, и в слизистые оболочки, включая вагинальное и ректальное применение), легочным, например, с помощью ингаляции или инсуффляции порошков или аэрозолей, включая введение с помощью небулайзера; интратрахеальным, интраназальным, эпидермальным и трансдермальным), пероральным или парентеральным. Парентеральное введение включает в себя внутривенную, внутриартериальную, подкожную, внутрибрюшную или внутримышечную инъекцию или инфузию; или внутричерепное, например, интратекальное или интравентрикулярное введение. Олигонуклеотиды по меньшей мере с одной 2'-O-метоксиэтильной модификацией считаются особенно применимыми для перорального введения. Фармацевтические композиции и препараты для местного введения могут включать в себя трансдермальные пластыри, мази, лосьоны, кремы, гели, капли, суппозитории, спреи, жидкости и порошки. Общепринятые фармацевтические носители, водные, порошковые или масляные основы, наполнители и т.п. могут быть необходимы или желательны. Покрытые презервативы, перчатки и т.п. также могут быть полезны.

Фармацевтические препараты настоящего изобретения, которые могут быть удобно представлены в единичной дозированной форме, могут быть приготовлены согласно общепринятым методам, хорошо известными в фармацевтической промышленности. Указанные методы включают в себя стадию соединения активных инградиентов с фармацевтическим носителем (носителями) или эксципиентом (эксципиентами). В целом, препараты получают с помощью равномерного и непосредственного соединения активных ингредиентов с жидкими носителями или с мелкоизмельченными твердыми носителями или с обоими, и затем, если необходимо, придают форму продукту.

Композиции настоящего изобретения могут быть получены в любой из многих возможных дозированных форм, таких как, но без ограничения, таблетки, капсулы, гелевые капсулы, жидкие сиропы, мягкие гели, суппозитории и клизмы. Композиции настоящего изобретения также могут быть получены в виде суспензий в водной, неводной или смешанной среде. Водные суспензии могут дополнительно содержать вещества, которые увеличивают вязкость суспензии, включая, например, карбоксиметилцеллюлозу натрия, сорбитол и/или декстран. Суспензия также может содержать стабилизаторы.

Фармацевтические композиции настоящего изобретения включают в себя, но без ограничения, растворы, эмульсии, пленки и содержащие липосомы препараты. Фармацевтические композиции и препараты настоящего изобретения могут включать в себя одно или более веществ, способствующих проникновению, носители, среды для лекарства или другие активные или неактивные ингредиенты.

Эмульсии обычно представляют собой гетерогенные системы из одной жидкости, диспергированной в другой, в форме мелких капель диаметром обычно больше 0,1 мкм. Эмульсии могут содержать дополнительные компоненты, кроме дисперсных фаз, и активное лекарство, которое может быть представлено в виде раствора в водной фазе, в масляной фазе или само по себе в виде отдельной фазы. Микроэмульсии включены в виде варианта осуществления настоящего изобретения. Эмульсии и их применение хорошо известны в данной области техники и дополнительно описаны в патенте США № 6287860.

Препараты настоящего изобретения включают в себя липосомные препараты. Применяемый в настоящем изобретении термин "липосома" обозначает частицу, сформированную из амфифильных липидов, организованных в сферический бислой или бислои. Липосомы представляют собой однослойные или многослойные частицы, которые имеют мембрану, сформированную из липофильного вещества, и водосодержащую внутреннюю часть, которая содержит композицию, которая должна быть доставлена. Катионные липосомы представляют собой положительно заряженные липосомы, которые, как считают, взаимодействуют с отрицательно зараженными молекулами ДНК с образованием стабильного комплекса. Липосомы, которые являются pH-чувствительными или отрицательно-заряженными, как считают, скорее, захватывают ДНК, чем образуют с ней комплекс. Как катионные, так и некатионные липосомы применяются для доставки ДНК в клетки.

Липосомы также включают в себя "стерильно стабилизированные" липосомы, термин, который при использовании в описании, относится к липосомам, содержащим один или более специализированных липидов. При включении в липосомы, указанные специализированные липиды приводят к образованию липосом, с увеличенным сроком циркуляции, по сравнению с липосомами, не имеющими таких специализированных липидов. Примерами стерильно стабилизированных липосом являются такие липосомы, в которых часть липидной области, формирующей везикулу, содержит один или более гликолипидов или образует производное с одним или более гидрофильных полимеров, таких как молекула полиэтиленгликоля (PEG). Липосомы и их применения дополнительно описаны в патенте США № 6287860.

Фармацевтические препараты и композиции настоящего изобретения также могут включать в себя сурфактанты. Применение сурфактантов в лекарственных продуктах, препаратах и в эмульсиях хорошо известно в данной области техники. Сурфактанты и их применения дополнительно описаны в патенте США № 6287860, который включен в описание посредством ссылки.

В одном варианте воплощения настоящее изобретение использует различные вещества, способствующие проникновению, для осуществления эффективной доставки нуклеиновых кислот, в особенности олигонуклеотидов. Кроме облегчения диффузии нелипофильных лекарств через клеточные мембраны, вещества, способствующие проникновению, также увеличивают проницаемость для липофильных лекарств. Вещества, способствующие проникновению, могут быть классифицированы как принадлежащие к одной из пяти общих категорий, т.е. сурфактанты, жирные кислоты, соли желчных кислот, хелатирующие агенты, и нехелатирующие несурфактанты. Вещества, способствующие проникновению, и их применения описаны далее в патенте США № 6287860, который включен в описание посредством ссылки.

Специалисту в данной области техники понятно, что препараты обычно проектируют согласно их предполагаемому использованию, т.е. способу введения.

Предпочтительные препараты для местного введения включают в себя те препараты, в которых олигонуклеотиды изобретения находятся в примеси со средством для местной доставки, таким как липиды, липосомы, жирные кислоты, сложные эфиры жирной кислоты, стероиды, хелатирующие агенты и сурфактанты. Предпочтительные липиды и липосомы включают в себя нейтральные (например, диолеоилфосфатидил этаноламин DOPE, димиристоилфосфатидилхолин DMPC, дистеаролифосфатидилхолин) отрицательные (например, димиристоилфосфатидилглицерин DMPG) и катионные (например, диолеоилтетраметиламинопропил DOTAP и диолеоилфосфатидилэтаноламин DOTMA).

Для местного или другого введения олигонуклеотиды изобретения могут быть инкапсулированы в липосомы или могут образовывать комплексы, в особенности с катионными липосомами. Альтернативно, олигонуклеотиды могут образовывать комплексы с липидами, в частности с катионными липидами. Предпочтительные жирные кислоты и сложные эфиры, их фармацевтически приемлемые соли и их применение дополнительно описаны в патенте США № 6287860.

Композиции и препараты для перорального введения включают в себя порошки или гранулы, микрочастицы, наночастицы, суспензии или растворы в водных или неводных средах, капсулы, гелевые капсулы, саше, таблетки или мини-таблетки. Наполнители, вкусовые добавки, разбавители, эмульгаторы, диспергирующие агенты или связующие вещества могут быть желательны. Предпочтительные пероральные препараты представляют собой препараты, в которых олигонуклеотиды изобретения вводят в сочетании с один или более веществами, способствующими проникновению, сурфактантами и хелаторами. Предпочтительные сурфактанты включают в себя жирные кислоты и/или сложные эфиры или их соли, желчные кислоты и/или их соли. Предпочтительные желчные кислоты/соли и жирные кислоты и их применение дополнительно описаны в патенте США № 6287860, который включен в описание посредством ссылки. Также предпочтительными являются комбинации веществ, способствующих проникновению, например, жирные кислоты/соли в комбинации с желчными кислотами/солями. Особенно предпочтительная комбинация представляет собой натриевую соль лауриновой кислоты, каприновую кислоту и UDCA. Другие вещества, способствующие проникновению, включают в себя полиоксиэтилен-9-лауриловый эфир, полиоксиэтилен-20-цетиловый эфир. Олигонуклеотиды изобретения могут быть доставлены перорально, в гранулированной форме, включая распыляемые сухие частицы, или могут образовывать комплексы с формированием микро- или наночастиц. Комплексообразующие реагенты для олигонуклеотидов и их применение дополнительно описаны в патенте США № 6287860, который включен в описание посредством ссылки.

