Члены связывания против il-1r1

Изобретение относится к области биотехнологии и иммунологии. Описаны различные варианты антител, специфические в отношении IL-1R1. Раскрытые антитела могут быть пригодны для лечения расстройств, опосредованных IL-1R1, включая ревматоидный артрит, астму, хроническое обструктивное заболевание легких (ХОЗЛ). Предложенная группа изобретений может быть использована в медицине. 13 н. и 8 з.п.ф-лы, 14 ил., 12 табл., 5 пр.

 

Изобретение относится к членам связывания, особенно молекулам антитела, для рецептора-1 интерлейкина 1 (IL-1R1). Члены связывания применяются для лечения нарушений, опосредованных IL-1R1, включая ревматоидный артрит, астму и хроническое обструктивное заболевание легких (ХОЗЛ). Изобретение также относится к способам получения таких членов связывания, способам лечения нарушений, опосредованных IL-1R1 с применением членов связывания по изобретению, и применению членов связывания по изобретению для получения лекарственного средства для лечения нарушений, опосредованных IL-1R1.

Интерлейкин 1 (IL-1) является многофункциональным цитокином, который играет важную роль в воспалительных реакциях при иммуно-обусловленных заболеваниях и инфекциях. IL-1 продуцируется различными типами клеток после стимуляции бактериальными продуктами, цитокинами или иммунными комплексами. IL-1 демонстрирует аутокринную и паракринную активность в различных типах клеток, способствуя выработке медиаторов воспаления, таких как простагландины, оксид азота, цитокины, хемокины, металлопротеиназы и адгезивные молекулы. Блокада биологической активности IL-1 должна быть благоприятной для предотвращения повреждений тканей, вызванных чрезмерной выработкой или дисрегуляцией активности IL-1 или нормализацией аберрантных ответов на патогенные факторы, например, во время обострения ХОЗЛ.

Семейство цитокинов IL-1 на данный момент состоит из одиннадцати отдельных членов, IL 1 альфа (IL-1α), IL-1 бета (IL-1β), интерлейкин-18 (IL-18), антагонист интерлейкина 1 (IL-1Ra), IL1F5-10 и интерлейкин-33 (IL-33). Четыре из них, а именно: IL-1α, IL-1β, IL-18 и IL-1Ra (антагонист рецептора IL-1), охарактеризованы наиболее полно и связаны с патологическими процессами при различных заболеваниях, и IL-1α, IL-1β и IL-1Ra, как было показано, взаимодействуют с мембранным IL-1R1 (1, 2, 3). IL-1α и IL-1β являются продуктами отдельных генов. Эти белки связаны на аминокислотном уровне, IL-1α и IL-1β обладают 22% гомологии, в случае IL-1α и IL-1Ra степень гомологии составляет 18%. IL-1β обладает 26% гомологии с IL-1Ra. Гены для IL-1α, IL-1β и IL-1Ra членов находятся на аналогичных участках в человеческой хромосоме 2q14 (4, 5).

Как IL-1α, так и IL-1β синтезируются в виде предшественников пептидов с массой 31кДа, которые расщепляются для создания зрелых IL-1α и IL-1β размером 17кДа. IL-1β продуцируется с помощью различных типов клеток, включая эпителиальные клетки и макрофаги. Он высвобождается из клетки после расщепления цистеинпротеазой каспазой-1 (IL-1β преобразующий фермент (ICE) (6)). IL-1α расщепляется протеазой кальпаином и может оставаться на клеточной мембране, откуда он активирует клетки с помощью прямого контакта клетки с клеткой (7). Рrо-IL-1α содержит последовательность ядерной локализации на N-конце, что может привести к активации ряда клеточных путей (8).

IL-1Ra является естественным ингибитором IL-1. Он продуцируется в виде четырех различных изоформ, полученных путем альтернативного сплайсинга и альтернативной инициации трансляции. Секретируемая изоформа IL-1Ra размером 17 кДа экспрессируется в виде вариабельно гликозилированной формы, размером 22-25 кДа (9, 10), которая названа sIL-1Ra. Внутриклеточная изоформа размером 18 кДа называется icIL-1Ra1 (11). Изоформа icIL-1Ra2 продуцируется с помощью альтернативного транскрипционного сшивания с экзоном, расположенным между icIL-1Ra1 и sIL-1Ra первыми экзонами (12). Третья внутриклеточная изоформа icIL-1Ra3 размером 16 кДа также была определена (13). Кинерет® (анакинра) является рекомбинантной, негликозилированной формой растворимого антагониста человеческого рецептора интерлейкина-1 (IL-1Ra). Кинерет® отличается от природного человеческого IL-1Ra тем, что содержит один добавленный остаток метионина на N-конце. Кинерет® состоит из 153 аминокислот, и его молекулярная масса составляет 17,3 кДа. Кинерет® одобрен для лечения умеренного и тяжелого активного ревматоидного артрита.

IL-1α и IL-1β проявляют свои биологические эффекты через связывание с трансмембранным рецептором IL-1R1 (RefSeq NM_00877), который принадлежит к семейству рецепторов IL-1. В настоящее время найдены 10 членов семейства рецепторов IL-1 (14); IL-1 рецептор 1 (IL-1R1 (80 кДа)), IL-1RII (68 кДа) и IL-1 рецептор акцессорного белка (IL-1RacP), имеющие актуальное значение для проведения сигнала IL-1α и β. IL-1R1 и IL-1RacP образуют комплекс в клеточной мембране для формирования рецептора с высоким сродством, способного проводить сигнал при связывании с IL-1α и IL-1β. IL-1Ra связывается с IL-1R1, но не взаимодействует с IL-1RAcP. IL-1α, IL-1β и IL-1Ra также связываются с IL-RII, который не имеет внутриклеточного сигнального домена.

Все три этих рецептора могут быть экспрессированы как мембраносвязанные или растворимые белки. IL-1R типа I (IL-1R1), IL-1RII и IL-1R акцессорный белок (IL-1RAcP) принадлежат к суперсемейству гена иммуноглобулина (Ig), с внеклеточным участком, содержащим три Ig-подобных домена. IL-1R1 и IL-1RacP содержат цитоплазматические домены (Toll-подобные IL-1R (TIR) домены), которые связаны с суперсемейством Toll-подобных рецепторов (TLR). IL-1R1 называется сигнальным рецептором, который в результате связывания с лигандом и комплексообразования с IL-1RAcP инициирует трансдукцию сигнала через цитоплазматический концевой сегмент из 213 аминокислотных остатков (15). Современная литература указывает на то, что IL-1RII действует только как "рецептор-ловушка", на поверхности клетки или внеклеточно, как растворимая форма (16).

Кристаллическая структура внеклеточного участка IL-1R1 связана с IL-1β была проанализирована с разрешением 2,5А (17). Два N-конца Ig доменов образуют жесткие связи с дисульфидным линкером, для третьего домена показана большая пластичность. IL-1R1 является обернутым вокруг IL-1β, с двумя существенными поверхностями контакта. Одна из них находится в бороздке между доменами 1 и 2, а вторая поверхность контакта с меньшей площадью локализована на третьем домене. Любопытно, что IL-1Ra также является связанным с участком бороздки между доменами 1 и 2 IL-1R1, однако там не будет происходить каких-либо контактов между IL-1Ra и третьим доменом Ig IL-1R1 (18).

Если IL-1 связан с цепью IL-1R1, IL-1RAcP укрепляет пару «лиганд-рецептор» и формирует рецепторный комплекс с высоким сродством, что приводит к инициированию трансдукции сигнала.

Модель взаимодействия IL-1RAcP с IL-1-IL-1R1 была предложена на основе исследований мутагенеза и антитела (19, 20 и 21). Это указывает на то, что IL-1RAcP взаимодействует с поверхностью контакта между IL-1 и IL-1R1. Эти исследования также показали, что АсР не может взаимодействовать с парой IL-1Ra-IL-lRl, которая является более расслабленной структурой. Greenfeder и др., (22) показали, что IL-1R1 связанный с IL-1Ra не в состоянии укреплять IL-1RacP, и поэтому не в состоянии передавать сигнал. ILRa действует, занимая сайт связывания на IL-1R1 для IL-1β и IL-1α и, кроме того, неспособен формировать сигнальный комплекс с IL-1RAcP.

Еще одним членом семейства IL-1R является тип II IL-1R (IL-1RII). Этот рецептор обладает высокой степенью гомологии с IL-1R1 во внеклеточном участке и может связываться с IL-1α и IL-1β. Существующие данные свидетельствуют о том, что IL-1RII, несмотря на это, не инициирует передачу сигнала, за неимением внутрицитоплазматического домена. Этот рецептор может быть расщеплен на поверхности клетки и вместе с мембранной формой выполнять функцию ингибиторов активности IL-1, выступая в качестве рецептора-ловушки (16). IL-1RII обладает высоким сродством к IL-1β и низким сродством к IL-1Ra, и это означает, что IL-1RII не блокирует ингибирующую активность IL-1Ra (23). Лиганд связывания для IL-1RII является причиной рекрутмента IL-1RAcP, однако этот комплекс остается без передачи сигнала (24). Поскольку IL-1RAcP устранен таким образом на IL-1RII и предотвращает IL-1RAcP связывание с IL-1R1, он может также блокировать действие IL-1 по этому механизму, что называется "корецепторной конкуренцией" (24). Однако, не было окончательно опровергнуто на данный момент, что IL-1RII может участвовать и в других цепях передачи сигнала, хотя клетки, которые экспрессируют высокие уровни IL-1RII, становятся нечувствительными к IL-1β (25).

Формирование комплекса с высоким сродством при связывании IL-1 с IL-1R1 приводит к формированию IL-1RAcP и инициации рецепторов передачи сигнала. IL-1R1 и IL-1RacP содержат цитоплазматические домены (Toll-подобные IL-1R (TIR) домены), которые связаны с суперсемейством Toll-подобного рецептора (TLR).

Во время трансдукции сигнала домен TIR адаптерной молекулы MyD88, взаимодействует с доменом TIR IL-1RAcP и вызывает формирование рецепторного комплекса, содержащего IRAK-4 и IRAK-1. Было предположено, что фосфорилированный IRAK, в свою очередь, вовлекает TRAF6 в рецепторный комплекс.Далее IRAK переносит TRAF6 к ТАК1, ТАВ1 и ТАВ2, которые тесно связаны на мембране до инициации формирования мембраносвязанного комплекса II. Формирование комплекса II приводит к фосфорилированию ТАК1 и ТАВ2 на мембране с помощью неизвестной киназы, с последующей диссоциацией TRAF6-TAK1-TAB1-ТАВ2 (комплекс III) от IRAK, что приводит в результате к транслокации комплекса III в цитозоле. Формирование комплекса III и его взаимодействие с дополнительными цитозольными факторами приводит к активации ТАК1. Фосфорилированный IRAK остается на мембране и в конечном итоге поддается убиквитинированию и расщеплению. Активация ТАК-1 приводит к активации IKK, расщеплению белков IkB, что приводит к активации NF-кВ, который активирует транскрипцию в ядре. Было также показано, что ТАК-1 играет роль в активации пути митоген-активированной протеинкиназы (МАРК), которая через активацию р38, INK и ERK1/2 регулирует активность транскрипционных факторов, включая AP1 (26). Поскольку проведение сигнала усиливается вниз по этим многоступенчатым путям, процент рецепторов, заполненных только лигандом, на клетку тоже должен быть низким для инициации физиологических реакций в экспрессирующих IL-1R клетках (возможно, всего 10 заполненных рецепторов на клетку).

IL-1 является одним из основных воспалительных цитокинов, которые играют важную роль во многих хронических воспалительных заболеваниях. Экспрессия IL-1 на уровне гена и белка была изучена при различных заболеваниях. Повышение уровней IL-1 было зарегистрировано при диабете 2 типа (27, 28, 29), солидных опухолях при ВИЧ-1, лейкозе, болезни Альцгеймера, ишемической болезни (30) и атеросклерозе (31), астме, ХОЗЛ и остеоартрите (32). С помощью разнообразных исследований in vitro и in vivo было показано, что IL-1 проявляет многочисленные биологические эффекты. Его плейотропное действие связанно с его важной ролью в экспрессии генов различных медиаторов воспаления, включая простаноиды, оксид азота, цитокины, хемокины, протеазы, молекулы адгезии и цитокины рецепторов экспрессии (32). Чрезмерная выработка или экспрессия этих медиаторов воспаления связана с патогенезом заболеваний, а также ремоделированием и разрушением тканей. Таким образом, IL-1 представляет собой ключевую терапевтическую мишень при многих распространенных воспалительных заболеваниях, таких как ревматоидный артрит, остеоартроз (ОА), бронхиальная астма и хроническое обструктивное заболевание легких (ХОЗЛ), сахарный диабет 2 типа, ишемическая болезнь и атеросклероз.

В настоящем изобретении предлагаются члены связывания, которые связываются с IL-1R1 и подавляют биологическую активность IL-1α и/или IL-1β, включая полностью человеческие антитела или антигенсвязывающие их части.

Члены связывания, направленные на IL-1R1, раскрыты в следующих международных патентных заявках: WO 2004/022718, WO 2005/023872, WO 2007/063311, WO 2007/063308 и WO 2006/059108.

В другом варианте изобретения предлагается выделенный член связывания, например, антитело, специфичное в отношении IL-1R1, которое конкурирует с IL-1Ra за связывание с IL-1R1.

В другом варианте изобретения предлагается выделенный член связывания, специфичный в отношении IL-1R1, который конкурирует с IL-1 и IL-1Ra за связывание с IL-1R1, и связывается с IL-1R1 с KD 10 пМ или менее, по данным Kinexa™. В одном из вариантов IL-1 имеет отношение к IL-1α, в другом варианте IL-1 имеет отношение к IL-1β. В другом варианте IL-1 имеет отношение к IL-1α и к IL-1β.

Антитела, которые блокируют связывание как IL-1, так и IL1Ra, считаются особенно эффективными. В отсутствие IL-1 IL-1R1 интернализируется с t1/2 около 11 час, однако в присутствии рецепторов IL-1 происходит более быстрая интернализация, таким образом, что t1/2 составляет примерно 1,5 часа [33, 34]. Напротив, IL-1Ra связывается с IL-1R1, но не вызывает увеличения интернализации рецептора [35]. Когда IL-1R1 является интернализированным, его нелегко вернуть обратно к поверхности мембраны [33], таким образом, вполне возможно, что антитела, которые связываются с эпитопом, сходным с собственно IL-1, могут быть легко интернализированы, и таким образом, могут быть направлены в эндосомальные пути и подвергаться клиренсу с высокой скоростью с помощью этого опосредованного рецептором механизма клиренса. Антитела к эпитопам, более сходным с IL-1 ra, могут быть менее восприимчивы к увеличению скорости интернализации рецепторов и могут не подвергаться усиленному клиренсу с помощью опосредованного рецептором механизма, и поэтому с большей вероятностью могут демонстрировать клиренс из кровотока и период полувыведения, характерные для человеческого IgG. В международной патентной заявке WO 2004/022718 раскрыт класс антител, которые блокировали связывание как IL-1, так и IL-1Ra с IL-1R1, однако, этот класс является гораздо менее эффективным, чем предпочтительный класс раскрытых антител, которые связываются с третьим доменом IL-1R и предотвращают связывание с IL-1β. Напротив, антитела по данному изобретению способны блокировать связывание IL-1 и IL-1Ra с IL-1R1 и связываться с IL-1R1 с высоким сродством.

В другом варианте изобретения предлагается выделенный член связывания, специфичный в отношении IL-1R1, демонстрирующий среднее значение IC50, для, по крайней мере, 6 разных доноров, менее 1 нМ для ингибирования индуцированной IL-1β выработки IL-6 в цельной человеческой крови в присутствии 30 пМ IL-1β. В других вариантах, среднее значение IC50 получено для, по крайней мере, 10, 15 или 20 различных доноров. В других вариантах средне значение IC50 составляет менее 800 пМ, менее 700 пМ, менее 600 пМ, менее 500 пМ, менее 400 пМ, менее 300 пМ, менее 300 пМ, менее 200 пМ, менее 100 пМ или менее 50 пМ.

Члены связывания по изобретению связываются с IL-1R1 и нейтрализуют IL-1R1 с высокой эффективностью. Нейтрализация обозначает ингибирование биологической активности IL-1R1. Члены связывания по изобретению могут нейтрализовать один или несколько видов биологических активности IL-1R1, как правило, члены связывания по изобретению ингибируют связывание IL1α и IL1β с IL-1R1.

Члены связывания по изобретению могут также связываться и нейтрализовать нечеловеческий IL-1R1, это ортолог IL-1R1, который встречается в природе в других видах, исключая человека.

Члены связывания по изобретению, как правило, специфичны в отношении IL-1R1 по сравнению с другими белками, и, таким образом, выборочно связываются с IL-1R1. Такая избирательность может быть определена или продемонстрирована, например, в стандартном анализе конкуренции.

Соответствующие тесты для измерения нейтрализации IL-1R1 путем связывания с членами по изобретению включают, например, лиганд-рецепторные биохимические тесты и поверхностный плазменный резонанс (SPR) (например, BIACORE™).

Кинетика и сродство связывания (выраженное в виде равновесной константы диссоциации KD) IL-1R1 с членом связывания для человеческого IL-1R1 могут быть определены, например, с помощью поверхностного плазменного резонанса (BIACORE™). Члены связывания по изобретению обычно обладают сродством к человеческому IL-1R1 (KD) менее приблизительно 1 нМ, а в некоторых вариантах KD менее приблизительно 100 мкМ, в других вариантах KD менее 50 пМ, в других вариантах KD менее 25 пМ, в других вариантах KD менее 10 пМ, в других вариантах KD менее 5 пМ, в других вариантах KD менее 3 пМ, в других вариантах kd менее 1 пМ.

Существует ряд методик для измерения сродства связывания антитела с антигенами, одной из таких методикой является KinExA™. Кинетический анализ исключения (KinExA™) является многоцелевой платформой иммуноанализа (с использованием проточного спектрофлуориметра), что позволяет измерять равновесные константы диссоциации и ассоциации и константы скорости диссоциации для взаимодействия антиген/антитело. Поскольку KinExA™ выполняется после достижения равновесия, это подходящий способ выполнения, используемый для измерения KD взаимодействия с высоким сродством, где скорость диссоциации для взаимодействия может быть очень медленной. Использование KinExA™ особенно уместно в данном случае, когда сродство антитела и антигена выше, чем можно точно предсказать по методу поверхностного плазменного резонанса. Методика KinExA™ может быть проведена, как описано в Drake et al (2004) Analytical Biochemistry 328, 35-43.

В одном из вариантов изобретения члены связывания по изобретению являются специфичными в отношении IL-1R с KD 300 пМ или ниже, по данным измерения с помощью методики KinExA™. Как вариант, KD равна 200 пМ или ниже, 100 пМ или ниже, 50 пМ или ниже, 20 пМ или ниже, или 10 пМ или ниже, 5 пМ или ниже, 3 пМ или ниже, 1 пМ или ниже.

Ингибирование биологической активности может быть частичным или полным. Члены связывания могут ингибировать биологическую активность IL-1R1, такую как индуцированное IL-1β высвобождение IL-8 в клетках CYNOM-K1, или индуцированное IL-1α и IL-1β высвобождение IL-8 в клетках HeLa, на 100%, или, альтернативно, не менее 95%, не менее 90%, не менее 85%, не менее 80%, не менее 75%, не менее 70%, не менее 60% или не менее 50% от активной концентрации IL-1α или β, которая индуцирует 50% или 80% от максимально возможной активности в отсутствие члена связывания.

Нейтрализующая способность членов связывания, как правило, выражается как значение IC50, в нМ, если не указано иное. В функциональных тестах, IC50 является концентрацией члена связывания, снижающей биологическую реакцию на 50% от максимальной. В исследованиях связывания с лигандом, IC50 является концентрацией, которая уменьшает связывание с рецептором на 50% от максимального уровня специфичного связывания. Значение IC50 может быть рассчитано путем построения зависимости % максимальной биологической реакции, как логарифмической функции, от концентрации членов связывания, с использованием программного обеспечения, такого как Prism (GraphPad Software Inc, Ла-Хойя, Калифорния, США), для перевода сигмоидальной функции в данные для генерации значений IC50. Эффективность может быть определена или измерена с помощью одного или нескольких тестов, известных специалисту, и/или как описано или упомянуто в данном описании. Эффективность нейтрализации членом связывания может быть выражена как геометрическое среднее значение (Geomean).

Нейтрализация активности IL-1R1 членом связывания в тесте, описанном в данном описании, означает, что член связывания связывается и нейтрализует IL-1R1. Другие способы, которые могут быть использованы для определения связывания IL-1R1 с членом связывания, включают ELISA, Вестерн-блоттинг, иммунопреципитацию, аффинную хроматографию и биохимические тесты.

Член связывания по изобретению может обладать таким же или более сильным сродством к человеческому IL-1R1, чем к IL-1R1 других видов. Сродство члена связывания к человеческому IL-1R1 может быть аналогичным или, например, в 5 или 10 раз превышать сродство к IL-1R1 яванского макака. Кроме того, член связывания может обладать аналогичным сродством к IL-1R1 человека и яванского макака.

Член связывания по изобретению включает обязательный мотив IL-1R1, содержащий один или нескольких участков CDR, например, "множество CDR" в структуре. Множество CDR состоит из одного или нескольких участков, выбранных из CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3. В одном из вариантов множество CDR включает HCDR3 из табл.2, дополнительно скомбинированый с одним или несколькими CDR, выбранными из: HCDR1, HCDR2, LCDR1, LCDR2 и LCDR3, например, одним или несколькими CDR, выбранными из: HCDR1, HCDR2, LCDR1, LCDR2 и LCDR3 из табл.2. В другом варианте изобретения множество CDR, содержащих HCDR3 и LCDR3 из табл.2, дополнительно скомбинировано с одним или несколькими CDR, выбранными из: HCDR1, HCDR2, LCDR1 и LCDR2, например, один или несколько выбранных из CDR: HCDR1, HCDR2, LCDR1 и LCDR2 в табл.2. В другом варианте изобретения множество CDR состоит из HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3 табл.2. Хотя это является предпочтительным для выбора одного или нескольких CDR из одного и того же антитела в табл.2, CDR может быть выбран из одного или нескольких антител, перечисленных в табл.2.

В другом варианте член связывания по изобретению, например, антитело, состоит из мотива связывания IL-1R1, включая один или несколько участков, выбранных из CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, например, как указано в табл.1а и 1b, в которых указанный член связывания специфично связывается с IL-1R1.

В другом варианте член связывания по изобретению, например, антитело, состоит из мотива связывания IL-1R1, включая один или несколько участков выбранных из CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, например, как указано в табл.1а и 1b, в которых указанный член связывания специфично связывается с IL-1R1 и конкурирует с IL-1β и IL-1Ra за связывание с IL-1R1, и связывается с IL-1R1 с KD 10 пМ или менее, по данным измерения с помощью KinExA™.

Как описано в данном описании, была выделена исходная молекула антитела, содержащая множество последовательностей участков CDR, как показано в табл.1 (см. Антитело 1). В рамках процесса оптимизации мы получили панель клонов антитела, пронумерованных 2-3, с участками CDR последовательности, полученными из гибридной последовательности CDR, с изменениями в положениях, указанных в табл.1. Так, например, как видно из табл.1а, Антитело 2 содержит гибридный HCDR1, HCDR2, LCDR1 и LCDR2, и гибридную последовательность HCDR3, в которой: остаток Kabat 100E заменен на Т, остаток Kabat 100F заменен на V, остаток Rabat 100G заменен на D, остаток Kabat 100H заменен на А, остаток Kabat 100I заменен на А, остаток Kabat 101 заменен на V и остаток Kabat 102 заменен на D.

Как описано в данном описании, была выделена вторая исходная молекула антитела, содержащая множество последовательностей участков CDR, как показано в табл.1b (см. Антитело 4). В рамках процесса оптимизации мы получили панель клонов антитела, пронумерованных 5-10, с последовательностями участков CDR, полученными из гибридной последовательности CDR, с изменениями в положениях, указанных в табл.1b. Например, как видно из табл.1b, Антитело 5 содержит исходные HCDR1, HCDR2, LCDR1 и LCDR2, и исходную последовательность HCDR3, в которой: остаток Kabat 100А заменен на А, остаток Kabat 100В заменен на Р, остаток Kabat 100С заменен на Р, остаток Kabat 100D заменен на Р, остаток Kabat 100E заменен на L, остаток Kabat 100F заменен на G, и остаток Kabat 100I заменен на G. Как видно из табл.1b, Антитело 6 содержит исходную последовательность HCDR1, HCDR2, LCDR1 и LCDR2, и исходную HCDR3, в которой: остаток Kabat 100A заменен на Е, остаток Kabat 100В заменен на Q, остаток Kabat 100C заменен на Y, остаток Kabat 100D заменен на G, остаток Kabat 100E заменен на V, остаток Kabat 100F заменен на V, остаток Kabat 100J был удален, остаток Kabat 101 заменен на F и остаток Kabat 102 заменен на V.

Описанный в данном описании, является членом связывания, содержащим множество исходных CDR, как показано в табл.1 (Антитело 1), где HCDR1 является SEQ ID NO: 93 (остатки Kabat 31-35), HCDR2 является SEQ ID NO: 94 (остатки Kabat 50-65), HCDR3 является SEQ ID NO: 95 (остатки Kabat 95-102), LCDR1 является SEQ ID NO: 98 (остатки Kabat 24-34), LCDR2 является SEQ ID NO: 99 (остатки Kabat 50-56) и LCDR3 является SEQ ID NO: 100 (остатки Kabat 89-97). Член связывания в соответствии с изобретением может также быть исходным членом связывания (Антитело 1), как показано в табл.1, где один или несколько CDR содержат одно или несколько добавление, замен, делеций и/или вставок аминокислот. В некоторых вариантах, член связывания включает множество CDR, содержащих от 1 до 12 добавлений, замен, делеций и/или вставок по отношению к исходной последовательности Антитела 1. В другом варианте содержится от 1 до 10 добавлений, замен, делеций и/или вставок относительно Антитела 1. В другом варианте содержится от 1 до 5 добавлений, замен, делеций и/или вставок по отношению к исходной последовательности Антитела 1. В другом варианте содержится от 1 до Зрех добавлений, замен, делеций и/или вставок относительно Антитела 1.

В некоторых вариантах член связывания по изобретению включает HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, и LCDR3; где HCDR3 содержит аминокислотную последовательность SEQ ID NO: 95, дополнительно включающую от 1 до 7 добавлений, замен, делеций и/или вставок аминокислот; и LCDR3 содержит аминокислотную последовательность SEQ ID NO: 100, дополнительно включающую от 1 до 5 добавлений, замен, делеций и/или вставок аминокислот. В таких вариантах HCDR1 может содержать аминокислотную последовательность SEQ ID NO: 93; HCDR2 может содержать аминокислотную последовательность SEQ ID NO: 94; LCDR1 может содержать аминокислотную последовательность SEQ ID NO: 98 и LCDR2 может содержать аминокислотную последовательность SEQ ID NO: 99. Кроме того, HCDR1, HCDR2, LCDR1, и LCDR2 могут также совместно содержать одно или несколько добавлений, замен, делеций и/или вставок аминокислот по отношению к исходной последовательности (Антитело 1), например, от 1 до 10 замен.

В данном описании описан член связывания, содержащий множество исходных CDR, как показано в табл.1b (Антитело 4), где HCDR1 является SEQ ID NO: 103 (остатки Kabat 31-35), HCDR2 является SEQ ID NO: 104 (остатки Kabat 50-65), HCDR3 является SEQ ID NO: 105 (остатки Kabat 95-102), LCDR1 является SEQ ID NO: 108 (остатки Kabat 24-34), LCDR2 является SEQ ID NO: 109 (остатки Kabat 50-56) и LCDR3 является SEQ ID NO: 110 (остатки Kabat 89-97). Член связывания в соответствии с изобретением может также быть исходным членом связывания, как показано в табл.1b, где один или несколько CDR включают одно или несколько добавлений, замен, делеций и/или вставок аминокислот. В некоторых вариантах член связывания включает множество CDR, содержащих от 1 до 15 добавлений, замен, делеций и/или вставок по отношению к исходной последовательности Антитела 4. В другом варианте содержится от 1 до 10 добавлений, замен, делеций и/или вставок относительно Антитела 4. В другом варианте содержится от 1 до 5 добавлений, замен, делеций и/или вставок по отношению к исходной последовательности Антитела 4. В другом варианте содержится от 1 до 3 добавлений, замен, делеций и/или вставок относительно Антитела 4.

В некоторых вариантах член связывания по изобретению включает HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, и LCDR3; где HCDR3 содержит аминокислотную последовательность SEQ ID NO: 105, дополнительно содержащую от 1 до 9 добавлений, замен, делеций и/или вставок аминокислот; и LCDR3 содержит аминокислотную последовательность SEQ ID NO: 110, дополнительно содержащую от 1 до 6 добавлений, замен, делеций и/или вставок аминокислот. В таких вариантах HCDR1 может содержать аминокислотную последовательность SEQ ID NO: 103; HCDR2 может содержать аминокислотную последовательность SEQ ID NO: 104; LCDR1 может содержать аминокислотную последовательность SEQ ID NO: 108; и LCDR2 может содержать аминокислотную последовательность SEQ ID NO: 109. Кроме того, HCDR1, HCDR2, LCDR1, и LCDR2 могут также совместно содержать одно или несколько добавлений, замен, делеций и/или вставок аминокислот по отношению к исходной последовательности (Антитело 4), например, от 1 до 10 замен.

