Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части генов nkx2.5, cfc1, gata4 и выявления мутаций, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца

Изобретение относится к области кардиологии и касается набора синтетических олигонуклотидов. Представленный набор используется для выявления мутаций кодирующей части генов NKX2.5, CFC1, GATA4, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца. Мутации выявляют путем определения полной нуклеотидной последовательности кодирующей части генов NKX2.5, CFC1, GATA4. Осуществляют амплификацию кодирующей части генов NKX2.5, CFC1, GATA4 с помощью 15 пар синтетических олигонуклеотидов при одной температуре и времени отжига с последующим секвенированием полученных продуктов амплификации с помощью одной пары универсальных праймеров. Предложенное изобретение позволяет чувствительно и специфично определять мутации генов NKX2.5, CFC1, GATA4, при этом сокращаются время реакции амплификации, количество манипуляций, время внесения реактивов для реакции секвенирования и снижается вероятность ошибки при постановке реакции. 2 з.п. ф-лы, 1 ил., 4 табл.

 

Настоящее изобретение относится к области медицины, в частности к кардиологии и молекулярной биологии, и может быть использовано для выявления мутаций кодирующей части генов NKX2.5, CFC1, GATA4 и выявления мутаций, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца, для определения тактики ведения больных семейными формами врожденных пороков сердца и оценки рисков развития заболевания.

Примерно 1% всех новорожденных имеет аномалии развития сердца, или врожденные пороки сердца. Значительная часть этих аномалий ассоциирована с мутациями в генах, отвечающих за эмбриональное развитие сердца. Часть врожденных пороков сердца носит семейный характер. Ранняя диагностика таких состояний позволит подбирать своевременное и адекватное лечение, а также подбирать тактику ведения пациентов при планировании беременности.

Врожденные пороки сердца (ВПС) - дефекты в структуре сердца или прилегающих к нему крупных сосудов, присутствующих с рождения. ВПС являются одними из самых распространенных врожденных нарушений и самой распространенной причиной детской смертности. По данным van der Linde с соавторами, распространенность врожденных пороков сердца достигает 1% от числа всех новорожденных, из них преобладающими пороками являются дефект межжелудочковой перегородки и дефект межпредсердной перегородки [van der Linde D, Konings EEM, Slager MA, Witsenburg M, Helbing WA, Takkenberg JJM, Roos-Hesselink JW. (2011) Birth Prevalence of Congenital Heart Disease Worldwide: A Systematic Review and Meta-Analysis. Journal of the American College of Cardiology, Vol.58, Pages 2241-2247]. Наиболее известные причины врожденных пороков сердца - точечные генные изменения, либо хромосомные мутации в виде делеции или дупликации сегментов ДНК. В литературе описано не менее 12 генов, ассоциированных с развитием различных форм ВПС [Hinton RB Jr., Yutzey КЕ, Benson DW. (2005) Congenital heart disease: Genetic causes and developmental insights. Progress in Pediatric Cardiology, Vol.20, Pages 101-111]. Наиболее вовлеченными в нормальное развитие сердца являются такие гены как NKX2.5, GATA4, также важную роль в нормальном развитии сердца играют гены CFC1, ТВХ5, PTPN11 и другие. Мутации в этих генах приводят к морфофункциональным нарушениям сердца, которые являются причиной врожденных пороков сердца разной степени выраженности. Диагностика и терапия у детей с сердечно-сосудистыми заболеваниями требует мультидисциплинарного подхода для раннего выявления причин, характера и выраженности заболевания. В случае семейных форм ВПС, генетическая диагностика позволит осуществить ранний прогноз развития заболевания у всех членов семьи и сделать информированный выбор при планировании беременности.

Быстрое генотипирование является важным инструментом для принятия информированного решения о дальнейшей стратегии лечения пациентов раннего возраста с сердечно-сосудистыми заболеваниями, в частности с ВПС. Однако известные до сих пор методы определения последовательности генов, ассоциированных с ВПС, слишком дорогие и трудозатратные, что не позволяет сделать их скрининговыми методами и оснастить ими большинство клинических лабораторий. Таким образом, в лабораторной практике высока потребность в разработке тест-системы для определения генов, ассоциированных с ВПС, достаточно простой для того, чтобы использовать ее в качестве скринингового метода дифференциальной диагностики ВПС, а также методов диагностики возможных нарушений при планировании беременности.

NKX2.5 - первый описанный маркер эмбрионального развития сердца позвоночных. Этот ген кодирует гомеобокс-содержащий транскрипционный фактор, который участвует в формировании и развитии сердца. Мутации гена NKX2.5 приводят к развитию дефектов межпредсердной перегородки с нарушениями атриовентрикулярной проводимости, а также тетраду Фалло, которые являются пороками сердца. Продукт гена NKX2.5 молекулярной массой 35 кДа представляет собой белки, относящиеся к классу гомеобокс-содержащих транскрипционных факторов. Ген NKX2.5 располагается на длинном плече хромосомы 5 (5q34). Ген состоит из 2 экзонов, которые расположены на участке 3209 пар оснований, и является высококонсервативным среди животных. NKX2.5 экспрессируется по всему развивающемуся сердцу. К настоящему времени описано более 50 мутаций кодирующей части гена NKX2.5.

