Олигодезоксирибонуклеотидный ингибитор днк-метилтрансферазы 1 человека



Олигодезоксирибонуклеотидный ингибитор днк-метилтрансферазы 1 человека
Олигодезоксирибонуклеотидный ингибитор днк-метилтрансферазы 1 человека
Олигодезоксирибонуклеотидный ингибитор днк-метилтрансферазы 1 человека

 


Владельцы патента RU 2553349:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к области молекулярной биологии и может быть использовано в медицине. Предложен олигодезоксирибонуклеотидный ингибитор ДНК-метилтрансферазы 1 человека (Dnmt1), характеризующийся тем, что он имеет самокомплементарную структуру, которая образует двуцепочечную шпильку, имеет неспаренную СА пару в сайте узнавания фермента ДНК-метилтрансферазы 1 человека и содержит в своем составе 5-метилцитозин (5mC) и тиофосфаты вместо фосфатов. Изобретение обеспечивает селективное ингибирование активности фермента Dnmt1 в реакциях in vitro и in vivo. 3 ил., 3 пр.

 

Изобретение относится к молекулярной биологии и может быть использовано в медицине. Изобретение предназначено для селективного ингибирования активности фермента ДНК-метилтрансферазы 1 человека (Dnmt1) как в реакциях in vitro, так и в клетках человека с гиперэкспрессией Dnmt1, например в некоторых видах раковых клеток.

В настоящее время известные специфические ингибиторы Dnmt1 можно разделить на две группы: нуклеозидные и ненуклеозидные ингибиторы [Delpu Y, Cordelier P, Cho WC, Torrisani J.DNA methylationandcancerdiagnosis // Int J MolSci. 2013 Jul 18;14(7):15029-58]. К первой группе относятся модифицированные аналоги цитидина, которые встраиваются во вновь синтезированную цепь ДНК и/или РНК и ковалентно связываются с ферментом Dnmt1, что приводит к снижению числа активных молекул. Типичные представители этой группы: 5-аза-цитидин (Vidaza®), 5-аза-2′-дезоксицитидин (Dacogen®) и 1-(β-D-рибофуранозил)-2(1Н)-пиримидинон (Зебуларин). Эти три нуклеозидных ингибитора показали свою эффективность и допущены к лечению острого миелоидного лейкоза и миелодиспластического синдрома, однако они крайне токсичны и обладают сильным мутагенным эффектом [Robak T.Newnucleoside-analogsforpatientswithhematologicalmalignancies. ExpertOpin. Investig. Drugs. 2011;20:343-359]. Кроме того, механизм их воздействия на систему метилирования ДНК может активировать прометастатические гены [Chik F., Szyf M.Effectsofspecific DNMT genedepletiononcancercelltransformation-andbreastcancercellinvasion; towardselective DNMT inhibitors. Carcinogenesis. 2011;32:224-232] и остается нерешенным вопрос их метаболизма в здоровых клетках.

Группа ненуклеозидных ингибиторов более обширна. В нее входят, например, флавоноиды, гидралазин, производные прокаина, антисмысловые олигонуклеотиды и синтетические олигонуклеотиды - аналоги природных субстратов Dnmt1, обладающие большей аффинностью, чем природные субстраты или необратимо связывающиеся с ферментом [Knox J.D., Araujo F.D., Bigey P., Slack A.D., Price G.B., Zannis-Hadjopoulos M., Szyf M. 2000.Inhibition of DNA methyltransferase inhibits DNA replication. J. Biol. Chem. 275, 17986-17990. Stewart D.J., Donehower R.C., Eisenhauer E.A., Wainman N., Shah A.K., Bonfils C., MacLeod A.R., Besterman J.M., Reid G.K. 2003. A phase I pharmacokinetic and pharmacodynamic study of the DNA methyltransferase 1 inhibitor MG98 administered twice weekly. Ann. Oncol. 14, 766-774. Flynn J., Fang J.Y., Mikovits J.A., Reich N.O. 2003. A potent cell-active allosteric inhibitor of murine DNA cytosine C5 methyltransferase.J. Biol. Chem. 278, 8238-8243]. Перечисленные ингибиторы отличаются по механизмам действия, но одна общая черта - отсутствие этапа встройки в ДНК, а следовательно, существенно сниженный токсический и мутагенный эффекты, что делает их, наряду с хорошими ингибирующими свойствами, перспективными для терапии онкопатологий.