Композиции и препараты для парантерального, интратекального или интравентрикулярного введения могут включать в себя стерильные водные растворы, которые также могут содержать буферы, разбавители и другие подходящие добавки такие как, но без ограничения, вещества, способствующие проникновению, соединения-носители и другие фармацевтически приемлемые носители или эксципиенты.

Определенные варианты воплощения изобретения предоставляют фармацевтические композиции, содержащие одно или более олигомерных соединений и один или более других хемитерапевтических агентов, которые действуют с помощью не антисмыслового механизма. Примеры таких хемитерапевтических агентов включают в себя, но без ограничения противораковые хемитерапевтические лекарства, такие как даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозина арабинозид, бисхлорэтил-нитромочевина, бусульфан, митомицин C, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметилмеламин, пентаметилмеламин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилниромочевина, азотистый иприт, мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-азацитидин, гидроксимочевина, дезоксикофомицин, 4-гидроксипероксициклофосфорамид, 5-фторурацил (5-FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (MTX), колхицин, таксол, винкристин, винбластин, этопозид (VP-16), триметрексат, иринотекан, топотекан, гемцитабин, тенипозид, цисплатин и диэтилстилбестрол (DES). В случае применения с соединениями изобретения, такие хемитерапевтические агенты могут быть использованы по отдельности (например, 5-FU и олигонуклеотид), последовательно (например, 5-FU и олигонуклеотид в течение периода времени, за которым следует MTX и олигонуклеотид), или в комбинации с одним или более другими такими хемитерапевтическими агентами (например, 5-FU, MTX и олигонуклеотид, или 5-FU, радиотерапия и олигонуклеотид). Противовоспалительные лекарства, включающие в себя, но без исключения нестероидные противовоспалительные лекарственные средства и кортикостероиды, и противовирусные лекарственные средства, включающие в себя, но без исключения, рибивирин, видарабин, ацикловир и ганцикловир, также могут быть объединены в композиции изобретения. Комбинации антисмысловых соединений и других антисмысловых лекарств также входят в объем настоящего изобретения. Два или более комбинированных препарата могут быть использованы вместе или последовательно.

В другом связанном варианте осуществления композиции изобретения могут содержать одно или более антисмысловые соединения, в особенности олигонуклеотиды, направленные на первую нуклеиновую кислоту, и одно или более дополнительных антисмысловых соединений, направленных на вторую нуклеиновую кислоту-мишень. Например, первая мишень может быть определенной антисмысловой последовательностью сиртуина 1 (SIRT1), и вторая мишень может быть областью из другой нуклеотидной последовательности. Альтернативно, композиции изобретения могут содержать два или более антисмысловых соединения, направленных на различные области одной и той же мишени, нуклеиновой кислоты сиртуина 1 (SIRT1). Многочисленные примеры антисмысловых соединений проиллюстрированы в описании, и другие соединения могут быть выбраны из подходящих соединений, известных в данной области техники. Два или более комбинированных соединений могут быть использованы совместно или последовательно.

Дозировки

Препарат терапевтических композиций и их последующее введение (дозировка), как считают, находится в компетенции специалистов в данной области техники. Дозировка зависит от тяжести и чувствительности болезненного состояния, которое лечат, с помощью курса лечения продолжительностью от нескольких дней до нескольких месяцев, или до тех пор, пока лечение не даст эффекта или достижения уменьшения болезненного состояния. Оптимальные режимы дозирования могут быть рассчитаны из измерений кумуляции лекарства в организме пациента. Специалисты с обычными навыками в данной области техники могут легко определить оптимальные дозировки, способы дозирования и частоту повторения. Оптимальные дозировки могут изменяться в зависимости от активности отдельных олигонуклеотидов, и обычно могут быть рассчитаны на основе значения EC50, которое, как обнаружили, является эффективным в моделях in vitro и в животных моделях in vivo. В целом, дозировка составляет от 0,01 мкг до 100 г на кг веса тела, и может быть введена один или более раз в день, в неделю, в месяц или в год или даже один раз каждые 2-20 лет. Специалисты с обычными навыками в данной области техники могут легко рассчитать частоту повторения доз, исходя из измеренного времени удержания и концентраций лекарства в жидкостях тела или в тканях. После успешного лечения может быть желательно провести пациенту поддерживающую терапию для предотвращения рецидива заболевания, при которой олигонуклеотид вводят в поддерживающих дозах, в диапазоне от 0,01 мкг до 100 г на кг веса тела, от одного или более раз в день до одного раза каждые 20 лет.

Несмотря на то, что различные варианты осуществления настоящего изобретения были описаны выше, следует понимать, что они представлены только в качестве примера и не для ограничения. Многочисленные изменения в отношении раскрытых вариантов осуществления могут быть выполнены в соответствии с раскрытием в настоящем документе без нарушения сущности и объема изобретения. Таким образом, широта и объем настоящего изобретения не должны ограничиваться каким-либо из описанных выше вариантов осуществления.

Все документы, упомянутые здесь, включены в описание посредством ссылки. Все публикации и патентные документы, цитируемые в настоящей заявке, включены посредством ссылки во всех отношениях в том же объеме, как если бы каждая индивидуальная публикация или патентный документ были указаны по отдельности. При цитировании различных ссылок в настоящем документе заявители не принимают, что какая-либо конкретная ссылка представляет собой "уровень техники" для изобретения. Варианты осуществления композиций и способов изобретения проиллюстрированы в следующих примерах.

ПРИМЕРЫ

Следующие неограничивающие примеры служат для иллюстрации выбранных вариантов осуществления изобретения. Следует понимать, что изменения количественных соотношений и заменители элементов показанных компонентов будут очевидны для специалистов в данной области техники, и они входят в объем воплощений настоящего изобретения.

Пример 1. Схема антисмысловых олигонуклеотидов, специфичных для молекулы нуклеиновой кислоты антисмысловой и/или смысловой цепи полинуклеотида сиртуина 1 (SIRT1)

Как указано выше, термин "олигонуклеотид, специфичный для" или "олигонуклеотид воздействует" относится к олигонуклеотиду, содержащему последовательность, (i) способную к формированию стабильного комплекса с частью гена-мишени или (ii) способную к формированию стабильного дуплекса с частью транскрипта мРНК гена-мишени.

Отбор подходящих олигонуклеотидов осуществляется с применением компьютерных программ, которые автоматически выравнивают последовательности нуклеиновых кислот и показывают области идентичности или гомологии. Такие программы используют для сравнения последовательностей нуклеиновых кислот, полученных, например, при поиске в базах данных, таких как GenBank, или при секвенировании продуктов ПЦР. Сравнение последовательностей нуклеиновых кислот ряда биологических видов обеспечивает отбор последовательностей нуклеиновых кислот, которые демонстрируют подходящую степень идентичности видов. В случае генов, которые не были секвенированы, выполняют саузерн-блоттинг, чтобы сделать возможным определение степени идентичности генов биологического вида-мишени и других биологических видов. При проведении саузерн-блоттинга в условиях различной жесткости, как хорошо известно в данной области техники, можно получить приблизительное значение показателя идентичности. Указанные процедуры позволяют провести отбор олигонуклеотидов, которые демонстрируют высокую степень комплементарности к последовательностям нуклеиновой кислоты-мишени у субъекта, которую контролируют, и низкую степень комплементарности в отношении соответствующих последовательностей нуклеиновых кислот, полученных из других биологических видов. Специалисту в данной области техники понятно, что существует значительная широта выбора подходящих областей генов для применения в настоящем изобретении.

Антисмысловое соединение является "способным к специфической гибридизации", если связывание соединения с нуклеиновой кислотой-мишенью препятствует нормальной функции нуклеиновой кислоты-мишени, что вызывает модуляцию функции и/или активности, и имеется достаточная степень комплементарности, для того чтобы избежать неспецифического связывания антисмыслового соединения с последовательностями, не являющимися мишенями, в условиях, в которых специфическое связывание является желательным, т.е. в физиологических условиях в случае тестов in vivo или терапевтического лечения, и в условиях, в которых исследования проводят в случае тестов in vitro.

Гибридизационные свойства олигонуклеотидов, описанных здесь, могут быть определены с помощью одного или более тестов in vitro, которые известны в данной области техники. Например, свойства олигонуклеотидов, описанных здесь, могут быть изучены с помощью определения связывающей способности между природным антисмысловым соединением-мишенью и молекулами потенциального лекарственного средства, используя анализ кривой плавления.

Связывающая способность натуральной антисмысловой последовательности-мишени и молекулы потенциального лекарственного средства (молекулы) может быть оценена с применением любого из общепризнанных методов измерения силы межмолекулярных взаимодействий, например анализ кривой плавления.