В данном описании описан член связывания, содержащий множество CDR Антитела 6, как показано в табл.1b, в котором HCDR1 является SEQ ID NO: 63 (остатки Kabat 31-35), HCDR2 является SEQ ID NO: 64 (остатки Kabat 50-65), HCDR3 является SEQ ID NO: 65 (остатки Kabat 95-102), LCDR1 является SEQ ID NO: 68 (остатки Kabat 24-34), LCDR2 является SEQ ID NO: 69 (остатки Kabat 50-56) и LCDR3 является SEQ ID NO: 70 (остатки Kabat 89-97). Член связывания в соответствии с изобретением может быть также членом связывания Антитела 6, как показано в табл.1b, в котором один или несколько CDR содержат одно или несколько добавлений, замен, делеций и/или вставок аминокислот. В некоторых вариантах член связывания включает множество CDR, содержащих от 1 до 17 добавлений, замен, делеций и/или вставок по отношению к последовательности Антитела 6. В другом варианте содержится от 1 до 10 добавлений, замен, делеций и/или вставок относительно Антитела 6. В другом варианте содержится от 1 до 5 добавлений, замен, делеций и/или вставок по отношению к последовательности Антитела 6. В другом варианте содержится от 1 до 3 добавлений, замен, делеций и/или вставок относительно Антитела 6. В другом варианте содержится от 1 до 2 добавлений, замен, делеций и/или вставок относительно Антитела б. В другом варианте содержится одно добавление, замена, делеция или вставка относительно Антитела 6.

В некоторых вариантах член связывания по изобретению включает HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, и LCDR3; где HCDR3 содержит аминокислотную последовательность SEQ ID NO: 65, дополнительно содержащую от 1 до 11 добавлений, замен, делеций и/или вставок аминокислот; и LCDR3 содержит аминокислотную последовательность SEQ ID NO: 70, дополнительно содержащую от 1 до 6 добавлений, замен, делеций и/или вставок аминокислот. В таких вариантах HCDR1 может содержать аминокислотную последовательность SEQ ID NO: 63; HCDR2 может содержать аминокислотную последовательность SEQ ID NO: 64; LCDR1 может содержать аминокислотную последовательность SEQ ID NO: 68; и LCDR2 может содержать аминокислотную последовательность SEQ ID NO: 69. Кроме того, HCDR1, HCDR2, LCDR1, и LCDR2 могут также совместно содержать одно или несколько аминокислотных добавлений, замен, делеций и/или вставок по отношению к последовательности Антитела 6, как например, от одной до десяти замен.

Член связывания по изобретению может содержать одно или сочетание участков CDR, как описано в данном описании. Например, член связывания по изобретению может включать HCDR1 с аминокислотной последовательностью SEQ ID NO: 93; HCDR2 с аминокислотной последовательностью SEQ ID NO: 94; HCDR3 с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 95, 5 или 125; LCDR1 с аминокислотной последовательностью SEQ ID NO: 98; LCDR2 с аминокислотной последовательностью SEQ ID NO: 99; и LCDR3 с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 100, 10 или 130.

Член связывания по изобретению может содержать один или сочетание участков CDR, как описано в данном описании. Например, член связывания по изобретению может включать HCDR1 с аминокислотной последовательностью SEQ ID NO: 103; HCDR2 с аминокислотной последовательностью SEQ ID NO: 104; HCDR3 с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 105, 15, 65, 25, 35, 75, 45, 115, 55 или 85; LCDR1 с аминокислотной последовательностью SEQ ID NO: 108; LCDR2 с аминокислотной последовательностью SEQ ID NO: 109; и LCDR3 с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 110, 20, 70, 30, 40, 80, 50, 120, 60 или 90.

Член связывания по изобретению может содержать один или сочетание участков CDR, как описано в данном описании. Например, член связывания по изобретению может включать HCDR1 с аминокислотной последовательностью SEQ ID NO: 93; HCDR2 с аминокислотной последовательностью SEQ ID NO: 94; HCDR3 с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 95, 5, 125, 105, 15, 65, 25, 35, 75, 45, 115, 55 или 85; LCDR1 с аминокислотной последовательностью SEQ ID NO: 98 или 108; LCDR2 с аминокислотной последовательностью SEQ ID NO: 99 или 109; и LCDR3 с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 100, 10, 130, 110, 20, 70, 30, 40, 80, 50, 120, 60 или 90.

В некоторых вариантах член связывания или домен VH по изобретению содержит HCDR3 (SEQ ID NO: 95) Антитела 1 с одной или несколькими из следующих замен или делеций:

остаток Kabat 100Е, замененный на Т;

остаток Kabat 100F, замененный на V или L;

остаток Kabat 100G, замененный на D;

остаток Kabat 100H, замененный на А или Р;

остаток Kabat 1001, замененный на А или Р;

остаток Kabat 101, замененный на V или G;

остаток Kabat 102, замененный на D или V;

В некоторых вариантах член связывания или домен VH по изобретению содержит HCDR3 (SEQ ID NO: 105) Антитела 4 с одной или несколькими из следующих замен или делеций:

остаток Kabat 100А, замененный на А или Е;

остаток Kabat 100В, замененный на Р, Q, или А;

остаток Kabat 100C, замененный на Р, Y, S или L;

остаток Kabat 100D, замененный на Р, G или А;

остаток Kabat 100Е, замененный на L или V;

остаток Kabat 100F, замененный на G, V или Р;

остаток Kabat 100G, замененный на V;

остаток Kabat 100Н, замененный на Y;

остаток Kabat 100I, замененный на G или D;

остаток Kabat 100J, замененный на А или удаленный;

остаток Kabat 101, замененный на F;

остаток Kabat 102, замененный на V.

В некоторых вариантах член связывания или его домен VL может содержать LCDR3 (SEQ ID NO 100) Антитела 1 с одной или несколькими из следующих замен:

остаток Kabat 94, замененный на А или Н;

остаток Kabat 95, замененный на А;

остаток Kabat 95A, замененный на Е или R;

остаток Kabat 95В, замененный на Q или V;

остаток Kabat 97, замененный на Н или L.

В некоторых вариантах член связывания, или его домен VL может содержать LCDR3 (SEQ ID NO 110) Антитела 4 с одной или несколькими из следующих замен:

остаток Kabat 94, замененный на А, V, D, Н, L или R;

остаток Kabat 95, замененный на G, R или А;

остаток Kabat 95A, замененный на G, L, А, V или D;

остаток Kabat 95В, замененный на Н, R, А или D;

остаток Kabat 96, замененный на Н, Р и А.

остаток Kabat 97, замененный на Н, V или Q.

В некоторых вариантах член связывания или домен VH по изобретению содержит HCDR3 (SEQ ID NO: 65) Антитела 6 с одной или несколькими из следующих замен или добавлений:

остаток Kabat 100А, замененный на G или А;

остаток Kabat 100В, замененный на S, Р или А;

остаток Kabat 100C, замененный на D, Р, S или L;

остаток Kabat 100D, замененный на Y, Р или А;

остаток Kabat 100Е, замененный на Т или L;

остаток Kabat 100F, замененный на Т, G или Р;

остаток Kabat 100G, замененный на V;

остаток Kabat 100Н, замененный на Y;

остаток Kabat 100I, замененный на G или D;

остаток Kabat 100J удален в Антителе 6, восстановлен как А или F;

остаток Kabat 101, замененный на D;

остаток Kabat 102, замененный на I.

В некоторых вариантах член связывания или его домен VL может содержать LCDR3 (SEQ ID NO 70) Антитела 6 с одной или несколькими из следующих замен:

остаток Kabat 94, замененный на S, А, D, Н, L или R;

остаток Kabat 95, замененный на L, G или А;

остаток Kabat 95A, замененный на S, G, А, V или D;

остаток Kabat 95В, замененный на G, R, или D;

остаток Kabat 96, замененный на S, Р или А.

остаток Kabat 97, замененный на L, Н или Q.

В одном из вариантов изобретения содержится член связывания, включающий множество участков CDR, в том числе: HCDR1 с аминокислотной последовательностью SEQ ID NO: 3, HCDR2 с аминокислотной последовательностью SEQ ID NO: 4, HCDR3 с аминокислотной последовательностью SEQ ID NO: 5, LCDR1 с аминокислотной последовательностью SEQ ID NO: 8, LCDR2 с аминокислотной последовательностью SEQ ID NO: 9 и LCDR3 с аминокислотной последовательностью SEQ ID NO: 10.

В одном из вариантов изобретения содержится член связывания, включающий множество CDR, в том числе: HCDR1 с аминокислотной последовательностью SEQ ID NO: 63, HCDR2 с аминокислотной последовательностью SEQ ID NO: 64, HCDR3 с аминокислотной последовательностью SEQ ID NO: 65, LCDR1 с аминокислотной последовательностью SEQ ID NO: 68, LCDR2 с аминокислотной последовательностью SEQ ID NO: 69 и LCDR3 с аминокислотной последовательностью SEQ ID NO: 70.

В одном из вариантов изобретения содержится член связывания, включающий множество CDR, в том числе: HCDR1 с аминокислотной последовательностью SEQ ID NO: 23, HCDR2 с аминокислотной последовательностью SEQ ID NO: 24, HCDR3 с аминокислотной последовательностью SEQ ID NO: 25, LCDR1 с аминокислотной последовательностью SEQ ID NO: 28, LCDR2 с аминокислотной последовательностью SEQ ID NO: 29 и LCDR3 с аминокислотной последовательностью SEQ ID NO: 20.

В одном из вариантов изобретения содержится член связывания, включающий множество CDR, в том числе: HCDR1 с аминокислотной последовательностью SEQ ID NO: 113, HCDR2 с аминокислотной последовательностью SEQ ID NO: 114, HCDR3 с аминокислотной последовательностью SEQ ID NO: 115, LCDR1 с аминокислотной последовательностью SEQ ID NO: 118, LCDR2 с аминокислотной последовательностью SEQ ID NO: 119 и LCDR3 с аминокислотной последовательностью SEQ ID NO: 120.

В одном из вариантов изобретения содержится член связывания, включающий множество CDR, в том числе: HCDR1 с аминокислотной последовательностью SEQ ID NO; 53, HCDR2 с аминокислотной последовательностью SEQ ID NO: 54, HCDR3 с аминокислотной последовательностью SEQ ID NO: 55, LCDR1 с аминокислотной последовательностью SEQ ID NO: 58, LCDR2 с аминокислотной последовательностью SEQ ID NO: 59 и LCDR3 с аминокислотной последовательностью SEQ ID NO: 60.

Член связывания по изобретению может быть единственным, который конкурирует или перекрестно конкурирует за связывание с IL-1R1 с каким-либо членом связывания, описанным в данном описании, где оба связываются с IL-1R1 и включают элемент связывания, такой как домен VH и/или VL CDR, например, HCDR3, и/или множество CDR, описанных в данном описании, например, антитела, раскрытые в табл.2. Конкуренция между членами связывания может быть проанализирована с легкостью in vitro, например, с помощью ELISA и/или с помощью меченой специфической молекулы репортера одного их членов связывания, которая может быть обнаружена в присутствии одного или нескольких других немеченых членов связывания, чтобы можно было установить члены связывания, которые связываются с аналогичным эпитопом или перекрывающимся эпитопом. Такие быстрые способы известны специалистам в данной области, и более подробно описаны в данном описании. Таким образом, еще в одном аспекте настоящего изобретения предлагается член связывания, специфичный в отношении IL-1R1, который конкурирует или перекрестно конкурирует за связывание человеческого IL-1R1 с молекулой антитела, включая домен VH и/или VL или участок CDR, например, HCDR3 или множество CDR любых антител от 1 до 10. В одном из вариантов член связывания по изобретению конкурирует или перекрестие конкурирует с Антителом 1 и/или Антителом 3 из табл.2.

В другом варианте изобретения предлагаются члены связывания, которые связываются с конкретным участком IL-1R1, например, эпитопом. Конкретно, аналогичный эпитоп или его части связаны с каким-либо одним из антител, перечисленных в табл.2.

В другом варианте изобретения предлагается выделенный член связывания, который связывается с эпитопом, включая одну или несколько из следующих последовательностей IL-1R1:

(I) N123-V134;

(II) L140-К157, и/или

(III) K178-R180.

В другом варианте изобретения предлагает выделенный член связывания, специфичный в отношении IL-1R1 согласно п.16, который связывается с эпитопом прерывистого типа, включая следующие последовательности IL-1R1:

(I) N123-V134;

(II) L140-K157, и

(III) K178-R180.

В других аспектах настоящего изобретения предлагается член связывания, включая сайт связывания с антигеном человеческого антитела, который конкурирует или перекрестно конкурирует с сайтом связывания «антиген-антитело» за связывание с человеческим IL-1R1, где сайт связывания «антиген-антитело» состоит из домена VH и домена VL, и где домены VH и VL включают множество участков CDR из исходных антител (Антитело 1 или Антитело 4), или каких-либо антител от 2 до 3 или от 5 до 10 в списке табл.2.

Любой подходящий способ может быть применен для определения остатков последовательности, связанных с членом связывания. Например, сканирование связанного пептида может быть использовано, например, на основе иммуноферментного анализа (ELISA) PEPSCAN. В сканировании связанного пептида, таком, как предложенный способ PEPSCAN, короткие перекрывающиеся пептиды, полученные из антигена, систематически проверяются на связывание с членом связывания. Пептиды могут быть ковалентно связаны с опорной поверхностью в форме сетки пептидов. Пептиды могут находиться в линейной или изогнутой конформации. Изогнутая конформация может быть получена с использованием пептидов, содержащих концевой остаток Cys (цистеина) на каждом конце пептидной последовательности. Остатки Cys могут быть ковалентно связанны прямо или косвенно с опорной поверхностью таким образом, что пептид удерживается в конформации двойной петли. Таким образом, пептиды, используемые в способе, могут содержать остатки Cys, добавленные к каждому концу пептидной последовательности, соответствующие фрагменту антигена. Двойная петля пептидов также может быть использована, где остаток Cys дополнительно расположен в или около середины пептидной последовательности. Остатки Cys могут быть ковалентно связаны прямо или косвенно с опорной поверхностью таким образом, что пептиды будут находиться в конформации двойной петли, с одной петлей с каждой стороны центрального остатка Cys. Пептиды могут быть синтезированы, и остатки Cys могут быть вставлены на необходимые места, несмотря на неприродную последовательность IL-1R1. Дополнительно, линейные и изогнутые пептиды могут быть изучены в пептидном анализе связывания. Сканирование связанного пептида может включать выявление (например, с помощью ELISA) множества пептидов, которые связаны с членом связывания, где пептиды содержат аминокислотную последовательность, соответствующую фрагментам IL-1R1 (например, пептиды, состоящие из приблизительно 5, 10 или 15 смежных остатков IL-1R1), и выравнивание в одну линию пептидов для определения площади остатков связанных членом связывания, где площадь включает остатки общие для перекрывающихся пептидов.

Альтернативно или дополнительно способ сканирования пептидного связывания может включать выявление пептидов, которые связываются с членом связывания, по крайней мере, представляя соотношение сигнал/шум. Подробная информация о подходящем способе сканирования пептидного связывания для определения связывания известна в данной области. Другие способы, которые хорошо известны и могут быть использованы для определения остатков, связанных с антителом, и/или для подтверждения результатов сканирования пептидного связывания, включают сайт-направленный мутагенез, водородно-дейтериевый обмен, масс-спектрометрию, ЯМР и рентгеноструктурную кристаллографию.

Членом связывания по изобретению может быть молекула антитела или ее фрагмент связывания, предпочтительно, молекула человеческого антитела, или молекула гуманизированного антитела, или их фрагмент связывания. Антителами могут быть моноклональные антитела, особенно человеческого, мышиного, химерного или гуманизированного происхождения, которые могут быть получены в соответствии со стандартными способами, хорошо известными специалистам в данной области.

Хотя, как отмечается ниже, CDR могут быть расположены на каркасных структурах, не относящихся к антителам, структурой, содержащей CDR или множество CDR по изобретению, как правило, будет антитело с последовательностью тяжелой или легкой цепи, или значительная его часть, в которой CDR или множество CDR находятся на месте соответствующих CDR или множества CDR природных вариабельных доменов антител VH и VL, кодируемых перестроенными генами иммуноглобулинов. Структура и расположение вариабельных доменов иммуноглобулина могут быть определены с помощью ссылки на Kabat, с соавт., 1987 [36], и их обновлений, доступных для поиска в разделе "Kabat" с помощью любой поисковой системы Интернет.

Антитело по изобретению обычно включает домен антитела VH и/или VL. Домен VH по изобретению включает множество HCDR, и домен VL включает множество LCDR. Молекула антитела может содержать домен VH антитела, содержащий VH CDR1, CDR2, и CDR3, и каркасную область. Она может в качестве альтернативы или одновременно включать домен VL антитела, содержащий VL CDR1, CDR2, и CDR3, и каркасную область. Примером домена VH антитела по изобретению является SEQ ID NO. 22, и примером домена VL антитела по изобретению является SEQ ID NO. 27.

В изобретении предлагаются члены связывания, содержащие HCDR1 и/или HCDR2 и/или HCDR3 любых антител из табл.2, и/или LCDR1 и/или LCDR2 и/или LCDR3 любых антител табл.2. Член связывания может содержать множество VH CDR, дополнительно может также включать множество VL CDR, и VL CDR может быть из того же или другого антитела, что и VH CDR.

Как правило, домен VH в паре с доменом VL обеспечивает антигенсвязывающий сайт антитела, хотя, как обсуждается ниже, VH или VL по отдельности могут быть использованы для связывания с антигеном. Например, домен VH Антитела 1 (см. табл.2) может быть сопряжен с доменом VL Антитела 1 таким образом, что образованный антигенсвязывающий сайт антитела включает как домен VH, так и домен VL Антитела 1. Аналогичные варианты предлагаются для других доменов VH и VL, описанных в данном описании. В других вариантах домен VH Антитела 1 находится в паре с доменом VL, но не Антитела 1. Распускание легкой цепи хорошо известно в данной области. Кроме того, аналогичные варианты предлагаются в изобретении для других доменов VH и VL, описанных в данном описании. Поэтому VH любых антител из табл.2 может работать в паре с VL тех же или любых других антител из табл.2.

Другим аспектом изобретения является молекула антитела, содержащая домен VH, обладающий как минимум 60, 70, 80, 85, 90, 95, 98 или 99% идентичностью аминокислотной последовательности с доменом VH любых антител, показанных в табл.2, или содержащих множество HCDR (например, HCDR1, HCDR2, и/или HCDR3), показанных в табл.1 или 1b. Молекула антитела также может дополнительно содержать домен VL, который обладает как минимум 60, 70, 80, 85, 90, 95, 98 или 99% идентичностью аминокислотной последовательности с доменом VH любых антител с 1 по 28, или с множеством LCDR (например, LCDR1, LCDR2, и/или LCDR3), показанных в табл.1 или 1b. Алгоритмы, которые могут быть использованы для расчета % идентичности двух аминокислотных последовательностей, включают, например, BLAST [37], FASTA [38] или алгоритм Смита-Уотермана [39], например, с применением параметров по умолчанию.

Члены связывания по настоящему изобретению могут дополнительно содержать константный домен антитела или его части, например, константные домены человеческого антитела или их части. Например, домен VL может быть прикреплен к С-концу константных доменов легкой цепи антитела, включая человеческие Ск или Сλ цели. Аналогично, член связывания на основе домена VH может быть прикреплен к С-концу тяжелой цепи всего или части (например, домен СН1) иммуноглобулина, полученного из любого изотипа антитела, например, IgG, IgA, IgE и IgM, и любого подкласса изотипа, особенно IgG1, IgG2, IgG3 и IgG4. IgG1 является предпочтительным из-за его простоты изготовления и стабильности, например, из-за периода полувыведения. Любые синтетические или другие варианты константных участков, которые модулируют функцию и/или свойства члена связывания, например, стабилизацию вариабельной области, также могут быть использованы в настоящем изобретении.

Кроме того, в соответствии с настоящим изобретением предпочтительно модифицировать аминокислотные последовательности, описанные в данном описании, особенно константные участки тяжелой цепи человека, адаптируя последовательности к необходимому аллотипу, например к аллотипу, найденному у кавказского населения.

Член связывания может содержать молекулу антитела, или ее фрагмент связывания, содержащий один или несколько CDR, например, множество CDR в каркасной области антитела. Например, один или несколько CDR или множество CDR антитела могут быть привиты в каркасном участке (например, в человеческом каркасном участке) для данной молекулы антитела. Каркасными участками могут быть последовательности генов генеративной линии человека, или не относящихся к генеративной линии. Таким образом, каркасный участок может принадлежать к генеративной линии, где один или несколько остатков в каркасном участке заменены на соответствующие остатки в аналогичном положении в наиболее сходном человеческом каркасном участке генеративной линии. Таким образом, член связывания по изобретению может быть выделенной молекулой человеческого антитела, содержащей домен VH, включающий множество HCDR в каркасном участке генеративной линии человека, например, VH каркасного участка IgG генеративной линии человека. Член связывания также содержит домен VL, содержащий множество LCDR, например, VL каркасного участка IgG генеративной линии человека.

Остатки VH и/или VL могут быть модифицированы, как обсуждалось и приводилось в данном описании, например, с помощью сайт-направленного мутагенеза. Домен VH или VL в соответствии с изобретением, или член связывания, содержащий такой домен VL, предпочтительно содержит домен VH и/или VL последовательности антитела из табл.2 и содержит HCDR3 по изобретению.

Молекула антитела, не относящаяся к генеративной линии, содержит аналогичные CDR, но различных каркасных участков, по сравнению с молекулой антитела генеративной линии. Антитела генеративной линии могут быть получены с помощью генерирования последовательностей домена VH и VL каркасного участка, показанных в данном описании для этих антител.

Замены могут быть введены в одном или нескольких каркасных участках и/или в одном или нескольких участках CDR. Замены обычно не приводят к потере функции, поэтому член связывания, содержащий измененную аминокислотную последовательность, должен сохранить способность связываться и/или нейтрализовать IL-1R1. Возможно сохранение такого же количественной способности связывать и/или нейтрализовать, как и у члена связывания, в котором замены не производились, например, по данным анализа, описанного в данном описании. Член связывания, содержащий, таким образом, измененную аминокислотную последовательность, может обладать улучшенной способностью связываться и/или нейтрализовать IL-1R1.

Изменения могут включать замену одного или нескольких аминокислотных остатков, неприродных или нестандартных аминокислот, модификацию одного или нескольких аминокислотных остатков, неприродной или нестандартной формы, или вставку одной или нескольких неприродных или нестандартных аминокислот в последовательность. Примеры символов и мест изменения в последовательностях по изобретению описаны в данном описании. Природные аминокислоты включают 20 "стандартных" L-аминокислот, идентифицированных как G, А, V, L, I, M, P, F, W, S, Т, N, Q, Y, С, К, R, H, D, Е с помощью стандартных однобуквенных кодов. Нестандартные аминокислоты включают любой другой остаток, который может быть включен в полипептидный каркас или в результате модификации имеющегося аминокислотного остатка. Нестандартные аминокислоты могут быть природными или неприродными. Несколько природных нестандартных аминокислот известны в данной области, такие как 4-гидроксипролин, 5-гидроксилизин, 3-метилгистидин, N-ацетилсерин и т.д. [40]. Те аминокислотные остатки, которые дериватизированы в положении N-альфа, будут находиться только на N-конце аминокислотной последовательности. Как правило, в настоящем изобретении аминокислотой является L-аминокислота, но это может быть и D-аминокислота. Поэтому изменения могут включать замену в L-аминокислоте или замену ее D-аминокислотой. Метилированная, ацетилированная и/или фосфорилированная форма аминокислот также известна, и аминокислоты в настоящем изобретении могут быть предметом таких модификаций.

Аминокислотные последовательности в доменах антител и членах связывания по изобретению могут содержать неприродные или нестандартные аминокислоты, описанные выше. Нестандартные аминокислоты (например, D-аминокислоты) могут быть включены в аминокислотную последовательность в процессе синтеза, модификации или замены "оригинальных" стандартных аминокислот после синтеза аминокислотной последовательности.

Использование нестандартных и/или неприродных аминокислот увеличивает структурное и функциональное разнообразие, и может тем самым увеличивать потенциал для достижения требуемых свойств связывания и нейтрализации IL-1R1 члена связывания по изобретению. Кроме того, D-аминокислоты и аналоги, как было показано, демонстрируют удовлетворительный фармакокинетический профиль по сравнению со стандартным профилем L-аминокислот, который демонстрируют L-аминокислоты в результате расщепления полипептидов in vivo после введения животному, например, человеку.

Новые участки VH или VL полученных последовательностей приведенных CDR по изобретению могут быть созданы с помощью случайного мутагенеза одного или нескольких выбранных генов VH и/или VL для создания мутации во всем вариабельном домене. Такая методика описана в работе Gram с соавт. [41], которые использовали ПЦР пониженной точности. В некоторых вариантах одна или две замены аминокислот введены во всем вариабельном домене или множестве CDR.

Другим способом, который может быть использован, является прямой мутагенез участков CDR генов VH или VL. Такие методики описаны в работах Barbas с соавт. [42] и Schier с соавт. [43].

Все описанные выше методики известны как таковые в данной области и специалист будет в состоянии использовать такие методики, чтобы обеспечить применение обычных методик в данной области к членам связывания по изобретению.

В другом аспекте изобретения предлагается способ получения связывающего сайта антиген-антитело для IL-1R1 способом, включающим обеспечение посредством добавления, делеции, замены или вставки одной или нескольких аминокислот в домене VH аминокислотной последовательности, описанной в данном описании, дополнительного комбинирования домена VH с одним или несколькими доменами VL, и тестирования VH или комбинации VH/VL, или комбинаций для определения члена связывания или сайта связывания антиген-антитело для IL-1R1, дополнительно с одним или несколькими заданными свойствами, например, со способностью нейтрализовать активность IL-1R1. Указанный домен VL может содержать аминокислотную последовательность, которая в основном описана в данном описании. Аналогичный способ может быть использован, в котором один или несколько вариантов последовательности домена VL, описанных в данном описании, комбинируются с одним или несколькими доменами VH.

Варианты аминокислотной последовательности вариабельного домена для любого из доменов VH и VL, последовательности которых в основном раскрыты в данном описании, могут быть использованы в соответствии с настоящим изобретением, как это обсуждается. Конкретные варианты могут включать одно или несколько изменений аминокислотных последовательностей (добавлений, делеции, замен и/или вставок аминокислотного остатка). В некоторых реализациях, варианты содержат менее приблизительно 20, менее 15, менее 10 или менее 5 таких изменений.

Как отмечалось выше, аминокислотная последовательность CDR, в основном описанная в данном описании, может содержать CDR вариабельного домена человеческого антитела или значительной его части. Последовательности HCDR3, в основном в соответствии с изложенным, представляют варианты настоящего изобретения, и каждая из них может содержать HCDR3 в вариабельном домене тяжелой цепи человека или значительную часть его, возможно в комбинации с HCDR1, HCDR2, LCDR1, LCDR2 и/или LCDR3 по изобретению.

Члены связывания по изобретению также включают фрагменты антител, которые составляют сайт связывания антиген-антитело. Фрагменты антител получают с помощью методики рекомбинантной ДНК, или с помощью ферментативного или химического расщепления интактных антител. Фрагменты антител, которые составляют сайт связывания антиген-антитело, включают, не ограничиваясь этим, молекулы, такие как Fab, Fab′, Fab′-SH, scFv, Fv, dAb, Fd и стабилизированного дисульфидом вариабельного участка (dsFv), Различные другие молекулы антитела, включающие один или несколько сайтов связывания антиген-антитело, были созданы, включая, например, Fab2, Fab3, диатела, триотела, тетратела и минитеда. Молекулы антитела и способы их создания и применения описаны в Holliger & Hudson (44).

Было показано, что фрагменты целого антитела могут выполнять функцию связывания с антигенами. Примерами фрагментов связывания являются (I) фрагмент Fab, состоящий из доменов VL, VH, константного домена легкой цепи (CL) и константного домена 1 тяжелой цепи (СН1); (II) фрагмент Fd, состоящий из доменов VH и СН1; (III) фрагмент Fv, состоящий из доменов VL и VH одного антитела; (IV) фрагмент dAb [45, 46, 47], который состоит из домена VH или VL; (V) изолированный участок CDR область; (VI) фрагмент F(ab′)2, двухвалентный фрагмент, состоящий из двух связанных фрагментов Fab; (VII) одноцепочечные молекулы Fv (ScFv), в которых домен VH и домен VL связаны пептидной связью, которая позволяет двум доменам присоединяться к сайту связывания с антигеном [48, 49]; (VIII) биспецифичные одноцепочечные димеры Fv (например, описанные в WO 1993/011161); и (IX) "диатела", поливалентные или полиспецифичные фрагменты, созданные путем слияния генов (например, как описано в WO 94/13804 и [50]). Fv, ScFv или молекулы диател могут быть стабилизированы с помощью включения дисульфидных мостиков, соединяющих домены VH и VL [51]. Минитела, содержащие ScFv, присоединенные к домену СН3, могут быть также получены [52]. Другими примерами фрагментов связывания являются Fab′, который отличается от фрагмента Fab добавлением нескольких остатков на карбоксильном конце домена СН1 тяжелой цепи, включая один или несколько цистеинов шарнирной области антитела, и Fab′-SH, который является фрагментом Fab′, в котором остаток(и) цистеина константных доменов содержат свободные тиольные группы.

Фрагменты антител по изобретению могут быть получены, исходя из исходной молекулы антитела (Антитела 1 или 4) или из любых молекул антитела 2, 3, 5 до 10, с помощью таких способов, как расщепление ферментами, например, пепсином и папаином, и/или с помощью расщепления дисульфидных мостиков методом химического восстановления. В другом способе, фрагменты антител, входящих в настоящее изобретение, могут быть получены с помощью методик генетической рекомбинации, также хорошо известных специалистам в данной области, либо путем синтеза пептидов с помощью, например, автоматических синтезаторов пептидов, таких как поставляемые, например, компанией Applied Biosystems Inc (Фостер-Сити, штат Калифорния, США), или с помощью синтеза и экспрессии нуклеиновых кислот.