Известен ингибитор-аналог «Modulators of DNA cytosine-5 methyltransferase and methods for use thereof» (патент США на изобретение №7138384 (B1), МПК А61К 38/00, опубл. 21.11.2006), имеющий двуцепочечную структуру, содержащую в своем составе метилцитозины. Длины и последовательности указанных известных запатентованных структур и в предлагаемой заявке на изобретение имеют существенные отличия.

Применение данного ингибитора для подавления активности ДНК-метилтрансферазы 1 возможно, однако эффективность данного процесса значительно ниже, чем при использовании предлагаемого нами ингибитора. Указанные недостатки связаны с тем, что имеется в наличии только одна модификация сайта узнавания фермента, а также отсутствует защита сахарофосфатного остова от действия нуклеаз клетки.

Известен другой ингибитор-аналог «OLIGONUCLEOTIDE INHIBITORS OF DNA METHYLTRANSFERASES AND THEIR USE IN TREATING DISEASES» (Международная заявка №WO2014011573 (A2), МПК А61К 38/55, опубл. 16.01.2014 г.), представляющий собой самокомплементарный олигонуклеотид, образующий шпильку и имеющий сайт узнавания метилтрансферазы CpG, а также метилцитозин в сайте узнавания и защиту сахарофосфатного остова от действия нуклеаз клетки.

Однако в международной заявке в структуре олигонуклеотида применяются аналоги цитидина: азацитидин и зебуларин, а длины и последовательности этих структур существенно отличаются от предлагаемой авторами настоящей заявки. Применение данных ингибиторов для подавления активности ДНК-метилтрансферазы 1 возможно, однако эффективность данного процесса существенно ниже, чем при использовании предлагаемого в настоящей заявке ингибитора.

Наиболее близким аналогом к заявляемому объекту изобретения является селективный ингибитор GC-boxmet [Flynn J., Fang J.Y., Mikovits J.A., Reich N.O. 2003.A potent cell-active allosteric inhibitor of murine DNA cytosine C5 methyltransferase. J. Biol. Chem. 278, 8238-8243] (прототип). Он представляет собой олигодезоксирибонуклеотидную структуру 5′-CTGGATCCTTGCCC(5mC)GCCCCTTGAATTCCC-3' и показал хороший ингибирующий потенциал на мышиной Dnmt1 и бактериальной ДНК-метилтрансферазеSssI. К недостаткам прототипа относятся:

1. Одноцепочечная структура менее аффинна, чем двуцепочечная ДНК.

2. Высокая биодоступность для экзо- и эндонуклеаз рестрикции.

3. Относительно низкая ингибирующая активность в отношении человеческой Dnmt1.

Техническим результатом предлагаемого изобретения является получение более высокой ингибирующей активности олигодезоксирибонуклеотидного ингибитора путем повышения аффинности к Dnmt1 человека и модификации его для придания устойчивости к эндо- и экзонуклеазам в живых клетках.

Указанный технический результат достигается получением олигодезоксирибонуклеотидного ингибитора ДНК-метилтрансферазы 1 человека, характеризующегося тем, что он имеет самокомплементарную структуру (5′→3′):

5′GAATGGATCCGCTCTAACTGCCCCCAGTTAGAG(5mC)AGATCCATTC3′, которая образует двуцепочечную шпильку, имеет неспаренную СА пару в сайте узнавания фермента ДНК-метилтрансферазы 1 человека 5′-CG-3/3′-A(5mC)-5′ и содержит в своем составе тиофосфаты вместо фосфатов, где 5mC-5-метилцитозин (для повышения сродства к ферменту и защиты от нуклеазной активности в живой клетке).

Определяющими отличительными признаками предлагаемого изобретения по сравнению с прототипом, являются:

1. Образование самокомплементарной двуцепочечной шпильки.

2. Наличие неспаренной С:А пары в сайте узнавания фермента Dnmt1 5′-CG-3/3′-A(5mC)-5′

3. Замена всех фосфатов на тиофосфаты.

Выше указанные отличительные признаки позволяют повысить ингибирующую активность олигодезоксирибонуклеотидного ингибитора путем повышения аффинности к Dnmt1 человека и модификации его для придания устойчивости к эндо- и экзонуклеазам в живых клетках.