Ген CFC1 кодирует белок Cripto с молекулярной массой 24 кДа, входящий в семейство эпидермальных факторов роста - FRL-1-CFC- Cryptic, которое задействовано в путях передачи сигнала во время эмбрионального развития. Cripto необходим для правильного формирования лево-правой эмбриональной оси. Мутации гена CFC1 ассоциированы с дефектами развития органов, в том числе с висцеральной гетеротаксией и врожденными пороками сердца. Ген CFC1 располагается на длинном плече хромосомы 2. Ген состоит из 6 экзонов, которые расположены на участке 7411 пар оснований, и является высококонсервативным среди позвоночных.

Ген GATA4 кодирует специфический для сердца транскрипционный фактор - GATA-связывающий белок 4. Этот белок с молекулярной массой 45 кДа принадлежит к группе родственных пальцевых белков, которые распознают последовательности ДНК известные как GATA мотив. GATA4 - критический регулятор развития сердца у человека, показано, что мутации гена GATA4 могут являться причиной врожденных пороков развития сердца. Также GATA4 участвует в поддержании нормального сердечного ремоделирования и процессах программированной клеточной гибели [Perrino С., Rockman НА. (2006) GATA4 and the two sides of gene expression reprogramming. Circ Res., Vol.98, No 6, Pages 715-716]. Ген GATA4 располагается на коротком плече хромосомы 8 (8р23). Ген состоит из 7 экзонов, которые расположены на участке 55793 пар оснований, и является высококонсервативным среди животных. GATA связывающий белок 4 экспрессируется во взрослом состоянии в тканях сердца, кишечном эпителии и гонадах. Во время эмбрионального развития этот белок экспрессируется в энтодерме желточного мешка и клетках, участвующих в формировании сердца. Известно, что GATA связывающий белок 4 и белок NKX2.5 могут физически взаимодействовать посредством С-терминальных цинковых пальчиков и соседней щелочной области GATA связывающего белка 4 и С-терминально располагающегося гомеодомена белка NKX2.5. Установлено также, что GATA связывающий белок 4 и белок NKX2.5 могут синергично активировать промотор ANF, кроме того их коооперация необходима для связывания с ДНК.

Выявление мутаций кодирующей части генов NKX2.5, CFC1, GATA4 рекомендовано для использования в практическом здравоохранении у больных различными видами врожденных пороков сердца для определения генетической причины заболевания. Однако в настоящее время в рутинной практике медицинских лабораторий не проводится скрининг мутаций кодирующей части генов NKX2.5, CFC1, GATA4, поскольку все известные способы определения последовательности кодирующей части этих генов требуют больших затрат времени, включают большое количество манипуляций и приводят к большому количеству ошибок из-за сложности постановки реакций.

Из уровня техники известен способ определения последовательности кодирующей части гена NKX2.5, описанный в: Zhang W, Li X, Shen A, Jiao W, Guan X, Li Z (2009) Screening NKX2.5 mutation in a sample of 230 Han Chinese children with congenital heart diseases. Genet Test Mol Biomarkers, Vol.13, No 2, Pages 159-162. При осуществлении этого способа геномную ДНК выделяют из образцов крови пациентов, применяя стандартную методику выделения ДНК. На выделенной ДНК проводят амплификацию методом полимеразной цепной реакции (ПЦР) с использованием 3 пар синтетических олигонуклеотидов, называемых также праймерами, сконструированных для 2 экзонов гена NKX2.5. Последовательности праймеров приведены ниже:

exon 1F CTTGTGCTCAGCGCTACCT

exon 1R CTGAGTTTCTTGGGGACGAA

exon 2-IF GCGCTCCGTAGGTCAAGC

exon 2-1R TAGGGATTGAGGCCCACG

exon 2-2F CAGACTCTGGAGCTGGTGG

exon 2-2R CCCACGAGAGTCAGGGAG.

ПЦР проводят с использованием 37,5 нг геномной ДНК, в присутствии буфера для ПНР, 1,5 ммоль/л MgCl2, 0,2 ммоль/л каждого деоксинуклеотидтрифосфата, 0,3 мкмоль/л прямого праймера, 0,3 мкмоль/л обратного праймера, 1 ед. Taq-полимеразы в конечном объеме 25 мкл. ПЦР проводят на амплификаторе РТС220 (MJ Research, Watertown, MA), используя следующий протокол: начальная денатурация 94°С в течение 3 мин, затем 35 циклов (денатурация при 94°С 30 секунд, отжиг при 60-63°С 30 секунд и элонгация при 72°С 30 секунд), и завершающая стадия синтеза при 72°С 7 мин. В результате ПЦР получают фрагменты ДНК размером 550, 469 и 443 пары оснований соответственно. Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе 3730 Automatic Sequencer (Applied Biosystems).

В Benson DW, Silberbach GM, Kavanaugh-McHugh A, Cottrill C, Zhang Y, Riggs S, Smalls 0, Johnson MC, Watson MS, Seidman JG, Seidman CE, Plowden J, Kugler JD. (1999) Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways. J Clin Invest., Vol.104, No 11, Pages 1567-1573 описан способ определения последовательности гена NKX2.5 с использованием следующих праймеров

1F GTCCCGCCTCTCCTGCCCCTTGTG

1R TCCTCCTCCTGGCCCTGAGTTTCT

2F TGGGCGCTCCAGGCAGGACACAGT

2R GCTTGCCATCGCGCACCAGCACTG

3F GTTCCAGAACCGGCGCTACAAGTG

3R GCGCGTGGGACAGAAAAAGTTCCT

При осуществлении этого способа ПЦР проводят с использованием 100 нг геномной ДНК, в присутствии 5 мкл раствора Q (QIAGEN Inc., USA), 1,5 ммоль/л MgCl2, 0,2 ммоль/л каждого деоксинуклеотидтрифосфата, 40 нг прямого праймера, 40 нг обратного праймера, Taq-полимеразы в конечном объеме 25 мкл. ПЦР проводят, используя следующий протокол: начальная денатурация 95°С в течение 2 мин, затем 35 циклов (денатурация при 94°С 10 секунд, отжиг при 65°С 30 секунд и элонгация при 68°С 2 минуты). Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе ABI377 с использованием Auto Assembler (Perkin-Elmer Biosystems, USA) и SEQMAN (DNASTAR Inc., USA).