Функциональные фрагменты антител в соответствии с настоящим изобретением включают какой-либо функциональный фрагмент, период полувыведения которого увеличивается с помощью химической модификации, например, путем пегилирования или с помощью включения в липосому.

dAb (домен антитела) представляет собой небольшой мономерный антигенсвязывающий фрагмент антитела, а именно вариабельный участок тяжелой или легкой цепи антитела [47]. VH dAb встречаются в природе у верблюдовых (например, верблюд, лама) и могут быть получены путем иммунизации верблюдовых целевым антигеном, с выделением антиген-специфичных В-клеток и непосредственным клонированном генов dAb из отдельных В-клеток. dAb также могут быть произведены в культуре клеток. Их небольшие размеры, хорошая растворимость и температурная стабильность делают их особенно удобными с физиологической точки зрения и пригодными для селекции и созревания сродства. Верблюжьи VH dAb в настоящее время разрабатываются для терапевтического использования под названием "нанотела™". Членом связывания настоящего изобретения может быть dAb, содержащий домен VH или VL, в основном описанный в данном описании, или домен VH или VL, содержащий множество CDR, в основном описанный в данном описании.

Антитела по изобретению включают биспецифичные антитела. Биспецифичная или бифункциональная форма антитела характерна для моноклональных антител второго поколения, в которой два различных вариабельных участка объединены в одной молекуле [53]. Их применение было продемонстрировано в области диагностики и в области терапии со способностью к комплектованию новых эффекторных функций или целевых отдельных молекул на поверхности опухолевых клеток. Там, где биспецифичные антитела будут применяться, они могут быть обычными биспецифичными антителами, которые могут быть получены различными способами [54], например, приготовлены химически или из межвидовых гибридом, или могут быть любым фрагментом биспецифичного антитела, упомянутого выше. Эти антитела могут быть получены с помощью химических способов [55, 56] или физических способов [57, 58], но также и преимущественно с помощью способов генетической инженерии, которые позволяют принудительную гетеродимеризацию и тем самым облегчают процесс очистки антитела [59]. Примеры биспецифичных антител включают технологию BiTE™, в которой домены связывания двух антител с различной специфичностью могут быть использованы и непосредственно связаны с помощью коротких гибких пептидов. Это объединяет два антитела в короткой одинарной полипептидной цепи. Диатела и ScFv могут быть получены без участка Fc, с использованием только вариабельных доменов, что потенциально снижает эффект антиидиотипического взаимодействия.

Биспецифичные антитела могут быть созданы как весь IgG, как биспецифичный Fab′2, как Fab′PEG, как диатела или как биспецифичный ScFv. Кроме того, два биспецифичных антитела могут быть скомпонованы с помощью рутинных способов, известных в данной области, в форме четырехвалентного антитела.

Биспецифичные диатела, в отличие от биспецифичных целых антител, также могут быть особенно удобны, поскольку они могут быть быстро получены и экспрессированы в Е.coli. Диатела (и многие другие полипептиды, такие как фрагменты антител), соответствующие специфичному связыванию, могут быть легко отобраны с помощью показа фага (WO 1994/13804) из библиотек. Если одна нить диатела должна быть постоянной, например, специфически направленная против IL-1R1, тогда библиотека может быть создана там, где другая нить достаточно разнообразна, и антитела соответствуют выбранной специфике. Биспецифичные целые антитела могут быть созданы с помощью альтернативных инженерных способов, как описано в Ridgeway с соавт. [60] или как описано в WO 1996/27011, WO 1998/50431 и WO 2006/028936.

Кроме того, член связывания по изобретению может содержать антигенсвязывающий сайт в молекуле, не являющейся антителом, как правило, обеспеченный одним или несколькими CDR, например, множество CDR в каркасном белке, не являющемся антителом, как описано ниже.

Сайт связывания с антигеном может быть обеспечен посредством расположения CDR на каркасном белке, не являющемся антителом, таком как фибронектин или цитохром В и т.д. [61, 62, 63], или с помощью рандомизирования или мутации аминокислотных остатков петли внутри каркасного белка, чтобы придать специфичность связывания для заданной мишени. Остовы для инженерных новых сайтов связывания белков были детально рассмотрены Nygren с соавт. [63]. Имитаторы каркасного белка для антитела раскрыты в WO 200034784, которая включена в полном объеме путем ссылки в данное описание, где авторы описывают белки (имитаторы антитела), которые включают домен фибронектина типа III, содержащий не менее одной рандомизированной петли. Пригодный остов, на который привит один или несколько CDR, например, множество HCDR, может быть предоставлен с помощью любого домена члена подсемейства иммуноглобулиновых генов. Каркасным может быть человеческий или не человеческий белок. Преимущество каркасного белка, не являющегося антителом, состоит в том, что он может обеспечить антигенсвязывающий сайт в каркасной молекуле, которая меньше и/или которую легче получить, чем, по крайней мере, некоторые молекулы антитела. Малый размер члена связывания может обеспечивать полезные физиологические свойства, такие, как способность проникать в клетки, проникать глубоко в ткани, или достигать мишеней внутри других структур, или связываться в белковых полостях с целевым антигеном. Использование сайтов связывания с антигеном в каркасном белке не антитела рассматривается в Wess, 2004 [64]. Типичными являются белки, содержащие стабильные каркасы и одну или несколько вариабельных петель, в которых аминокислотная последовательность петли или петель специально или случайно мутирована, чтобы создать антигенсвязывающий сайт, который связывается с целевым антигеном. Такие белки включают IgG-связывающие домены белка А из золотистого стафилококка, трансферрин, тетранектин, фибронектин (например, десятый домен фибронектина типа III), липокалины, а также гамма-кристаллический и другой каркасный Аффилин™ (Scil Proteins). Примеры других подходов включают синтетические "Микротела" на основе циклотидов - небольших белков, содержащих внутримолекулярные дисульфидные связи, Микробелки (Versabodies™, Amunix Inc, Mountain View, Калифорния, США) и белки с анкириновым повтором (DARPins, Molecular Partners AG, Цюрих-Шлирен, Швейцария), Такие белки также включают небольшие, сконструированные домены белка, такие как, например, иммуно-домены (см., например, публикации патентов США №№2003/082630 и 2003/157561). Иммуно-домены содержат хотя бы один гипервариабельный участок (CDR) антитела.

Член связывания в соответствии с настоящим изобретением, может содержать другие аминокислоты, например, сформированного пептида или полипептида, такого как изогнутый домен, или придавать молекуле другую функциональную характеристику в дополнение к способности связываться с антигеном. Члены связывания по изобретению могут содержать определяемую метку, или могут быть конъюгированы с токсином или нацеленной частью или ферментом (например, через пептидную связь или линкер). Например, член связывания может содержать каталитический сайт (например, в домене фермента), а также сайт связывания с антигеном, где сайт связывания с антигеном связывается с антигеном и, таким образом, нацеливает каталитический сайт на антигену. Каталитический сайт может подавлять биологическую функцию антигена, например, путем расщепления.

Изобретение также включает члены связывания, которые были модифицированы, чтобы изменить, т.е. увеличить, уменьшить или устранить биологический эффект функции членов связывания, например антител с модифицированным участком Fc. В некоторых вариантах члены связывания или антитела, как описано в данном описании, могут быть модифицированы, чтобы повысить их возможность фиксировать комплемент и участвовать в комплементзависимой цитотоксичности (CDC). В других вариантах члены связывания или антитела могут быть модифицированы, чтобы повысить их возможность активировать эффекторные клетки и участвовать в антителозависимой цитотоксичности (ADCC), В других вариантах члены связывания или антитела, как описано в данном описании, могут быть модифицированы как для повышения их способности активировать эффекторные клетки и участвовать в антителозависимой цитотоксичности (ADCC), так и для повышения их способности фиксировать комплемент и участвовать в комплементзависимой цитотоксичности (CDC).

В некоторых вариантах члены связывания или антитела, как описано в данном описании, могут быть модифицированы, чтобы уменьшить их возможность фиксировать комплимент и участвовать в комплементзависимой цитотоксичности (CDC). В других вариантах члены связывания или антитела могут быть модифицированы, чтобы уменьшить их возможность активировать эффекторные клетки и участвовать в антителозависимой цитотоксичности (ADCC). В других вариантах члены связывания или антитела, как описано в данном описании, могут быть модифицированы, чтобы снизить их способность активировать эффекторные клетки и участвовать в антителозависимой цитотоксичности (ADCC), и уменьшить их возможность фиксировать комплемент и участвовать в комплементзависимой цитотоксичности (CDC).

В некоторых вариантах период полувыведения члена связывания или антитела, как описано в данном описании, и композиции по изобретению составляет, по крайней мере, приблизительно от 4 до 7 дней. В некоторых вариантах средний период полувыведения члена связывания или антитела, как описано в данном описании, и композиции по изобретению составляет, по крайней мере, приблизительно от 2 до 5 дней, от 3 до 6 дней, от 4 до 7 дней, от 5 до 8 дней, от 6 до 9 дней, от 7 до 10 дней, от 8 до 11 дней, от 8 до 12, от 9 до 13, от 10 до 14, от 11 до 15, от 12 до 16, от 13 до 17, от 14 до 18, от 15 до 19 или от 16 до 20 дней. В других вариантах средний период полувыведения члена связывания или антитела, как описано в данном описании, и композиции по изобретению составляет, по крайней мере, приблизительно от 17 до 21 дня, от 18 до 22 дней, от 19 до 23 дней, от 20 до 24 дней, от 21 до 25 дней, от 22 до 26 дней, от 23 до 27 дней, от 24 до 28 дней, от 25 до 29 дней или от 26 до 30 дней. В большинстве вариантов период полувыведения члена связывания или антитела, как описано в данном описании, и композиции по изобретению может составлять до 50 дней. В некоторых вариантах период полувыведения антител и композиций по изобретению может быть продлен способами, известными в данной области. Такое продление может, в свою очередь, уменьшить количество и/или периодичность введения доз композиции антител. Антитела с улучшенным периодом полувыведения in vivo и способы их получения раскрыты в патенте США №6,277,375 и международных публикациях № WO 1998/23289 и WO 1997/3461.

В другом варианте изобретения предлагается изделие промышленного производства, включающее контейнер. Контейнер включает композицию, содержащую член связывания или антитело, как описано в данном описании, и листок-вкладыш или этикетку о том, что композиция может быть использована для лечения расстройств, связанных с IL-1R1.

В других вариантах изобретения предлагается набор, включающий композицию, содержащую член связывания или антитело, как описано в данном описании, и инструкции для введения композиции субъекту, нуждающемуся в лечении.

В настоящем изобретении предлагается разработка белков, содержащих вариант участка Fc. Т.е., неприродного участка Fc, например, участка Fc, включающего один или несколько неприродных аминокислотных остатков. Также включен вариант участков Fc по настоящему изобретению, который представляет собой участки Fc, которые включают делеции, добавления и/или модификации аминокислот.

Период полувыведения из сыворотки белков, содержащих участок Fc, может быть увеличено путем увеличения сродства связывания участка Fc в отношении FcRn. В одном из вариантов вариант Fc белка демонстрирует увеличенный период полувыведения из сыворотки по сравнению с сопоставимой молекулой.

В другом варианте настоящее изобретение предлагается вариант Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 239, 330 и 332, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 239D, 330L и 332Е, в соответствии с индексом ЕС, изложенным Kabat, При желании, участок Fc может дополнительно содержать дополнительные, неприродные аминокислоты в одном или нескольких положениях выбранных из группы, состоящей из 252, 254 и 256, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается участок Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 239D, 330L и 332Е, в соответствии с индексом ЕС, изложенным Kabat; и, по крайней мере, одну неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 252Y, 254Т и 25 6Е, в соответствии с индексом ЕС, изложенным Kabat.

В другом варианте настоящего изобретения предлагается вариант Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 234, 235 и 331, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 234F, 235F, 235Y, и 331S, в соответствии с индексом ЕС, изложенным Kabat. В дальнейшем конкретном варианте, вариант Fc по изобретению включает остатки неприродных аминокислот в положениях 234F, 235F и 331S, в соответствии с индексом ЕС, изложенным Kabat. В другом конкретном варианте вариант Fc по изобретению включает остатки неприродных аминокислот в положениях 234F, 235Y и 331S, в соответствии с индексом ЕС, изложенным Kabat. В другом конкретном варианте настоящего изобретения предлагается вариант Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 234F, 235Е и 331S, в соответствии с индексом ЕС, изложенным Kabat. В другом конкретном варианте настоящего изобретения предлагается вариант Fc, в котором участок Fc включает неприродную аминокислоту, состоящую из 234F, 235Е и 331S, в соответствии с индексом ЕС, изложенным Kabat. При желании участок Fc может дополнительно содержать дополнительную неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 252, 254, и 256, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 234F, 235F, 235Y, и 331S, в соответствии с индексом ЕС, изложенным Kabat; и, по крайней мере, одну неприродную аминокислоту в одной или нескольких положениях, выбранных из группы, состоящей из 252Y, 254Т и 256Е, в соответствии с индексом ЕС, изложенным Kabat.

В другом варианте настоящего изобретения предлагается вариант Fc белка, в котором участок Fc включает, по крайней мере, неприродную аминокислоту в одной или нескольких положениях, выбранных из группы, состоящей из 239, 330 и 332, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc состава белка, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 239D, 330L и 332Е, в соответствии с индексом ЕС, изложенным Kabat. При желании участок Fc может дополнительно содержать дополнительную неприродную аминокислоту в одной или нескольких положениях, выбранных из группы, состоящей из 252, 254 и 256, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc белка, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 239D, 330L и 332Е, в соответствии с индексом ЕС, изложенным Kabat; и, по крайней мере, одну неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 252Y, 254Т и 256Е, в соответствии с индексом ЕС, изложенным Kabat. В другом варианте настоящего изобретения предлагается вариант Fc белка, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 234, 235 и 331, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc белка, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 234F, 235F, 235Y и 331S, в соответствии с индексом ЕС, изложенным Kabat. При желании, участок Fc может дополнительно содержать дополнительную неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 252, 254 и 256, в соответствии с индексом ЕС, изложенным Kabat. В конкретном варианте настоящего изобретения предлагается вариант Fc белка, в котором участок Fc включает, по крайней мере, одну неприродную аминокислоту, выбранную из группы, состоящей из 234F, 235F, 235Y и 331S, в соответствии с индексом ЕС, изложенным Kabat; и, по крайней мере, одну неприродную аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 252Y, 254Т и 256Е, в соответствии с индексом ЕС, изложенным Kabat.

Способы генерации неприродных участков Fc известны в данной области. Например, аминокислотные замены и/или делеции могут быть сгенерированы методами мутагенеза, в том числе, не ограничиваясь этим, сайт-направленный мутагенез (Kunkel, Proc. Natl. Acad. Sci. USA 82:488-492 (1985)), ПЦР мутагенез (Higuchi, in "PCR Protocols: A Guide to Methods and Applications", Academic Press, San Diego, pp.177-183 (1990)) и кассетный мутагенез (Wells et al., Gene 34:315-323 (1985)). Предпочтительно, сайт-направленный мутагенез осуществляется способом ПЦР с перекрывающимся удлинением (Higuchi, in "PCR Technology: Principles and Applications for DNA Amplification", Stockton Press, New York, pp.61-70 (1989)). Техника ПЦР с перекрывающимся удлинением (Higuchi, там же.) также может быть использована для введения любой предпочтительной мутации(ий) в последовательность мишени (исходной ДНК). Например, первый цикл ПЦР с перекрывающимся удлинением включает амплификацию целевой последовательности с использованием наружного праймера (праймер 1) и внутреннего праймера мутагенеза (праймер 3), так и отдельно со вторым наружным праймером (праймер 4) и внутренним праймером (праймер 2), что приводит к образованию двух ПЦР сегментов (сегменты А и В). Внутренний праймер мутагенеза (праймер 3) предназначен для внесения несоответствия в целевую последовательность для указания предпочтительной мутации(ий). Во втором цикле ПЦР продукты первого цикла ПЦР (сегменты А и В) амплифицируются методом ПЦР с использованием двух внешних праймеров (праймеры 1 и 4). В конце весь ПЦР сегмент (сегмент С) обрабатывают ферментами рестрикции, и полученный рестрикционный фрагмент клонируют в соответствующий вектор. Как первый шаг мутагенеза, исходную ДНК (например, кодированный белок слияния Fc, антитело или простой участок Fc) оперативно клонируют в вектор мутагенеза. Праймеры предназначены для отражения предпочтительной аминокислотной замены. Другие способы, используемые для генерации вариантов участков Fc, известны в данной области (см., например, патенты США №№5624821; 5885573; 5677425; 6165745; 6277375; 5869046; 6121022; 5624821; 5648260; 6528624; 6194551; 6737056; 6821505; 6277375; публикации патентов США №№2004/0002587 и РСТ WO 94/29351; публикации РСТ WO 99/58572, WO 00/42072, WO 02/060919, WO 04/029207, WO 04/099249;WO 04/063351, WO 06/23403).

В некоторых вариантах изобретения образцы гликозилирования антител, предусмотренных в данном описании, модифицировали для усиления эффекторной функции ADCC и CDC. См. Shields RL et al., (2002) JBC. 277:26733; Shinkawa T et al., (2003) JBC. 278:3466 и Okazaki A et al., (2004) J.Mol. Biol., 336: 1239. В некоторых вариантах вариант Fc белка включает одну или несколько инженерных гликоформ, т.е. состав углеводов, которые ковалентно связаны с молекулой, содержащей участок Fc. Инженерные гликоформы могут быть пригодны для различных целей, в том числе, не ограничиваясь ими, усиление или ослабление эффекторной функции. Инженерные гликоформы могут быть получены любым способом, известным специалистам в данной области, например, с помощью инженерии или экспрессии штаммов, с помощью ко-экспрессии с одним или несколькими ферментами, например, DI N-ацетилглюкозаминилтрансферазой III (GnTI11), с помощью экспрессии молекулы, содержащей участок Fc, в различных организмах или клеточных линиях из различных организмов, или путем экспрессии модифицированной молекулы углевода(ов), содержащей участок Fc. Способы создания инженерных гликоформ известны в данной области и включают, не ограничиваясь ими, описанные в Umana et al, 1999, Nat. Biotechnol 17:176-180; Davies et al., 20017 Biotechnol Bioeng 74:288-294; Shields et al, 2002, J Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol Chem 278:3466-3473; патенты США No. 6,602,684; No. 10/277,370; No. 10/113,929; РСТ WO 00/61739A1; РСТ WO 01/292246A1; РСТ WO 02/311140A1; РСТ WO 02/30954A1; Potillegent™ technology (Biowa, Inc. Принстон, штат Нью-Джерси); GlycoMAb™ glycosylation engineering technology (Glycart Biotechnology AG, Цюрих, Швейцария). См., например, WO 00/061739; EA 01229125; США 20030115614; Okazaki et al., 2004, JMB, 336:1239-49.

В данной области также известно, что гликозилированный участок Fc может быть модифицирован для усиления или ослабления эффекторной функции (см., например, Umana et al, 1999, Nat. Biotechnol 17:176-180; Davies et al., 2001, Biotechnol Bioeng 74:288-294; Shields et al, 2002, J Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol Chem 278:3466-3473; патент США No. 6,602,684; No. 10/277,370; No. 10/113,929; PCT WO 00/61739A1; РСТ WO 01/292246A1; РСТ WO 02/311140A1; РСТ WO 02/30954A1; Potillegent™ technology (Biowa, Inc. Принстон, штат Нью-Джерси); GlycoMAb™ glycosylation engineering technology (Glycart Biotechnology AG, Цюрих, Швейцария). Соответственно, в одном из вариантов участки Fc антител по изобретению включают измененное гликозилирование аминокислотных остатков. В другом варианте изменение гликозилирования аминокислотных остатков приводит к ослаблению эффекторной функции. В другом варианте изменение гликозилированных аминокислотных остатков приводит к усилению эффекторной функции. В конкретном варианте в участке Fc уменьшено фукозилирование. В другом варианте участок Fc является афукозилированым (см., например, опубликованную патентную заявку США No. 2005/0226867), В другом варианте участок Fc является сиалированным, где, по меньшей мере, один остаток галактозы связан с соответствующим концом сиаловой кислоты с помощью связи α 2,6 (см., например: международная патентная заявка № WO 2009079382).

Члены связывания пригодны для лечения и/или предотвращения нарушений, которые опосредованы IL-1R1, особенно при воспалительных заболеваниях, таких как ревматоидный артрит, остеоартроз (ОА), астма и хроническое обструктивное заболевание легких (ХОЗЛ). Члены связывания также пригодны для лечения и/или предотвращения нарушений, которые опосредованы IL-1R1, такие как ВИЧ-1, солидные опухоли, лейкозы, болезнь Альцгеймера и ишемическая болезнь.

В дальнейших аспектах настоящего изобретения предлагаются композиции, содержащие члены связывания по изобретению, и их применение в способах ингибирования и/или нейтрализации IL-1R1, включая способы лечения организма человека или животного.

Например, члены связывания в соответствии с изобретением могут быть применены в способе лечения и/или профилактики или применены в способах диагностики биологической реакции, заболевания, расстройства или состояния организма человека или животного (например, у пациента-человека) или in vitro.

Способ лечения и/или профилактики может включать введение указанному пациенту члена связывания по изобретению в количестве, достаточном для измеримой нейтрализации IL-1R1. Состояния, поддающиеся лечению в соответствии с настоящим изобретением, включают любые, в которых играет роль IL-1R1, такие как ХОЗЛ и астма.

Члены связывания по настоящему изобретению могут применяться в способах диагностики или лечения у субъекта-человека или животного, особенно у человека. Член связывания по изобретению может быть применяться для изготовления лекарственного средства с целью применения в способах диагностики или лечения у субъекта-человека или животного, особенно у человека. В изобретении также предлагается применение члена связывания по данному изобретению для диагностики или лечения у субъекта-человека или животного, особенно у человека. Лечение включает заболевания, характеризующиеся биологическими эффектами опосредованными IL-1R1, в частности, воспалительные заболевания такие, как ревматоидный артрит, остеоартроз (ОА), астма и ХОЗЛ.

Таким образом, в изобретении предлагается способ лечения воспалительных заболеваний, таких как ревматоидный артрит, остеоартрит, астма и ХОЗЛ, у млекопитающих, включающий введение указанному млекопитающему члена связывания по изобретению. В другом варианте изобретения предлагается применение члена связывания по изобретению в производстве лекарственного средства для лечения воспалительных заболеваний, таких как ревматоидный артрит, остеоартрит, астма и ХОЗЛ, у млекопитающих. В другом варианте изобретения предлагается применение члена связывания по изобретению для лечения воспалительных заболеваний, таких как ревматоидный артрит, остеоартрит, астма и ХОЗЛ, у млекопитающих. В одном из вариантов млекопитающим является человек, в другом варианте млекопитающим является животное, не относящееся к Homo sapiens. В одном из вариантов членом связывания является антитело, домен VH или домен VL по изобретению, в количестве, достаточном для нейтрализации IL-1R1.

Таким образом, в изобретении предлагается способ ингибирования рекрутмента и хемотаксиса нейтрофилов в легких млекопитающего, включающий введение указанному млекопитающему члена связывания по изобретению. В другом варианте изобретения предлагается применение члена связывания по изобретению в производстве лекарственного средства для ингибирования рекрутмента и хемотаксиса нейтрофилов в легких млекопитающего. В другом варианте изобретения предлагается применение члена связывания по изобретению для рекрутмента и хемотаксиса нейтрофилов в легких млекопитающего. В одном из вариантов млекопитающим является человек, в другом варианте млекопитающим является животное, не относящееся к Homo sapiens. В одном из вариантов членом связывания является антитело, домен VH или домен VL по изобретению, в количестве, достаточном для нейтрализации IL-1R1.

Таким образом, в изобретении предлагается способ лечения заболевания, выбранного из ВИЧ, солидных опухолей, лейкоза, болезни Альцгеймера, диабета II типа, ишемической болезни и атеросклероза у млекопитающего, включающий введение указанному млекопитающему члена связывания по изобретению. В другом варианте изобретения предлагается применение члена связывания по изобретению в производстве лекарственного средства для лечения заболеваний, выбранных из ВИЧ, солидных опухолей, лейкоза, болезни Альцгеймера, диабета II типа, ишемической болезни и атеросклероза у млекопитающих. В другом варианте изобретения предлагается применение члена связывания по изобретению для лечения заболеваний, выбранных из ВИЧ, солидных опухолей, лейкоза, болезни Альцгеймера, диабета II типа, ишемической болезни и атеросклероза у млекопитающих. В одном из вариантов млекопитающим является человек, в другом варианте млекопитающим является животное, не относящееся к Homo sapiens. В одном из вариантов членом связывания является антитело, домен VH или домен VL по изобретению, в количестве достаточном для нейтрализации IL-1R1.

Если исследуемые клетки контактируют с членом связывания по изобретению in vitro, контрольная клетка(и) может также быть использована для положительного контроля (например, реакции, не включающие член связывания) и/или отрицательного контроля (например, реакции, не включающие IL-1R1 и/или антиген).

Если клетки контактируют с членом связывания in vivo, например, путем введения члена связывания по изобретению млекопитающим, с продемонстрированными биологическими реакциями, опосредованными IL-1α и/или IL-1β, член связывания по изобретению вводят в количестве, достаточном для нейтрализации IL-1R1.

Кроме того, в изобретении предлагается способ снижения опосредованной IL-1R1 активности у млекопитающего, такого, как человек, включающий введение члена связывания, такого, как антитело, домен VH или домен VL по изобретению. В другом варианте изобретения предлагается применение члена связывания по изобретению в производстве лекарственного средства для снижения опосредованной IL-1R1 активности у млекопитающего. В другом варианте изобретения предлагается применение члена связывания по изобретению для снижения опосредованной IL-1R1 активности у млекопитающего. В одном из вариантов млекопитающим является человек, в другом варианте млекопитающим является животное, не относящееся к Homo sapiens. В одном из вариантов членом связывания является антитело, домен VH или домен VL по изобретению, в количестве, достаточном для нейтрализации IL-1R1 и ингибирования опосредованной IL-1R1 активности.