Изобретение иллюстрируется следующими графическими материалами. На фиг. 1 представлена нуклеотидная последовательность олигодезоксирибонуклеотидного ингибитора ДНК-метилтрансферазы 1, образующая двуцепочечную шпильку. На фиг. 2 приведены зависимости активности фермента Dnmt1 (А) от концентрации заявляемого ингибитора (I). На фиг. 3 показана зависимость количества живых клеток HeLa (фиг. 3, а), CaSki (фиг.3, б) и L-68 (фиг. 3, в) от концентрации заявляемого ингибитора.

Пример 1. Синтез олигодезоксирибонуклеотидного ингибитора. Олигонуклеотидный ингибитор был синтезирован стандартным амидофосфинным методом на автоматическом синтезаторе с использованием фосфорамидитов фирмы "Glen Research" (США) [Beaucage S.L., Caruthers М.Н. Deoxynucleoside phosphoramidites - A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett.,22, 1859-1862, (1981)]. Затем проводилась реакция окисления фосфатов до фосфотиоатов с использованием реактива Beaucage ("Glen Research", США) как сульфирующего агента [Iyer R. P., Egan W., Regan J. В., Beaucage S. L. 3H-l,2-Benzodithiole-3-one 1,1-dioxide as an improved sulfurizing reagent in the solid-phase synthesis of oligodeoxyribonucleoside phosphorothioates // J. Am. Chem. Soc. 1990. 112. №3. 1253-1254]. Окончательная очистка проводилась при помощи ВЭЖХ. Концентрацию олигонуклеотида определяли спектрофотометрически, молярный коэффициент экстинкции рассчитывали на основании нуклеотидной последовательности. Шпилечную ДНК-структуру получали отжигом олигонуклеотида при повышении температуры до 85°C и постепенном ее снижении до +25°C. "Шпилька" образуется из-за особенностей последовательности олигонуклеотида, разные концы которого имеют большое сродство друг к другу. Полученный олигодезоксирибонуклеотидный ингибитор ДНК-метилтрансферазы имеет нуклеотидную последовательность (см. приложение), образующую двуцепочечную шпильку.

Пример 2. Ингибирование Dnmtl invitro. Реакции метилирования ДНК проводили при 37°C. Реакционная смесь содержала 50 мМТрис-HCl, pH 7.8, 1 mMEDTA, 1 мМ DTT, 5% глицерин и 0.1 мг/мл БСА. Концентрации фермента Dnmt1 человека, AdoMet, ДНК субстрата ((инозинсодержащего полимера поли(dI-dC)•поли(dI-dC) длиной 1755 п.н. (“GE Healthcare”, Великобритания)) и олигонуклеотидного ингибитора составляли 0.05 е.а./мкл (~ 10-9 М), 10 мкМ, 1 мкМ (в пересчете на сайты) и 1 мкМ соответственно. Реакции запускали добавлением раствора Dnmt1 к смеси радиоактивно меченного тритием [3H-CH3]AdoMet (“GE Healthcare”, Великобритания) и субстратной ДНК (с ингибитором или без) до конечного объема 20 мкл. Смешиваемые растворы предварительно прогревали до 37°С. Время реакции составляло 3 ч. Аликвоты реакционных смесей объемом 18 мкл наносили на диски анионо-обменных фильтров DE-81 (“Whatman”, Великобритания). Фильтры промывали трижды раствором 0,02 М NH4HCO3, дважды водой и один раз 75%-ным этанолом, после чего фильтры высушивали и считали их 3Н-радиоактивность в толуольном сцинтилляторе на счетчике Mark III (“SearleAnalytic”, США).

Предварительную оценку субстратных и ингибиторных свойств проводили на основе сравнения степеней метилирования ДНК-метилтрансферазой Dnmt1 субстрата поли(dI-dC)•поли(dI-dC) (D), синтетического олигонуклеотидного ингибитора (B) и их смеси с субстратом (C). Процент ингибирования реакции метилирования поли(dIdC)•поли(dIdC) в смесях вычисляли следующим образом: 100% × (1 - (C - B) / D). Зависимости активности Dnmt1 (A) от концентрации ингибитора (I), представленные на фиг. 2, анализировали с помощью программы для нелинейного регрессионного анализа Origin 8.0 (“OriginLab”), вычисляя 50%-ные ингибирующие концентрации (IC50) согласно стандартному выражению: A = Amax / (1 + ([I] / IC50)n), где n - коэффициент Хилла.