Анализ кривой плавления определяет температуру, при которой происходит быстрый переход из двухцепочечной в одноцепочечную конформацию комплекса природная антисмысловая последовательность/молекула. Указанная температура является общепринятой в качестве достоверного показателя силы взаимодействия между двумя молекулами.

Анализ кривой плавления может быть осуществлен с применением копии кДНК существующей природной антисмысловой молекулы РНК или синтетической ДНК или нуклеотида РНК, соответствующего сайту связывания молекулы. Многочисленные наборы, содержащие все необходимые реагенты для выполнения указанного анализа, имеются в наличии (например, набор Applied Biosystems Inc. MeltDoctor). Указанные наборы включают в себя подходящий буферный раствор, содержащий один из красителей, связывающихся с двухцепочечной ДНК (dsДНК) (такие как красители ABI HRM, SYBR Green, SYTO и т.д.). Свойства красителей dsДНК являются такими, что они практически не флуоресцируют в свободной форме, но являются высоко флуоресцентными, если связаны с dsДНК.

Для выполнения анализа кДНК или соответствующий олигонуклеотид смешивают с молекулой в концентрациях определенных в протоколах конкретных производителей. Смесь нагревают до 95ºC для диссоциации всех предварительно сформированных комплексов dsДНК, затем медленно охлаждают до комнатной температуры или другой более низкой температуры, определенной производителем набора, чтобы дать возможность молекулам ДНК ренатурировать. Вновь сформированные комплексы затем медленно нагревают до 95ºC с одновременным непрерывным сбором данных о величине флуоресценции, которая вызывается реакцией. Интенсивность флуоресценции обратно пропорциональна количествам dsДНК, представленным в реакции. Данные могут быть получены с применением устройства для проведения ПЦР в реальном режиме времени, совместимого с набором (например, устройство StepOne Plus Real Time PCR System производства ABI или устройство LightTyper instrument производства Roche Diagnostics, Lewes, UK).

Пики плавления строят путем нанесения на график отрицательного значения производной флуоресценции относительно температуры (-d(флуоресценция)/dT) на оси y) против температуры (ось x) с применением соответствующего программного обеспечения (например, LightTyper (Roche) или SDS Dissociation Curve, ABI). Данные анализируют для определения температуры быстрого перехода от комплекса dsДНК к одноцепочечным молекулам. Указанная температура называется Tm, и она прямо пропорциональна силе взаимодействия между двумя молекулами. Обычно, Tm превышает 40ºC.

Пример 2. Модуляция полинуклеотидов SIRT1

МАТЕРИАЛЫ И МЕТОДЫ

Обработка клеток HepG2 очищенными антисмысловыми олигонуклеотидами

Клетки HepG2 от компании ATCC (по каталогу № HB-8065) выращивали в среде роста (MEM/EBSS (Hyclone по каталогу № SH30024, или Mediatech, по каталогу № MT-10-010-CV)+10% FBS (Mediatech, по каталогу № MT35-011-CV)+пенициллин/стрептомицин (Mediatech, по каталогу № MT30-002-CI)) при 37ºC и 5% CO2. За один день до проведения эксперимента клетки пересевали с плотностью 0,5×105/мл в 6-луночные планшеты и инкубировали при 37ºC и 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяли 1,5 мл/лунку свежей среды роста. Все антисмысловые олигонуклеотиды разводили водой до концентрации 20 мкМ. Инкубировали 2 мкл указанного раствора с 400 мкл среды Opti-MEM (Gibco, по каталогу № 31985-070) и 4 мкл липофектамина 2000 (Invitrogen, по каталогу № 11668019) при комнатной температуре в течение 20 мин и добавляли в каждую лунку 6-луночного планшета, содержащую клетки HepG2. Аналогичную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, использовали для мнимо трансфецированных контролей. После 3-18 часов инкубации при 37ºC и 5% CO2 среду заменяли на свежую среду роста. Через 72 часа после добавления антисмысловых олигонуклеотидов клетки повторно обрабатывали дозами олигонуклеотидов, как описано выше. Через 48 часов после второго добавления антисмысловых олигонуклеотидов среду удаляли и экстрагировали РНК из клеток с помощью системы SV Total RNA Isolation System от Promega (по каталогу № Z3105) или с помощью набора RNeasy Total RNA Isolation от Qiagen (по каталогу № 74181) в соответствии с инструкциями производителей. Добавляли 600 нг РНК в реакцию обратной транскрипции, осуществляемую с применением набора Verso cDNA от Thermo Scientific (по каталогу № AB1453B), как описано в протоколе производителя. Использовали кДНК, полученную в указанной реакции обратной транскрипции, для контролирования экспрессии генов с помощью ПЦР в реальном режиме времени с применением смеси ABI Taqman Gene Expression (по каталогу № 4369510) и праймеров/зондов, сконструированных ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00202021_ml от Applied Biosystems Inc., Foster City CA). Использовали следующую схему цикла ПЦР: 50ºC в течение 2 мин, 95ºC в течение 10 мин, 40 циклов (95ºC в течение 15 сек, 60ºC в течение 1 мин) с применением прибора для проведения анализа ПЦР в реальном режиме времени StepOne Plus Real Time PCR (Applied Biosystems). Кратное изменение экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывали исходя из разницы в 18S-нормализованных значениях dCt между обработанными и мнимо трансфицированными образцами.

Результаты

Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки некоторыми антисмысловыми олигонуклеотидами для SIRT1-антисмысловой последовательности CV396200 (фиг.2, 3A).

Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают в присутствии одного из олигонуклеотидов, предназначенных для SIRT1-антисмысловой последовательности CV396200. Полосы, обозначенные как CUR-1230, CUR-1231, CUR-1232 и CUR-1230, соответствуют SEQ ID NO:32-35 (фиг.6).

Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают в присутствии двух олигонуклеотидов, предназначенных для SIRT1-антисмысловой последовательности CV428275. Полосы, обозначенные как CUR-1302, CUR-1304, CUR-1303 и CUR-1305 соответствуют SEQ ID NO:36-39 (фиг.7).

Результаты показывают, что уровни мРНК SIRT1 значительно возрастают в клетках HepG2 через 48 часов после обработки одним из олигонуклеотидов, предназначенных для SIRT-антисмысловой последовательности BE717453. Полосы, обозначенные как CUR-1264, CUR-1265 и CUR-1266, соответствуют SEQ ID NO:40-42 соответственно (фиг.8).

Результаты показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки тремя олигонуклеотидами, предназначенными для SIRT1-антисмысловой последовательности AV718812. Полосы, обозначенные как CUR-1294, CUR-1297, CUR-1295, CUR-1296 и CUR-1298 соответствуют SEQ ID NO:43-47 соответственно (фиг.9).

Обработка клеток Vero76 антисмысловыми олигонуклеотидами

Клетки Vero76 от компании ATCC (по каталогу № CRL-1587) выращивали в среде роста (MEM/EBSS (Hyclone, по каталогу № SH30024, или Mediatech, по каталогу № MT-10-010-CV)+10% FBS (Mediatech, по каталогу № MT35-011-CV)+пенициллин/стрептомицин (Mediatech, по каталогу № MT30-002-CI)) при 37ºC и 5% CO2. За один день до проведения эксперимента клетки пересевали с плотностью 1,5×105/мл в 6-луночные планшеты и инкубировали при 37ºC и 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяли свежей средой роста. Все антисмысловые олигонуклеотиды разводили водой до концентрации 20 мкМ. Инкубировали 2 мкл указанного раствора с 400 мкл среды Opti-MEM (Gibco, по каталогу № 31985-070) и 4 мкл липофектамина 2000 (Invitrogen, по каталогу № 11668019) при комнатной температуре в течение 20 мин и добавляли в каждую лунку 6-луночного планшета, содержащую клетки Vero76. Аналогичную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, использовали для мнимо трансфецированных контролей. После 3-18 часов инкубации при 37ºC и 5% CO2 среду заменяли на свежую среду роста. Через 48 часов после добавления антисмысловых олигонуклеотидов среду удаляли и экстрагировали РНК из клеток с помощью системы SV Total RNA Isolation System от Promega (по каталогу № Z3105) или с помощью набора RNeasy Total RNA Isolation от Qiagen (по каталогу № 74181), в соответствии с инструкциями производителей. Добавляли 600 нг РНК в реакцию обратной транскрипции, осуществляемую с применением набора Verso cDNA от Thermo Scientific (по каталогу № AB1453B), как описано в протоколе производителя. Использовали кДНК, полученную в указанной реакции обратной транскрипции, для контролирования экспрессии генов с помощью ПЦР в реальном режиме времени с применением смеси ABI Taqman Gene Expression (по каталогу № 4369510) и праймеров/зондов, сконструированных ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00202021_ml от Applied Biosystems Inc., Foster City CA). Использовали следующую схему цикла ПЦР: 50ºC в течение 2 мин, 95ºC в течение 10 мин, 40 циклов (95ºC в течение 15 сек, 60ºC в течение 1 мин) с применением прибора для проведения анализа ПЦР в реальном режиме времени StepOne Plus Real Time PCR (Applied Biosystems). Кратное изменение экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывали исходя из разницы в 18S-нормализованных значениях dCt между обработанными и мнимо трансфицированными образцами.