Заболевания или расстройства, при которых член связывания по изобретению может применяться включают, не ограничиваясь ими:

1. Расстройства со стороны дыхательных путей: обструктивные заболевания дыхательных путей, в том числе: астма, в том числе бронхиальная, аллергическая, наследственная, приобретенная, вызванная физической нагрузкой, лекарственная (включая вызванную аспирином и НПВП) и пылевая астма, прерывистая и устойчивая, любой степени тяжести, а также другие причины гиперреактивности дыхательных путей; хроническое обструктивное заболевание легких (ХОЗЛ), бронхит, включая инфекционный и эозинофильный бронхит, эмфизема, бронхоэктаз, муковисцидоз, саркоидоз; аллергический альвеолит у сельскохозяйственных рабочих и родственные заболевания; экзогенный аллергический альвеолит; фиброз легких, включая криптогенный фиброзирующий альвеолит; идиопатическая интерстициальная пневмония; фиброз, осложненный противоопухолевой терапией и хронической инфекцией, включая туберкулез, а также аспергиллез, и другие микозы; осложнения в результате трансплантации легких; васкулитные и тромботические нарушения сосудов легких и легочная гипертензия; противокашлевая активность, включая лечение хронического кашля, связанного с воспалительным и секреторным состоянием дыхательных путей, и ятрогенного кашля; острые и хронические риниты, включая медикаментозный ринит, и вазомоторный ринит; многолетний и сезонный аллергический ринит, включая нервный ринит (сенная лихорадка); носовой полипоз; острая вирусная инфекция, включая простуду и инфекции, связанные с респираторно-синцитиальным вирусом, вирусом гриппа, коронавирусом (включая САП), аденовирусом, а также РДСВ и ALI;

2. Расстройства со стороны костей и суставов: артриты, связанные или включая остеоартрит/остеоартроз, первичный и вторичный, например, врожденная дисплазия бедра, спондилит шейного и поясничного отделов, боли в нижней части спины и шее, ревматоидный артрит и болезнь Стилла-Шоффара; серонегативная спондилоартропатия, включая анкилозирующий спондилит, псориатический артрит, реактивный артрит; недифференцированная спондилоартропатия, септический артрит и другие инфекционные артропатии и поражение костей, такие как туберкулез, включая болезнь Потта и синдром Понсе; острый и хронический индуцированный кристаллами синовиит, включая уратовую подагру, псевдоподагру и заболевание сухожилий, связанное с апатитом кальция; бурсальное и синовиальное воспаление, болезнь Бехчета, первичный и вторичный синдром Шегрена, системная склеродермия и ограниченная склеродермия; системная красная волчанка, смешанное заболевание соединительной ткани и недифференцированное заболевание соединительной ткани; воспалительная миопатия, включая дерматомиозит и полимиозит; ревматическая полималгия; юношеский артрит, включая идиопатический воспалительный артрит, независимый от совместного распределения, и связанные с ним синдромы, острая ревматическая лихорадка и ее системные осложнения; васкулиты, включая гигантоклеточный артериит, артериит Такаясу, синдром Черджа-Стросса, узелковый полиартрит, микроскопический полиартрит, и васкулиты, связанные с вирусной инфекцией, аллергической реакцией, криоглобулинами и парапротеинами; боли в пояснице; семейная средиземноморская лихорадка, синдром Макла-Уэллса и семейная ирландская лихорадка, синдром Кавасаки, болезнь Кикучи; медикаментозная артралгия, тендониты и миопатии;

3. Расстройства, связанные с болью и ремоделированием соединительной ткани опорно-двигательного аппарата из-за травмы, например, спортивные травмы или заболевания: артриты (например, ревматоидный артрит, остеоартроз, подагра или кристаллическая артропатия), другие заболевания суставов (например, дистрофия межпозвоночных дисков или дистрофия височно-нижнечелюстного сустава), расстройства ремоделирования кости (такие, как остеопороз, болезнь Педжета или остеонекроз), полихондрит, склеродермия, смешанное заболевание соединительной ткани, спондилоартропатия или заболевание пародонта (такое как периодонтит);

4. Расстройства кожи: псориаз, парапсориаз, атопический дерматит, контактный дерматит, экземы или другие дерматозы, гиперчувствительность замедленного типа, фито- и фотодерматит; себорейный дерматит, герпетиформный дерматит, красный плоский лишай, склеротический атрофический лишай, гангренозная приодермия, саркоидоз кожи, дискоидная красная волчанка, пузырчатка, пемфигоид, буллезный эпидермол, грибовидный микоз, крапивница, ангионевротический отек, васкулиты, токсические эритемы, кожный лейкоцитоз, очаговая алопеция, облысение по мужскому типу, синдром Свита, синдром Вебера-Кристиана, полиморфная эритема; целлюлит инфекционный и неинфекционный; панникулит; лимфома кожи, немеланомный рак кожи и другие диспластические поражения; медикаментозные заболевания, включая стойкую лекарственную эритему;

5. Расстройства со стороны глаз: блефарит, конъюнктивит, включая многолетний и весенний аллергический конъюнктивит, ирит; передний и задний увеит; хориоидит; аутоиммунные, дегенеративные и воспалительные заболевания, влияющие на сетчатку; офтальмиты, включая симпатические офтальмиты; саркоидоз; инфекции, включающие вирусные, грибковые и бактериальные;

6. Расстройства со стороны желудочно-кишечного тракта: глоссит, гингивит, пародонтит; эзофагит, включая рефлюкс; эозинофильный гастроэнтерит, мастоцитоз, болезнь Крона, колит, например, язвенный колит, колит неопределенной этиологии, проктит, микроскопический колит, анальный зуд; глютеновая энтеропатия, синдром раздраженного кишечника, расстройство раздраженного кишечника, невоспалительная диарея и аллергия, связанная с пищевыми продуктами, которая может вызывать последствия в отдаленных органах (например, мигрень, ринит или экзема);

7. Расстройства со стороны органов брюшной полости: гепатит, включая аутоиммунный, алкогольный и вирусный; фиброз и цирроз печени; холецистит, панкреатит, острый и хронический;

8. Расстройства мочеполовой системы: нефриты, включая интерстициальный нефрит и гломерулонефрит, нефротический синдром, циститы, включая острый и хронический (интерстициальный) цистит и язву Ханнера; острый и хронический уретрит, простатит, эпидидимит, оофорит и сальпингит, вульвовагинит, болезнь Пейрони; эректильная дисфункция (у мужчин и женщин);

9. Отторжение аллотрансплантата: острое и хроническое в результате, например, трансплантации почки, сердца, печени, легкого, костного мозга, кожи или роговицы, или после переливания крови, острая и хроническая реакция «трансплантат против хозяина»;

10. Расстройства со стороны ЦНС: болезнь Альцгеймера и другие дементные заболевания, включая КСД и не-КСД; амилоидоз; рассеянный склероз и другие демиелинизирующие синдромы; церебральный атеросклероз и васкулиты; височный артериит, тяжелая псевдопаралитическая миастения; острые и хронические боли (острые, кратковременные или постоянные, центрального или периферического происхождения), включая висцеральные боли, головную боль, мигрень, невралгию тройничного нерва, атипическую лицевую боль, боль в суставах и в костях, боль, связанную с онкологическим заболеванием и опухолевой инвазией, невропатический болевой синдром, включая диабет, постгерпетическую и ВИЧ-ассоциированную невропатию; тропический спастический парапарез, нейросаркоидоз, осложнения злокачественных, инфекционных и аутоиммунных процессов центральной и периферической нервной системы;

11. Другие аутоиммунные и аллергические заболевания (включая комбинацию с другими видами лечения аллергии), включая тиреоидит Хашимото, болезнь Грейвса, болезнь Аддисона, сахарный диабет, идиопатическая тромбоцитопеническая пурпура, эозинофильный фасциит, синдром гиперпродукции IgE, антифосфолипидный синдром; преждевременные роды;

12. Другие заболевания с воспалительными или иммунологическими элементами; включая синдром приобретенного иммунодефицита (СПИД), проказу, синдром Сезари и паранеопластические синдромы;

13. Сердечно-сосудистые расстройства: атеросклероз, влияющий на коронарное и периферическое кровообращение; перикардит; миокардит, воспалительные и аутоиммунные кардиомиопатии, включая миокардиальный саркоидоз; ишемические реперфузионные повреждения; эндокардит, вальвулит и аортит, включая инфекционный (например, сифилис); васкулиты; нарушения со стороны проксимальных и периферических вен, включая флебит и тромбоз, в том числе, тромбоз глубоких вен и осложнения варикозного расширения вен; и

14. Онкологические заболевания: лечение наиболее распространенных видов рака, включая рак предстательной железы, молочной железы, легкого, яичника, поджелудочной железы, кишечника и прямой кишки, желудка, кожи, опухоли головного мозга, злокачественные новообразования, затрагивающие костный мозг (включая лейкозы) и лимфопролиферативную систему, такие как лимфома Ходжкина и неходжкинская лимфома; включая профилактику и лечение метастазов и рецидивов опухоли, а также паранеопластических синдромов.

Данные, представленные в данном описании в отношении связывания и нейтрализации IL-1R1, таким образом, показывают, что члены связывания по изобретению могут применяться для лечения и профилактики таких заболеваний, включая уменьшение тяжести расстройств. Таким образом, в изобретении предлагается способ лечения или уменьшения тяжести, по крайней мере, одного из симптомов какого-либо из нарушений, указанных в данном описании, включая введение пациенту, нуждающемуся в этом, эффективного количества одного или нескольких членов связывания по изобретению отдельно или в комбинации со схемой введения другого соответствующего лекарственного средства, известного в данной области или описанного в данном описании, таким образом, что тяжесть, по крайней мере, одного из симптомов какого-либо из вышеупомянутых заболеваний уменьшается.

Члены связывания по изобретению могут применяться в соответствующих животных и на животных моделях заболеваний, особенно у обезьян.

Таким образом, члены связывания по настоящему изобретению пригодны в качестве терапевтических средств в лечении заболеваний или нарушений, при участии IL-1R1, например, выработка, экспрессия и/или активность IL-1R1, особенно аберрантное продуцирование, экспрессия и/или активность. Способ лечения может включать введение эффективного количества члена связывания по изобретению пациенту, нуждающемуся в этом, при котором продуцирование, экспрессия и/или активность IL-1R1 в связи с этим уменьшается. Способ лечения может включать (I) идентификацию пациента, у которого присутствуют повышенные уровни IL-1R1 или IL-1 или их активность, например, с применением диагностических способов, описанных выше, и (II) введение эффективного количества члена связывания по изобретению пациенту, при котором повышенное продуцирование, экспрессия и/или активность IL-1R1 снижается. Альтернативный способ лечения может включать (I) идентификацию пациента, у которого не проявляется очевидного увеличения опосредованной IL-1R1 активности, но который, как предполагается, получит пользу от введения члена связывания по изобретению, и (II) введение эффективного количества члена связывания по изобретению пациенту. Эффективным количеством в соответствии с изобретением является количество, которое уменьшает повышенное продуцирование, экспрессию и/или активность IL-1R1 таким образом, чтобы снизить или уменьшить тяжесть, по крайней мере, одного из симптомов конкретного заболевания или расстройства в результате лечения, но не обязательно вылечивать заболевание или нарушение.

В изобретении также предлагается способ антагонизма, по крайней мере, одного эффекта IL-1R1, включающий взаимодействие с или введение эффективного количества одного или нескольких членов связывания по изобретению таким образом, что вышеуказанный, по крайней мере, один эффект IL-1R1 вызывает антагонизм. Эффекты IL-1R1, которые могут вызывать антагонизм в ходе способов по изобретению, включают биологические реакции, опосредованные IL-1α и/или IL-1β, и любые нижележащие эффекты, возникающие как следствие этих реакций связывания.

Соответственно, в других аспектах изобретения предлагается применение выделенного члена связывания, такого, как антитело, домен VH или домен VL по изобретению для производства лекарственного средства для лечения расстройств, связанных с, или опосредованных IL-1R1, как обсуждается в данном описании. Такое применение или способы изготовления лекарственного средства или фармацевтической композиции включают сочетание члена связывания с фармацевтически приемлемым наполнителем.

Фармацевтически приемлемым наполнителем может быть соединение или комбинация соединений, входящих в фармацевтическую композицию, которые не провоцируют вторичных реакций и которые позволяют, например, облегчить введение активного компонента(ов), увеличить его период полувыведения и/или его эффективность в организме, увеличить растворимость в растворе или улучшить его сохранность. Такие фармацевтически приемлемые наполнители хорошо известны и будут адаптированы специалистом в данной области в зависимости от характера и способа введения выбранного биологически активного вещества(веществ).

Члены связывания по изобретению, как правило, вводятся в форме фармацевтической композиции, которая может включать, по меньшей мере, один компонент, в дополнение к члену связывания. Таким образом, фармацевтические композиции в соответствии с настоящим изобретением, а также применение в соответствии с настоящим изобретением, может включать помимо активного ингредиента, фармацевтически приемлемый наполнитель, носитель, буфер, стабилизатор или другие материалы, хорошо известные специалистам в данной области. Такие материалы должны быть нетоксичными и не должны препятствовать эффективности активного ингредиента. Конкретная природа носителя или другого материала будет зависеть от способа введения, который может быть пероральным, ингаляционным, интратрахеальным, локальным, интравезикулярным или инъекционным, как это обсуждается ниже.

Фармацевтические композиции для перорального применения, например, одноцепочечных молекул антитела (например, "нанотела™") и т.д. также предусмотрены в настоящем изобретении. Такие композиции для перорального применения могут приобретать форму таблетки, капсулы, порошка, жидкости или полутвердой формы. Таблетка может содержать твердый носитель, такой как желатин или вспомогательное вещество. Жидкие фармацевтические композиции обычно содержат жидкий носитель, такой как вода, масло, животные или растительные жиры, минеральное масло или синтетическое масло. Физиологический раствор, глюкоза или другие растворы сахаридов или гликолей, таких как этиленгликоль, пропиленгликоль или полиэтиленгликоль, могут быть включены.

Для внутривенной инъекции или инъекции в месте повреждения, активный ингредиент будет находиться в форме приемлемого для парентерального введения водного раствора, который является апирогенным и обладает подходящим рН, изотоничностью и стабильностью. Специалисты в данной области в состоянии изготовить соответствующие растворы, используя, например, изотонические среды, такие как физиологический раствор для инъекций, раствор Рингера, раствор Рингера с лактатом. Консерванты, стабилизаторы, буферы, антиоксиданты и/или другие добавки могут быть применены по мере необходимости, включая буферы, такие как фосфатный, цитратный и другие соли органических кислот, антиоксиданты, такие как аскорбиновая кислота и метионин, консерванты (например, октадецилдиметилбензилхлорид аммония; гексаметония хлорид; бензалкония хлорид; фенол, бутиловый или бензиловый спирт; алкилпарабены, такие как метил- или пропилпарабен, катехин, резорцин; циклогексанол; 3′-пентанол; и м-крезол); низкомолекулярные полипептиды; белки, такие как сывороточный альбумин, желатин или иммуноглобулины; гидрофильные полимеры, такие как поливинилпирролидон; аминокислоты, такие как глицин, глутамин, аспарагин, гистидин, аргинин, лизин; или моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу или декстрины; хелатные средства, такие как ЭДТА; сахара, такие как сахароза, маннитол, трегалоза или сорбит; солеобразующие противоионы, такие как натрий; комплексы металлов (например, Zn-белковые комплексы) и/или неионогенные поверхностно-активные вещества, такие как Твин (TWEEN™), PLURONICS™ или полиэтиленгликоль (ПЭГ).

Члены связывания по настоящему изобретению могут быть введены в жидкие, полутвердые и твердые лекарственные формы, в зависимости от физико-химических свойств молекул и способа введения. Композиции могут включать наполнители или комбинации наполнителей, например, сахара, аминокислоты и поверхностно-активные вещества. Жидкие композиции могут включать широкий спектр концентраций и рН антител. Твердые композиции могут быть получены, например, путем лиофилизации, распылительной сушки или сушки с помощью технологии сверхкритической среды. Композиции анти-IL-1R1 будут зависеть от предполагаемого способа введения: например, композиции для легочного введения могут состоять из частиц с физическими свойствами, которые обеспечивают проникновение вглубь легких при вдыхании; композиции для местного применения (например, для лечения рубцов, например, кожных рубцов) могут включать модификаторы вязкости, которые продлевают время действия препарата на месте нанесения. Член связывания может сочетаться с носителем, который будет защищать член связывания от быстрого выведения, например, с регулируемым высвобождением, включая имплантаты, трансдермальные пластыри, и микроинкапсулированные системы его доставки. Могут применяться биоразрушаемые биосовместимые полимеры, например, этиленвинилацетат, полиангидриды, полигликолевая кислота, коллаген, полиортоэфиры и полимолочная кислота. Многие способы приготовления таких составов известны специалистам в данной области [65].

С целью лечения анти-IL-1R1 может вводиться перорально (например, однодоменные молекулы антитела (например, "нанотела™")), в виде инъекции (например, подкожно, внутрисуставно, внутривенно, нитраперитонеально, внутриартериально или внутримышечно), с помощью ингаляции, интратрахеально, с помощью интравезикулярного применения (инстилляция в мочевой пузырь), или местно (например, интраокулярно, интраназально, ректально, в раны, накожно). Средство может быть введено пульс-инфузией, в частности, со сниженной дозой члена связывания. Пути введения могут быть определены на основе физико-химических свойств лекарственного средства, на основе специальных факторов, которые необходимо учитывать для заболевания, или на основе требований к оптимизации, эффективности или к минимизации побочных эффектов. Одним из конкретных способов введения является внутривенный способ. Другим способом введения фармацевтической композиции по настоящему изобретению является подкожное введение. Предполагается, что лечение анти-IL-1R1 не будет ограничено введением в условиях клиники. Таким образом, подкожные инъекции с помощью иглы без приспособления также эффективны.

Примеры композиций для внутривенного введения включают:

25 мМ гистидина,

120 мМ хлорида натрия

рН 6,0.

Член связывания для IL-1R1 или композиция, содержащая член связывания для IL-1R1, может применяться как часть комбинированной терапии в сочетании с дополнительным лекарственным средством. Комбинированная терапия может применяться для обеспечения выраженного синергетического эффекта, в частности, сочетание члена связывания анти-IL-1R1 с одним или несколькими другими препаратами. Член связывания IL-1R1 может быть введен одновременно, или последовательно, или как комбинированный препарат с другим терапевтическим средством или средствами для лечения одного или нескольких заболеваний, перечисленных в данном описании.

Член связывания по изобретению может вводиться и/или применяться в сочетании с другими существующими терапевтическими средствами для заболеваний, опосредованных IL-1R1, таких как обструктивные заболевания дыхательных путей, астма и аллергические заболевания, или другие нарушения, в механизм которых вовлечены опосредованные IL-1R1 эффекты.

Член связывания в соответствии с настоящим изобретением может быть введен в качестве монотерапии или в комбинации или в дополнение к одному или нескольким из следующих средств:

- цитокин или агонист или антагонист функции цитокина (например, средство, которое действует на сигнальные пути цитокина, такое как модулятор системы СЦС (супрессор цитокиновых сигналов)), такой как альфа-, бета- и/или гамма-интерферон, инсулин-подобный фактор роста типа I (IGF-1), его рецепторы и присоединенные белки связывания; интерлейкины (IL), например, один или несколько из множества от IL-2 до IL-33, и/или антагонист или ингибитор интерлейкина, такой как анакинра; ингибиторы рецепторов членов семейства интерлейкина или ингибиторы специфических субъединиц таких рецепторов, ингибитор фактора некроза опухолей альфа (TNF-α)), такой как моноклональные анти-TNF антитела (например, инфликсимаб, адалимумаб и/или CDP-870) и/или антагонист рецептора TNF, например, молекула иммуноглобулина (такая, как этанерцепт) и/или низкомолекулярное средство, такое как пентоксифиллин;

- модулятор В-клеток, например, моноклональное антитело, нацеленное на В-лимфоциты (такое как CD20 (ритуксимаб) или MRA-aIL16R) или Т-лимфоциты (например, CTLA4-Ig, HuMax I1-15 или Abatacept);

- модулятор, который подавляет активность остеокластов, например антитело к RANKL;

- модулятор хемокина или функции рецептора хемокина, такой как антагонист CCR1, CCR2, CCR2A, CCR2B, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10 и CCR11 (для семейства С-С); CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6 (для семейства С-Х-С), и CX3CR1 для семейства С-Х3-С;

- ингибитор матриксных металлопротеаз (ММП), т.е. одного или больше из стромелизинов, коллагеназ и желатиназ, а также агреканазы, особенно коллагеназы-1 (ММП-1), коллагеназы-2 (ММП-8), коллагеназы-3 (ММП-13), стромелизина-1 (ММП-3), стромелизина-2 (ММП-10) и/или стромелизина-3 (ММП-11), и/или ММП-9, и/или ММП-12, например, такое средство, как доксициклин;

- ингибиторы биосинтеза лейкотриенов, ингибитор 5-липоксигеназы (5-LO) или антагонист активации белка 5-липоксигеназы (FLAP), такой как зилеутон; АВТ-761; фенлеутон; тепоксалин; Эббот-79175; Эббот-85761, N-(5-замещенный)-тиофен-2-алкилсульфонамид; 2,6-ди-трет-бутилфенолгидразон; метокситетрагидропиран, такой как Zeneca ZD-2138; соединение SB-210661; пиридинил-(замещенное)-2-цианонафталиновое соединение, такое как L-739010; 2-цианохинолиновое соединение, такое как L-746530; индольное и/или хинолиновое соединение, такое как МК-591, МК-886 и/или BAY x 1005;

- антагонист рецептора лейкотриенов (LT) B4, LTC4, LTD4 и LTE4, выбранный из группы, состоящей из фенотиазина-3-1s, такой как L-651392; амидиновых соединений, такой как CGS-25019c; бензоксаламинов, такой как онтазоласт; бензолкарбоксимидамидов, такой как BIIL 284/260; и таких соединений, как зафирлукаст, аблукаст, монтелукаст, пранлукаст, верлукаст (МК-679), RG-12525, Ro-245913, иралукаст (CGP 45715A) и BAY x 7195;

- ингибитор фосфодиэстеразы (ФДЭ), такой как метилксантанин, например, теофиллин, и/или эуфиллин, и/или селективный ингибитор изофермента ФДЭ, например, ингибитор PDE4, и/или ингибитор изоформы PDE4D, и/или ингибитор ФДЭ-5;

- антагонист гистаминового рецептора типа 1, такой как цетиризин, лоратадин, деслоратадин, фексофенадин, акривастин, терфенадин, астемизол, азеластин, левокабастин, хлорфенирамин, прометазин, циклизин и/или мизоластин (как правило, применяются перорально, местно или парентерально);

- ингибитор протонной помпы (например, омепразол) или антагонист гастропротекторного гистаминового рецептора типа 2;

- антагонист гистаминового рецептора типа 4;

агонист альфа-1/альфа-2 адренорецептора, сосудосуживающее симпатомиметическое средство, такое как пропилгекседрин, фенилэфрин, фенилпропаноламин, эфедрин, псевдоэфедрин, нафтизина гидрохлорид, оксиметазолина гидрохлорид, тетрагидрозолина гидрохлорид, ксилометазолина гидрохлорид, трамазолина гидрохлорид и этилнорэпинефрина гидрохлорид;

- антихолинергическое средство, например, антагонист мускариновых рецепторов (M1, M2 и М3), такой, как атропин, гиосцин, глюкопирролат, ипратропия бромид, тиотропия бромид, окситропия бромид, пирензепин и телензепин;

- агонист бета-адренорецептора (включая бета-рецептор подтипа 1-4), такой как изопреналин, сальбутамол, формотерол, сальметерол, тербуталин, орципреналин, битолтерола мезилат и/или пирбутерол, например, их хиральный энантиомер;

- хромон, например кромогликат натрия и/или недокромил натрия;

- глюкокортикоид, такой как флунизолид, триамцинолона ацетонид, беклометазона дипропионат, будесонид, флутиказона пропионат, циклезонид и/или мометазона фуроат;

- средство, которое модулирует ядерные гормональные рецепторы, такое как PPAR;

- иммуноглобулин (Ig) или препарат Ig, или антагонист, или антитело, модулирующее функцию Ig, такое как анти-IL-1R1, который связывается с тем же или другим эпитопом, что и член связывания по изобретению;

- другое системное или местное противовоспалительное средство, например, талидомид или его производное, ретиноид, дитранол и/или кальципотриол;

- комбинации аминосалицилатов и сульфапиридина, такие как сульфасалазин, месалазин, балсалазид и олсалазин; а также иммуномодулирующих средств, таких как тиопурины; и кортикостероидов, таких как будесонид;

- антибактериальное средство, например, производные пенициллина, тетрациклин, макролид, бета-лактам, фторхинолон, метронидазол и/или ингаляционный аминогликозид; и/или противовирусное средство, например, ацикловир, фамцикловир, валацикловир, ганцикловир, цидофовир; амантадин, ремантадин, рибавирин; занамавир и/или оселтамавир; ингибитор протеазы, такой как индинавир, нелфинавир, ритонавир и/или саквинавир; нуклеозидный ингибитор обратной транскриптазы, например, диданозин, ламивудин, ставудин, залцитабин, зидовудин; ненуклеозидный ингибитор обратной транскриптазы, такой как невирапин, эфавиренц;

- средство, действующее на сердечно-сосудистую систему, такое как

1) антидислипидемическое средство, такое как ингибиторы ГМГ-КоА-редуктазы (например, статины); агонисты PPARα (фибраты, например, гемфиброзил); секвестранты желчных кислот (холестирамин); ингибиторы абсорбции холестерина (растительные станолы, синтетические ингибиторы); ингибиторы абсорбции желчной кислоты (IBATi) и никотиновой кислоты, и их аналоги (ниацин и препараты с замедленным высвобождением);

2) антигипертензивные препараты, такие как β-блокаторы (например, атенолол, анаприлин), ингибиторы АПФ (например, лизиноприл); антагонисты кальция (например, нифедипин); антагонисты ангиотензиновых рецепторов (например, кандесартан); антагонисты и мочегонные средства (например, фуросемид, бензтиазид);

3) модуляторы гемостаза, такие как антитромбические активаторы фибринолиза и антитромбоцитарные средства; антагонисты тромбина; ингибиторы фактора Ха, ингибиторы фактора VIIa; антитромбоцитарные средства (например, аспирин, клопидогрель), антикоагулянты (гепарин и низкомолекулярные аналоги, гирудин и варфарин);

4) антагонисты действия глюкагона, а также

5) противовоспалительные средства, такие как нестероидные противовоспалительные препараты (например, аспирин) и стероидные противовоспалительные средства (например, кортизон).

6) модуляторы морфологии клеток крови, например, пентоксифиллин.

- Антидиабетические средства, такие как:

1) инсулин и аналоги инсулина;

2) стимуляторы секреции инсулина, включая сульфонилмочевину (например, глибенкламид, глипизид), регуляторы уровня глюкозы натощак (например, репаглинид, натеглинид);

3) средства, которые усиливают действие инкретинов (например, ингибиторы дипептидилпептидазы IV, такие как саксаглиптин, ситаглиптин, вилдаглиптин или алоглиптин и агонисты GLP-1);

4) инсулиносенсибилизаторы, включая агонисты PPAR-гамма (например, пиоглитазон и розиглитазон), и средства с комбинированной активностью PPAR-альфа и -гамма;

5) средства, которые модулируют печеночной баланс глюкозы (например, метформин, ингибиторы фруктозо-1,6-бисфосфатазы, ингибиторы гликогенфосфорилазы, ингибиторы гликоген-синтетазы-киназы);

6) средства, направленные на снижение абсорбции глюкозы в кишечнике (например акарбоза);

7) средства, которые препятствуют реабсорбции глюкозы в почках (ингибиторы SGLT);

8) средства, предназначенные для лечения осложнений длительной гипергликемии (например, ингибиторы альдозоредуктазы);

- средство против ожирения, такое как неселективный ингибитор обратного захвата норадреналина/серотонина.

- средства ЦНС, такие как антидепрессанты (например, сертралин); противопаркинсонические средства (такие как депренил, L-допа, ропинирол, прамипексол; ингибитор МАОВ, такой как селегилин и расагилин; ингибитор comP, такой как тасмар; ингибитор А-2, ингибитор обратного захвата дофамина, антагонист NMDA, агонист никотина, агонист дофамина и/или ингибитор нейронной NO-синтетазы); и средства против болезни Альцгеймера, такие как донепезил, ривастигмин, такрин, ингибитор СОХ-2, пропентофиллин или метрифонат;

- средства для лечения острой и хронической боли, например, анальгетик центрального или периферического действия, такой как аналог опия или его производное, карбамазепин, фенитоин, вальпроат натрия, амитриптилин или другой антидепрессант, парацетамол или нестероидное противовоспалительное средство;

- анестетик для парентерального или местного применения (включая ингаляционные), например, лидокаин или его аналог;

- средство для лечения остеопороза, например, гормональное средство, такое как ралоксифен, или бифосфонат, такой как алендронат;

- (I) ингибитор триптазы; (II) антагонист фактора активации тромбоцитов (PAF); (III) ингибитор интерлейкин-превращающего фермента (ИПФ); (IV) ингибитор IMPDH; (V) ингибитор молекул адгезии, включая антагонист VLA-4; (VI) катепсин; (VII) ингибитор киназы, например, ингибитор тирозинкиназы (например, Btk, Itk, Jak3 MAP, примеры ингибиторов могут включать гефитиниб, иматиниб мезилат), сериновой/треониновой киназы (например, ингибитор MAP киназы, такой как р38, JNK, протеинкиназы А, В и С и IKK), или киназы, участвующей в регуляции клеточного цикла (например, циклинзависимой киназы); (VIII) ингибитор глюкозо-6-фосфатдегидрогеназы; (IX) антагонист рецептора кинин-В.суб1. и/или -В.суб2.; (X) противоподагрическое средство, например, колхицин; (XI) ингибитор ксантиноксидазы, например, аллопуринол; (XII) средство, способствующее выведению мочевой кислоты, например, пробенецид, сульфинпиразон и/или бензбромарон; (XIII) стимулятор секреции гормона роста; (XIV) трансформирующий фактор роста (TGFβ); (XV) тромбоцитарный фактор роста (PDGF); (XVI) фактор роста фибробластов, например, основной фактор роста фибробластов (bFGF); (XVII) гранулоцитарно-моноцитарный колониестимулирующий фактор (GM-CSF); (XVIII) крем капсаицин; (XIX) антагонист рецептора тахикинин-NК.суб.1 и/или -NK.суб.3, такой как NKP-608С, SB-233412 (талнетант) и/или D-4418; (XX) ингибитор эластазы, например, UT-77 и/или ZD-0892; (XXI) ингибитор преобразования фермента TNF-альфа (ТАСЕ); (XXII) ингибитор индуцированной NO-синтетазы (INOS) или (XXIII) хемотаксический рецептор гомологичной молекулы, экспрессированной на ТН2 клетках (например, антагонист CRTH2); (XXIV) ингибитор Р38; (XXV) средство, модулирующее функции Toll-подобных рецепторов (TLR), и (XXVI) средство, модулирующее активность пуринергических рецепторов, таких как Р2Х7; (XXVII) ингибитор фактора активации транскрипции, такой как NFkB, API, и/или STATS.