Эксперимент показал, что сам ингибитор не подвержен метилированию и вызывает 82% ингибирование реакции при данных условиях. Вычисленное значение IC50 составило 144±7 нМ.

Пример 3. Ингибирование Dnmt1 in vivo. Для оценки цитотоксической активности олигодезоксирибонуклеотидного ингибитора использовали следующую стандартную методику. Монослой культуры клеток L-68, HeLa и CaSki выращивали в лунках плоскодонных 96-луночных планшетов. После замены среды на свежую без сыворотки КРС и антибиотиков в культуральную среду добавляли серийные разведения исследуемого ингибитора или контрольного олигонуклеотида без ингибирующего эффекта, смешанных с трансфецирующим агентом (Lipofectamine 2000 (Invitrogen, США)) в подобранной пропорции. После инкубирования в течение 4 часов, среду меняли на ростовую с сывороткой и культивировали в течение 24-х часов. После этого, среду удаляли, а монослой прокрашивали витальным красителем нейтральным красным, который включается только в жизнеспособные клетки и не окрашивает погибшие. После удаления красителя и отмывки лунок добавляли лизирующий буфер. Количество красителя, адсорбированного живыми клетками монослоя, измеряли спектрофотометрически по интенсивности поглощения на длине волны 540 нм. В качестве контролей использовали лунки планшета, в которые вносили контрольный олигонуклеотид, а также лунки без ингибитора, но с добавленным Lipofectamine'ом. Учет результатов проводили с использованием планшетного спектрофотометра Emax (MolecularDevices, США). 50%-ную токсическую концентрацию (TC50) препаратов рассчитывали при помощи программы Origin 8.0 (“OriginLab”) по формуле такой же, как и для IC50. Статистическую обработку полученных результатов проводили общепринятыми методами.

На фиг. 3 показана зависимость количества живых клеток HeLa (фиг. 3а), CaSki (фиг. 3б) и L-68 (фиг. 3в) от концентрации ингибитора. Полученные значения TC50 составили 236±10 нМ для клеток HeLa, 118±3 нМ для клеток CaSki и >10000 нМ для клеток L-68. Половинная токсическая концентрация для контролей составила 4 и >50 мкМ для Lipofectamin'а и контрольного олигонуклеотида соответственно.

Олигодезоксирибонуклеотидный ингибитор ДНК-метилтрансферазы 1 человека, характеризующийся тем, что он имеет самокомплементарную структуру (5′→3′):
5′GAATGGATCCGCTCTAACTGCCCCCAGTTAGAG(5mC)AGATCCATTC3′, которая образует двуцепочечную шпильку, имеет неспаренную СА пару в сайте узнавания фермента ДНК-метилтрансферазы 1 человека 5′-CG-3/3′-A(5mC)-5′ и содержит в своем составе тиофосфаты вместо фосфатов, где 5mC - 5-метилцитозин.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложен способ печати биологических лигандов, представляющих собой олигосахариды, и/или полисахариды, и/или пептиды, и/или гликопептиды, и/или биотин.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.
Изобретение относится к области биохимии и молекулярной биологии, а именно к способу очистки синтетических олигодезоксирибонуклеотидов. Основной задачей настоящего изобретения является разработка эффективного способа очистки олигодезоксирибонуклеотидов с высоким выходом и высокой степенью очистки от производных кремниевой кислоты, пригодного для крупномасштабного синтеза.

Изобретение относится к области биотехнологии, а именно к реагенту для предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР), способу предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР-амплификация) и наборам, которые включают данный реагент.

Изобретение относится к области биотехнологии, а именно к способу и набору для определения наличия или отсутствия мутации в гене PIK3CA. .

Изобретение относится к области биохимии и молекулярной биологии и может быть использовано для детекции нуклеиновых кислот, диагностики и/или лечения заболеваний.

Изобретение относится к области биотехнологии, в частности к полипептиду и его гомодимеру, которые обладают агонистической активностью в отношении рецептора гормона роста, молекуле нуклеиновой кислоты, их кодирующей, вектору, который включает данную нуклеиновую кислоту, клетке для экспрессии данного полипептида, фармацевтической композиции и способу с применением вышеуказанных полипептидов для лечения дефицита гормона роста.

Изобретение относится к области биотехнологии, а именно к способу оценки эффективности терапии рака мочевого пузыря человека методом ПЦР в режиме реального времени и набору для его осуществления.