Результаты

Результаты анализа ПЦР в реальном масштабе времени показывают, что уровни мРНК SIRT1 в клетках Verо значительно возрастают через 48 часов после обработки антисмысловыми олигонуклеотидами для SIRT1-антисмысловой последовательности CV396200 (фиг.3B).

Пример 3. Модуляция экспрессии гена SIRT1

МАТЕРИАЛЫ И МЕТОДЫ

Обработка клеток HepG2 очищенными антисмысловыми олигонуклеотидами

Клетки HepG2 от компании ATCC (по каталогу № HB-8065) выращивали в среде роста (MEM/EBSS (Hyclone по каталогу № SH30024, или Mediatech по каталогу № MT-10-010-CV)+10% FBS (Mediatech, по каталогу № MT35-011-CV)+пенициллин/стрептомицин (Mediatech, по каталогу номер MT30-002-CI)) при 37ºC и 5% CO2. За один день до проведения эксперимента клетки пересевали с плотностью 0,5×105/мл в 6-луночные планшеты и инкубировали при 37ºC и 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяли 1,5 мл/лунку свежей среды роста. Все антисмысловые олигонуклеотиды разводили водой до концентрации 20 мкМ. Инкубировали 2 мкл указанного раствора с 400 мкл среды Opti-MEM (Gibco, по каталогу № 31985-070) и 4 мкл липофектамина 2000 (Invitrogen по каталогу № 11668019) при комнатной температуре в течение 20 мин и добавляли в каждую лунку 6-луночного планшета, содержащую клетки HepG2. Аналогичную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, использовали для мнимо трансфецированных контролей. После 3-18 часов инкубации при 37ºC и 5% CO2 среду заменяли свежей средой роста. Через 72 часа после добавления антисмысловых олигонуклеотидов клетки повторно обрабатывали дозами олигонуклеотидов, как описано выше. Через 48 часов после второго добавления антисмысловых олигонуклеотидов среду удаляли и экстрагировали РНК из клеток с помощью системы SV Total RNA Isolation System от Promega (по каталогу № Z3105) или с помощью набора RNeasy Total RNA Isolation от Qiagen (по каталогу № 74181) в соответствии с инструкциями производителей. Добавляли 600 нг РНК в реакцию обратной транскрипции, осуществляемую с применением набора Verso cDNA от Thermo Scientific (по каталогу № AB1453B), как описано в протоколе производителя. Использовали кДНК, полученную в указанной реакции обратной транскрипции, для контролирования экспрессии генов с помощью ПЦР в реальном режиме времени с применением смеси ABI Taqman Gene Expression (по каталогу № 4369510) и праймеров/зондов, сконструированных ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00202021_ml от Applied Biosystems Inc., Foster City CA). Использовали следующую схему цикла ПЦР: 50ºC в течение 2 мин, 95ºC в течение 10 мин, 40 циклов (95ºC в течение 15 сек, 60ºC в течение 1 мин) с применением прибора для проведения анализа ПЦР в реальном режиме времени StepOne Plus Real Time PCR (Applied Biosystems). Кратное изменение экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывали исходя из разницы в 18S-нормализованных значениях dCt между обработанными и мнимо трансфицированными образцами.

Праймеры и зонд для анализа с помощью сконструированного по заказу Taqman для экзона 4: AACTGGAGCTGGGGTGTCTGTTTCA (SEQ ID NO:48) SIRT1 природной антисмысловой последовательности CV396200.

Последовательность прямого праймера: CCATCAGACGACATCCCTTAACAAA (SEQ ID NO:49).

Последовательность обратного праймера: ACATTATATCATAGCTCCTAAAGGAGATGCA (SEQ ID NO:50).

Репортерная последовательность: CAGAGTTTCAATTCCC (SEQ ID NO:51).

Результаты

Результаты показывают, что уровни мРНК SIRT1 в клетках HepG2 значительно возрастают через 48 часов после обработки одной из siРНК, предназначенных для sirtas (sirtas_5, P=0,01). В некоторых образцах уровни sirtas РНК значительно снижались после обработки sirtas_5, но не изменялись после обработки sirtas_6 и sirtas_7, которые также не оказывали эффекта на уровни мРНК SIRT1 (фиг.1B). sirtas_5, sirtas_6 и sirtas_7 соответствуют SEQ ID NO:29, 30 и 31 соответственно.

Обработка первичных гепатоцитов обезьяны

Первичные гепатоциты обезьяны были предоставлены в культуре RxGen Inc. и высеяны в 6-луночные планшеты. Гепатоциты обрабатывали олигонуклеотидами как указано ниже. Среду в 6-луночных планшетах заменяли свежей средой роста, состоящей из среды Уильяма E (Sigma, по каталогу № W4128), дополненной 5% FBS, 50 Ед/мл пенициллина и 50 мкг/мл стрептомицина, 4 мкг/мл инсулина, 1 мкМ дексаметазона, 10 мкг/мл фунгина (InVivogen, San Diego CA). Все антисмысловые олигонуклеотиды разводили до концентрации 20 мкМ. Инкубировали 2 мкл указанного раствора с 400 мкл среды Opti-MEM (Gibco, по каталогу № 31985-070) и 4 мкл липофектамина 2000 (Invitrogen, по каталогу № 11668019) при комнатной температуре в течение 20 мин и наносили в каждую лунку 6-луночного планшета с клетками. Аналогичную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, использовали для мнимо трансфецированных контролей. После 3-18 часов инкубации при 37ºC и 5% CO2 среду заменяли свежей средой роста. Через 48 часов после добавления антисмысловых олигонуклеотидов среду удаляли и экстрагировали РНК из клеток с помощью системы SV Total RNA Isolation System от Promega (по каталогу № Z3105) или набора RNeasy Total RNA Isolation kit от Qiagen (по каталогу № 74181) в соответствии с инструкциями производителей. Добавляли 600 нг РНК в реакцию обратной транскрипции, осуществляемую с применением набора Verso cDNA от Thermo Scientific (по каталогу № AB1453B), как описано в протоколе производителя. Использовали кДНК, полученную в указанной реакции обратной транскрипции, для контролирования экспрессии генов с помощью ПЦР в реальном режиме времени с применением смеси ABI Taqman Gene Expression (по каталогу № 4369510) и праймеров/зондов, сконструированных ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00978340_ml от Applied Biosystems Inc., Foster City CA). Использовали следующую схему цикла ПЦР: 50ºC в течение 2 мин, 95ºC в течение 10 мин, 40 циклов (95ºC в течение 15 сек, 60ºC в течение 1 мин) с применением термоциклера Mx4000 (Stratagene). Кратное изменение экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывали исходя из разницы в 18S-нормализованных значениях dCt между обработанными и мнимо трансфицированными образцами.

Результаты

Результаты представлены на фиг.5. Результаты анализа ПЦР в реальном масштабе времени показывают увеличение уровней мРНК SIRT1 после обработки олигонуклеотидом против SIRT1-антисмысловой последовательности.

Пример 4. Исследование эффективности и продолжительности действия CUR-963 у зеленой африканской мартышки

Целью настоящего исследования было оценить и сравнить эффект антисмыслового нокдауна несовпадающих некодирующих антисмысловых последовательностей, которые регулируют гены SIRT1, после внутривенного введения в модели нечеловекообразного примата. Антисмысловые олигонуклеотидные тестируемые препараты, предназначенные для ингибирования регуляторных последовательностей SIRT1, обозначали как CUR-963.