Член связывания в соответствии с настоящим изобретением также может вводиться в качестве монотерапии или в комбинации или в дополнение к обычному хирургическому вмешательству или лучевой терапии или химиотерапии злокачественной опухоли. Такая химиотерапия злокачественной опухоли может включать одно или несколько противоопухолевых средств из следующих категорий:

(I) другие антипролиферативные/противоопухолевые препараты и их комбинации, применяемые в медицинской онкологии, например, алкилирующие средства (например, цисплатин, оксалиплатин, карбоплатин, циклофосфан, ипритный азот, мелфалан, хлорамбуцил, бусульфан, темозоламид и нитрозомочевина); антиметаболиты (например, гемцитабин) и антифолаты (например, фторпиримидины, такие как 5-фторурацил и тегафур, ралтитрексед, метотрексат, цитозин арабинозид и гидроксимочевина); противоопухолевые антибиотики (например, антрациклины, подобные адриамицину, блеомицину, доксорубицину, дауномицину, эпирубицину, идарубицину, митомицину-С, дактиномицину и митрамицину); антимитотические средства (например, алкалоиды барвинка, такие как винкристин, винбластин, виндезин и винорельбин, таксаны, подобные таксолу и таксотеру, ингибиторы полокиназы); ингибиторы топоизомеразы (например, эпидофиллотоксин, такой как этопозид и тенипозид, амсакрин, топотекан и камптотецин);

(II) цитостатические средства, такие как антиоэстрогены (например, тамоксифен, фулвестрант, торемифен, ралоксифен, дролоксифен и йодоксифен), антиандрогены (например, бикалутамид, флутамид, нилутамид и ципротерон ацетат), антагонисты ЛГРГ или агонисты ЛГРГ (например, госерелин, лейпрорелин и бусерелин), прогестагены (например, мегестрол ацетат), ингибиторы ароматазы (например, такие как анастрозол, летрозол, воразол и экземестан) и ингибиторы 5′-редуктазы, такие как финастерид;

(III) противоинвазивные средства (например, ингибиторы семейства c-Src киназы, такие как 4-(6-хлор-2,3-метиленедиоксианилино)-7-[2-(4-метилпиперазин-1-ил)-этокси]-5-тетрагидропиран-4-илоксиквиназолин (AZD0530; международная патентная заявка WO 01/94341), N-(2-хлор-6-метилфенил)-2-{6-[4-(2-гидроксиэтил)-пиперазин-1-ил]-2-метилпирпмидин-4-иламино}-тиазол-5-карбоксамиду (дазатиниб, BMS-354825; J. Med Chem., 2004, 47, 6658-6661) и босутинибу (SKI-606); и ингибиторы металлопротеиназ, такие как маримастат; ингибиторы функции рецептора активатора плазминогена урокиназы или антител к гепараназе);

(IV) ингибиторы функции фактора роста: например, такие ингибиторы включают фактор роста антител и фактор роста рецепторов антител (например, анти-erbB2 антитело трастузумаб [Герцептин™], анти-EGFR антитело панитумумаб, анти-erbB1 антитело цетуксимаб [Эрбитукс, С225] и любой фактор роста или фактор роста рецептора антитела, раскрытые Stern et al. Critical reviews in oncology/haematology, 2005, Vol.54, pp 11-29); такие ингибиторы также включают ингибиторы тирозинкиназы, например ингибиторы семейства эпидермального фактора роста (например, ингибиторы семейства EGFR тирозинкиназы, такие как N-(3-хлор-4-фторфенил)-7-метокси-6-(3-морфолинопропокси)квиназолин-4-амин (гефитиниб, ZD1839), N-(3-этинилфенил)-6,7-бис(2-метоксиэтокси)квиназолин-4-амин (эрлотиниб, OSI 774) и 6-акриламидо-N-(3-хлор-4-фторфенил)-7-(3-морфолинопропокси)-квиназолин-4-амин (CI 1033), ингибиторы тирозинкиназы erbB2, такие как лапатиниб; ингибиторы семейства фактора роста гепатоцитов; ингибиторы семейства фактора роста инсулина; ингибиторы семейства фактора роста тромбоцитов, такие как иматиниб и/или нилотиниб (AMN107); ингибиторы сериновой/треониновой киназы (например, ингибиторы передачи сигнала Ras/Raf, такие как ингибиторы фарнезилтрансферазы, например сорафениб (BAY 43-9006), типифарниб (R115777) и лонафарниб (SCH66336)), ингибиторы клеточной передачи сигнала через МЕК и/или АКТ киназы, ингибиторы c-kit, ингибиторы киназы abl, ингибиторы киназы PI3, ингибиторы киназы Plt3, ингибиторы киназы CSF-1R, ингибиторы рецепторов киназы IGF (инсулиноподобного фактора роста); ингибиторы ауроракиназы (например, AZD1152, РН739358, VX-680, MLN8054, R763, МР235, МР529, VX-528 и АХ39459) и ингибиторы циклин-зависимых киназ, такие как ингибиторы CDK2 и/или CDK4;

(V) антиангиогенные средства, такие как те, которые подавляют эффекты фактора роста эндотелия сосудов (например, антитело против васкулярного фактора роста эндотелиальных клеток бевацизумаб (Авастин™) и, например, ингибитор рецептора тирозинкиназы VEGF, такой как вандетаниб (ZD6474), ваталаниб (РТК787), сунитиниб (SU11248), акситиниб (AG-013736), пазопаниб (GW 786034) и 4-(4-фтор-2-метиллиндол-5-илокси)-6-метокси-7-(3-пирролидин-1-илпропокси)квиназолин (AZD2171; Пример 240 с WO 00/47212); такие соединения, как раскрыты в международных патентных заявках WO 97/22596, WO 97/30035, WO 97/32856 и WO 98/13354 и соединения с другими механизмами действия (например, линомид, ингибиторы функции интегрина av(33 и ангиостатин);

(VI) поражающие сосуды средства, такие как комбретастатин А4 и соединения, описанные в международных патентных заявках WO 99/02166, WO 00/40529, WO 00/41669, WO 01/92224, WO 02/04434 и WO 02/08213;

(VII) антагонист рецептора эндотелина, например зиботентан (ZD4054) или атрасентан;

(VIII) антисмысловые терапевтические средства, например те, которые направлены на вышеперечисленные мишени, такие как антисмысловые ISIS 2503, анти-ras;

(IX) подходы генной терапии, включая, например, замену аберрантных генов, таких как аномальный р53 или аномальный BRCA1, или BRCA2, GDEPT (нацеленный на ген фермент пролекарственной терапии), подходы, в которых применяют цитозиндеаминазу, тимидинкиназу или бактериальный фермент нитроредуктазу, и подходы к увеличению переносимости пациентом химиотерапии или лучевой терапии, такие как генная терапия резистентных ко многим лекарственных средствам заболеваний; и

(X) иммунотерапевтические подходы, включая, например, подходы ex vivo и in vivo для повышения иммуногенности опухолевых клеток пациента, например, трансфекция цитокинами, такими как интерлейкин 2, интерлейкин 4 или гранулоцитарно-моноцитарный колониестимулирующий фактор, подходы к уменьшению анергии Т-клеток, подходы с применением трансфицированных иммунных клеток, таких как трансфицированные цитокинами дендритные клетки, подходы с применением трансфицированных цитокинами линий опухолевых клеток и подходы с применением антиидиотипических антител.

Ингибитор может быть специфичным или может быть смешанным ингибитором, например, ингибитор нацеленный более чем на одну из молекул (например, рецепторы) или на молекулярный класс, упомянутый выше.

Член связывания может также применяться совместно с химиотерапевтическим средством, таким как ингибитор тирозинкиназы, путем совместного введения или в виде иммуноконъюгата. Фрагменты указанного антитела могут также применяться в биспецифичных антителах, полученных с помощью рекомбинантных механизмов или биохимического взаимодействия, с последующим сочетанием специфичности описанного выше антитела со специфичностью других антител, способных распознавать другие молекулы, участвующие в активности, связанной с IL-1R1.

Для лечения воспалительных заболеваний, например, ревматоидного артрита, остеоартрита, астмы, аллергического ринита, хронического обструктивного заболевания легких (ХОЗЛ) или псориаза, член связывания по изобретению может быть объединен с одним или несколькими средствами, такими как нестероидные противовоспалительные средства (далее НПВС), включая ингибиторы неселективной циклооксигеназы (ЦОГ-1/ЦОГ-2), которые применяются местно или системно, такие как пироксикам, диклофенак; производные пропионовой кислоты, такие как напроксен, флурбипрофен, фенопрофен, кетопрофен и ибупрофен; фенаматы, такие как мефенамовая кислота, индометацин, сулиндак, азапропазон; пиразолоны, такие как фенилбутазон; салицилаты, такие как аспирин; селективные ингибиторы ЦОГ-2 (например, мелоксикам, целекоксиб, рофекоксиб, валдекоксиб, лимарококсиб, парекоксиб и эторикоксиб); ингибирующие циклооксигеназу доноры оксида азота (CINOD); глюкокортикостероиды (которые применяются местно, перорально, внутримышечно, внутривенно или внутрисуставно); метотрексат, лефлуномид; гидроксихлорохин, D-пеницилламин, ауранофин или другие парентеральные или пероральные препараты золота; анальгетики; диацереин; средства для внутрисуставной терапии, такие как производные гиалуроновой кислоты, а также пищевые добавки, такие как глюкозамин.

Член связывания по изобретению и один или несколько из вышеуказанных дополнительных лекарственных компонентов могут применяться для производства лекарственного средства. Лекарственное средство может быть предназначено для монотерапии или комбинированного введения человеку, и, соответственно, может содержать член связывания и дополнительный компонент в виде комбинированного препарата или в виде отдельных препаратов. Отдельные препараты могут применяться для облегчения отдельного и последовательного или одновременного введения, и позволяют вводить компоненты с помощью различных способом, например, перорально и парентерально.

В соответствии с настоящим изобретением, предложенные композиции могут быть введены млекопитающим. Они вводятся, как правило, в "терапевтически эффективном количестве", которое является достаточным, чтобы обеспечить эффект для пациента. Таким эффектом может быть, по крайней мере, улучшение, по крайней мере, одного симптома. Фактическое количество веденного средства, скорость и период действия в результате введения будут зависеть от природы и тяжести расстройства, конкретного млекопитающего, проходящего лечение, клинического состояния пациента, причины расстройства, места доставки композиции, типа члена связывания, способа введения, схемы введения и других факторов, известных врачам. Назначение лечения, например, выбор дозы и т.д., является обязанностью практикующих врачей и других врачей и зависит от тяжести симптомов и/или прогрессирования заболевания, которое подлежит лечению. Соответствующие дозы антител хорошо известны в данной области [66, 67]. Конкретные дозы, указанные в данном описании, или в Physician′s Desk Reference (2003), могут применяться по мере необходимости, в зависимости от вида лекарственного средства, которое вводится. Терапевтически эффективное количество или подходящая доза члена связывания по изобретению может быть определена путем сравнения его активности in vitro и активности in vivo на животной модели. Известны способы экстраполяции эффективных доз у мышей и других экспериментальных животных для человека. Точность дозы будет зависеть от ряда факторов, включая наличие антител для диагностики, профилактики или лечения, размер и расположение участка, который подлежит лечению, природы антитела (например, полноразмерное антитело, фрагмент или диатело) и свойства любой определяемой метки или другой молекулы прикрепленной к антителу. Типичная доза антител будет находиться в пределах от 100 мкг до 1 г для системного применения, и от 1 мкг до 1 мг для местного применения. Может быть введена начальная высокая ударная доза, за которой следует одна или несколько сниженных доз. Как правило, антителом будет целое антитело, например, изотипа IgG1, изотипа IgG2, изотипа IgG3 или изотипа IgG4. Указана доза для одного введения взрослому пациенту, которая может быть пропорционально скорректирована для детей и младенцев, а также скорректирована для другого формата антитела пропорционально молекулярной массе. Введение может повторяться ежедневно, 2 раза в неделю, еженедельно или ежемесячно, на усмотрение врача. Введение может повторяться 1 раз в 2-4 недели для подкожного введения и через каждые 4-8 недель для внутривенного введения. Лечение может быть периодическим, и период между введением составляет около 2 недель и более, например, около 3 недель и более, около 4 недель или более, или приблизительно 1 раз в месяц. Введение может осуществляться до и/или после хирургического вмешательства, и/или может осуществляться или наноситься непосредственно на анатомический участок в результате хирургического вмешательства.

Члены связывания по изобретению также обладают диагностической ценностью, например, для определения наличия или количества IL-1R1, например, в образце пациента с обструктивным заболеванием дыхательных путей или другим воспалительным процессом с участием IL-1R. Такая диагностическая ценность может включать введение метки в член связывания по изобретению.

Связывающий элемент изобретения можно маркировать детектируемой или функциональной меткой. Таким образом, связывающий элемент или молекулу антитела можно представить в форме иммуноконьюгата для того, чтобы получить обнаружимый и/или выражаемый количественно сигнал. Иммуноконьюгат можно сравнить с молекулой антитела по изобретению, конъюгированной с обнаружимой или функциональной меткой. Метка может быть молекулой, которая продуцирует или может быть индуцированной для произведения сигнала, в том числе, не ограничиваясь ими, люминофоры, радиометки, ферменты, хемилюминесцентные вещества или фотосенсибилизаторы. Таким образом, связывание может быть обнаружено и/или измерено по флуоресценции или люминесценции, радиоактивности, ферментной активности или поглощению света.

Соответствующие метки включают, только для иллюстрации и без ограничений

- ферменты, такие как щелочная фосфатаза, глюкозо-6-фосфат-дегидрогеназа (Г6ФДГ), альфа-D-галактозидаза, глюкозооксидаза, глюкозоамилаза, карбоангидраза, ацетилхолинэстераза, лизоцим, малатдегидрогеназа и пероксидаза, например, пероксидаза хрена;

- красители;

- флуоресцентные метки или люминофоры, такие как флуоресцеин и его производные, флуорохром, соединения и производные родамина, ЗФБ («зеленый флуоресцентный белок»), дансил, умбеллиферон, о-фталевый альдегид, фикоэритрин, фикоцианин, аллофикоцианин, флуорескамин; флуорофоры, такие как лантанид криптаты и хелаты, например, европиум и т.д. (Perkin Elmer и Cis Biointemational);

- хемилюминесцентные метки или хемилюмнофоры, такие как изолюминол, люминол и диоксетан;

- биолюминесцентные метки, такие как люцифераза и люциферин;

- сенсибилизаторы;

- коэнзимы;

- ферментные субстраты;

- радиометки, в том числе, не ограничиваясь ими, бром 77, углерод 14, кобальт 57, фтор 8, галлий 67, галлий 68, водород 3 (тритий), индий 111, индий 113м, йод 123м, йод 125, йод 126, йод 131, йод 133, ртуть 107, ртуть 203, фосфор 32, рений 99м, рений 101, рений 105, рутений 95, рутений 97, рутений 103, рутений 105, скандий 47, селений 75, сера 35, технеций 99, технеций 99м, теллур 121м, теллур 122м, теллур 125м, тулий 165, тулий 167, тулий 168, иттрий 199 и другие радиоактивные метки в данном описании;

- частицы, такие как частички латекса или углерода; золь металла, кристаллит; липосомы; клетки, и т.д., которые могут быть далее мечены красителем, катализаторами или другими обнаружимыми группами;

- молекулы, такие как биотин, дигоксигенин или 5-бромдезоксиуридин;

- токсичные группы, например, токсические вещества, выбранные из группы экзотоксина Pseudomonas (экзотоксин Pseudomonas, цитотоксический фрагмент или его мутанты), токсин дифтерии, цитотоксический фрагмент или его мутант, ботулинический токсин А, В, С, D, Е или F, рицин или его цитотоксический фрагмент, например, рицин А, абрин или его цитотоксический фрагмент, антивирусный токсин лаконоса или его цитотоксический фрагмент и дриодин 1 или его фитотоксический фрагмент.

Соответствующие ферменты или коферменты раскрыты в Litman, et al., US 4,275,149, and Boguslaski, et al., US 4318980, каждый из которых включен в данное описание путем ссылки в полном объеме.

Подходящие флуоресцирующие и хемилюминесцирующие вещества раскрыты в Litman, et al., US 4275149, которые включены в данное описание путем ссылки в полном объеме. Маркеры дополнительно содержат химическую составляющую, такую как биотин, которая может быть определена по связи со специфической сходной обнаружимой составляющей, например маркированным авидином или стрептавидином. Обнаружимые маркеры могут прикрепляться к антителам по изобретению с использованием традиционной химии, известной в этой области.

Иммуноконъюгаты или их функциональные фрагменты могут быть получены методами, известными специалисту в данной области. Они могут быть связаны с ферментами или флуоресцентными маркерами непосредственно или с помощью спейсерной или линкерной групп, таких как полиальдегид, глютаральдегид, этилендиаминтетрауксусная кислота (ЭДТА), диэтилентриаминпентауксусная кислота (ДТПА), или в присутствии связывающего агента, такого как упоминалось выше для терапевтических конъюгатов. Конъюгаты, содержащие маркеры флуоресцентного типа, могут быть получены реакцией с изотиоцианатом.

Методы, известные специалистам в области, существуют для связывания терапевтических радиоизотопов с антителами непосредственно или через хелатирующий агент, такой как ЭДТА, ДТПА, упоминавшиеся выше, которые можно использовать для радиоэлементов, применимых в диагностике. Подобным образом, можно ввести метку натрия 125 с помощью метода с использованием хлорамина Т [68] или технеция 99m способом Crockford с соавт., (US 4424200, включен в данное описание путем ссылки в полном объеме) или присоединением через ДТПА, как описано Hnatowich (US 4,479,930, включен в данное описание путем ссылки в полном объеме).

Существует большое количество методов, с помощью которых маркер может продуцировать обнаруживаемый внешним устройством сигнал, например, визуальное обследование, электромагнитное излучение, нагревание и химические реагенты. Маркер можно также соединять с другим членом связывания, который связывается с антителом по изобретению, или с носителем.

Маркер может непосредственно давать сигнал, и, следовательно, дополнительные компоненты для генерации сигнала не требуются. Множество органических молекул, например, флуоресцентные вещества, способны поглощать ультрафиолет и видимый свет, когда поглощенный свет переносит энергию на эти молекулы и приводит их в возбужденное энергетическое состояние. Такая поглощенная энергия затем рассеивается с выделением света на второй длине волны. Такая вторичная эмиссия также может переносить энергию к маркированным акцепторным молекулам, и результирующая энергия рассеивается из акцепторной молекулы с выделением света, например, резонансный перенос энергии флуоресценции (РПЭФ). Другие маркеры, которые непосредственно вырабатывают сигнал, содержат радиоактивные изотопы или красители.

В качестве альтернативы, маркер может нуждаться в других компонентах для генерации сигнала, и система, образующая сигнал, может содержать все компоненты, необходимые для генерации измеримого сигнала, которые могут включать субстраты, коэнзимы, энхансеры, дополнительные ферменты, вещества, которые далее реагируют с ферментными продуктами, катализаторы, активаторы, кофакторы, ингибиторы, акцепторы, ионы металлов и специфически связывающие вещества, необходимые для связывания с веществами, генерирующими сигнал. Подробное обсуждение приемлемого сигнала, продуцирующего системы, можно найти в Ullman, et al. US 5,185,243, который включен в данное описание путем ссылки в полном объеме.

В настоящем изобретении предлагается способ, включающий причину или разрешение связывания со связывающимся элементом, как предусмотрено в данном описании для IL-1R1. Как отмечалось, такое связывание может иметь место in vivo, например, после введения связывающего элемента или кодирующих нуклеиновых кислот человека или животного (например млекопитающее), или это может иметь место in vitro, например, в методе ELISA, Вестерн-блоттинга, иммуноцитохимии, иммунопреципитации, аффинной хроматографии, биохимии и анализах на клеточной основе.

В основном, комплексы между членом связывания по изобретению и IL-1R1 можно обнаруживать с помощью, среди прочего, метода иммуноанализа, связанного с ферментом, иммунопреципитацией, флуоресцентным иммуноанализом, хемилюминесцентным анализом, анализом иммуноблота, методом бокового сдвига, реакцией агглютинации и анализом, основанным на частицах.

В настоящем изобретении также предлагается измерение уровней антигена непосредственно, с помощью применения члена связывания в соответствии с изобретением, например в биосенсорной системе. Например, настоящее изобретение включает метод обнаружения и/или измерения связывания с IL-1R1, включающий, (i) обеспечение контакта вышеупомянутого члена связывания с IL-1R1 и (ii) обнаружение связывания вышеупомянутого члена связывания с IL-1R1, где обнаруживают без применения какого-либо метода или обнаружимой метки, описанной в данном описании. Этот или другой метод обнаружения, описанный в данном описании, может быть осуществлен непосредственно с помощью человека, исполняющего метод, например, с помощью визуального наблюдения обнаружимой метки. В качестве альтернативы, этот метод или любой другой метод обнаружения связывания, описанный в данной описании, может предоставлять отчет в форме ауторадиограмм, фотоснимков, вывода данных на печатающее устройство вычислительной машины, отчета проточной цитометрии, диаграммы, схемы, пробирочного теста, результата контейнера или ячейки, или любого другого визуального или физического представления результатов анализа.

Можно количественно определять связывание члена связывания с IL-1R1, Количественный анализ можно относить к количеству антигена в тестовом образце, который может быть интересным с диагностической точки зрения. Скрининг и/или количественное определение связывания с IL-1R1 может быть полезным, например, в обследовании пациентов на предмет заболевания или нарушения, вышеупомянутого в данном описании, и/или любых других заболеваний или нарушений, включающих аберрантную выработку, экспрессию и/или активность IL-1R1.

Способ диагностики по изобретения может включать (i) получение образцов ткани или жидкости от субъекта, (ii) обеспечение контакта вышеупомянутого образца ткани или жидкости одним или более членами связывания по настоящему изобретению; и (iii) обнаружение связанного IL-1R1, по сравнению с контрольным образцом, где увеличение количества IL-1R1 связывания по сравнению с контролем, может показывать аберрантный уровень выработки, экспрессии или активности IL-1R1.

Образцы ткани или жидкости для тестирования включают кровь, сыворотку, мочу, материалы биопсии, опухоли или любую другую ткань, предположительно содержащую аберрантный уровень IL-1R1. Субъекты, с позитивным тестом на аберрантный уровень или активность IL-1R1, также могут получить пользу от способов лечения, раскрытых в данном описании ниже.

Способ диагностики по изобретению далее может включать комплекс члена связывания и IL-1R1, соединенных через иммобилизированный антиген. Например, антиген можно иммобилизировать на пробе латеральной полоски для захватывания антиген-специфического IL-1R1 в интересующем образце.

Специалисты могут выбрать приемлемый способ определения связывания члена связывания с антигеном в соответствии с предпочтениями и общими знаниями, на основе методов, раскрытых в данном описании.

Реакционную способность членов связывания в образце можно определять любым подходящим способом. Радиоиммунный анализ (РИА) - один из способов. Радиоактивно меченый антиген смешивают с немаркированным антигеном (тестовым образцом) и позволяют связывание члена связывания. Связанный антиген физически отделяют от несвязанного антигена и определяют количество радиоактивного антигена, связанного с членом связывания.

Чем больше антигена в тестовом образце, тем меньше радиоактивного антигена будет связываться с членом связывания. Анализ конкурирующего связывания можно использовать с нерадиоактивным антигеном, с использованием антигена или линкерного аналога с репортерной молекулой. Репортерная молекула может быть флуорохромом, фосфором или оптическим красителем с характеристиками спектрально изолированного поглощения или эмиссии. Приемлемый флуорохром включает флуоресцеин, родамин, фикоэритрин, Texas Red и хелаты или криптаты лантанида. Приемлемый хромогенный краситель включает диаминобензидин.

Другие репортеры включают макромолекулярные коллоидные частицы или зернистый материал, такой как окрашенные капли латекса, магнит или парамагнит, биологически или химически активные агенты, которые могут непосредственно или косвенно генерировать обнаружимый сигнал для визуального наблюдения, обнаруживаемый с помощью электронных приборов или регистрируемый другим способом. Такие молекулы могут быть ферментами, которые катализируют реакции, проявляющие или изменяющие цвет или приводящие к изменению электрических свойств, например. Они могут быть возбудимыми на молекулярном уровне, поскольку перенос электронов между энергетическими состояниями дает спектральные характеристики поглощения или выделения. Они могут включать химические объекты, используемые в конъюгации с биосенсорами. Можно использовать системы обнаружения на основе биотина/авидина или биотина/стрептавидина и щелочной фосфатазы.

Сигналы, генерируемые отдельными связывающими конъюгатами «член связывания-репортер», могут быть использованы для выведения абсолютных или относительных количественных данных соответствующего связывания члена связывания в образце (нормальном или тестовом).

Набор, содержащий член связывания, в соответствии с любым аспектом или модификацией настоящего изобретения, также представлен как аспект настоящего изобретения. В наборе, член связывания может быть меченым, что позволяет определить реакционную способность в образце, например, как описано ниже. Далее член связывания может быть или может не быть соединен с твердым носителем. Компоненты набора, в общем, стерильны и находятся в запаянных флаконах или в других контейнерах. Наборы могут быть задействованы в диагностических анализах или других методах, в которых используется член связывания. Набор должен содержать инструкции по использованию компонентов в методиках, например в способе в соответствии с настоящим изобретением. Вспомогательные материалы для содействия или создания возможности проведения таких методов можно включать в набор по изобретению. Дополнительные материалы включают различные вторичные члены связывания, которые связываются с первичным членом связывания и конъюгированы с обнаружимым маркером (например, флуоресцентная метка, радиоактивный изотоп или фермент).

Наборы, основанные на антителах, также могут содержать гранулы для проведения иммунопреципитации. Каждый компонент наборов, в основном, находится в отдельной подходящей упаковке. Таким образом, эти наборы обычно содержат разные контейнеры, пригодные для каждого члена связывания. Дополнительно, наборы могут содержать инструкции для проведения анализов и методик, интерпретации и анализа данных, полученных в результате выполнения анализа.

Настоящее изобретение также предусматривает применение члена связывания, как описано выше, для измерения уровня антигена в конкурентном анализе, другими словами, для способа измерения уровня антигена в образце с применением члена связывания, как предусмотрено в настоящем изобретении, в ходе конкурентного анализа. Это может происходить там, где не требуется физическое разделение связанного и несвязанного антигена. Соединение репортерной молекулы с членом связывания с результатом в виде изменения физических или оптических параметров является одной из возможностей. Репортерная молекула может прямо или косвенно генерировать обнаружимые сигналы, которые могут быть количественно измерены. Связь репортерных молекул может быть прямой или непрямой, ковалентной, например, через пептидную связь, или нековалентной. Связывание через пептидную связь может быть результатом рекомбинантной экспрессии слияния генов, кодирующих антитело или репортерную молекулу.

Один из вариантов настоящего изобретения включает способ распознавания связывающегося с IL-1R1 соединения, включающий (i) иммобилизацию IL-1R1 на носителе, (ii) контакт вышеупомянутого иммобилизованного IL-1R1 одновременно или пошаговым способом, по меньшей мере, с одним целевьм или меченым членом связывания в соответствии с изобретением или одним или больше нецелевых или немеченых исследуемых членов связывания, и (iii) распознавание нового члена связывания IL-1R1 посредством наблюдения количественного уменьшения связывания метки целевого члена связывания. Такие способы можно выполнять с высокой производительностью, используя многолуночный или матричный формат. Такие анализы можно также выполнять в растворе. См. к примеру, U.S. 5814468, который включен в данное описание путем ссылки в полном объеме. Как описано выше, обнаружение связывания может быть осуществлено непосредственно экспертом, исполняющим способ, например, через визуальное наблюдение обнаружимой метки или уменьшение ее содержания. В качестве альтернативы, в способах связывания по изобретению может быть предоставлен отчет в форме ауторадиограмм, фотоснимков, вывода данных на печатающее устройство вычислительной машины, отчета проточной цитометрии, диаграммы, схемы, пробирочного теста, результата контейнера или лунки, или любого другого визуального или физического представления результатов способов.

В настоящем изобретении далее предлагается выделенная нуклеиновая кислота, кодирующая член связывания по настоящему изобретению. Нуклеиновая кислота может включать ДНК и/или РНК. В одном из вариантов настоящего изобретения предлагается нуклеиновая кислота, которая кодирует CDR или серию CDR, VH домен или VL домен, антиген-связывающий сайт антитела или молекулу антитела, например, scFv или IgG1, по изобретению. В дальнейших аспектах изобретения предлагается изолированная нуклеиновая кислота, которая включает последовательность кодируемого члена связывания по изобретению, VH домен и/или VL домен в соответствии с настоящим изобретением.

Например, SEQ ID NOS: 92, 2, 122, 102, 12, 62, 22, 32, 72, 42, 112, 52 и 82 кодируют типичные VH домены по настоящему изобретению, и SEQ ID NOS: 97, 7, 127, 107, 17, 67, 27, 37, 77, 47, 117, 57 и 87 кодируют типичные VL домены по настоящему изобретению. Настоящее изобретение также предусматривает конструкции в форме плазмид, векторов, кассет транскрипции или экспрессии, которые включают, по меньшей мере, одну нуклеиновую кислоту, как указано выше.

Настоящее изобретения также предусматривает, что рекомбинантная клетка-хозяин включает одну или более конструкций, как указано выше, и предусматривает способ продуцирования кодируемого продукта, где способ включает экспрессию вышеуказанной кодирующей конструкции. Экспрессия может быть легко достигнута с помощью культивирования в соответствующих условиях рекомбинантной клетки-хозяина, содержащего конструкцию. После продуцирования с помощью экспрессии VH или VL домен или член связывания можно выделять и/или очищать с помощью какой-либо соответствующей методики.

Нуклеиновая кислота в соответствии с настоящим изобретением может включать ДНК или РНК и может быть полностью или частично синтетической. Ссылка на нуклеотидную последовательность, как представлено в данном описании, охватывает молекулу ДНК со специфической последовательностью, и охватывает молекулу РНК со специфической последовательностью, в которой У замещает Т, если контекст не диктует иного.

Дополнительный аспект предусматривает способ продуцирования антитела или вариабельного VH домена, включающий экспрессию кодирующей нуклеиновой кислоты. Такой способ может включать культивирование клетки-хозяина в условиях продуцирования указанного вариабельного домена VH антитела.

Аналогичные способы продуцирования вариабельных доменов VL и членов связывания, таких как антитела, содержащие VH и/или VL домен, предусмотрены как дополнительный аспект настоящего изобретения, способ продуцирования может включать стадию выделения и/или очистки продукта. Способ продуцирования может включать рецептуру продукта в препарате, включающем, по меньшей мере, один дополнительный компонент, такой как фармацевтически приемлемый наполнитель.

Хорошо известны системы клонирования и экспрессии полипептида в различных клетках-хозяевах. Подходящие клетки-хозяева включают бактерии, клетки млекопитающих, клетки растений, мицелиальные грибы, дрожжи и бакуловирусные системы, трансгенные растения и животных. Экспрессия антител и фрагментов антител в прокариотных клетках признана в данной области. Обзора, см., например, в Plückthun [69]. Общепринятый бактериальный хозяин - Е.coli.

Экспрессия в эукариотных клетках в культуре также применяется специалистами как альтернатива продуцированию члена связывания [70, 71, 72]. Линии клеток млекопитающих, которые применяют в данной области для экспрессии гетерологичных полипептидов, включают клетки яичника китайского хомяка (СНО), клетки HeLa, клетки почки новорожденного хомяка, клетки NS0 меланомы мыши, YB2/0 клетки миеломы крысы, клетки почки человеческого эмбриона, клетки сетчатки глаза человеческого эмбриона и др.

Может быть выбран или сконструирован подходящий вектор, содержащий соответствующие регуляторные последовательности и при необходимости включающий промоторные последовательности, терминаторные последовательности, полиаденилированные последовательности, энхансерные последовательности, маркерные гены и другие последовательности. При необходимости векторы могут быть плазмидами, например фагемидами, или вирусами, например фагами [73]. Известно много методик и протоколов для манипуляций нуклеиновой кислотой, например, изготовление конструкции нуклеиновой кислоты, мутагенез, секвенирование, введение ДНК в клетки, экспрессия генов и анализ белков описаны подробно в Ausubel с соавт. [74].