Изобретение относится к медицине, а именно к экспериментальной хирургии, и может быть использовано для лечения инфекционного перитонита в эксперименте. Для этого крысам внутривенно вводят суспензию аллогенных мезенхимальных стволовых клеток из расчета 1,5×106 на 100 г массы животного в 2 мл физиологического раствора.

Изобретение относится к области биотехнологии, конкретно к лентивирусной доставке апоптина в опухолевые ткани, и может быть использовано в медицине. Способ включает получение лентивирусного конструкта, экспрессирующего модифицированный апоптин, слитый с секреторным сигналом лактотрансферрина и трансдукторным сигналом (ST-CTP-апоптин), с последующим получением рекомбинантных лентивирусных частиц, дефектных по репликации и несущих модифицированный апоптин, которые затем вводятся в Т-лимфоциты (TILs), полученные при хирургическом удалении опухоли или в процессе получения биопсии, которые обладают способностью проникать в опухолевые ткани.

Изобретение относится к области биотехнологии, конкретно к получению олигопептидных соединений, содержащих мотив, взаимодействующий с ядерным антигеном пролиферирующих клеток (PCNA), и может быть использовано в медицине.

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине.

Изобретение относится к химико-фармацевтической промышленности и представляет собой способ уменьшения продуцирующих внеклеточный матрикс клеток в легких или подавления увеличения продуцирующих внеклеточный матрикс клеток в легких, содержащий введение субъекту композиции, содержащей (i) носитель, содержащий ретиноид в качестве направляющего агента, и (ii) лекарственное средство, выбранное из группы, состоящей из миРНК, рибозима, антисмысловой нуклеиновой кислоты и ДНК/РНК химерного полинуклеотида, который нацелен на HSP47, и векторов, экспрессирующих указанные миРНК, рибозим, антисмысловую нуклеиновую кислоту и/или ДНК/РНК химерный полинуклеотид.

Изобретение относится к биотехнологии, конкретно к композициям для индукции развития кровеносных сосудов в тканях, и может быть использовано в медицине. Способ предусматривает трансформацию штамма E.

Изобретение относится к биотехнологии, в частности к опухолеспецифичным промоторам, и может быть использовано в противоопухолевой терапии. Сконструированы опухолеспецифичные промоторы широкого спектра действия, обеспечивающие экспрессию терапевтического гена внутри раковой клетки.

Настоящее изобретение относится к биотехнологии и представляет собой молекулярные конъюгаты, способные связываться с нуклеиновыми кислотами (ДНК или РНК) для доставки их в клетки млекопитающего, экспрессирующие рецепторы трансферрина.

Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано в медицине. Способ включает масштабирование диплоидных клеток линии М-20 из криобанка ИПВЭ им.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложена молекула RNAi для супрессии экспрессии тимидилатсинтазы за счет действия RNAi, содержащая домен двухцепочечной РНК, состоящий из смысловой цепи, состоящей из нуклеотидной последовательности, представленной SEQ ID NO: 1, гибридизованной с антисмысловой цепью, гибридизующейся в жестких условиях со смысловой цепью.

Настоящее изобретение относится к биотехнологии и представляет собой конъюгат для внутриклеточной доставки миРНК, содержащий миРНК, которая посредством ковалентной связи конъюгирована с одной стороны с гидрофильным соединением, например, с ПЭГ, а с другой стороны с гидрофобным соединением, например с холестерином. Такие конъюгаты способны путем самосборки формировать гомогенные наночастицы, мицеллы, в которых гидрофобные соединения пакуются внутри мицеллы, миРНК - между гидрофобными и гидрофильными соединениями, а гидрофильные соединения - снаружи. Настоящее изобретение также раскрывает способы получения указанного конъюгата, фармацевтические композиции, содержащие указанные наночастицы, для генотерапии различных заболеваний в зависимости от конкретной доставляемой миРНК. В том числе раскрыта фармацевтическая композиция для лечения рака, которая содержит наночастицы, содержащие сурвивин-специфическую миРНК. Настоящее изобретение позволяет повышать устойчивость миРНК в живом организме, обеспечивая тем самым эффективную доставку лечебной миРНК в клетки и проявление активности миРНК даже в малой дозе относительно низкой концентрации. 10 н. и 15 з.п. ф-лы, 19 ил., 1 табл., 6 пр.
Наверх