CUR 963: +G*+T*C*T*G*A*T*G*G*+A*+G*+A (SEQ ID NO:25).

CUR-962 (контроль): +G*+C*T*A*G*T*C*T*G*+T*+T*+G (SEQ ID NO:52).

ОСНОВНЫЕ ПОЛОЖЕНИЯ, РЕГЛАМЕНТИРУЮЩИЕ ИССЛЕДОВАНИЕ

Настоящее исследование разработано в соответствии с принятыми токсикологическими принципами и соответствует Согласованному трехстороннему руководству Международной конференции по гармонизации (ICH) (Доклинические исследования безопасности для проведения клинических испытаний фармацевтических препаратов с участием людей ICH M3(m), 9 ноября 2000 года), и в соответствии с общепринятыми процедурами тестирования терапевтических агентов.

ТЕСТИРУЕМЫЙ И КОНТРОЛЬНЫЙ ПРЕПАРАТЫ

Определение идентичности и приготовление тестируемого препарата

Тестируемый препарат, CUR-963, представляет собой химически стабильный антисмысловой олигонуклеотид. Средой для внутривенной доставки лекарства является фосфатно-солевой буферный раствор (PBS).

Описание среды для лекарства

В отношении среды для лекарства PBS, состав, номер партии, срок годности и условия хранения (температура и на свету/в защищенном от света месте) получали от поставщика.

Хранение и применение тестируемого препарата

Тестируемую субстанцию и среду для лекарства хранили в соответствии с полученными условиями хранения, поставляемыми спонсором и производителем, соответственно.

Анализ композиций тестируемых препаратов

Образцы композиции тестируемого препарата замораживают для анализа концентрации, стабильности и гомогенности композиций тестируемых веществ.

ОБОСНОВАНИЕ ЦЕЛЕСООБРАЗНОСТИ СИСТЕМЫ ТЕСТИРОВАНИЯ

Примат представляет собой подходящий биологический вид негрызунов, разрешенный регуляторными органами в качестве показателя потенциальных опасностей, и для которых доступны значительные исходные данные. Африканская зеленая мартышка, в частности, представляет собой клинически важную модель многих физиологических состояний и заболеваний человека.

Внутривенный путь введения соответствует возможному терапевтическому пути введения у человека. Доза тестируемых препаратов основана на результатах исследований по определению дозы аналогичных соединений, выполненных ранее на африканской зеленой мартышке.

Африканские зеленые мартышки были выбраны в качестве предпочтительных приматов, поскольку последовательности-мишени тестируемых веществ сохраняются между видами со 100% гомологией у приматов.

Кроме того, тестируемое вещество является синтетическим олигонуклеотидом. Поэтому введение доз приматам дает превосходную возможность оценки эффективности указанных соединений, что лучше отражало бы возможное усвоение, которое можно наблюдать у человека, чем введение доз любому другому биологическому виду.

ЖИВОТНЫЕ

Биологический вид

Chlorocebus sabaeus, низший примат.

Порода

Африканская зеленая мартышка, обитающая на Сент-Китс.

Источник

RxGen, Lower Bourryeau, St. Kitts, West Indies.

Предполагаемый возраст

Тестируемые животные являлись взрослыми.

Ожидаемый вес тела

Вес тела обезьян составлял приблизительно 3-4 кг. Фактический диапазон значений может варьировать, но должен быть задокументирован в данных.

Пол

Тестируемые животные являлись взрослыми самками.

Количество животных

Были отобраны десять животных, чтобы обеспечить идентификацию 8 животных, подходящих для включения в исследование.

Число животных в период исследования

Самки: 8

Обоснование числа животных в исследовании

Настоящее исследование было разработано для использования наименьшего возможного числа животных, в соответствии с основной задачей оценки терапевтической эффективности тестируемого препарата у африканской зеленой мартышки и предшествующими исследованиями системного введения указанного типа олигонуклеотида у данного биологического вида.

Описание животных

Десять взрослых африканских зеленых мартышек весом от 3 до 4 кг участвовали в исследовании. Обезьяны являлись не получавшими медикаментозного лечения взрослыми животными, гуманно отловленными из дикой популяции, которая населяет остров. Пойманных обезьян обрабатывали антигельминтными препаратами, чтобы устранить любую возможную нагрузку кишечными паразитами, и наблюдали в карантине в течение минимум 4 недель до скрининга для включения в исследование. Возраст пойманных обезьян определяли по размерам и по зубам, с исключением старых животных из исследования. До включения в исследование проводили клинический осмотр каждой обезьяны, включая оценку двигательной активности и физическую ловкость. Получали образцы крови и отправляли их в Antech Diagnostics (Memphis, TN) для проведения комплексного клинического биохимического анализа, клинического анализа крови и определения липидного профиля (подробности смотрите в разделах 9.2 и 319567928). Обезьяны с абнормальными значениями лабораторных показателей, которые определяли путем сравнения с установленным нормальным диапазоном значений для обезьян колонии Сент-Китс, были исключены из исследования. Чтобы выявить 8 обезьян, которые соответствуют указанному критерию, скринингу подвергали 10 животных, с участием в скрининге дополнительных животных при необходимости. Перед началом исследования отобранных обезьян перемещают в отдельные клетки для привыкания к отдельному содержанию на период времени продолжительностью в одну неделю. В исследование включают только животных, которых считают подходящими для проведения эксперимента. Фактические (или предполагаемые) диапазоны возраста и веса уточняют в начале исследования в исходных данных и в заключительном отчете.

Здоровье и защита животных

Следовали самым высоким стандартам защиты животных и придерживались основных положений, условленных Министерством сельского хозяйства Сент-Китс и Министерством здравоохранения и социального обеспечения США. Все исследования проводят в соответствии с указанными требованиями и всеми применимыми правилами и нормами по уходу и содержанию лабораторных животных. Все применимые стандарты для ветеринарного ухода, операции и обследования содержатся в Руководстве NIH по уходу и использованию животных. Помещение в Сент-Китс содержит Комитет по научным исследованиям животных, который проверяет протоколы и инспектирует помещения в соответствии с указаниями методического руководства. Фонд имеет утвержденный документ о передаче прав на недвижимость, зарегистрированный Департаментом по защите лабораторных животных, в соответствии с указаниями методического руководства, № A4384-01 (Научный фонд по исследованию центральной нервной системы/Биомедицинский фонд Сент-Китс). Не возникает проблем особого ветеринарного ухода за нечеловекообразным приматом и проблем биологической безопасности, вызываемых экспериментом, предусмотренным в настоящем исследовании.

Содержание и условия

Для возможности определения любых связанных с лечением клинических признаков, животных размещали по отдельности до и после операции до умерщвления. Здание для содержания приматов, в котором находились отдельные клетки, которые полностью освещались естественным освещением, что при 17 градусах северной широты приблизительно соответствует циклу света-темноты 12 часов:12 часов, как рекомендовано в методическом руководстве США D.H.H.S. Здание для содержания приматов компании RxGen вентилировалось снаружи. Дополнительное движение воздуха обеспечивали с помощью потолочных вентиляторов, чтобы поддержать постоянную заданную температуру 23-35ºC, которая является обычной для Сент-Китса в течение всего года. Экстремумы температуры за двадцать четыре часа и относительную влажность (которую также не контролировали) измеряли ежедневно. Во время исследования клетки очищали с регулярными интервалами.

Питание и вода

Каждому животному предлагали приблизительно 90 грамм в день стандартного корма для обезьян (TekLad, Madison, WI). Записывали конкретный питательный состав пищевого рациона. Воду периодически анализировали на микробиологическую чистоту. Критерии приемлемых уровней загрязнения в основном рационе и запасе воды находились в пределах аналитических характеристик, установленных производителем питания и периодических оценок водопроводной воды, соответственно. Вода соответствовала всем критериям, необходимым для сертификации в качестве разрешенной для потребления человеком.

СХЕМА ЭКСПЕРИМЕНТА

Определение и рандомизация животных

Распределение по группам проводили с помощью процедуры статифицированной рандомизации, исходя из профилей веса тела и концентрации холестерина в плазме крови. До и после распределения в группу, каждое животное идентифицировали с помощью татуировки на животе. Татуировки помещают на всех животных колонии, как средство идентификации, в процессе обычного медицинского осмотра. Рисовали план размещения клеток, чтобы идентифицировать размещенных в них субъектов, и отдельных обезьян далее идентифицировали с помощью маркированной таблички, прикрепляемой к соответствующей им клетке.