Дополнительный аспект настоящего изобретения предусматривает клетку-хозяина, содержащую нуклеиновую кислоту, как раскрыто в данном описании. Такая клетка-хозяин может находиться in vitro или в культуре. Такая клетка-хозяин может находиться in vivo. In vivo присутствие клетки-хозяина может привести к внутриклеточной экспрессии члена связывания, обозначенных в настоящем изобретении, как «интраантитела» или внутриклеточные антитела. Интраантитела можно применять в генной терапии.

Изобретение также включает способы получения члена связывания, VH домена и/или VL домена по изобретению, которые содержат указанную экспрессирующую нуклеиновую кислоту в условиях продуцирования указанного члена связывания, VH домена и/или VL домена, и выделение и/или очистку члена связывания.

Дополнительный аспект предусматривает способ, включающий введение нуклеиновой кислоты по изобретению в клетку-хозяина. Введение можно осуществлять любыми доступными технологиями. Для эукариотных клеток, подходящие методики могут включать трансфекцию фосфат кальция, диэтиламиноэтилдекстран, электропорацию, опосредованную липосомами трансфекцию и трансдукцию с применением ретровируса или другого вируса, например, вакцинацию или, для клеток насекомых, бакуловирус. При введении нуклеиновой кислоты в клетку-хозяина, в частности, эукариотную клетку, можно применять вирусную или основанную на плазмидах систему. Плазмидная система может поддерживаться эписомально или быть встроенной в клетку-хозяина или в искусственную хромосому. Встраивание может быть случайной или нацеленной инкорпорацией одной или больше копий в одиночном или множественном локусе. Для бактериальных клеток, подходящие техники могут включать трансформацию хлоридом кальция, электропорацию или трансфекцию с применением бактериофагов.

Встраивание может следовать за вызыванием или разрешением экспрессии нуклеиновой кислоты, например, культивированием клеток-хозяев в условиях экспрессии генов. Очистка экспрессированного продукта может осуществляться способами, известными специалисту.

Нуклеиновую кислоту по изобретению можно встраивать в геном (например хромосому) клетки-хозяина. Встраивание может стимулироваться включением последовательности, которая стимулирует рекомбинацию с геномом, в соответствии со стандартными методиками.

Настоящее изобретение также предусматривает способ, который включает применение конструкции, как описано выше, в системе экспрессии, чтобы экспрессировать член связывания или полипептид, как указано выше.

В общем, для получения моноклональных антител или их функциональных фрагментов, особенно мышиного происхождения, можно ссылаться на методики, которые описаны, в частности, в руководстве "Антитела" [75] или на методику приготовления из гибридом, описанную Köhler and Milstein [76].

Моноклональные антитела можно получать, например, из клеток, полученных от иммунизированных против IL-1R1 животных, или одного из фрагментов, содержащего эпитоп, распознаваемый вышеупомянутыми моноклональными антителами. Приемлемые фрагменты, пептиды или полипептиды, содержащие их, можно применять для иммунизации животных с генерацией антител против IL-1R1. Указанный IL-1R1 или один из его фрагментов, конкретно может продуцироваться в соответствии с обычными рабочими методиками, генетической рекомбинацией, начинающейся с последовательности нуклеиновой кислоты, содержащейся в последовательности кДНК, кодирующей IL-1R1 или его фрагмент, с последующим синтезом белка, начинающегося с последовательности аминокислот, содержащих пептидную последовательность IL-1R1 и/или его фрагмента.

Моноклональные антитела можно, например, быть очищенными на аффинной колонне, в которой IL-1R1 или один из его фрагментов, содержащий распознанный эпитоп вышеупомянутых моноклональных антител, был предварительно иммобилизирован.

В частности, Моноклональные антитела можно очищать с помощью аффинной хроматографии на протеине А и/или G после или не после ионообменной хроматографии, нацеленной на устранение остаточных белковых загрязняющих веществ, а также ДНК и липополисахаридов (ЛПС), после или не после эксклюзионной хроматографии на Sepharose™ геле для того что бы устранить белковые агрегаты по причине присутствия димеров или других мультимеров. В одном из вариантов, все эти способы можно применяться одновременно или последовательно. Есть возможность взять моноклональные или другие антитела и применять способы технологии рекомбинантных ДНК для продуцирования других антител или химерных молекул, которые связывают целевой антиген. Такие способы можно содержать индуцирующие ДНК, кодирующие вариабельный домен имуноглобулина, или CDR, антитела к константным доменам, или константные домены плюс каркасные регионы, различного иммуноглобулина. См. к примеру, ЕР-А-184187, GB 2188638 A или ЕР-А-239400, и большое множество дальнейшей литературы. Гибридом или другая клетка, продуцирующая антитело, может быть субъектом генетической мутации или других изменений, которые можно или не можно видоизменять связывающую специфичность продуцированных антител.

Дальнейшие способы доступны в области инженерии антител сделали возможным выделение человеческих и гуманизированные антитела. Например, человеческие гибридомы можно быть получены, как описано Kontermann & Dubel [77]. Дисплей, другие адаптированные способы генерации члена связывания были описаны подробно во многих публикациях, таких как Kontermann & Dubel [77] и WO 92/01047 (обсуждается далее), и патентах США US 5,969,108, US 5,565,332, US 5,733,743, US 5,858,657, US 5,871,907, US 5,872,215, US 5,885,793, US 5,962,255, US 6,140,471, US 6,172,197, US 6,225,447, US 6,291,650, US 6,492,160 и US 6,521,404.

Трансгенных мышей, у которых гены мышиного антитела инактивированы и функционально заменены генами человеческого антигена, в то время как другие компоненты иммунной системы мыши остаются неповрежденными, можно использовать для выделения человеческих антител [78]. Гуманизированные антитела можно продуцировать известными в данной области способами, например, такими как раскрыты WO 91/09967, US 5,585,089, ЕР 592106, US 5,565,332 и WO 93/17105. Далее, в W02004/006955 описаны способы гуманизации антител на основании селективных последовательностях каркасных вариабельных участков генов человеческого антигена с помощью сравнения канонических типов структуры CDR для последовательностей CDR вариабельного участка нечеловеческого антитела с каноническими типами структуры CDR для соответствующих CDR из библиотеки последовательностей человеческого антитела, например сегменты гена антитела зародышевой линии. Вариабельные участки человеческого антитела, содержащие подобные канонические типы структуры CDR для нечеловеческих CDR, из которых формируют субпопуляцию элементов последовательностей человеческого антитела для селекции человеческих каркасных последовательностей. Элементы субпопуляции далее могут быть упорядочены на основе сходства аминокислот между человеческими и нечеловеческими последовательностями CDR. В способе WO 2004/006955, лидирующие человеческие последовательности подобраны для того, что бы обеспечить каркасные последовательности для конструирования химерного антитела, в котором человеческие последовательности CDR функционально замещены нечеловеческими эквивалентными копиями CDR с применениям подобранного элемента субкультуры человеческих каркасов, посредством чего обеспечивается гуманизированное антитело с высокой эффективностью или низкой иммуногенностью без необходимости в сравнении каркасных последовательностей между нечеловеческими и человеческими антителами.

Химерные антитела, созданные в соответствии с способом, также раскрыты.

Синтетические молекулы антитела могут быть созданы экспрессией генерированных генов посредством синтезированных олигонуклеотидов и собранны в соответствующие экспрессионные векторы, например как описано Knappik с соавт. [79] или Krebs с соавт. [80].

Как отмечено выше, член связывания в соответствии с настоящим изобретением модулирует или может нейтрализовать биологическую активность IL-1R1. Как описано в данном описании, IL-1R1 - связывающие элементы по настоящему изобретению могут быть оптимизированы для нейтрализации активности. В общем, оптимизация активности включает мутацию последовательности выбранного члена связывания (обычно последовательность вариабельного домена антитела) для генерации библиотеки членов связывания, которые далее анализируют на предмет активности, отбирая члены связывания с высокой активностью. Таким образом, выбор членов связывания «с оптимизированной активностью» дает активность выше, чем у члена связывания, из которого была сгенерирована библиотека. Тем не менее, высокая активность члена связывания может также быть получена без оптимизации, например, высокая активность члена связывания может быть получена непосредственно начальным скринингом, например, способом биохимической нейтрализации. «Оптимизированная активность» члена связывания обозначает член связывания с оптимизированной нейтрализующей активностью в отношении специфичной активности или нижерасположенной функции. Анализы или активность описаны подробнее в другом месте данного описания. В настоящем изобретении предлагаются члены связывания с оптимизированной или неоптимизированной активностью, а также способы оптимизации активности выбранного члена связывания. Настоящее изобретение, таким образом позволяет специалисту сгенерировать член связывания, обладающий высокой активностью.

Хотя оптимизация активности может быть применена для генерации более высокой активности члена связывания по сравнению с данным членом связывания, также следует отметить, что высокая активность членов связывания может быть достигнута даже без оптимизации активности.

В дальнейших аспектах настоящего изобретения предлагается способ получения одного или более членов связывания, способных связываться с антигеном, и выбор одного или более членов связывания библиотеки, способного связываться с указанным антигеном.

Библиотека может быть показана на частичках или молекулярных комплексах, например воспроизводимые генетические пакеты, такие как дрожжевые, бактериальные или фаговые (например Т7) частички, вирусы, клетки или ковалентные, рибосомальные или другие системы показа in vitro, где каждая частичка или молекулярный комплекс содержит нуклеиновую кислоты, кодирующую вариабельный домен VH антитела, показанного на нем, факультативно также демонстрируется домен VL, если он присутствует. Показ фага описан в WO 92/01047 и, например, патентах США US 5,969,108, US 5,565,332, US 5,733,743, US 5,858,657, US 5,871,907, US 5,872,215, US 5,885,793, US 5,962,255, US 6,140,471, US 6,172,197, US 6,225,447, US 6,291,650, US 6,492,160 и US 6,521,404, каждый из которых включен в данное описание в полном объеме, путем ссылки

После выбора члена связывания, способного к связыванию с антигеном и показа на бактериофаге или другой библиотеке частиц или молекулярных комплексов, нуклеиновые кислоты могут быть извлечены из бактериофагов или других частиц или молекулярных комплексов, демонстрирующих выбранный член связывания. Такую нуклеиновую кислоту можно применять для продуцирования последовательности VH или VL вариабельного домена члена связывания или антитела посредством экспрессии нуклеиновой кислоты с последовательностью нуклеиновой кислоты, выделенной из бактериофага или другой частички или молекулярного комплекса, демонстрирующего указанный член связывания.

Вариабельный домен VH антитела с аминокислотной последовательностью VH вариабельного домена антитела указанного выбранного члена связывания может быть предоставлен в выделенной форме, как и член связывания, содержащий такой VH домен.

Способность к связыванию с IL-1R1 далее можно протестировать, как и способность конкурировать, например, с исходной молекулой антитела (антитело 1 или 4) или молекулой антитела 2, 3, 5, до 10 (например, в scFv формате и/или IgG формате, например, IgG1) за связывание с IL-1R1. Способность к нейтрализации IL-1R1 можно протестировать, как обсуждается далее в данном описании.

Член связывания в соответствии с настоящим изобретением может связываться со сродством исходной (антитело 1 или 4) и других молекул антитела, например, scFv, или одного из антител 2, 3, 5, до 10, например, IgG1, или с лучшим сродством.

Член связывания в соответствии с настоящим изобретением может нейтрализовать биологическую активность IL-1R1 с активностью исходной (антитело 1 или 4) или другой молекулы антитела, одного из антител 2, 3, 5 до 10, например, scFv, или IgG1, или с лучшей активностью.

Сродство связывания и нейтрализующая активность различных членов связывания можно сравнить в подходящих условиях.

Варианты VH и VL доменов и CDR по настоящему изобретению, включающие такие, для которых аминокислотные последовательности показаны в данном описании, и которые можно использовать в членах связывания для IL-1R1, могут быть получены посредством способов изменения последовательности или мутации и скрининга для поиска членов связывания с антигеном с желательными свойствами. Примеры желательных характеристик включают, не ограничиваясь ими:

- повышенное сродство к антигену относительно известных антител, которые являются специфичными в отношении антигена;

- повышенная нейтрализация активности антигена относительно известных антител, которые являются специфичными в отношении антигена, если активность известна;

- специфическая способность конкурировать с известным антителом или лигандом к антигену при определенном молярном отношении;

- способность к образованию иммунопреципитатного комплекса;

- способность связываться со специфическим эпитопом;

О линейный эпитоп, например, идентифицированная с помощью пептид-связывающего сканирования последовательность, как описано в данном описании, например, с применение скрининга пептидов в линейной и/или ограниченной конформации;

О конформационный эпитоп, сформированный с помощью прерывающихся остатков;

- способность к модулированию новой биологической активности IL-1R1 или нижележащей в биохимическом пути молекулы.

Такие способы также представлены в данном описании. Варианты молекул антитела, раскрытые в данном описании, также могут быть продуцированы и применены в настоящем изобретении. Далее ход вычислительной химии с применением метода анализа многомерных данных к взаимосвязи «структура/свойства-активность» [81] для количественной оценки взаимосвязи «активность-свойства» антител можно вывести с применением хорошо известных математических способов, таких как статистическая регрессия, распознавание изображений и классификация [82, 83, 84, 85, 86, 87]. Свойства антитела можно вывести из эмпирических и теоретических моделей (например, анализы вероятно контактирующих остатков или вычисленного физико-химического свойства) последовательности антитела, функциональных или трехмерных структур, и эти свойства можно рассматривать по одному или в комбинации.

Антиген-связывающий сайт антитела состоит из VH домена и VL домена и типично формируется с помощью шести петель полипептидов: три из вариабельного домена легкой цепи (VL) и три из вариабельного домена тяжелой цепи (VH). Анализ антител известной атомарной структуры интерпретирует родственные связи между последовательностью и трехмерной структурой комбинированных сайтов антитела [88, 89]. Эти родственные связи подразумевают, что, за исключением третьего участка (петли) в VH доменах, петлям связывающего сайта присуща одна из небольшого количества конформации главной цепи: канонические структуры. Очевидно, что каноническую структуру, сформированную в специфических петлях, определяют по ее размеру и присутствию некоторых остатков в ключевых положениях петли и каркасных участков [88, 89].

Данное исследование взаимосвязи «последовательность-структура» можно применять для прогнозирования тех остатков в известной последовательности антитела с неизвестной трехмерной структурой, которые являются важными для поддержания трехмерной структуры его CDR петель и, следовательно, для сохранения специфичности связывания.

Такое прогнозирование можно улучшить с помощью сравнения результата прогнозирования с результатом эксперимента, проводимого с целью оптимизации. В структурном подходе, может быть создана модель молекулы антитела [90] с применением какого-либо бесплатного или коммерческого пакета, такого как WAM [91]. Программный пакет для визуализации и анализа белка, такой как Insight II (Accelrys, Inc, San Diego, USA.) или Deep View [92] можно далее применять для оценки возможного замещения в каждом положении CDR. Эту информацию можно далее применять для создания замещений, например, оказывающих минимальное или благоприятное влияние на активность.

Необходимые способы для создания замещений в аминокислотных последовательностях CDR, VH или VL доменов антитела и члена связывания в основном доступны специалисту в данной области. Разновидности последовательностей могут быть созданы с поддающимся или не поддающимся прогнозированию замещением, чтобы получить минимальное или благотворное влияние на активность, и проверены на предмет способности к связыванию и/или нейтрализации IL-1R1 и/или любого другого желательного свойства.

Вариабельный домен, который применяется в изобретении, можно получить или вывести из любой зародышевой линии или перегруппированного человеческого вариабельного домена, или он может быть синтетическим вариабельным доменом, который основывается на консенсусной или фактической последовательности известных человеческих вариабельных доменов. Вариабельный домен может происходить из нечеловеческого антитела, последовательность CDR по изобретению (например, HCDR3) можно внедрить в состав вариабельного домена с дефицитом CDR (например HCDR3), с применением технологий рекомбинантной ДНК. Например, Marks с соавт. [93] описывает способы генерации репертуара вариабельных доменов антитела, в которых типичные праймеры, нацеленные или смежные с 5′ концом участка вариабельного домена, используются в сочетании с типичным праймером, к третьему каркасному региону человеческих генов VH для получения репертуара вариабельных доменов VH с дефицитом CDR2. Marks с соавт. далее описывают, как этот набор можно комбинировать с CDR2 конкретного антитела. С применением аналогичных способов, выведенная последовательность CDR2 по настоящему изобретению может быть перетасована с наборами VH или VL доменов с дефицитом CDR2, и перетасованные полные VH или VL домены комбинированы с родственными VH или VL доменами для получения членов связывания по изобретению. Репертуар далее может быть продемонстрирован в подходящей системе хозяина, такой как система показа фага WO 92/01047, которая включена в данное описание путем ссылки в полном объеме, или любое количество источников литературы, включая Кау, Winter & McCafferty [94], таким образом, что могут быть выбраны подходящие члены связывания. Репертуар может включать от отсутствия до больше чем 104 индивидуальных элементов, например, как минимум, 105, как минимум, 106, как минимум, 107, как минимум, 108, как минимум, 109 или как минимум, 1010 элементов или больше. Другие соответствующие системы хозяина включают, не ограничиваясь ими, показ дрожжей, показ бактерий, показ Т7, показ вирусов, показ клеток, показ рибосом или ковалентный показ.

Предлагается способ получения члена связывания для антигена IL-1R1, который включает:

(а) обеспечение начального репертуара нуклеиновых кислот, кодирующих VH домен, который включает CDR2 для замещения или имеет дефицит кодирующего CDR2 участка;

(б) сочетание указанного репертуара нуклеиновых кислот, кодирующих аминокислотную последовательность, в значительной мере как показано в данном описании для VH CDR2, таким образом, что указанный донор нуклеиновой кислоты внедряется в участок CDR2 в репертуаре для обеспечения репертуаром нуклеиновых кислот продукта, кодирующих VH домен;

(в) экспрессию нуклеиновых кислот указанного продукта репертуара;

(г) выбор члена связывания для IL-1R1; и

(д) выделение указанного члена связывания или кодирующей его нуклеиновой кислоты.

Снова, аналогичный способ может быть применен, в котором VH или VL CDR3 по изобретению комбинируется с репертуаром нуклеиновых кислот, кодирующих VH или VL домен, который включает CDR3 для замещения или имеет дефицит кодирующего CDR2 участка;

Подобным образом, один или более, или все три CDR могут быть трансплантированы в состав VH или VL доменов, которые далее подвергают скрининг для поиска членов связывания или членов связывания с IL-1R1.

Подобным образом, можно применять другие VH и VL домены, серии CDR и серии HCDR и/или серии LCDR, раскрытые в данном описании.

Значительная часть вариабельного домена иммуноглобулина может включать как минимум три участка CDR, вместе с промежуточными каркасными участками. Часть также может включать как минимум 50% каждого или обоих из первого или четвертого каркасного регионов, где 50% представляет собой С-концевые 50% первого каркасного участка и N-концевые 50% четвертого каркасного участка. В дополнение, остатки на N- и С-конце значительной части вариабельного домена могут быть такими, которые в норме не ассоциируются с естественно возникающими участками вариабельных доменов. Например, структура члена связывания по настоящему изобретению создана с помощью способов рекомбинантной ДНК, может приводить к введению N- и С-концевых остатков, кодированных линкерами, введенными для облегчения клонирования или других стадий манипуляции. Другие стадии манипуляции включают внедрение линкеров для присоединения вариабельных доменов по изобретению к другим белковым последовательностям, включающим константные регионы антитела, другие вариабельные домены (например, при продуцировании диател) или обнаружимые/функциональные метки, как обсуждается более подробно в данном описании.

Хотя в некоторых аспектах изобретения члены связывания включают пары VH и VL доменов, единичные домены связывания, основанные на последовательностях VH или VL домена, формируют другие аспекты изобретения. Известно, что единичные домены иммуноглобулина, особенно VH домены, способны к связыванию с целевыми антигенами особенным способом. Например, см. обсуждение dAb.

В случае любого из единичных связывающих доменов, эти домены могут быть применены для скрининга с целью поиска комплементарных доменов, способных формировать двухдоменный член связывания, способный к связыванию с IL-1R1. Это может быть достигнуто посредством способов селекционного показа фага с применение так называемого иерархического спаренного комбинаторного подхода, как раскрыто в WO 92/01047, включенной в данное описание путем ссылки в полном объеме, где индивидуальная колония, содержащая клон Н или L цепи используется для инфицирования полной библиотеки клонов, кодирующих другую цепь (L или Н), и результирующий двухцепочечный член связывания селекционируют в соответствии с способами показа фага, такими как описанные в ссылке. Этот способ также раскрыт в Marks et al, ibid.

В данном описании 20 стандартных «аминокислот» и их сокращения соответствуют стандартному употреблению. См. Immunology - A Synthesis (2nd Edition, E.S.Golub and D.R.Gren, Eds., Sinauer Associates, Sunderland, Mass. (1991)), которая включена в данное описание путем ссылки. Стереоизомеры (например, D-аминокислоты) 20 стандартных аминокислот, неприродные аминокислоты, такие как α-, α-дизамещенные аминокислоты, N-алкиламинокислоты, молочная кислота и Другие нестандартные аминокислоты также могут быть подходящими компонентами для полипептидов по настоящему изобретению.

Например, нестандартные аминокислоты включают: 4-гидроксипролин, γ-карбоксиглутамин, ε-N,N,N-триметиллизин, ε-N-ацетиллизин, O-фосфосерин, N-ацетилсерин, N-формилметионин, 3-метилгистидин, 5-гидроксилизин, σ-N-метиларгинин, и другие подобные аминокислоты и иминокислоты (например, 4-гидроксипролин).

В системе обозначений полипептидов, которая применялась в данном описании, левостороннее направление является аминоконцевым направлением, и правосторонее направление - карбоксиконцевым направлением, в соответствии со стандартным применением и договоренностью.

В данном описании термин «аллотип» употребляют в отношении антигенных детерминант, установленных аллельными формами генов антитела. Аллотипы представляют незначительные отличия в последовательности аминокислот тяжелых и легких цепей различных индивидуумов и различия последовательностей между аллелями подкласса, посредством чего антисыворотка распознает только аллельные различия. Наиболее важные типы - Gm (тяжелая цепь) и Km (легкая цепь). Полиморфизм Gm определяется генами IGHG1, IGHG2 и IGHG3, которые содержат аллели, кодирующие аллотипичные антигенные детерминанты, и называются G1m, G2m, и G3m аллотипами для маркировки человеческих молекул IgG1, lgG2 и lgG3. На сегодняшний день известно 18 аллотипов Gm: Glm (1, 2, 3, 17) или Glm (a, x, f, z), G2m (23) или G2m (n), G3m (5, 6, 10, 11, 13, 14. 15, 16, 21, 24, 26, 27, 28) или G3m (b1, c3, b5, b0, b3, b4, s, t, g1, c5, u, v, g5) (Lefranc, et al., The human IgG subclasses: molecular analysis of structure, function and regulation. Pergamon, Oxford, pp.43-78 (1990); Lefranc, G. et al., 1979, Hum. Genet.: 50, 199-21 1, каждая из которых включена в данное описание путем ссылки в полном объеме).

Аллельные формы человеческого иммуноглобулина хорошо описаны (WHO Review of the notation for the allotypic and related markers of human immunoglobulins. J lmmunogen 1976, 3:357-362; WHO Review of the notation for the allotypic and related markers of human immunoglobulins. 1976, Eur. J. Immunol. 6, 599-601; E. van Loghem, 1986, Allotypic markers, Monogr Allergy 19:40-51, все включены в данное описание путем ссылки в полном объеме). Дополнительно, описаны другие полиморфизмы (Kim et al., 2001, J. MoI. Evol. 54:1-9, включена в данное описании путем ссылки в полном объеме).

В данном описании термин «антитело» обозначает олигоклональное, поликлональное антитело, моноклональное антитело, гибридное антитело, CDR-привитое антитело, полиспецифичное антитело, биспецифичное антитело, каталитическое антитело, гуманизированное антитело, полностью человеческое антитело или атиидиотипическое антитело и антитела, в которые может быть введена метка в растворимой или связанной форме, как и фрагменты, варианты или их производные, отдельно или в комбинации с другими аминокислотными последовательностями, предусмотренными известными методиками. Антитело может быть любого вида. Термин «антитело» также включает связывающие фрагменты антител по изобретению; примеры фрагментов включают Fv, Fab, Fab′, Fab′-SH, одноцепочечное антитело (svFC), димерный вариабельный участок (диатело), триатело, тетратело, миниантитело и стабилизированный дисульфидными связями вариабельный участок (dsFv).

Антитело типично имеет тетрамерную форму, содержащую две идентичные пары полипептидных цепей, каждая пара включает одну «легкую» и одну «тяжелую» цепь. Вариабельные участки каждой пары легкой/тяжелой цепи образуют сайта связывания антитела. Антитело обозначает антитело, природное или частично или полностью синтетическое. Следует понимать, что изобретение не относится к антителам в природной форме, другими словами, они не находятся в природном окружении, а выделены или очищены из природных источников, или даже получены генетической рекомбинацией или химическим синтезом, включая модификацию неприродными аминокислотами.

Другое антитело, которое не является «биспецифичным» или «бифункциональным» антитело, понимают, как такое, где все связывающие сайты идентичны. Антитело в существенной мере ингибирует связывание лиганда с рецептором, когда избыток антитела уменьшает количество связанных с рецепторами лигандов как минимум 20%, 40%, 60% или 80%, или обычно даже более чем на 85% (по данным измерения in vitro в анализе конкурирующего связывания).

В данном описании термин «антитело-связывающий сайт» обозначает часть молекулы, которая связывается и комплементарна ко всему антигену или целевой части антигена. В молекуле антитела обозначают антигенсвязывающий сайт, и он включает в себя часть антитела, которая связывается и комплементарна ко всему антигену или целевой части антигена. В случае антигена большого размера, член связывания может связываться только со специфической частью антигена, которая обозначается как эпитоп. Антиген-связывающий сайт антитела может обеспечиваться одним или больше вариабельных участков антитела. Антиген-связывающий сайт антитела в основном сформирован вариабельными тяжельми (VH) и вариабельными легкими (VL) участками иммуноглобулина, со сформированной антигенсвязывающей поверхностью из 6 внешних петель полипептида, которая называется определяющим коплементарность участком (CDR). Существует 3 CDR в каждом VH (HCDR1, HCDR2, HCDR3) и в каждом VL (LCDR1, LCDR2, LCDR3), вместе с каркасным участком (FR).

В данном описании термин «член связывания» обозначает полипептид или группу полипептидов, которые содержат, как минимум, один сайт связывания с антигеном, сформированный свертыванием или полипептидными цепями, обладающими трехмерными пространствами связывания, с формой и распределением заряда внутренней поверхности, комплементарными к свойствам антигенной детерминанты антигена. В одном из вариантов, член связывания является специфичным только в отношении одного целевого сайта. В других вариантах, член связывания является специфичным в отношении более чем одного целевого сайта. В первом варианте член связывания представляет собой антитело, например, моноклональное антитело.

В данном описании термин «химерное антитело» обозначает молекулы, включающие антигенсвязывающий сайт антитела, или эквивалент, слитый с другим полипептидом (например, производным от других видов или принадлежащим к другому классу или подклассу антитела). Клонирование или экспрессия химерных антител описаны в ЕР-А-0120694 и ЕР-А-0125023, и большом количестве других литературных ссылок.

В данном описании термин «конкурировать» указывает, что член связывания конкурирует за связывание с IL-1R1 с любым другим из антителом от 1 до 10, и наоборот, например конкуренция является двунаправленной.

В данном описании термин «определяющий комплементарность участок» (CDR) предназначен для обозначения гипервариабельных участков тяжелых и легких цепей иммуноглобулина, как определено в Kabat с соавт. 1991 [95], и более поздние редакции. Антитело типично содержит 3 CDR тяжелой цепи и 3 CDR легкой цепи. Термин CDR применяется в данном описании для того, чтобы определить, в зависимости от обстоятельства, один или несколько из этих участков, или даже эти области в целом, которые содержат большинство аминокислотных остатков, ответственных за связывание и сродство антитела к антигену или эпитопу, который антитело распознает.

Среди шести коротких последовательностей CDR, третий CDR тяжелой цепи (HCDR3) обладает большей вариабельностью (большее разнообразие по существу из-за механизмов расположения генов, которые его кодируют). Он может быть длиной всего 2 аминокислоты, хотя наиболее длинный из известным сайтов содержит 26 остатков. Длинна CDR может также варьироваться в соответствии с, длиной которая может быть помещена в конкретную исходную структуру. Функционально, HCDR3 частично играет роль в определении специфичности антитела [см. ссылки 96, 97, 98, 99, 100, 101, 102, 103].

В данном описании термин «эпитоп» включает любой детерминант белка, способный к специфическому связыванию с членом связывания, например, иммуноглобулином или рецепторами Т-клеток. Детерминанты эпитопов обычно содержат химически активные поверхностные группирования молекул, таких как аминокислоты или сахарные боковые цепи, или не всегда могут обладать специфическими свойствами трехмерной структуры, такими как специфические характеристики заряда. Упоминалось, что антитело специфические связывается с антигеном, если константа диссоциации составляет ≤1 мкМ, предпочтительно ≤100 нМ, более предпочтительно ≤10 нМ.

В данном описании термин «каркас» обозначает любую комбинацию атомов, например, аминокислот, которые могут нести один или более CDR в конфигурации, которая связывается с IL-1R1.

В данном описании термин «Fv» обозначает минимальный фрагмент антитела, который сохраняет антигенраспознающий и антигенсвязывающий сайты.

В данном описании термин «Fab» обозначает фрагмент антитела, который содержит константный домен легкой цепи и СН1 домен тяжелой цепи.