Известен способ определения последовательности кодирующей части гена NKX2.5, описанный в: Goldmuntz E, Geiger E, Benson DW. (2001) NKX2.5 mutations in patients with tetralogy of fallot. Circulation, Vol.104, No 21, Pages 2565-2568. При осуществлении этого способа, геномную ДНК выделяют из образцов крови пациентов, применяя стандартную методику выделения ДНК. На выделенной ДНК проводят амплификацию методом полимеразной цепной реакции (ПНР) с использованием 4 пар праймеров, сконструированных для 2 экзонов гена NKX2.5. Последовательности праймеров приведены ниже:

1А 5' exon 1F CGGCACCATGCAGGGAAG

1A 5' exon 1R AGGGTCCTTGGCTGGGTCGG

1B 3' exon 1F CCTAAACCTGGAACAGCAGC

1B 3' exon 1R TCCTGGCCCTGAGTTTCTTG

2A 5' exon 2F GCGCTCCGTAGGTCAAGC

2A 5' exon 2R TAGGGATTGAGGCCCACG

2B 3' exon 2F CAGACTCTGGAGCTGGTGG

2В 3' exon 2R CCCACGAGAGTCAGGGAG

ПЦР проводят, используя следующий протокол: начальная денатурация 95°С в течение 2 мин, затем 35 циклов, состоящих из денатурации при 95°С в течение 45 секунд, отжига при 60 или 61°С в течение 30 секунд и элонгации при 72°С в течение 45 секунд. Завершающую стадию синтеза проводят при 72°С в течение 7 мин. В результате ПЦР получают фрагменты ДНК размером 404, 355, 469 и 442 пары оснований соответственно. Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе ABI Prism 373 или 377 (Applied Biosystems).

Из уровня техники известен способ определения последовательности кодирующей части гена GATA4, описанный в: Reamon-Buettner SM, Cho SH, Borlak J. (2007) Mutations in the 3'-untranslated region of GATA4 as molecular hotspots for congenital heart disease (CHD). BMC Med Genet., Vol.8, Page 38-50. При осуществлении этого способа геномную ДНК выделяют из образцов крови пациентов, применяя стандартную методику выделения ДНК. На выделенной ДНК проводят амплификацию методом полимеразной цепной реакции (ПНР) с использованием 13 пар праймеров, сконструированных для 7 экзонов гена GATA4. Последовательности праймеров приведены ниже:

GT4x1F CTTGCACGTGACTCCCACAG

GT4x1R AAGCAAAGGCGGAGAAGCTC

GT4x2-1F TCTCTTTCTGTCGTTCCTCTT

GT4x2-1R GCACGTAGACTGGCGAGGAC

GT4x2-2F GGACCATGTATCAGAGCTTGG

GT4x2-2R GCCCTCGCGCTCCTACTCAC

GT4x3F AGTCAGAGTGAGGAAGAGCAAGAG

GT4x3R CAGTTTCTGTGTGCCGAAGAG

GT4x4F CCAGCCCTGCCTCCCGTTAG

GT4x4R GAGGACTGAGAGATGGGCATCAG

GT4x5F AGTAGCCATCACATCACACAGG

GT4x5R AAAGCTCCCAACACGTTCC

GT4x6F GTTTGTCCCTGCCGCTGATT

GT4x6R GCAGTCGGCCTCCCCACAAA

GTx7-1F ACAAGGCTATGCGTCTCCC

GTx7-1R CTGAGAAAATCCAACACCCG

GT4x7-2F GCGTAATCTTCCCTCTTCCC

GT4x7-2R GGGACAAGGACATCTTGGG

GTx7-3F GTCGACAATCTGGTTAGGGG

GTx7-3R GTACATGGCAAACAGATGCC

GTx7-4F GAGGATCTGAGAACAAGCGG

GTx7-4R CAGCTGCATTTTGATGAGGC

GTx7-5F AAATTGTGGGGTGTGACATACA

GTx7-5R GTTGCAGAATCTCTGGCTTTTT

GTx7-6F CTGTCTGTCTGCTCCTCCTAGC

GTx7-6R ACCTCCCAGTGAAGACCACTAA

Для каждой пары праймеров подбирают свои условия ПЦР - время и температуру отжига. В результате ПЦР получают фрагменты ДНК размером 250, 600, 641, 541, 294, 504, 247, 289, 291, 281, 270, 577 и 586 пар оснований соответственно. Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе ABI 3100 (Applied Biosystems) с помощью набора реагентов «BigDyeTerminator v3.1 Kit» компании Applied Biosystems и указанных выше праймеров.