Размеры групп, дозы и идентификационные номера

Животных распределили в 2 группы лечения, по 4 обезьяны в каждой группе. Каждой обезьяне присваивали специальный идентификационный номер согласно объектной системе нумерации. Указанная система единственным образом идентифицирует каждую обезьяну с помощью буквы с последующим трехзначным номером например, Y032.

Путь и частота введения

Животные получали дозы один раз в день в дни 1, 3 и 5, которые вводили внутривенно с помощью ручной инфузии в течение ~10 мин. Скорость инфузии составляла 24 мл/кг/ч. Животные находились под седативным воздействием кетамина и ксилазина перед проведением и во время процедуры введения дозы. Венозный катетер (система для инфузии малых вен Terumo, размер иглы 20, или аналогичная подходящая система инфузии) вводили в подкожную вену. Дозу вводили каждой обезьяне между 8:00 и 10:00 часами утра, вскоре после того, как животные просыпались и до кормления. Образец крови для оценки уровней холестерина и других липидов в плазме крови, как описано ниже в разделе "Биохимический анализ крови", брали непосредственно перед каждой инфузией. Взятие крови предшествовало кормлению в обоих интервалах отбора образцов, чтобы минимизировать эффекты питания на измерения холестерина.

Клиническое наблюдение

Все видимые признаки реакции на лечение записывали в каждый день введения дозы. Кроме того, по меньшей мере один раз в неделю у животных проверяли физические признаки, такие как внешний вид и общее состояние.

Вес тела

Вес тела записывали с недельными интервалами во время периодов лечения и после лечения.

Потребление пищи

Не проводили определение индивидуального потребления пищи. Однако контролировали модели питания и отмечали любые значительные изменения.

Заболеваемость и смертность

Регистрируют данные по заболеваемости и смертности. Любое решение относительно преждевременного выведения животного из эксперимента принимают после консультации с руководителем исследования и по возможности с научным сотрудником, контролирующим проведение исследования со стороны спонсора. Животных, которые умерли или которые были умерщвлены преждевременно, подвергают некропсии с извлечением тканей печени, почек, сердца, селезенки и легких для гистопатологического исследования. В случае преждевременного умерщвления также получают образцы крови (если возможно) и определяют соответствующие параметры. Животных, которых обнаруживают мертвыми после окончания рабочего времени, помещают на ночь в холодильную камеру и проводят некропсию в начале следующего рабочего дня. Если состояние животного требует преждевременного умерщвления, проводят эфтаназию путем внутривенного введения повышенной дозы пентобарбитала натрия. Все исследование регулируется Правилами использования животных. Компании RxGen необходимо по закону следовать стандартам Министерства здравоохранения и социального обеспечения США в отношении благоприятных условий для приматов, которые устанавливают уровни тяжести, так что процедуры в настоящем исследовании, обозначенные как умеренные, должны соблюдаться.

КЛИНИЧЕСКИЕ ЛАБОРАТОРНЫЕ ИССЛЕДОВАНИЯ

Биопсия жировой ткани

Биопсию подкожной жировой ткани проводили всем обезьянам, участвовавшим в исследовании, кроме Y775, на 26-й день исследования путем экстракции ткани через 1 см переднесрединный разрез, ниже пупка. Образцы биопсии немедленно помещали в подписанную криопробирку, содержащую 2 мл РНК-стабилизирующего реагента RNAlater (Qiagen) и инкубировали при 4ºC в течение ночи, после чего удаляли РНКlater и пробирку быстро замораживали в жидком азоте. После транспортировки в жидком азоте, выделяли общую РНК для проведения анализа количественной ПЦР в реальном режиме времени генов-мишеней.

Результаты

Результаты анализа ПЦР в реальном масштабе времени показывают увеличение уровней мРНК SIRT1 в образцах биопсии жировой ткани обезьян, получавших дозы CUR-963, олигонуклеотида, предназначенного для SIRT1-антисмысловой последовательности CV396200.1, по сравнению с обезьянами, получавшими дозы CUR-962 (SEQ ID NO: 52), олигонуклеотида, который не оказывает влияния на экспрессию SIRT1 in vitro (предназначенный для ApoA1-антисмысловой последовательности DA327409, данные не представлены). Уровни мРНК определяли с помощью анализа ПЦР в реальном режиме времени (фиг.4).

Хотя изобретение проиллюстрировано и описано в отношении одного или более воплощений, эквивалентные изменения и модификации будут вноситься другими специалистами в данной области техники после прочтения и понимания настоящего описания и прилагаемых чертежей. Кроме того, несмотря на то, что конкретный признак изобретения может быть раскрыт с учетом одного или нескольких воплощений, указанный признак может быть скомбинирован с одним или более другими признаками других воплощений, которые могут быть желательными или полезными для любого данного или конкретного практического применения.

Краткое изложение сущности изобретения позволит читателю быстро определить сущность технического раскрытия. Оно предоставляется с пониманием, что не будет использовано, чтобы толковать или ограничить объем или значение следующей формулы изобретения.

1. Применение олигонуклеотида длиной 10-30 нуклеотидов, который специфически направлен на природный антисмысловой транскрипт сиртуина 1 (SIRT1) для профилактики или лечения связанного с сиртуином 1 (SIRT1) заболевания или расстройства, где указанный олигонуклеотид повышает экспрессию сиртуина 1 (SIRT1), и где природный антисмысловой транскрипт обладает нуклеотидной последовательностью, представленной любой из SEQ ID NO: 2-5.

2. Применение олигонуклеотида длиной 10-30 нуклеотидов, который специфически направлен на природный антисмысловой транскрипт сиртуина 1 (SIRT1), для получения лекарственного средства для профилактики или лечения связанного с сиртуином 1 (SIRT1) заболевания или расстройства, где указанный олигонуклеотид повышает экспрессию сиртуина 1 (SIRT1), и где природный антисмысловой транскрипт обладает нуклеотидной последовательностью, представленной любой из SEQ ID NO: 2-5.

3. Применение олигонуклеотида по п. 1 или 2, где заболевание или расстройство выбрано из группы, состоящей из метаболических заболеваний, злокачественного новообразования и нейродегенеративных заболеваний.

4. Применение олигонуклеотида по п. 3, где:
а) метаболическое заболевание выбрано из резистентности к инсулину, диабета, диабета зрелого возраста, диабетической нефропатии, диабета 2-го типа, ожирения, нарушенной толерантности к глюкозе, повышенного содержания холестерина в крови, гипергликемии, дислипидемии или гиперлипемии;
b) злокачественное новообразование выбрано из рака молочной железы, колоректального рака, CCL, CML или рака предстательной железы;
c) нейродегенеративное заболевание выбрано из болезни Альцгеймера, болезни Хантингтона, болезни Паркинсона, бокового амиотрофического склероза, рассеянного склероза и нарушений, вызванных агрегацией полиглутамина, СПИД-ассоциированного слабоумия или невропатии (например, сенсорной невропатии, вегетативной невропатии, двигательной невропатии, ретинопатии).

5. Способ повышения экспрессии сиртуина 1 (SIRT1) в клетках или тканях пациента in vitro, включающий: приведение указанных клеток или тканей в контакт с олигонуклеотидом длиной 10-30 нуклеотидов, который направлен на природный антисмысловой транскрипт сиртуина 1 (SIRT1), где природный антисмысловой транскрипт обладает нуклеотидной последовательностью, представленной любой из SEQ ID NO: 2-5; повышая таким образом экспрессию сиртуина 1 (SIRT1).

6. Применение олигонуклеотида по любому из пп. 1-4, где природный антисмысловой транскрипт обладает нуклеотидной последовательностью, представленной любой из SEQ ID NO: 2-4.

7. Способ по п. 5, где природный антисмысловой транскрипт обладает нуклеотидной последовательностью, представленной любой из SEQ ID NO: 2-4.

8. Применение олигонуклеотида по любому из пп. 1-4, где олигонуклеотид содержит любую из последовательностей SEQ ID NO: 6-47.

9. Способ по п. 5, где олигонуклеотид содержит любую из последовательностей SEQ ID NO: 6-47.

10. Применение олигонуклеотида по пп. 1-4, где олигонуклеотид содержит SEQ ID NO: 25.

11. Способ по п. 5, где олигонуклеотид содержит SEQ ID NO: 25.