В данном описании термин «huIL» обозначает человеческий интерлейкин.

В данном описании, термин «IL-1R1» обозначает рецептор 1 интерлейкина 1. Аминокислотная последовательность IL-1R1 публично доступна (RefSeq NM_00877). В некоторых вариантах IL-1R1 может быть человеческим IL-1R1 или IL-1R1 яванского макака. Как описано в данном описании, IL-1R1 может быть рекомбинантным, и/или может быть гликозилированным или негликолизированным.

В данном описании термин «Geomean» (также известный как геометрическое среднее), обозначает среднее логарифмическое значение множества данных, обратно конвертированных к основным 10 числам. Необходимо, чтобы присутствовал результат по меньшей мере 2 измерений, например, как минимум 2, предпочтительно, как минимум, 5, более предпочтительно, как минимум 10

Специалист будет принимать во внимание, что чем больше количество повторений, тем более стабильным будет значение геометрического среднего. Выбор повторяемого числа может быть оставлен на усмотрение специалиста.

В данном описании термин «выделенный (изолированный)» обозначает состояние, в котором члены связывания по изобретению или нуклеиновые кислоты, кодирующие такие члены связывания, будут в основном соответствовать настоящему изобретению. Таким образом, члены связывания, VH и/или VL домены, кодирующие молекулы нуклеиновых кислот и векторы в соответствии с настоящим изобретением могут быть представлены в выделенной (изолированной) и/или очищенной форме, например, из их природного окружения, в значительной мере чистой или гомогенной форме, или, в случае нуклеиновых кислот, как свободные или в значительной мере не содержащими нуклеиновых кислот или генов другого происхождения, чем последовательность, кодирующая полипептид с необходимой функцией.

Выделенные члены и выделенные нуклеиновые кислоты могут быть свободными или в существенной мере не содержащими материала, с которым они естественно ассоциированы, такого как другие полипептиды или нуклеиновые кислоты, с которыми они находятся в природной среде, или среде, в который они были получены (например, клеточная культура), поскольку такое получение с помощью технологии рекомбинантных ДНК осуществляется in vitro или in vivo.

Элементы или нуклеиновые кислоты могут сочетаться с растворителями или стимуляторами и, тем не менее, для практических целей будут выделены, например члены обычно будут смешаны с желатином или другими носителями, если они применяются, для покрытия микротитрационных планшетов при применении в иммуноанализе, или будут смешаны с фармацевтически приемлемыми носителями или растворителями при применении в диагностике или терапии.

Члены связывания могут быть гликозилированы естественным образом или с помощью систем гетерологических эукариотных клеток (например, клеток СНО или NS0 (ЕСАСС 85110503), или они могут быть (например, если продуцированы экспрессией в прокариотных клетках) не гликозилированными.

Гетерогенные препараты, содержащие молекулы анти-IL-1R1 антитела, также формируют часть изобретения. Например, такие препараты могут быть смесью антител с тяжелыми цепями полной длины и тяжелыми цепями с недостатком С-концевого лизина, с различной степенью гликозилирования и/или с дериватизированными аминокислотами, такими как циклизированная N-концевая глютаминовая кислота для формирования остатков пироглютаминовой кислоты.

В данном описании термин «моноклональное антитело» обозначает антитело из в существенной мере гомогенной совокупности антител, которые специфично связываются с одними и теми же эпитопами. Термин «mAb» обозначает моноклональное антитело.

В данном описании фраза «в существенной мере (в основном, главным образом)» обозначает, что характеристики CDR VH или VL доменов членов связывания, соответственно, описанных в данном описании, будут идентичными или подобными специфичным участкам, последовательность которых представлена в данном описании. В данном описании фраза «в высокой степени подобный» по отношению к специфичному участку(ам) одного или более вариабельных доменов, предполагает, что от 1 до приблизительно 6, например от 1 до 5, в том числе, от 1 до 3, или 1 или 2, или 3 или 4 замены аминокислот может быть введено в CDR и/или VH или VL домене.

Здесь уместно отметить, что «и/или» применяют для того, чтобы обозначить конкретное раскрытие каждого из двух заданных свойств или компонентов, с или без других. Например «А и/или В» используется как конкретное раскрытие (i) A, (ii) В и (iii) А и В, так же, как если бы каждый был представлен индивидуально в данном описании.

Краткое описание таблиц и рисунков

Табл.1а представляет список аминокислотных последовательностей тяжелых и легких цепей CDR каждого из антител 1-3.

Табл.1b представляет список аминокислотных последовательностей тяжелых и легких цепей CDR каждого из антител 4-10.

Табл.2 представляет последовательности типичных членов связывания по изобретению, как представлено в приложенном перечне последовательностей, где SEQ ID номер совпадает с приведенным в табл.3.

Табл.3 представляет примеры ведущих видов активности scFv по данным анализа связывания HTRF® человеческий рецептор-лиганд IL-1β.

Табл.4 представляет примеры ведущих IgG1 потенций в анализе человеческом IL-1β индуцированного IL-8 высвобождения

Табл.5 представляет оптимизированную активность IgG1 и GL IgG2 для ингибирования IL-α- или IL-1β-индуцированного высвобождения IL-8 в клетках HeLa.

Табл.6 представляет активность семейства членов IL-1R и различных видов IL-1R в анализе человеческого оптимизированного IgG, связывающегося с IL-1R (DELFIA®).

Табл.7 представляет ингибирование с помощью оптимизированного IgG в анализе связывания рецептор-лиганд (IL1Ra) HTRF®.

Табл.8 представляет ингибирование с помощью оптимизированного IgG индуцированного IL-1β высвобождения IL-8 из клеток CYNOM-K1, экспрессирующих эндогенный IL-1R яванского макака

Табл.9 представляет значение ИК50 для ингибирования индуцированного IL-1β продукта IL-6 в цельной человеческой крови.

Табл.10 представляет результаты измерения сродства для анти-IL-1R1 FAb для растворимого человеческого IL-1R1 и растворимого IL-1R1 яванского макака.

Табл.11 представляет результаты измерения сродства для связывания антитела 6 и AMG108 с растворимым человеческим IL-1R1.

Табл.12 представляет IC50 (в нМ) химерных IL-1R1 молекул, конкурирующих за связывание человеческого IL-1R1 с антителом.

Фиг.1. представляет последовательность IL-1R1 внеклеточного домена кДНК яванского макака [SEQ ID NO: 131]

Фиг.2. представляет последовательность IL-1R1 внеклеточного домена кДНК яванского макака [SEQ ID NO: 132]

Фиг.3 представляет нуклеотидную последовательность кДНК IL1R1Fc человека [SEQ ID NO: 133]

Фиг.4 представляет последовательность белка IL1R1Fc [SEQ ID NO: 134]

Фиг.5 представляет нуклеотидную последовательность кДНК IL1R1Fc человека [SEQ ID NO: 135]

Фиг.6 представляет последовательность белка IL1R1Fc яванского макака [SEQ ID NO:136]

Фиг.7 представляет последовательность внеклеточного IL-1R1 человека [SEQ IDNO: 137]

Фиг.8 представляет последовательность кДНК IL-1R1 человека [SEQ ID NO: 138]

Фиг.9 представляет последовательность внеклеточного IL-1R1 Cyno (остатки от 1 до 337) [SEQ ID NO: 139]

Фиг.10 представляет последовательность внеклеточного IL-1R1 Cyno [SEQ ID NO: 140]

Фиг.11 представляет последовательность зрелого человеческого HIS-FLAG IL-1rα [SEQ ID NO: 141]

Фиг.12 представляет последовательность зрелого человеческого HIS-FLAG IL-1rβ [SEQ IDNO: 142]

Фиг.13 представляет ингибирование индуцированной IL-1β выработки IL-6 в цельной человеческой крови для антитела 6 IgG2 (Пример 2, 7). Ось Х представляет концентрацию антитела 6 (Log молярный) и ось Y - процент ингибирования выработки IL6.

Фиг.14 представляет праймер SDCAT-CG, который преобразует Glu в Gln конструкции показа рибосомы и выборке семейства Vh3_DP-47_(3-23).

Примеры

Библиотеки показа фага наивного человеческого одноцепочечного Fv (scFv), клонированного в фагемидный вектор, взятого из нитчатого фага М13, применяли для селекции [104, 105]).

Анти-IL-1R1 специфические scFv антитела выделяли из библиотек показа фага с применением серии селективных циклов на рекомбинантном человеческом IL-1R1.

Селекционированные scFv антитела оптимизировали на предмет связывания с человеческим IL-1R1 и/или активности, и переформатировали как IgG антитела.

Последовательности

Последовательности типичных членов связывания по изобретению представлены в приложенном перечне последовательностей, где SEQ ID NO совпадает с приведенной в табл.2 ниже в данном описании:

i) где номер антитела следует за GL, например, 11GL обозначает антитело, где один или более остатков мутировали обратно к конфигурации генеративной линии, в основном, где в GL применяли все не принадлежащие к генеративной линии остатки, которые могут быть мутированы обратно к генеративной линии без ощутимой потери активности, с получением генеративной линии. Следует отметить, что в описании, где любое или все антитела от 1 до 10 ссылаются на это, также включены любые генеративные варианты, перечисленные в табл.2.

CDR представлены в табл.1а и 1b.

Табл.2
Антитело SEQ ID No. Описание
1 91 VH/ДНК
1 92 VH/аминокислота
1 93 HCDR1
1 94 HCDR2
1 95 HCDR3
1 96 VL/ДНК
1 97 VL/аминокисл
1 98 LCDR1
1 99 LCDR2
1 100 LCDR3
2 1 VH/ДНК
2 2 VH/аминокислота
2 3 HCDR1
2 4 HCDR2
2 5 HCDR3
2 6 VL/ДНК
2 7 VL/аминокислота
2 8 LCDR1
2 9 LCDR2
2 10 LCDR3
3 121 VH/ДНК
3 122 VH/аминокислота
3 123 HCDR1
3 124 HCDR2
3 125 HCDR3
3 126 VL/ДНК
3 127 VL/аминокислота
Антитело SEQIDNo. Описание
3 128 LCDR1
3 129 LCDR2
3 130 LCDR3
4 101 VH/ДНК
4 102 VH/аминокислота
4 103 HCDR1
4 104 HCDR2
4 105 HCDR3
4 106 VL/ДНК
4 107 VL/аминокислота
4 108 LCDR1
4 109 LCDR2
4 110 LCDR3
5 11 VH/ДНК
5 12 VH/аминокислота
5 13 HCDR1
5 14 HCDR2
5 15 HCDR3
5 16 VL/ДНК
5 17 VL/аминокислота
5 18 LCDR1
5 19 LCDR2
5 20 LCDR3
6 61 VH/ДНК
6 62 VH/аминокислота
6 63 HCDR1
6 64 HCDR2
6 65 HCDR3
6 66 VL/ДНК
6 67 VL/аминокислота
Антитело SEQ ID No. Описание
6 68 LCDR1
6 69 LCDR2
6 70 LCDR3
6GL 21 VH/ДНК
6GL 22 VH/аминокислота
6GL 23 HCDR1
6GL 24 HCDR2
6GL 25 HCDR3
6GL 26 VL/ДНК
6GL 27 VL/аминокислота
6GL 28 LCDR1
6GL 29 LCDR2
6GL 30 LCDR3
7 31 VH/ДНК
7 32 VH/аминокислота
7 33 HCDR1
7 34 HCDR2
7 35 HCDR3
7 36 VL/ДНК
7 37 VL/аминокислота
7 38 LCDR1
7 39 LCDR2
7 40 LCDR3
8 71 VH/ДНК
8 72 VH/аминокислота
8 73 HCDR1
8 74 HCDR2
S 75 HCDR3
8 76 VL/ДНК
8 77 VL/аминокислота
Антитело SEQ ID No. Описание
8 78 LCDR1
8 79 LCDR2
8 80 LCDR3
8GL 41 VH/ДНК
8GL 42 VH/аминокислота
8GL 43 HCDR1
8GL 44 HCDR2
8GL 45 HCDR3
8GL 46 VL/ДНК
8GL 47 VL/аминокислота
8GL 48 LCDR1
8GL 49 LCDR2
8GL 50 LCDR3
9 111 VH/ДНК
9 112 VH/аминокислота
9 113 HCDR1
9 114 HCDR2
9 115 HCDR3
9 116 VL/ДНК
9 117 VL/аминокислота
9 118 LCDR1
9 119 LCDR2
9 120 LCDR3E
9GL 51 VH/ДНК
9GL 52 VH/аминокислота
9GL 53 HCDR1
9GL 54 HCDR2
9GL 55 HCDR3
9GL 56 VL/ДНК
9GL 57 VL/аминокислота
Антитело SEQ ID No. Описание
9GL 58 LCDR1
9GL 59 LCDR2
9GL 60 LCDR3
10GL 81 VH/ДНК
10GL 82 VH/аминокислота
10GL 83 HCDR1
10GL 84 HCDR2
10GL 85 HCDR3
10GL 86 VL/ДНК
10GL 87 VL/аминокислота
10GL 88 LCDR1
10GL 89 LCDR2
10GL 90 LCDR3

Изобретение будет проиллюстрировано с помощью следующих неограничивающих примеров:

Пример 1: Выделение ведущих антител

1.1 Селекция

Библиотеки одноцепочечных Fv (scFv) большого размера из человеческого антитела, клонированные в фагемидный вектор, основанный на нитеобразном фаге М13, использовали для селекции (106,107109). Анти-IL-1R специфичные антитела scFv выделяли из библиотек показа фага с использованием серий селективных циклов на биотинилированном рекомбинантном человеческом IL-1R-Fc, преимущественно, как описано ранее (108) Кратко, частицы scFv-фага инкубировали с 100 нМ рекомбинантного биотилированного человеческого гибридного белка IL-1R-Fc в растворе (huIL-1R1-Fc гибридный белок, как описано во внутреннем документе «Материалы, методы и биотинилирование»). Связывание ScFv-фага с антигеном было далее зарегистрировано на покрытых стрептавидином парамагнитных гранулах (Dynabeads® M-280), следуя рекомендациями производителя. Выбранные частицы ScFv-фага высвобождали, как описано ранее (109) и процесс селекции повторяли во втором цикле.

Репрезентативное количество индивидуальных клонов из второго цикла селекции выращивали на 96-луночных планшетах. ScFv экспрессировали в бактериальной периплазме и проводили скрининг на ингибиторную активности в анализе связывание человеческом рецептора-лиганда (IL-1β) HTRF, описанном в документе «Материалы и методы». ScFv, которые показали очевидный ингибиторный эффект в данном анализе, так же, как неочищенные периплазматические экстракты, подвергали ДНК секвенированию (106, 109). Уникальные scFv экспрессировали снова в бактерию, очищали аффинной хроматографией (110), и значения ИК50 определяли тестированием серийных разведении очищенных scFv в одном и том же анализе связывания лиганд-рецептор.

1.2 Ингибирование scFv в анализе связывания рецептор-лиганд.

Выбранные антитела подвергали скринингу с помощью анализа связывания рецептор-лиганд HTRF® (гомологичная флуоресценция с временным разрешением) в формате пробы для ингибирования HIS FLAG меченого человеческого IL1 бета (внутренняя методика, экспрессия в Е.coli; HIS FLAG IL-1 бета), связывающегося с меченым гистидином человеческим (HIS) IL1RFc гибридным белком (внутренняя методика)

Подробная методика количественного определения, метод экспрессии материала описаны в разделе «Материалы и методы».

Примеры ведущей активности scFv получили анализом связывания, и они показаны в табл.3.

Таблица 3.
Примеры ведущей активности scFv в анализе связывания HTRF® человеческого рецептора-лиганда IL1β
Название клона IC50 (нМ) в HTRF® анализе
Антитело 1
Антитело 4
Kineret
IC225 нМ
22,5 нМ
0,323 нМ
IC=Неполная кривая ингибирования; IС50 предполагаемые значения

Данные единичного эксперимента, которые показательны для некоторых независимых экспериментов.

1.3 Изменение формы scFv до IgG1

Клоны, которые идентифицировали как ингибиторные в анализе связывания рецептор-лиганд HTRF, конвертировали из формата scFv в формат IgG1 субклонированием VH и VL доменов в векторы экспресии полноразмерного антитела с тяжелыми и легкими цепями, соответственно. VH домен клонировали в вектор (pEU15,1), содержащий константные участки человеческой тяжелой цепи и регуляторные элементы для экспрессии полноразмерной тяжелой цепи IgG в клетках млекопитающих. Также, VL домен клонировали в вектор (pEU4.4) для константных участков экспрессии человеческой легкой цепи (лямбда) участков и регуляторных элементов для экспрессии целой легкой цепи IgG в клетках млекопитающих. Векторы экспрессии тяжелых и легких цепей, основанных на таких же, первоначально описанных в ссылке (111). Наши векторы сконструированы подобным образом введением элемента OriP. Для получения IgG, тяжелую и легкую цепь IgG экспрессирующих векторов трансфицировали в EBNA-HEK293 клетках млекопитающих. IgG экспрессировали и секретировали в среду. Сбор клеток объединили и профильтровали перед очисткой, потом IgG очистили с использованием хроматографии с применением протеина А. Супернатанты культур переносили в колонку подходящего размера в Ceramic Protein A (BioSepra) и промывали 50 мл Трис-НСl рН 8,0, 250 мМ NaCl. Связанный IgG элюировали из колонки с использованием 0,1 М цитрата натрия (рН 3,0) и нейтрализовали добавлением Трис-НСl (рН 9,0). Элюированный материал заместили буфером в ФБР с использованием колонки Nap 10 (Amersham, #17-0854-02), и концентрацию IgG определяли спектрофотометрически, с использованием коэффициента затухания, зависящего от аминокислотной последовательности IgG (112). Очищенный IgG анализировали на предмет агрегации и деградации, используя эксклюзионную ВЭЖХ и SDS-PAGE.

1.4 Сведение к генеративной линии родителей KENB026 и KENB061

Аминокислотная последовательность VH и VL участков родительских антител Антитела 1 и Антитела 4, которые продемонстрировали ингибирование в биологических анализах, была выравняна с известной человеческой последовательностью генеративной линии в базе данных VBASE (113), и ближайшую генеративную линию идентифицировали по сходству последовательностей. Не учитывая остатков Верньера (114), которые остались неизменными, изменения в каркасных структурах VH и VL участков возвращали к ближайшей последовательности генеративной линии для идентификации соответствующих человеческих антител с использованием стандартного сайт-направленного мутагенеза технологии с подходящими праймерами мутагенеза. Эти мутагенные процедуры совершали в векторах IgGI для родителей.

1.5 Сведение к генеративной линии ведущих антител как IgG2

Родительское Антитело 4 (в формате IgG1) использовали как образец для мутагенеза с целью сведения к генеративной линии ведущих антител. Индивидуальные последовательности CDR3 VH и VL ведущих вводили в генеративную линию родителей в векторе IgG1 для продуцирования примеров генеративной линии с использованием стандартного сайт-направленного мутагенеза с подходящими праймерами мутагенеза.

Конверсию IgG1 к IgG2 проводили с использованием стандартной процедуры клонирования. Примеры плазмид IgG1 VH выделяли и удаляли генеративную линию VH для клонирования в вектор VH IgG2.

Информация генеративной линии

Антитело 1: VH Vh3_DP-47_(3-23), V1 Vlambdal_DPL3_(lg).
Позиция Антитело Аминокислота Генеративная линия Аминокислота Изменена?
Антитело 1 Vh94 Arg Lis Нет
Антитело 2 Vh108 Thr Leu Нет
Антитело 3 Vl2 Ala Ser Нет
Vl 8 Ser Pro Нет
Vl 39 Phe Leu Нет
Vl 45 Gly Lys Нет
Vl48 Val Ileu Нет
Vl49 Lis Tyr Нет
Антитело 4: VH Vh3_DP-47_(3-23), VI Vlambdal_DPL8_(le).
Позиция Антитело Аминокислота Генеративная линия Аминокислота Изменена?
Антитело 4 Vh 108 Met Leu Нет
Антитело 5 Vl74 Val Ala Нет
Антитело 6 Vl76 Ala thr Нет
Антитело 7
Антитело 8
Антитело 9
Антитело 7 Антитело 8 Позиция Верньера 1 Gln Glu Y Да1
Антитело 9
Антитело 6 VH CDR3 17 аминокислот 18 аминокислот Нет2
Антитело 9 Vhl03 Gly Trp Нет
1 Из-за изменения основ с GAA (Glu) на САА (Gln), во время использования праймера SDCATCG (см. праймер и Vh3_DP-47_(3-23) выравнивание каркасной последовательности для библиотеки конструкций и выборки показа рибосомы - фиг.14). Этот остаток (также Верньера) возвратили к глутаминовой кислоте (Glu) в ходе процесса сведения к генеративной линии, поскольку он был введен искусственно. Антитело 6 было также усилено использованием SDCATCG, но положение 1 откорректировали до Glu в ходе процесса конверсии IgG1.
2 Эта делеция, вероятно, произошла в ходе конверсии показа рибосомы и селекционного процесса. Показ рибосомы - это процесс, основанный на ПЦР, где применяется полимераза пониженной точности.

1.6 Ингибирование IL-1-индуцированной секреции IL-8 из клеток HeLa

Чтобы определить биологическую активность ингибиторов IL-1R, группу ингибирующих scFv по данным анализа связывания рецептор-лиганд конвертировали в IgG, и их активность определяли в анализе на человеческих клетках HeLa с измерением дозозависимого ингибирования IL-1β- и IL-1α-индуцированной секреции IL-8. Более подробно методику определения количественного состава см. в разделе «Материалы и методы».

В данном анализе, ингиб игорную активность группы анти-IL-1R IgG определяли в реакции с концентрацией ЕС50 человеческих IL-1β или IL-1α (определена, как концентрация IL-1, которая обеспечивает половину максимальной реакции в анализе; в данном случае приблизительно 2 пМ). Антитела, проявляющие очевидное ингибирование IL-1-индуцированной реакции, выбрали ранее в ведущей группе выделения, и образцы показаны в табл.4. Варианты IgG1 Антитела 1 и Антитела 4, сведенные к генеративной линии, также показали активность в анализе.

Таблица 4:
Примеры активности ведущих IgG1 в анализе IL-1β-индуцированной секреции человеческого IL-8
Название клона IC50 (нМ)
(N=2-5)
Антитело 1 95,9
Антитело 4 22,0
AMG 108 0,009
Kineret 0,01

Значения IС50 представляют геометрические средние значения от 2 до 5 независимых экспериментов.

Пример 2: Оптимизация антитела

2.1 Созревание аффинности

Антитело 4 и антитело 1 оптимизировали с использованием фага с аффинной основой и селекции показа рибосомы. Большие библиотеки scFv-фагов, выведенные из ведущих клонов, был созданы с помощью управляемого олигонуклеотидом мутагенеза комплементарности вариабельных участков CDR3 тяжелой (VH) и легкой (VL) цепи с использование стандартных методик молекулярной биологии, как описано в (115). Библиотеки подвергали основанному на сродстве отбору показа фага для того, чтобы выбрать варианты с высоким сродством к человеческому IL-1R-Fc. В результате ожидали улучшения ингибиторной активности в отношении человеческого IL-1β при связывании с IL-1R1. Селекцию проводили преимущественно, как было описано ранее (108). В аннотации, scFv-фаговые частицы инкубировали с рекомбинантным биотинилированным человеческим IL-1R-Fc в растворе. Связывание ScFv-фага с антигеном было далее зарегистрировано на покрытых стрептавидином парамагнитных гранулах (Dynabeads® M-280) в соответствии с рекомендациями производителя. Отобранные частички ScFv-фага были далее высвобождены, как описано ранее (109), и процесс селекции повторили в присутствии убывающей концентрации биотилированного человеческого IL-1R-1 (от 50 нМ до 0,05 нМ более 3 циклов).

Готовили необработанные scFv-содержащие периплазматические экстракты репрезентативного количества индивидуальных клонов выбранных вариабельных тяжелых (VH) и вариабельных легких (VL) и проводили скрининг с помощью анализа связывания в формате рецептор-лиганд HTRF® (Homogeneous Time-Resolved Fluorescence) на предмет ингибирования HIS FLAG меченого человеческого IL1 бета (внутренняя методика, экспрессия в Е.coli; HIS FLAG IL-1 бета) связывался с меченым гистидином человеческим (HIS) IL1RFc гибридным белком (внутренняя методика). Лучшие варианты, например, варианты scFv, которые показали значительно улучшенный ингибирующий эффект во время сравнения с соответствующим родительским антителом, подвергали секвенированию ДНК, и уникальные варианты из библиотечных выходов вариабельного тяжелого и вариабельного легкого продуцировали, как очищенные scFv для дальнейшей характеристики. Некоторые scFv далее отбирали, трансформировали до IgG1 и тестировали снова в попытке получить дополнительный прирост активности.

Вариабельный тяжелый (VH) и вариабельный легкий (VL) селективные выходы, включающие большое количество вариантов scFv со способностью к ингибированию связывания человеческого IL-1β с человеческим IL-1RI рекомбинировали для формирования единичной библиотеки в формате показа фага, в котором клоны содержали беспорядочно спаренные отдельные рандомизированные VH и VL последовательности. Селекцию фагов продолжали, как описано ранее, в присутствии убывающей концентрации биотилированного человеческого IL-1R-Fc (от 0,1 нМ до более 5 пМ в дальнейших 3 циклах). В качестве альтернативы, метод показа рибосомы дисплея применяли к рекомбинантным выборочным выходам. Для показа рибосомы, вариабельный тяжелый (VH) и вариабельный легкий (VL) селективные выходы, включающие большое количество вариантов scFv со способностью к ингибированию связывания человеческого IL-1β с человеческим IL-1RI рекомбинировали для формирования единичной библиотеки с помощью полимеразной цепной реакции (ПЦР) и адаптировали к формату показа рибосомы, преимущественно, как описано в ссылке (116). Выборки основанного на сродстве показа рибосомы осуществляли на рекомбинантных библиотеках, и процесс селекции повторяли в присутствии убывающей концентрации биотилированного человеческого IL-1RI (от 1 нМ до более чем 3 пМ в 3 циклах). Выходы показа рибосомы клонировали далее в вектор показа фага для дальнейшей характеристики, преимущественно, как описано в ссылке (117).

Готовили необработанные scFv-содержащие периплазматические экстракты характерного количества индивидуальных клонов из выходов показа фага и показа рибосомы и проводили скрининг на предмет способности ингибировать связывание человеческого био-человеческого II-1β с человеческим рецептором I1-1RI.

Лучшие варианты, например варианты scFv, которые показали значительно улучшенный ингибирующий эффект во время сравнения с соответствующим родительский антителом и ведущей генеративной пререкомбинацией, подвергали секвенированию ДНК, и уникальные рекомбинантные варианты продуцировали как очищенные scFv для дальнейшей характеристики.

Наиболее активные scFv в данном анализе трансформировали до не принадлежащего к генеративной линии IgG1 и/или генеративного IgG2, как описано в Примере 1,3 и 1,5, и тестировали на предмет специфичности в конкурентном формате ELISA, в анализах рецептор-лиганд IL-1Ra HTRF и HeLa IL-1-бета и -альфа индуцированной секреции IL-8. Антитела также тестировали на перекрестную реактивность с IL-1RI яванского макака.

2,3 Ингибирование с помощью оптимизированных IgG IL-1β- and IL-1α-индуцированного высвобождения IL-8 из клеток HeLa

Улучшение биологической активности клонов после оптимизации и переформатирования ведущих IgG оценивали в анализе HeLa высвобождения IL-8 с использование huIL-1-beta и huIL-1 альфа (R&D Systems) при EC80 концентрациях (5 пМ для обоих), как описано в разделе «Материалы и методы». Результаты представлены в табл.5.

Таблица 5
Активность оптимизированных IgG1 и GL IgG2 для ингибирования IL-α- или IL-1β-индуцированного высвобождения IL-8 в клетках HeLa
Название клона IC50 (ПМ)
IgGI GLIgG2
IL-1 бета(N=6-7) IL-1 бета (N=5-6) IL-1 альфа (N=3)
Антитело 2 77,5 - -
Антитело 3 49,4 - -
Антитело 5 32,0 - -
Антитело 6 7,8 - -
Антитело 6GL - 11,9 3,1
Антитело 7 42,6 - -
Антитело 8 29,3 - -
Антитело 8GL - 41,9 197,2
Антитело 9 11,5 - -
Антитело 9GL - 6,9 16,2
Антитело 10GL - 24,2 13,8
AMG 108 5,3 5,9 11,7
Kineret 6,2 2,0 1,7

Значения IC50 представляют средние геометрические значения для указанного количества экспериментов.

Субпопуляции клонов с повышенной активностью, в сравнении с родительской позже анализировали в дополнительных анализах, включающих анализ IL-1R яванского макака с использованием CYNOM-K1 клеток, (описано в разделах ниже и анализы описаны в «Материалах и методах»). Оптимизированные антитела сравнивали с IL-1Ra (Kineret®; Amgen, коммерчески доступен в аптеках) и AMG 108 последовательностью из US 2004/071702, опубликованной 15 апреля 2004 г.).

2.4 Селективная и видовая перекрестная реактивность оптимизированных антител в конкурентных анализах эпитопа DELFIA®

Селективная и видовая перекрестная реактивность ведущих антител с IL-1R семейством элементов адаптирована с использованием конкурентных анализов эпитопа DELFIA®.

В анализах измеряли ингибирование биотилированного человеческого HIS-IL1RFc (экспрессированный и биотилированный по внутренней методике) связывания каждого оптимизированного анти-IL1R антитела.

Титры небиотинилированного очищенного человеческого рекомбинатного IL1sRII (R&D Systems), человеческого рекомбинантного IL-1R6/IL1 R rp2/Fc (R&D Systems), человеческого рекомбинантного IL18R альфа /IL-1 R5/Fc (R&D systems) и человеческого рекомбинантного IL-1 R4 (ST2)/Fc (R&D systems) тестировали в каждом анализе для оценки активности для каждого структурно связанного родственного элемента с помощью значений IС50 в анализе.