Известен способ определения последовательности кодирующей части гена GATA4, описанный в: Yang Y-Q, Wang M-Y, Zhang X-L, Tan H-W, Shi H-F, Jiang W-F, Wang X-H, Fang W-Y, Liu X. (2011) GATA4 loss-of-function mutations in familial atrial fibrillation. Clinica Chimica Acta, Vol.412, No 19-20, Pages 1825-1830. При осуществлении этого способа геномную ДНК выделяют из образцов крови пациентов, применяя стандартную методику выделения ДНК. На выделенной ДНК проводят амплификацию методом полимеразной цепной реакции (ПЦР) с использованием 7 пар праймеров, сконструированных для 6 экзонов гена GATA4. Последовательности праймеров приведены ниже:

2-aF GATCTTCGCGACAGTTCCTC

2-aR GTCCCCGGGAAGGAGAAG

2-bF GCTGGGCCTGTCCTACCT

2-bR AAAAACAAGAGGCCCTCGAC

3F GGGCTGAAGTCAGAGTGAGG

3R GATGCACACCCTCAAGTTCC

4F GAGATCTCATGCAGGGTCGT

4R GCCCCTTCCAAATCTAAGTC

5F TCTTTCTCGCTGAGTTCCAG

5R GGGATGTCCGATGCTGTC

6F GCCATCCCTGTGAGAACTGT

6R GAGGGTAGCTCACTGCTTGC

7F AAGTGCTCCTTGGTCCCTTC

7R TTCCCCTAACCAGATTGTCG

ПЦР проводят, используя стандартный протокол. В результате ПЦР получают фрагменты ДНК размером 458, 554, 437, 390, 379, 444 и 479 пары оснований соответственно. Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе ABI Prism 3130 (Applied Biosystems) с помощью набора реагентов BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) и указанных выше праймеров.

Из уровня техники известен способ определения последовательности кодирующей части гена CFC1, описанный в: Selamet Tiemey ES, Marans Z, Rutkin MB, Chung WK (2007) Variants of the CFC1 gene in patients with laterality defects associated with congenital cardiac disease. Cardiol Young, Vol.17, No 3, Pages 268-274. При осуществлении этого способа геномную ДНК выделяют из образцов крови пациентов, применяя стандартную методику выделения ДНК. На выделенной ДНК проводят амплификацию методом полимеразной цепной реакции (ПЦР) с использованием 5 пар праймеров, сконструированных для 6 экзонов гена CFC1. Последовательности праймеров приведены ниже:

1F CTGGAGTAAAGACACCTTCAAATG

1R ATTTATTCTGAGGCTCTTAAGACC

2-3F GATGTAAATTTCTGCTTATACTTC

2-3R TGAATTTATCCTACATATTCTCAG

4F TTTCACATCCCTAACAAGCAG

4R CCCTCTCCTGACGCCTACTC

5F CCACCGCATTGATGCAGGTC

5R GCACTGTGGATCGGTATGGAGG

6F GGACAGAGCCTAGTGAGGGCG

6R CCGGTCACAGTGGTGCTGGG

ПЦР проводят с использованием 100 нг геномной ДНК, в присутствии 2,5 мкл 10-кратного буфера для ПЦР, 50 мкмоль каждого деоксинуклеотидтрифосфата, 0,1 мкмоль/л прямого праймера, 0,1 мкмоль/л обратного праймера, 1 ед. Taq-полимеразы в конечном объеме 25 мкл. ПЦР проводят, используя следующий протокол: начальная денатурация 94°С в течение 30 секунд, затем 35 циклов, состоящих из денатурации при 94°С в течение 45 секунд, отжига при 63°С первые 12 циклов или 58°С в последующие, в течение 30 секунд и элонгации при 72°С в течение 30 секунд. Завершающую стадию синтеза проводят при 72°С в течение 6 мин. В результате ПЦР получают фрагменты ДНК размером 404, 355, 469 и 442 пары оснований соответственно. Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе ABI Prism 377 (Applied Biosystems) с использованием стандратных реагентов и описанных выше праймеров.

Однако провести диагностику всех трех генов, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца, с помощью этих способов очень трудоемко и такой анализ занимает много времени: из-за разной температуры и времени отжига, ПЦР для каждой пары праймеров нужно проводить отдельно. На стадии внесения реагентов в микропланшет для проведения секвенирования много времени уходит на проверку соответствия внесенных праймеров и продуктов амплификации. На этом этапе допускается основная масса ошибок, приводящих к необходимости проведения повторного определения последовательности кодирующей части генов NKX2.5, CFC1 и GATA4. Эти особенности делают невозможным широкое применение упомянутых способов в рутинной лабораторной практике для скрининга мутаций кодирующей части генов NKX2.5, CFC1 и GATA4.

Из уровня техники не выявлен прототип данного изобретения.

Техническим результатом, на достижение которого направлено изобретение, является сокращение времени, затрачиваемого в процессе амплификации, уменьшение количества манипуляций на стадии секвенирования, а также повышение точности и достоверности диагностики путем снижения вероятности ошибок при определении последовательности кодирующих экзонов генов NKX2.5, CFC1, GATA4.

Уменьшение затраченного времени достигается в результате проведения амплификации всех экзонов генов NKX2.5, CFC1, GATA4 одновременно при одной и той же температуре и времени отжига праймеров за счет использования предлагаемого набора праймеров с последовательностями Seq ID NO:1-30.

Дополнительно, уменьшение количества манипуляций и вследствие этого дополнительное уменьшение затраченного времени и снижение вероятности ошибок достигается в результате последующего секвенирования полученных продуктов амплификации с использованием одной пары универсальных праймеров за счет присоединения к последовательностям Seq ID NO:1-30 с 5'-конца последовательности одного из упомянутой пары универсальных праймеров.