12. Применение олигонуклеотида по любому из пп. 1-4, где:
a) олигонуклеотид представляет собой соединение миРНК; предпочтительно, где соединение миРНК включает олигонуклеотид, выбранный из SEQ ID NO: 32, или
b) олигонуклеотид является одноцепочечным.

13. Способ по п. 5, где:
a) олигонуклеотид представляет собой соединение миРНК; предпочтительно, где соединение миРНК включает олигонуклеотид, выбранный из SEQ ID NO: 32, или
b) олигонуклеотид является одноцепочечным.

14. Применение по любому из пп. 1-4, где экспрессия сиртуина 1 (SIRT1) увеличивается по меньшей мере на 10%.

15. Способ по п. 5, где экспрессия сиртуина 1 (SIRT1) увеличивается по меньшей мере на 10%.

16. Применение олигонуклеотида по любому из пп. 1-4, где олигонуклеотид дополнительно содержит одну или несколько модификаций, включающих:
a) по меньшей мере одну модифицированную межнуклеозидную связь, выбранную из: фосфоротиоата, 2′-О-метоксиэтила (МОЕ), 2′-фтора, алкилфосфоната, фосфородитиоата, алкил фосфотиоата, фосфорной кислоты, карбамата, карбоната, фосфата триэфира, ацетамидата, карбоксиметилового эфира и их комбинаций;
b) по меньшей мере один модифицированный нуклеотид, выбранный из: пептидо-нуклеиновой кислоты (ПНК), закрытой нуклеиновой кислоты (LNA), арабино-нуклеиновой кислоты (FANA), аналога, производного и их комбинаций; или
с) по меньшей мере одну модифицированную сахаридную группу, выбранную из: 2′-О-метоксиэтил модифицированной сахаридной группы, 2′-метокси модифицированной сахаридной группы, 2′-O-алкил модифицированной сахаридной группы, бициклической сахаридной группы или их комбинаций.

17. Способ по п. 5, где олигонуклеотид дополнительно содержит одну или несколько модификаций, включающих:
a) по меньшей мере одну модифицированную межнуклеозидную связь, выбранную из: фосфоротиоата, 2′-О-метоксиэтила (МОЕ), 2′-фтора, алкилфосфоната, фосфородитиоата, алкил фосфотиоата, фосфорной кислоты, карбамата, карбоната, фосфата триэфира, ацетамидата, карбоксиметилового эфира и их комбинаций;
b) по меньшей мере один модифицированный нуклеотид, выбранный из: пептидо-нуклеиновой кислоты (ПНК), закрытой нуклеиновой кислоты (LNA), арабино-нуклеиновой кислоты (FANA), аналога, производного и их комбинаций; или
c) по меньшей мере одну модифицированную сахаридную группу, выбранную из: 2′-О-метоксиэтил модифицированной сахаридной группы, 2′-метокси модифицированной сахаридной группы, 2′-O-алкил модифицированной сахаридной группы, бициклической сахаридной группы или их комбинаций.

18. Олигонуклеотид для профилактики или лечения связанного с сиртуином 1 (SIRT1) заболевания или расстройства, содержащий любую из SEQ ID NO: 6-47.

19. Фармацевтическая композиция для профилактики или лечения связанного с сиртуином 1 (SIRT1) заболевания или расстройства, содержащая эффективное количество по меньшей мере одного олигонуклеотида по п. 18 и фармацевтически приемлемое вспомогательное вещество.



 

Похожие патенты:

Представленные изобретения касаются модифицированного белка, нуклеиновой кислоты, кодирующей такой белок, вектора, содержащего нуклеиновую кислоту, и носителя для связывания биотина, на котором иммобилизован такой белок.

Изобретение относится к биотехнологии, а именно к новым IL-17-ингибирующим полипептидам, соответствующим слитым белкам, к композициям и применению их в медицинских целях.

Настоящее изобретение относится к области иммунологии. Предложено полностью человеческое моноклональное антитело, которое связывает инсулиноподобный фактор роста-II (IGF-II) и имеет перекрестную реактивность к IGF-I, а также его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии. Предложено выделенное антитело к белку ICOS человека с повышенной эффекторной функцией.

Представленная группа изобретений касается слитых белков, нуклеиновых кислот, кодирующих такие белки, экспрессирующей кассеты, обеспечивающей экспрессию нуклеиновой кислоты, вектора, включающего такую кассету, способа диагностики in vitro-боррелиоза, набора для такой диагностики, в которых используют упомянутые белки, а также вакцинной композиции для профилактики боррелиоза, включающей такие белки.

Настоящее изобретение относится к биотехнологии и представляет собой антитела против фактора роста нервов (ФРН). Настоящее изобретение также раскрывает фармацевтическую композицию для облегчения боли, ассоциированной с заболеванием или состоянием, при котором развитие или сохранение боли опосредовано ФРН, содержащую указанные антитела, а также набор для лечения связанного с ФРН заболевания, такого как, например, остеоартрит, нуклеиновые кислоты, кодирующие тяжелую или легкую цепь антитела, вектор экспрессии, клетку-хозяина для получения указанных антител, способ экспрессии указанных антител против ФРН, а также применение указанных антител в способе лечения боли и для получения лекарственного средства для лечения боли, ассоциированной с заболеванием или состоянием, при котором развитие или сохранение боли опосредовано ФРН.

Настоящее изобретение относится к области иммунологии. Предложено антитело, способное связываться с амплифицированным рецептором эпидермального фактора роста (EGFR) и с усеченным вариантом EGFR - de2-7 EGFR, и охарактеризованное последовательностями вариабельных доменов.

Настоящее изобретение относится к биотехнологии и представляет собой экспрессионную плазмиду без устойчивости к антибиотику, которая содержит полинуклеотид, кодирующий белок-репрессор cI.

Изобретение относится к области биотехнологии. Представлена нуклеиновая кислота, кодирующая белок, обладающий ацетил-СоА- карбоксилазной активностью, компенсирующей недостаток ацетил-СоА-карбоксилазной активности в дрожжах, где нуклеотидная последовательность выбрана из группы, состоящей из нуклеиновой кислоты, которая содержит нуклеотидную последовательность: (a) кодирующую белок, состоящий из аминокислотной последовательности SEQ ID NO:2; (b) которая гибридизуется в жестких условиях с нуклеиновой кислотой, комплементарной SEQ ID NO:1; (c) SEQ ID NO:1; и (d) которая гибридизуется в жестких условиях с нуклеиновой кислотой, состоящей из комплементарной нуклеотидной последовательности, кодирующей белок SEQ ID NO:2; где SEQ ID NO:1 и 2 раскрыты в описании. Также описаны: ацетил-СоА-карбоксилаза (SEQ ID NO:2), повышающая содержание арахидоновой кислоты, характерное для хозяина; рекомбинантный вектор, содержащий указанную нуклеиновую кислоту; и клетка, которая трансформирована указанным вектором, предназначенные для получения композиции жирных кислот, содержащей повышенный уровень арахидоновой кислоты. Предложен способ получения композиции жирных кислот, включающий культивирование указанной клетки и сбор композиции жирных кислот из культуры трансформированных клеток. Изобретение позволяет получить композицию жирных кислот в клетке-хозяине с повышенным содержанием арахидоновой кислоты. 9 н. и 2 з.п. ф-лы, 8 ил., 5 табл., 8 пр.
Предложенное изобретение относится к области иммунологии. Описаны варианты антител или антигенсвязывающих фрагментов, связывающиеся с человеческим 4-1ВВ. Один из вариантов характеризуется наличием соответствующих 3 CDR участков легкой цепи и 3 CDR участков тяжелой цепи. Другой вариант характеризуется наличием тяжелой и лёгкой цепи с соответствующими аминокислотными последовательностями. Описаны варианты фармацевтической композиции для снижения опухолевого роста или для лечения рака у субъекта, а также способы снижения опухолевого роста или лечения рака у субъекта, использующие варианты антител или антигенсвязывающих фрагментов в терапевтически эффективном количестве. Описан способ лечения рака с использованием комбинации антитела и иммунотерапевтического агента. Раскрыты: варианты кодирующих нуклеиновых кислот, вектор экспрессии и клетка-хозяин, содержащая вектор для экспрессии антитела. Описан способ получения антитела с использованием клетки. Изобретение обеспечивает новые агонистические антитела к 4-1ВВ (также называемому CD137 или TNFRSF9) человека, которые распознают эпитоп, расположенный в области аминокислотных остатков K115, C121, R134, R154, V156 антигена, имеют аффинность Kd, измеренную методом BIACORE, порядка нМ, например 0,4 нМ или 8 нМ (для формата антитела IgG1), что может найти применение в терапии рака и опухолевых заболеваний. 12 н. и 7 з.п. ф-лы, 8 ил., 11 табл., 9 пр.
Изобретение относится к области биохимии, в частности к моноклональным антителам, связывающимся с с-Met, способных ингибировать как лиганд-зависимую, так и лиганд-независимую активацию с-Меt. Указанные антитела, а также включающая их композиция, могут применяться для получения лекарственного средства для лечения рака. Изобретение позволяет специфично ингибировать как лиганд-зависимую, так и лиганд-независимую активацию с-Мет, в частности ингибировать с-Мет-димеризацию. 17 н. и 17 з.п. ф-лы, 111 ил., 4 табл., 27 пр.
Предложенное изобретение относится к области иммунологии. Раскрыты варианты антитело человека или антиген-связывающий фрагмент антитела человека, которые специфическим образом связывают и ингибируют человеческую пропротеинконвертазу субтилизин/кексин тип 9 («hPCSK9»). Каждый вариант характеризуется тем, что содержит 6 CDR тяжелой и легкой цепи. Описаны: изолированная кодирующая нуклеиновая кислота, вектор экспрессии и способ получения антитела с использованием указанного вектора. Предложен фармацевтический состав на основе антитела для лечения заболевания или состояния, которое поддается смягчению, улучшению, подавлению или предотвращению с помощью антитела к PCSK9. Использование изобретения обеспечивает новые варианты антител, способные снижать сывороточный ЛНП холестерин при незначительных изменениях или отсутствии воздействия на функции печени, по данным измерения AЛТ и AСT. 5 н. и 3 з.п. ф-лы, 14 ил., 28 табл., 17 пр.