В частности, в качестве таких универсальных праймеров могут быть использованы прямой праймер pUC/M13(-21) Seq ID NO:31 и обратный праймер М13(-29) Seq ID NO:32.

В настоящем изобретении предлагается набор праймеров для определения последовательности кодирующих экзонов генов NKX2.5, CFC1, GATA4, с использованием которого амплификацию всех экзонов можно проводить одновременно при одной температуре и времени отжига праймеров, а последующее секвенирование продуктов амплификации можно проводить с использованием одной пары универсальных праймеров.

Создание специфических праймеров для амплификации

Выбор специфических праймеров для амплификации интересующего фрагмента ДНК осуществляют способом, хорошо известным специалистам в данной области. Работа над созданием праймеров строится обычно следующим образом:

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей в целевом геноме выбирают уникальный участок, содержащий область интереса исследователя.

2) На основании выбранного участка генома с помощью специального программного обеспечения подбирают последовательность олигонуклеотидов, используемых для проведения ПЦР, как правило, 2 праймера. Многие из таких программ находятся в свободном доступе, например РптегЗ (http://frodo.wi.mit.edu/), Primer designing tool (NCBI), PerlPrimer (http://perlprimer. sourceforge.net/).

3) Пары праймеров дополнительно проверяют на полиморфизмы целевой последовательности в области, комплементарной 3'-концевому участку праймера.

4) К последовательностям прямых праймеров с 5'-конца присоединяют последовательность одного из универсальных праймеров, а к последовательностям обратных праймеров с 5'-конца присоединяют последовательность другого универсального праймера, отличную от той, которая присоединена к прямым праймерам.

4) Праймеры синтезируют на заказ в специализированном сервисном центре, например НПК Синтол.

5) С помощью практических экспериментов доказывают пригодность подобранных последовательностей праймеров для конкретных целей.

Выбор праймеров, являющихся предметом настоящего изобретения, характеризуется тем, что праймеры подбирали таким образом, чтобы оптимальные температура и время отжига всех праймеров для кодирующих экзонов генов NKX2.5, CFC1, GATA4 были одинаковыми.

Предлагаемый набор праймеров для амплификации кодирующих экзонов генов NKX2.5, CFC1, GATA4 характеризуется тем, что содержит

1) праймеры следующего нуклеотидного состава:

Праймер Последовательность нуклеотидов Номер последовательности
NKX2.5 ex01F GTGCTCAGCGCTACCTGC Seq ID NO:1
NKX2.5 ex01R GACAACACCAGGCATCTTAC Seq ID NO:2
NKX2.5 ex02_1F GCTCCAGGCAGGACACAG Seq ID NO:3
NKX2.5 ex02_1R CGAGTCCCCTAGGCATGG Seq ID NO:4
NKX2.5 ex02_2F CAGACTCTGGAGCTGGTGG Seq ID NO:5
NKX2.5 ex02_2R CCCCCGAGAGTCAGGGAG Seq ID NO:6
CFC1 ex01F CTGGAGTAAAGACACCTTCAAATG Seq ID NO:7
CFC1 ex01R ATTTATTCTGAGGCTCTTAAGACC Seq ID NO:8
CFC1 ex02-03F TATGTGAATTTCTGCTTATACTTC Seq ID NO:9
CFC1 ex02-03R TGAATTTATCCTACATATTCTCAG Seq ID NO: 10
CFC1 ex04F GGGTTTACCTGAGCAAACACAC Seq ID NO: 11
CFC1 ex04R CATTCACTGAGAAGACGGGGAC Seq ID NO: 12
CFC1 ex05F CTACTGCGAGCATGACCAGAG Seq ID NO: 13
CFC1 ex05R ACTGGAAGATGCACTGTGGATC Seq ID NO: 14
CFC1 ex06F GGACAGAGCCTAGTGAGGGCG Seq ID NO: 15
CFC1 ex06R CCGGTCACAGTGGTGCTGGG Seq ID NO: 16
GATA ex02_1F TTCCTCCCACGCATATTATC Seq ID NO:17
GATA ex02_1R CCACTGCTGTAGGCCGC Seq ID NO:18
GATA ex02_2F GTCCTACCTCCAGGGCG Seq ID NO:19
GATA ex02_2R AACGAAGGCGTTGGTGG Seq ID NO:20
GATA ex03F GTTTCTGTGCGCTCTAGATTCTC Seq ID NO:21
GATA ex03R CCAGAGGATGTCCCACCAAG Seq ID NO:22
GATA ex04F AGATCTCATGCAGGGTCGTTAG Seq ID NO:23
GATA ex04R CTAGTACAAAGGAAGAAGACAAGGG Seq ID NO:24
GATA ex05F AGGTGTGTGTCTTTCAATGCTG Seq ID NO:25
GATA ex05R CTGCCTAACCCGGAAGATATG Seq ID NO:26
GATA ex06F CATTAGCTTGCACCCATCCC Seq ID NO:27
GATA ex06R GTACTAGGCTGGCCTCTGGG Seq ID NO:28
GATA ex07F GGGACATCTGCATAGCAGGG Seq ID NO:29
GATA ex07R GTTGTTCTGGAGTCATTACCAGG Seq ID NO:30

2) дополнительно, к последовательностям праймеров Seq ID NO:1, Seq ID NO:3, Seq ID NO:5, Seq ID NO:7, Seq ID NO:9, Seq ID NO:11, Seq ID NO:13, Seq ID NO:15, Seq ID NO:17, Seq ID NO:19, Seq ID NO:21, Seq ID NO:23, Seq ID NO:25, Seq ID NO:27, Seq ID NO:29, называемых «прямыми праймерами», с 5'-конца присоединена последовательность одного универсального праймера, например прямого праймера pUC/M13(-21) Seq ID NO:31, а к последовательностям праймеров Seq ID NO:2, Seq ID NO:4, Seq ID NO:6, Seq ID NO:8, Seq ID NO:10, Seq ID NO:12, Seq ID NO:14, Seq ID NO:16, Seq ID NO:18, Seq ID NO:20, Seq ID NO:22, Seq ID NO:24, Seq ID NO:26, Seq ID NO:28, Seq ID NO:30, называемых «обратными праймерами», с 5'-конца присоединена последовательность другого универсального праймера, например обратного праймера М13(-29) Seq ID NO:32.

Помимо предлагаемых праймеров, в реакционную смесь для амплификации входят следующие компоненты:

- смесь дезоксирибонуклеотидтрифосфатов четырех типов (dATP, dTTP, dGTP, dCTP);

- фермент Taq-полимераза;

- реакционный буфер: 100 ммоль Tris-HCl, pH 8,8 при 25°С, 500 ммоль KCl, 20 ммоль MgCl2);

Амплификация экзонов генов NKX2.5, CFC1, GATA4

Кодирующая часть гена NKX2.5 длиной 1669 пар нуклеотидов состоит из 2 фрагментов, или экзонов. Кодирующая часть гена CFC1 длиной 1677 пар нуклеотидов состоит из 6 фрагментов, или экзонов. Кодирующая часть гена GATA4 длиной 3419 пар нуклеотидов состоит из 7 фрагментов, или экзонов. В случае небольших экзонов, таких как 2 и 3 экзоны гена CFC1, предлагаемый набор праймеров позволяет амплифицировать 2 целых экзона с находящимся между фрагментами некодирующим участком гена, или интроном. В случае больших экзонов, например экзона 2 гена NKX2.5 и экзона 2 гена GATA4, амплификацию проводят в виде двух перекрывающихся фрагментов. Амплификацию проводят из расчета 15 реакций на один образец геномной ДНК по следующей схеме:

Номер реакционной смеси Номер экзона Используемые пары праймеров
1 NKX2.5 ex01 NKX2.5 ex01F, NKX2.5 ex01R
2 NKX2.5 ex02_1 NKX2.5 ex02_1F, NKX2.5 ex02_1R
3 NKX2.5 ex02_2 NKX2.5 ex02_2F, NKX2.5 ex02_2R
4 CFC1 ex01 CFC1 ex01F, CFC1 ex01R
5 CFC1 ex02-03 CFC1 ex02-03F, CFC1 ex02-03R
6 CFC1 ex04 CFC1 ex04F, CFC1 ex04R
7 CFC1 ex05 CFC1 ex05F, CFC1 ex05R
8 CFC1 ex06 CFC1 ex06F, CFC1 ex06R
9 GATA ex02_1 GATA ex02_1F, GATA ex02_1R
10 GATA ex02_2 GATA ex02_2F, GATA ex02_2R
11 GATA ex03 GATA ex03F, GATA ex03R
12 GATA ex04 GATA ex04F, GATA ex04R
13 GATA ex05 GATA ex05F, GATA ex05R
14 GATA ex06 GATA ex06F, GATA ex06R
15 GATA ex07 GATA ex07F, GATA ex07R

Реакцию амплификации проводят одновременно для всех реакционных смесей с использованием специализированного оборудования - амплификатора Veriti® Thermal Cycler, Applied Biosystems, США согласно следующему температурному режиму:

Температура Время Количество циклов
1 95°С 5 мин 1
2 95°С 45 сек 30
3 60°С 30 сек
4 72°С 30 сек
5 72°С 11 мин 1

Секвенирование экзонов генов NKX2.5, CFC1, GATA4

После окончания реакции амплификации полученные на первом этапе анализа продукты амплификации используют для постановки реакции секвенирования. В реакции секвенирования продуктов амплификации, полученных в результате первого этапа анализа, используют универсальные праймеры, например прямой праймер pUC/M13(-21) Seq ID NO:31 и обратный праймер М13(-29) Seq ID NO:32. При этом праймеры смешивают с реакционным буфером перед работой, и таким образом исключают стадию внесения разных праймеров в лунки микропланшета, в которых будет проходить реакция секвенирования, это существенно снижает риск допустить ошибку во время внесения компонентов и уменьшает время внесения реактивов более чем в два раза.

Реакцию секвенирования проводят с применением набора меченых дидезоксирибонуклеотидтрифосфатов (BigDye Terminator Cycle Sequencing Kit, версия 3.0, Applied Biosystems, США) и специализированного оборудования - амплификатора Veriti® Thermal Cycler, Applied Biosystems, США, согласно следующему температурному режиму:

Температура Время Количество циклов
1 96°С 1 мин 1
2 96°С 10 сек 25
3 50°С 5 сек
4 60°С 4 мин

Электрофоретический анализ продуктов секвенирования производят на секвенаторе ABI PRISM 377, Applied Biosystems, США. Обработку полученных данных производят с помощью программы BioEdit, или другого аналогичного программного обеспечения.

Изобретение иллюстрируется следующим графическим материалом.