Изобретение относится к областям медицинской и молекулярной генетики, а также к генотерапии. Описана генетическая конструкция, продуцирующая siPHK, которые являются ингибиторами репродукции вируса иммунодефицита человека 1 типа, субтипа А. Кассетная генетическая конструкция на основе вектора GeneClip-U1-neo, продуцирующая три siPHK - ингибиторы репродукции вируса иммунодефицита человека 1 типа и гена CCR5 человека. Конструкция anti-HIV-1R-anti-HIV-3R-anti-CCR5-8 содержит фрагмент длиной 30 bp, соответствующий консервативному району домена обратной транскриптазы генома ВИЧ-1 субтипа А у больных в России, фрагмент длиной 30 bp, соответствующий консервативному району домена интегразы генома ВИЧ-1 субтипа А у больных в России, а также 19 bp фрагмент, соответствующий мРНК гена CCR5. Техническим результатом предлагаемого изобретения является разработка эффективных анти-ВИЧ препаратов на основе интерферирующих РНК (siPHK), продуцируемых в клетках с помощью введенной кассетной генетической конструкции, содержащих палиндромы, предназначенные для образования продукции трех siPHK, две из которых направлены на мишени в клинических вариантах ВИЧ-1 субтипа А у больных в России, и тестированная с использованием невирусной системы. 3 ил., 3 табл., 2 пр.

Изобретение относится к областям медицинской и молекулярной генетики, а также к генотерапии. Описана генетическая конструкция, продуцирующим siPHK, которые являются ингибиторами репродукции вируса иммунодефицита человека 1 типа, субтипа А. Кассетная генетическая конструкция на основе вектора GeneClip-U1-neo, продуцирующая три siPHK - ингибиторов репродукции вируса иммунодефицита человека 1 типа и гена CCR5 человека. Конструкция anti-HIV-1R-anti-HIV-6R-anti-CCR5-8 содержит фрагмент длиной 30 bp, соответствующий консервативному району домена обратной транскриптазы генома ВИЧ-1 субтипа А у больных в России, фрагмент, длиной 30 bp, соответствующий консервативному району домена белка Р17 генома ВИЧ-1 субтипа А у больных в России, а также 19 bp фрагмент, соответствующий мРНК гена CCR5. Техническим результатом предлагаемого изобретения является разработка эффективных анти-ВИЧ препаратов на основе интерферирующих РНК (siPHK), продуцируемых в клетках с помощью введенной кассетной генетической конструкции, содержащие палиндромы, предназначенные для образования продукции трех siPHK, две из которых направлены на мишени в клинических вариантах ВИЧ-1 субтипа А у больных в России, и тестированная с использованием невирусной системы. 3 ил., 3 табл. 2 пр.

Изобретение относится к области биохимии, в частности к применению гена, кодирующего белок, который состоит из аминокислотной последовательности, представленной в SEQ ID NO.2, для получения трансгенного риса с длинными, большими и многочисленными зернами и увеличенной урожайностью, увеличенным количеством зерен в метелке и скрученными листьями. Раскрыто применение трансгенной линии клеток риса и рекомбинантного вектора для получения трансгенного риса с длинными, большими и многочисленными зернами и увеличенной урожайностью, увеличенным количеством зерен в метелке и скрученными листьями. Изобретение позволяет эффективно получать трансгенный рис с длинными, большими и многочисленными зернами и увеличенной урожайностью, увеличенным количеством зерен в метелке и скрученными листьями. 3 н. и 2 з.п. ф-лы, 16 ил., 4 табл., 2 пр.

Изобретения касаются инфекционной молекулы нуклеиновой кислоты, кодирующей инфекционный вирус Torque teNO свиней (PTTV), которая содержит по меньшей мере одну копию геномной последовательности, выбранной из группы, состоящей из последовательностей, соответствующих генотипам или подтипам PTTV1a-VA, PTTV1b-VA, PTTV2b-VA и PTTV2c-VA, а также биологически функциональной плазмиды или вирусного вектора, содержащего такую инфекционную нуклеотидную геномную последовательность, и клетки-хозяина, содержащей такую плазмиду или вектор. Кроме того, представленные изобретения предусматривают живые, аттенюированные, экспрессируемые при использовании вектора и очищенные рекомбинантные капсидные субъединичные или убитые вирусные вакцины для защиты против PTTV инфекции, а также способы иммунизации свиней против PTTV вирусной инфекции путем введения такой вакцины. Охарактеризованные изобретения могут быть использованы для предотвращения инфекции, вызываемой вирусом Torque teNO свиней. 11 н. и 12 з.п. ф-лы, 53 ил., 5 табл., 24 пр.

Изобретение относится к области биотехнологии. Представлен полипептид D-лактатдегидрогеназы, который содержит полипептид с аминокислотной последовательностью, которая характеризуется идентичностью по последовательности на уровне не менее 80% с аминокислотной последовательностью, показанной в SEQ ID NO:1 или 2, раскрытые в описании, где указанный полипептид обладает D-лактатдегидрогеназной активностью. Также представлены полинуклеотиды, кодирующие указанные полипептиды D-лактатдегидрогеназы; конструкция ДНК для экспрессии полинуклеотида, кодирующего D-лактатдегидрогеназу, в которой связаны указанный полинуклеотид и промотор, способный осуществлять экспрессию полинуклеотида. Описан трансформант, в частности трансформированные дрожжи, для получения D-молочной кислоты, в который введен полинуклеотид или конструкция ДНК по настоящему изобретению. Предложен способ получения D-молочной кислоты, который включает стадию культивирования указанного трансформанта. Изобретение позволяет получать D-молочную кислоту на повышенном уровне при помощи трансформанта по настоящему изобретению по сравнению с уровнем D-молочной кислоты, полученным с использованием нетрансформированной родительской клетки. 9 н. и 6 з.п. ф-лы, 2 ил., 4 табл., 13 пр.

Настоящее изобретение относится к биотехнологии и представляет собой генетически модифицированный штамм бактерии Streptomyces thermotolarences WSJ-IA, продуцирующий изовалерилспирамицин I. Настоящее изобретение также раскрывает способ получения указанного штамма. Способ включает этапы конструирования рекомбинантной плазмиды, содержащей двойной ген ist-acyB2, и трансформации указанной плазмиды в штамм WSJ-2, продуцирующий изовалерилспирамицин I. Изобретение также раскрывает способ получения изовалерилспирамицина I культивированием штамма Streptomyces thermotolarences WSJ-IA в питательной среде. Настоящее изобретение позволяет повысить выход получаемого изовалерилспирамицина I. 3 н.п. ф-лы, 3 ил., 5 табл., 4 пр.
Наверх