На чертеже представлено графическое изображение результатов секвенирования полученных при использовании заявляемых праймеров для амплификации и определения нуклеотидной последовательности 2 экзона гена NKX2.5. Обнаружен полиморфизм - синонимичная замена A/G (Glu→Glu) с положением 21 в белке.

Заявляемый набор праймеров применяют следующим образом.

1) Получение биологического материала от пациента. В качестве образцов для проведения анализа могут быть использованы биоптаты тканей, кровь, соскобы буккального эпителия.

2) Выделение и очистка препаратов ДНК из исходных образцов. Способы выделения ДНК из биологического материала хорошо известны специалистам и, как правило, включают стадии лизиса клеток, выделения ДНК и ее очистки. Быстрое и качественное выделение ДНК можно проводить с использованием коммерчески доступных наборов реагентов, например «Flexi Gene DNA kit» (не являются предметом данного патента).

3) Амплификация полученных препаратов геномной ДНК с применением предлагаемого набора праймеров, специфичных к экзонам генов NKX2.5, CFC1, GATA4, 15 реакций при одинаковых условиях, 1 загрузка амплификатора. Электрофоретическое разделение и последующая очистка продуктов амплификации.

4) Секвенирование продуктов амплификации, полученных в п.3 с применением пары коммерчески доступных универсальных праймеров, 7 реакций. Очистка продуктов реакции секвенирования и последующий капиллярный электрофорез.

5) Анализ результатов реакции секвенирования с использованием специализированного программного обеспечения, например BioEdit.

Перечень последовательностей нуклеотидов приведен в конце описания.

1. Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части генов NKX2.5, CFC1, GATA4 и выявления мутаций, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца, включающий праймеры следующей нуклеотидной последовательности:

GTGCTCAGCGCTACCTGC Seq ID NO: 1
GACAACACCAGGCATCTTAC Seq ID NO:2
GCTCCAGGCAGGACACAG Seq ID NO:3
CGAGTCCCCTAGGCATGG Seq ID NO:4
CAGACTCTGGAGCTGGTGG Seq ID NO:5
CCCCCGAGAGTCAGGGAG Seq ID NO:6
CTGGAGTAAAGACACCTTCAAATG Seq ID NO:7
ATTTATTCTGAGGCTCTTAAGACC Seq ID NO:8
TATGTGAATTTCTGCTTATACTTC Seq ID NO:9
TGAATTTATCCTACATATTCTCAG Seq ID NO:10
GGGTTTACCTGAGCAAACACAC Seq ID NO:11
CATTCACTGAGAAGACGGGGAC Seq ID NO:12
CTACTGCGAGCATGACCAGAG Seq ID NO:13
ACTGGAAGATGCACTGTGGATC Seq ID NO:14.
GGACAGAGCCTAGTGAGGGCG Seq ID NO:15
CCGGTCACAGTGGTGCTGGG Seq ID NO:16
TTCCTCCCACGCATATTATC Seq ID NO:17
CCACTGCTGTAGGCCGC Seq ID NO:18
GTCCTACCTCCAGGGCG Seq ID NO:19
AACGAAGGCGTTGGTGG Seq ID NO:20
GTTTCTGTGCGCTCTAGATTCTC Seq ID NO:21
CCAGAGGATGTCCCACCAAG Seq ID NO:22
AGATCTCATGCAGGGTCGTTAG Seq ID NO:23
CTAGTACAAAGGAAGAAGACAAGGG Seq ID NO:24
AGGTGTGTGTCTTTCAATGCTG Seq ID NO:25
CTGCCTAACCCGGAAGATATG Seq ID NO:26
CATTAGCTTGCACCCATCCC Seq ID NO:27
GTACTAGGCTGGCCTCTGGG Seq ID NO:28
GGGACATCTGCATAGCAGGG Seq ID NO:29
GTTGTTCTGGAGTCATTACCAGG Seq ID NO:30

2. Набор синтетических нуклеотидов по п. 1, в котором к последовательностям Seq ID NO:1, Seq ID NO:3, Seq ID NO:5, Seq ID NO:7, Seq ID NO:9, Seq ID NO:11, Seq ID NO:13, Seq ID NO:15, Seq ID NO:17, Seq ID NO:19, Seq ID NO:21, Seq ID NO:23, Seq ID NO:25, Seq ID NO:27, Seq ID NO:29 с 5'-конца присоединена последовательность первого универсального праймера, а к последовательностям Seq ID NO:2, Seq ID NO:4, Seq ID NO:6, Seq ID NO:8, Seq ID NO:10, Seq ID NO:12, Seq ID NO:14, Seq ID NO:16, Seq ID NO:18, Seq ID NO:20, Seq ID NO:22, Seq ID NO:24, Seq ID NO:26, Seq ID NO:28, Seq ID NO:30 с 5'-конца присоединена последовательность второго универсального праймера, при этом в качестве первого и второго универсального праймера используют разные универсальные праймеры.

3. Набор синтетических нуклеотидов по п.2, в котором в качестве одного из первого или второго универсальных праймеров используют прямой праймер pUC/M13(-21) Seq ID NO:31, а в качестве другого универсального праймера используют обратный праймер М13(-29) Seq ID NO:32.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к паре синтетических олигонуклеотидных праймеров, применяемых для выделения ДНК провируса и РНК вируса иммунодефицита кошек, и к способу диагностики вирусного иммунодефицита кошек с использованием данных праймеров.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации вируса лихорадки долины Рифт методом обратно транскриптазной полимеразной цепной реакции в реальном времени.
Изобретение относится к области биохимии, в частности к способу подвидовой дифференциации штаммов возбудителя чумы. Способ предусматривает выделение ДНК, проведение ПЦР с применением синтезированных праймеров для амплификации фрагментов межгенных участков wzyE-dapF и YPDF_0064-YPDSF_0065 исследуемого штамма.

Изобретение относится к области биотехнологии, конкретно к лентивирусной доставке апоптина в опухолевые ткани, и может быть использовано в медицине. Способ включает получение лентивирусного конструкта, экспрессирующего модифицированный апоптин, слитый с секреторным сигналом лактотрансферрина и трансдукторным сигналом (ST-CTP-апоптин), с последующим получением рекомбинантных лентивирусных частиц, дефектных по репликации и несущих модифицированный апоптин, которые затем вводятся в Т-лимфоциты (TILs), полученные при хирургическом удалении опухоли или в процессе получения биопсии, которые обладают способностью проникать в опухолевые ткани.

Изобретение относится к биотехнологии, а именно к способу анализа соматических мутаций в генах EGFR, KRAS и BRAF. Способ включает амплификацию фрагментов генов EGFR, KRAS и BRAF с помощью LNA-блокирующей мультиплексной «гнездовой» ПЦР, в которой в качестве матрицы для амплификации используется образец опухолевой ДНК.
Изобретение относится к области медицины и предназначено для диагностики вагинита у женщин репродуктивного возраста. Во влагалищных соскобах измеряют уровни экспрессии мРНК генов TNF, IL18, GATA3 и TLR4.

Группа изобретений относится к области биотехнологии, в частности к микроматричной геномной селекции (MGS). Устройство содержит:(a) по меньшей мере одну реакционную зону, содержащую микроматрицу, одну или более единиц контроля и регуляции температуры для контроля и регуляции температуры внутри реакционной зоны; (b) по меньшей мере одну нереакционную зону, содержащую одну или более единиц контроля и регуляции температуры для контроля и регуляции температуры внутри нереакционной зоны, которая соединена с возможностью переноса жидкости с реакционной зоной; и (c) по меньшей мере одно средство переноса, способное генерировать и/или регулировать поток жидкости между указанной реакционной зоной (а) и указанной нереакционной зоной (b).

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа.
Изобретение относится к области биохимии, в частности к набору олигонуклеотидных зондов для диагностики популяции людей, проживающих на территории РФ, на наследственные моногенные заболевания, путем выявления мутаций и/или полиморфизмов.
Изобретение относится к области биотехнологии и касается способа выявления и генотипирования бактерии Pasteurella multocida. Предложенный способ включает проведение ПЦР с электрофоретической детекцией результатов, перенос продукта амплификации на гель и оценку проведения реакции.
Изобретение относится к области биотехнологии и касается способа выявления и генотипирования бактерии Pasteurella multocida. Предложенный способ включает проведение ПЦР с электрофоретической детекцией результатов, перенос продукта амплификации на гель и оценку проведения реакции.

Настоящее изобретение относится к биотехнологии, молекулярной медицине, в частности генной инженерии. Описаны искусственные ДНК-конструкции, демонстрирующие высокую активность транскрипционного промотора человека, с которого осуществляется экспрессия расположенной ниже произвольной нуклеотидной последовательности, транскрибируемой РНК-полимеразой II.

Изобретение относится к биотехнологии, а именно к способу детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот с использованием праймера, генерирующего сигнал от мишени (TSG-праймера).

Изобретение относится к биохимии. Описан способ индукции апоптоза клеток злокачественной опухоли колоректального рака.

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу.

Изобретение относится к биотехнологии, а именно к новым IL-17-ингибирующим полипептидам, соответствующим слитым белкам, к композициям и применению их в медицинских целях.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин.

Группа изобретений относится к области биотехнологии и медицины. Введение субъекту молекулы нуклеиновой кислоты при лечении волчаночного нефрита, которая способна связываться с MCP-1 и является антагонистом МСР-1, где молекула нуклеиновой кислоты содержит последовательность нуклеиновой кислоты SEQ ID NO:37 совместно с иммуносупрессивным средством, позволяет снизить дозу вводимого иммуносупрессивного средства.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного. Рассмотрены содержащие конкатемерную молекулу фармацевтические композиции и набор, а также применение для изготовления средства для модуляции иммунной системы или для модуляции активности иммунной системы человека или животного молекулы и композиции по изобретению. Данное изобретение может найти дальнейшее применение в качестве иммуномодулятора в терапии различных заболеваний. 5 н. и 15 з.п. ф-лы, 4 ил.

Изобретение относится к области кардиологии и касается набора синтетических олигонуклотидов. Представленный набор используется для выявления мутаций кодирующей части генов NKX2.5, CFC1, GATA4, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца. Мутации выявляют путем определения полной нуклеотидной последовательности кодирующей части генов NKX2.5, CFC1, GATA4. Осуществляют амплификацию кодирующей части генов NKX2.5, CFC1, GATA4 с помощью 15 пар синтетических олигонуклеотидов при одной температуре и времени отжига с последующим секвенированием полученных продуктов амплификации с помощью одной пары универсальных праймеров. Предложенное изобретение позволяет чувствительно и специфично определять мутации генов NKX2.5, CFC1, GATA4, при этом сокращаются время реакции амплификации, количество манипуляций, время внесения реактивов для реакции секвенирования и снижается вероятность ошибки при постановке реакции. 2 з.п. ф-лы, 1 ил., 4 табл.

Наверх