Титры видов IL-1R, включающих человеческий HIS-IL1RFc (внутренний), HIS-IL1RFc яванского макака (внутренний) и IL-1RFc крысы (внутренний) тестировали в каждом анализе для оценки видовой перекрестной реактивности оптимизированных антител.

Примеры результатов суммированы в табл.6. Результаты показывают, что ведущие оптимизированные антитела были селективными в отношении человеческого IL-1R и также подобным образом связывались с IL-1R яванского макака, и не распознавали структурно родственные белки. IL-1R-Fc крысы не были распознаны никаким из оптимизированных антител.

Таблица 6:
Активность IL-1R семейства членов и различные виды IL-1R в анализе связывания человеческого IL-1R с оптимизированным IgG (DELFIA®)
Название клона IC50 (нМ) IL-1R виды / семейство элементов
человеческий his IL-1RFc Cyno his IL1RFc крысиный his IL1RFc человеческий IL1sRII человеческий IL1R6Fc IL18R альфа Fc IL1R4 (ST2) Fc
Антитело 6GL 0.199 0.405 NI NI NI NI NI
Антитело 8GL 0.241 0.454 NI NI NI NI NI
Антитело 9GL 0.145 0.261 NI NI NI NI NI
Антитело 10GL 0.096 0.186 NI NI NI NI NI
Значения IC50 представляют средние геометрические значения для указанного количества экспериментов.
NI: Не наблюдалось ингибирования huIL-1RFc

2.5 Ингибирование с помощью оптимизированного IgG в анализе связывания рецептор-лиганд (IL-1Ra)

Способность ведущих антител ингибировать связывание IL-1Ra с IL-1R1 оценивали в формате анализа связывания рецептор-лиганд HTRF® (Homogeneous Time-Resolved Fluorescence) для ингибирования связывания HIS FLAG меченого человеческого IL1Ra (внутренняя методика, экспрессия в Е.coli; HIS FLAG IL-1RA) с меченым гистидином человеческим (ГИС) IL1RFc гибридным белком (внутренняя методика), как описано в разделе «Материалы и методы».

Определяли, получен ли предпочтительный эпитоп, где антитела конкурировали за связывание IL-1Ra с IL-1R1 в дополнение к IL-1-бета и IL-1-альфа. In vivo это высвобождало бы рецептор-связанный IL-1Ra, таким образом делая возможным связывание с другим рецептором, что, как считается, является благоприятным. IL-1Ra может достичь ткани другим путем, недостаточно открытым для IgG, и он также может проникнуть через периферическую ткань из кровообращения быстрее, чем IgG. В патенте AMG108 Amgen (US 2004/0097712 A1) и Hoffmann-La Roche AG (WO 2005/023872) заявлено, что антитела из уровня техники не конкурируют прямо с IL-1Ra за связывание с IL-1R1. В патенте Anagen обсуждалось (US 2004/0097712 A1), что антитела, которые конкурировали с IL-1, но не конкурировали с IL-1Ra, показали более высокую активность в анализах, спроектированных для того чтобы показать ингибирование IL-1-опосредованных эффектом для антител, которые не конкурируют с IL-1 и IL-1ra, и таким образом, представить предпочтительный эпитоп.

Мы неожиданно обнаружили, что антитела, которые ингибируют IL-1 га, так же, как и IL-1, могут быть подобным образом сильнодействующими в анализах ингибирующей IL-1 активности, как и антитела, описанные в US 2004/0097712 A1, которые не демонстрируют ингибирования.

Пример результатов в табл.7 ниже подтверждает, что предпочтительные антитела не были способны к полной конкуренции с IL-1Ra за связывание с IL-1R1, но что наши ведущие антитела полностью ингибировали это взаимодействие, с показанными значениями IC50.

Таблица 7:
Ингибирование с помощью оптимизированного IgG в анализе связывания рецептор-лиганд (IL1Ra) HTRF
Клон IC50 (HM) Клон IC50(HM)
Антитело 2 IgG1 0,256 Антитело 6GL IgG2 0,181
Антитело 3 IgG1 0,469 Антитело 8GL IgG2 0,363
Антитело 5 IgG1 0,186 Антитело 9GL IgG2 0,208
Антитело 6 IgG1 0,100 Антитело 10GL IgG2 0,323
Антитело 7 IgG1 0,168 AMG108 IgG2 NI
Антитело 8 IgG1 0,156 DEI5-8 IgG4 NI
Антитело 9 IgG1 0,156 Kineret 0,323
Значения IC50 представляют средние геометрические значения для указанного количества экспериментов.
NI: Не наблюдалось ингибирования IL1Ra
GL: Сведение к генеративной линии

2.6 Ингибирование с помощью оптимизированного IgG huIL-1β-индуцированного IL-8 высвобождения из CYNOM-K1 клеток.

С целью оценки, были ли ведущие антитела эффективными с точки зрения ингибирования активности проведения сигнала IL-1β через эндогенно экспрессированный IL-1R1 яванского макака, измеряли способность ведущего IgG к ингибированию huIL-1β-индуцированного IL-8 высвобождения из CYNOM-K1 клеток.

Ведущие антитела несомненно и полностью ингибировали действующий IL-1β через IL-1R1 яванского макака с равной активностью к IL-1Ra, тогда как AMG108 IgG не ингибировал это взаимодействие. Показано, что коммерчески доступный ELISA для человеческого IL-8 также обнаруживал IL-8 яванского макака в клеточных супернатантах, и его использовали для определения IL-1-индуцированного эффекта на CYNOM-K1 клетках.

Таблица 8:
Ингибнрование с помощью оптимизированного IgG IL-1β индуцированного высвобождения IL-8 из CYNOM-K1 клеток, экспрессирующих эндогенный IL-1R яванского макака
Название клона IC50(нМ)(n=2)
Антитело 6GL IgG2 0,8, 0,6
Антитело 8GL IgG2 4,2, 2,5
Антитело 9GL IgG2 1,2, 1,1
Антитело 10GL IgG2 0,9, 0,7
AMG108 IgG2 NI, NI
Изотопный контроль IgG2 NI, NI
Kineret 0.2, 0.8
Значения IC50 представляют собой значения IC50 каждого из 2 независимых экспериментов
NI: не наблюдалось ингибирования IL-1-бета-индуцированного высвобождения IL-8

2.7 Ингибирование 1L-1β-индуцированной выработки IL-6 в цельной человеческой крови

Цельную кровь получали от нормальных волонтеров (6 доноров) в гепарин-натриевые контейнеры. Цельную кровь (80 мкл) аликвотами переносили в лунки 96-луночных планшетов, содержащих 10 мкл анти-IL-1RI моноклонального Ab антитела 6GL IgG2 в буфере анализа (1% альбумин телячьей сыворотки в физиологическом растворе с фосфатным буфером).

IL-1β добавили после 30 мин для достижения конечной концентрации 30 пМ (ЕС50). Супернатанты были собраны после 18 час, и уровни IL-6 в супернатанте измеряли с помощью ELISA (R&D Systems IL-6 ELISA). Анти-IL-1RI антитела блокировали активность IL-1, как показано на фиг.13. Ряд значений IC50 для ингибирования IL-1-индуцированной выработки IL-6 в цельной человеческой крови показан в табл.9. Среднее значение IC50 для 6 доноров составляло 229 пМ.

Таблица 9:
Значения IC50 для ингибирования IL-1-индуцированной выработки IL-6 в цельной человеческой крови
Донор 1 2 3 4 5 6
IC50 (пМ) 91 295 116 309 167 321

Эквивалентные данные представлены в Примере 4 для Антитела 6 с другим Fc форматом. Антитело 6 IgG1TM (Triple Mutant, 234F, 235E и 331S).

Материалы и методы анализа

Анализ связывания рецептор-лиганд (IL1 бета) HTRF®

Селективные выходы были подвергнуты скринингу в формате анализа связывания рецептор-лиганд HTRF® (Homogeneous Time-Resolved Fluorescence, Cis-Bio, Bedford, MA, USA) для ингибирования связывания меченого HIS FLAG человеческого IL1 бета (внутренний, экспрессия в Е.coli; HIS FLAG IL-1 бета) с меченым гистидином человеческим (HIS) IL1RFc гибридным белком (внутренний НЕК EBNA, экспрессированный, как описано ниже). Более детальное описание анализа HTRF® можно найти в Mathis (1995) Clinical Chemistry 41(9), 1391-1397.

Выходы в ходе выделения ведущих вариантов подвергали скринингу в виде неразбавленных, неочищенных, содержащих scFv периплазматических экстрактов, приготовленные в 200 мМ HEPES буфере, рН 7,4, 0,5 мМ ЭДТА и 0,5 М сахарозы. 5 мкл неочищенного образца scFv добавляли в лунки 384-луночного планшета для микроанализа (Costar 3676). Это происходило после добавления 2 нМ человеческого HIS IL1RFc к объему 20 мкл. Планшеты для анализа опечатывали и инкубировали при комнатной температуре в темноте на протяжении 1 час.

После предварительной инкубации планшетов для анализа добавляли 5 мкл 4 нМ HIS FLAG IL1 бета.

Далее прибавляли 5 мкл 20нМ анти-FLAG IgG, меченого XL665 (CIS Bio international 61FG2XLB), и 5 мкл 3,2 нМ античеловеческого Fc IgG, меченого криптатом (CIS Bio International 61HFCKLB). Все разведения осуществляли в физиологическом растворе с фосфатным буфером, содержащим 0,4 М калия фторида и 0,1% альбумина телячьей сыворотки (буфер анализа).

Планшеты анализа инкубировали на протяжении 3 час при комнатной температуре в темноте, после чего считывали флюоресценцию с временным разрешением на длинах волн 620 нм и 665 нм излучения с использованием EnVision спектрофотометра для считывания планшетов (Perkin Elmer).

Данные анализировали, вычисляя % значения Delta F и % специфического связывания для каждого образца в соответствии с уравнением 1 и уравнением 2.

Анализы репортер-лиганд также исполняли с использованием альтернативного источника FLAG IL1 бета (Alexis, ALX-522-056), как изложено ниже. 5 мл неочищенных, содержащих scFv периплазматических экстрактов, приготовленных в 200 мМ HEPES буфере, рН 7,4, 0,5 мМ ЭДТА и 0,5 М сахарозы, добавляли в лунки 384-луночного планшета для микроанализа (Costar 3676). Затем добавляли 8 нМ человеческого HIS IL1RFc к объему 20 мкл. Планшеты для анализа далее опечатывали и инкубировали при комнатной температуре в темноте на протяжении 1 час. После предварительной инкубации планшетов для анализа добавляли 5 мкл 80 нМ FLAG IL1 бета (Alexis ALX-522-056). Затем прибавляли 5 мкл 40 нМ анти-FLAG IgG, меченого XL665 (CIS Bio international 61FG2XLB), и 5 мкл 3,2 нМ античеловеческого Fc IgG, меченого криптатом (CIS Bio International 61HFCKLB).

Все разведения осуществляли в физиологическом растворе с фосфатным буфером, содержащим 0,4 М калия фторида и 0,1% альбумина телячьей сыворотки (буфер анализа).

Планшеты анализа инкубировали на протяжении 3 час при комнатной температуре в темноте, после чего считывали флюоресценцию с временным разрешением на длинах волн 620 нм и 665 нм излучения с использованием EnVision спектрофотометра для считывания планшетов (Perkin Elmer).

Данные анализировали, вычисляя % значения Delta F и % специфического связывания для каждого образца в соответствии с уравнением 1 и уравнением 2.

Уравнение 1:

Значения % Delta F впоследствии использованы для расчета % специфического связывания, как описано в уравнении 2.

Уравнение 2:

Очищенный scFv из позитивных клонов, идентифицированных в результате скрининга, тестировали в любом вышеупомянутом анализе ингибирования связывания человеческого HIS FLAG меченого IL1 бета с человеческим HIS IL1RFc рецептор-лиганд HTRF®.

Специалист может модифицировать указанные анализы для тестирования IgG или других форматов ингибирования. Титрование концентрации scFv использовали для установления активности клона, которую определяли на базе значения IC50 в анализе. Все разведения осуществляли в буфере анализа. 5 мл титрованного очищенного образца scFv добавляли в лунки 384-луночного планшета для микроанализа (Costar 3676). Затем добавляли 2 нМ человеческого HIS IL1RFc (при использовании внутреннего HIS IL1 бета) или 8 нМ человеческого HIS IL1RFc (при использовании Alexis source IL1 бета) к объему 20 мкл. Планшеты для анализа опечатывали и инкубировали при комнатной температуре в темноте на протяжении 1 час. Последующие стадии добавления осуществляли так же, как описано для неочищенных, содержащих scFv периплазматических экстрактов.

Планшеты для анализа инкубировали на протяжении 3 час при комнатной температуре в темноте, после чего считывали флюоресценцию с временным разрешением на длине волны длины волны излучения 620 нм и 665 нм с использованием спектрофотометра EnVision для считывания планшетов (Perkin Elmer).

Данные анализировали, вычисляя % значения Delta F и % специфического связывания для каждого образца в соответствии с уравнением 1 и уравнением 2. Значения IC50 определяли с использованием программного обеспечения GraphPad Prism путем обработки кривых с использованием четырехпараметрического логистического уравнения (Уравнение 3).

Уравнение 3:

Y=Низ+(Bepx-Hиз)/(1+10^((LogEC50-X)*HillSlope))

Х - логарифм концентрации. Y - специфическое связывание.

Y стартует снизу и идет верх сигмовидной кривой,

Эталонные мышиные античеловеческие IL1R1 mAb (Fitzgerald 10-I73) и антагонист рецептора IL-1 анакинра (Kineret®; AMGEN, коммерчески доступен в аптеке) использовали во всех анализах титрованных очищенных scFv как позитивный контроль.

Для оптимизации ведущих вариантов неочищенные scFv разбавляли буфером анализа. 5 мкл разбавленного неочищенного scFv образца добавляли в лунки 384-луночного планшета для микроанализа (Costar 3676). Затем добавляли 2 нМ человеческого HIS IL1RFc к объему 20 мкл. Планшеты для анализа опечатывали и инкубировали при комнатной температуре в темноте на протяжении 1 час.

После предварительной инкубации планшетов для анализа, добавили 5 мкл 40 нМ HIS FLAG IL1 бета (внутренняя методика, экспрессия в Е.coli). Далее прибавляли 5 мкл 40 нМ анти-FLAG IgG, меченого XL665 (CIS Bio international 61FG2XLB), и 5 мкл 3,2 нМ античеловеческого Fc IgG, меченого криптатом (CIS Bio International 61HFCKLB).

Все разведения осуществляли в физиологическом растворе с фосфатным буфером, содержащим 0,4 М калия фторида и 0,1% альбумина телячьей сыворотки (буфер анализа).

Планшеты анализа инкубировали на протяжении 3 час при комнатной температуре в темноте, после чего считывали флюоресценцию с временным разрешением на длинах волн 620 нм и 665 нм излучения с использованием EnVision спектрофотометра для считывания планшетов (Perkin Elmer).

Данные анализировали, вычисляя % значения Delta F и % специфического связывания для каждого образца в соответствии с уравнением 1 и уравнением 2.

Анализ связывания рецептор-лиганд (IL1 рецептор антагонист) HTRF®

Очищенные scFv из позитивных клонов, идентифицированных в ходе скрининга, тестировали в анализе связывания рецептор-лиганд антагониста рецептора IL1 (IL1ra) HTRF®. IgG также тестировали в этом формате анализа. Титрование концентрации scFv использовали для установления активности клона, которую определяли на базе значения IC50 в анализе.

Все разведения осуществляли в буфере анализа, как описано выше для анализа связывания с лигандом. 5 мл титрованного очищенного образца scFv добавляли в лунки 384-луночного планшета для микроанализа (Costar 3676).

Затем добавляли 0,4 нМ меченого крипта-том HIS IL1RFc. Планшеты для анализа опечатывали и инкубировали при комнатной температуре в темноте на протяжении 1 час.

После предварительной инкубации добавили 5 мкл 0,бнМ FLAG HIS IL1ra (внутренняя методика, экспрессия в Е.coli). Далее прибавляли 5 мкл 40 нМ анти-FLAG IgG, меченого XL665 (CIS Bio 61FG2XLB).

Планшеты для анализа инкубировали на протяжении 3 час при комнатной температуре в темноте, после чего считывали флюоресценцию с временным разрешением на длине волны длины волны излучения 620 нм и 665 нм с использованием спектрофотометра EnVision для считывания планшетов (Perkin Elmer).

Данные анализировали, вычисляя % значения Delta F и % специфического связывания для каждого образца в соответствии с уравнением 1 и уравнением 2. Значения IC50 определяли с использованием программного обеспечения GraphPad Prism путем обработки кривых с использованием четырехпараметрического логистического уравнения (Уравнение 3).

Селективность и перекрестная реактивность с другими видами антитела в анализе конкурентного связывания

Очищенный IgG обсорбировали на 96-луночные планшеты Maxisorp для микротитрования (Nunc) в физиологическом растворе с фосфатным буферным раствором при концентрации, которая дает значительный сигнал, когда биотилированный человеческий HIS IL1RFc добавляли при приблизительно оцененной Kd для специфического IgG. Излишек IgG вымывали физиологическим раствором с фосфатным буфером Твин (0,1% в объемном соотношении), и лунки блокировали обезжиренным сухим молоком в физиологическом растворе с фосфатным буфером (3%, масс/об) на протяжении 1 час. Серии разведении каждого из следующих конкурирующих антител готовили в 3% обезжиренном сухом молоке, начиная от концентрации, приблизительно в 400 раз превышающей значение Kd взаимодействия между биотинилированным человеческим IL1RFc и соответствующим IgG яванского макака (Масаса fascicularis) HIS IL1RFc (внутренний НЕК EBNA, экспрессированный, как описано ниже), крысиным HIS IL1RFc (внутренне НЕК EBNA экспрессированный), рекомбинантный человеческий IL1 sRI (R&D systems 269-1R/CF), человеческий IL-1R6/IL-1 R rp2/Fc (R&D systems 872-RP), рекомбинантный человеческий IL-18 R альфа (IL-1 R5)/Fc (R&D systems 816-LR), рекомбинантный человеческий IL-1 R4 (ST2)/Fc (R&D systems 523-ST).

Небиотинилированный человеческий HIS IL1RFc включали как позитивный контроль. 25 мкл этой серии разведения добавляли на блокированный IgG планшет для анализа. 25 мкл 1,4 нМ биотилированного человеческого HIS IL1RFc добавляли на планшет для анализа. Планшет далее опечатывали и инкубировали при комнатной температуре на протяжении 2 час. Несвязанный антиген удаляли промыванием физиологическим раствором с фосфатным буфером Твин (0,1%, об/об), тогда как оставшийся биотилированный человеческий IL1RFc детектировали конъюгатом стрептавидин-европий^ (детектирование DELFIA®, PerkinElmer). Флуоресценцию с временным разрешением измеряли на длине волны 620 нм на спектрофотометре для считывания планшетов EnVision (Perkin Elmer). Данные флуоресценции наносили на график как количества европия. IC50 значения определяли с использованием программного обеспечения GraphPad Prism через обработку кривых с использованием четырехпараметрического логистического уравнения (Уравнение 3).

Генерация рекомбинантного гибридного белка IL-1R1 Fc человека и яванского макака

Кодирующую последовательность кДНК внеклеточного домена человеческого IL-1R1 (аминокислотные остатки 1-336 NP_000868) амплифицировали из человеческой кДНК печени с помощью ПЦР с использованием праймеров, базирующихся на последовательности человеческой кДНК IL-1R1 (RefSeq NM_00877). кДНК, кодирующую последовательность внеклеточного домена IL-1R1 яванского макака (Macaco fascicularis) (аминокислотные остатки 1-336), амплифицировали из кДНК печени яванского макака с использованием идентичных праймеров, как при использовании для амплификации ПЦР человеческой кДНК.

Последовательность яванского макака определяли с помощью анализов продуктов ПЦР с использованием стандартного ди-дезокси флуоресцентного терминаторного секвенирования. Результирующая последовательность ДНК представлена на фиг 1, и прогнозированная аминокислотная последовательность представлена на фиг.2. Результирующие кДНК сублонировали по инструкции изготовителя в pENTR/D-TOPO (Invitrogen).

Фрагменты кДНК, кодирующие внеклеточные домены IL-IR1, были далее перенесены в вектор экспрессии млекопитающего pDEST12,2 (Invitrogen) с использованием LR Gateway® реакции (Invitrogen). Beктор pDEST12,2 модифицировали таким образом, чтобы он содержал кодирующую область человеческого IgG1 Fc внутрирамочно с вставленным исследуемым геном, и также при вставке oriP оригинала репликации из рСЕР4 вектора (Invitrogen) позволял эписомальную репликацию плазмиды в результате трансфекции в клеточные линии, экспресирующие генный продукт EBNA-1 (такие как клетки HEK293-EBNA). Результирующий нуклеотид и прогнозированная аминокислотная последовательность для человеческого IL-1R1Fc представлены на фиг.3 и фиг.4, и для IL-1R1Fc яванского макака - на фиг.5 и фиг.6, соответственно.

Белок очищали из кондиционированной среды с использование хроматографии с применением протеина G после эксклюзионной хроматографии.

Генерация рекомбинантного гибридного белка IL-1R-Fc человека, яванского макака и крысы

Крысиный IL-1R-Fc получали с помощью аналогичной методологии, как описано для генерации рекомбинантных гибридных белков IL-1R Fc человека и яванского макака, как описано выше.

Анализ HeLa IL-1α- и IL-1β-индуцированного высвобождения IL-8

Клетки HeLa (European Collection of Cell Cultures, ЕСАСС кат. №93021013), человеческая негроидная клеточная линию рака эпителия шейки матки (Cancer Res 1952; 12:264; Proc Soc Exp Biol Med 1954; 87:480) фиксировали в минимальной поддерживающей среде плюс 10% сыворотки телячьего эмбриона плюс 1% заменимых аминокислот; клетки расцепляли от 1:4 до 1:12 из 100% монослоя для обычной культуры), высевали в 96-луночные плоскодонные планшеты для анализа для культуры тканей (Costar) при 1,5×104 клеток/лунку в 10 мкл питательной среды/лунку (модифицированная по способу Дульбекко среда Игла), содержащей 10%, об/об термически инактивированной сыворотки телячьего эмбриона (Invitrogen), 1%, об/об заменимых аминокислот (Invitrogen)), и далее клетки культивировали на протяжении ночи (16-18 час) в увлажненной атмосфере при 37°С и 5% CO2.

Разведения очищенного scFv/IgG готовили в питательной среде и 50 мкл/лунку полученной серии разведении добавляли к клеткам HeLa без удаления ночной питательной среды, после чего предварительно инкубировали с HeLa клетками на протяжении 30-60 мин при 37°С. Затем прибавляли 50 мкл/ячейку ILα/ IL-1β и инкубировали на протяжении 4-5 час во влажной атмосфере при 37°С и 5% CO2. Концентрация использованного лиганда составляла ЕС50 или выше, в зависимости от активности исследуемого scFv/IgG, где ЕС50 - концентрация лиганда, которая обеспечивает половину максимальной реакции на лиганд в анализе (рассчитывают подобно Уравнению 3).

Эталонное мышиное анти-человеческое IL1R1 mAb (Fitzgerald 10-I73) и антагонист рецептора IL-1 анакинра (Kineret®; доступен в аптеках) включены в титриметрический анализ как положительный контроль.

Супернатанты (кондиционированная питательная среда) были собраны и хранились при -20°С до анализа IL-8 (обычно меньше 1 недели).

Уровни IL-8 в супернатанте определяли с использованием набора человеческих IL-8 Duoset ELISA (R&D Systems). Захваченное антитело против IL-8 (4 мкг/мл разбавили в ФБР, 50 мкл/лунку) адсорбировали на 96-луночных аутофлуоресцентных планшетах для микроанализа с высокой способностью связывать белок (планшеты FluoroNunc Maxisorb) на протяжении ночи при 4°С. Избыток IgG удаляли промыванием ФБР-Твин, и ячейки блокировали 1% альбумином телячьей сыворотки (BSA) в ФБР на протяжении 1 час при комнатной температуре, после чего планшеты промывали, как описано раньше. В каждую лунку добавляли 80 мкл 0,1% альбумина телячьей сыворотки (BSA) в ФБР. 20 мкл/лунку кондиционированной питательной среды потом добавляли для получения разведения кондиционированной питательной среды 1:5. IL-8 стандарты (из 1000 пг/мл, разведение 1:2) также добавляли на планшеты ELISA, после чего контроль ELISA и планшеты инкубировали при комнатной температуре 2 часа.

После инкубации планшеты промывали, как описано выше, для удаления несвязанных белков. Биотинилированный IL-8 обнаруживали с помощью Ab (20 нг/мл в растворителе реагента [0,1% АТС/ФБР]; 50 мкл/лунку) добавляли на планшеты и инкубировали при комнатной температуре 1 час. Обнаруженное несвязанное антитело удаляли промыванием ФБР-Твин (0,1%, об/об), и оставшееся биотинилированное антитело обнаруживали с помощью конъюгата стрептавидин-европий3+ (детектирование DELFIA®, PerkinElmer). Флуоресценцию с временным разрешением измеряли при 615 нм на устройстве для считывания планшетов Victor (PerkinElmer).

Данные флуоресценции наносили на график как количество европия. Данные ингибирования нормализовали до процента максимального выхода IL-8 с использованием подсчета Европия из IL-1 стимуляции в отсутствие ингибиторного контроля (максимальный контроль) и без IL-1 контроля (средний контроль) как уравнение 4.

Уравнение 4:

Значения IC50 определяли с использованием программного обеспечения GraphPad Prism путем обработки кривых с использованием четырехпараметрического логистического уравнения (Уравнение 3).

CYNOMK1 анализ IL-1β-индуцированной секреции IL-8

Клетки CYNOM-K1 (производные линии клеток фибробластов яванского макака; European Collection of Cell Cultures, номер доступа ЕСАСС 90071809; содержали в соответствии с сопроводительными инструкциями) собирали с использованием 0,25% трипсин/ЭДТА и высевали на 96-луночные плоскодонные планшеты для анализа для тканевых культур (Costar) по 8×103 клеток/лунку в 100 мкл питательной среды/лунку (Минимальная эссенциальная среда, MEM (Invitrogen) с 20%, об/об непрогретой инактивированной сыворотки телячьего эмбриона (Invitrogen), 1%, об/об заменимых аминокислот (Invitrogen)), и затем клетки культивировали на протяжении ночи (16-18 час) в увлажненной атмосфере при 37°С и 5% CO2.

Разведения очищенных scFv/IgG готовили в питательной среде, и 50 мкл/лунку полученной серии разведении добавляли к клеткам CYNOM-K1 без удаления ночной питательной среды и предварительно инкубировали с клетками CYNOM-K1 в течение 30-60 мин при 37°С. Далее добавляли 50 мкл/лунку 1Lα/IL-1β и инкубировали в течение 4-5 час в увлажненной атмосфере при 37°С и 5% СО2. Концентрация использованного лиганда составляла EC80, где EC80 - концентрация лиганда, обеспечивающая 80% максимальной реакции на лиганд в этом анализе (рассчитывали подобно Уравнению 3).

Антагонист IL-1 рецептора анакинра (Kineret®; доступен в аптеке) включен в титриметрический анализ как положительный контроль.

Супернатанты (кондиционированная питательная среда) были собраны и хранились при -20°С до анализа IL-8 (обычно меньше 1 недели). Уровни IL-8 в супернатанте определяли с использованием набора для определения человеческого IL-8 Duoset ELISA (R&D Systems).

Захваченное антитело против IL-8 (4 мкг/мл в ФБР, 50 мкл/лунку) адсорбировали на 96-луночных аутофлуоресцентных планшетах для анализа с высокой способностью связывать белок (планшеты FluoroNunc Maxisorb) на протяжении ночи при 4°С. Избыток IgG удаляли промыванием ФБР-Твин, и ячейки блокировали 1%

альбумином телячьей сыворотки (АТС) в ФБР в течение 1 час при комнатной температуре, после чего планшеты промывали, как описано раньше.

В каждую лунку добавляли 80 мкл 0,1% альбумина телячьей сыворотки (АТС) в ФБР. 20 мкл/лунку кондиционированной питательной среды затем добавляли для получения разведения кондиционированной питательной среды 1:5. Стандарты IL-8 (из 1000 пг/мл, разведение 1:2) также добавляли на планшеты ELISA, после чего контроль ELISA и планшеты инкубировали при комнатной температуре 2 час.

После инкубации планшеты промывали, как описано раньше, для удаления несвязанных белков. Биотинилированный IL-8 обнаруживали с помощью Ab (20 нг/мл в растворителе реагента [0,1% АТС/ФБР]; 50 мкл/лунку) добавляли на планшеты и инкубировали при комнатной температуре 1 час. Обнаруженное несвязанное антитело удаляли промыванием ФБР-Твин (0,1%, об/об), и оставшееся биотинилированное антитело обнаруживали с помощью конъюгата стрептавидин-европий3+ (детектирование DELFIA®, PerkinElmer). Флуоресценцию с временным разрешением измеряли при 615 нм на устройстве для считывания планшетов Victor (PerkinElmer). Данные флуоресценции наносили на график как количество европия. Данные ингибирования нормализовали до процента максимального выхода IL-8 с использованием подсчета Европия из IL-1 стимуляции в отсутствие ингибиторного контроля (максимальный контроль) и без IL-1 контроля (средний контроль) как Уравнение 4.

Уравнение 4:

Значение IC50 определяли при использовании программного обеспечения GraphPad Prism через обработку кривых с использованием четырех параметрическое логистическое уравнение (Уравнение 3).

Клонирование внеклеточного домена человеческого IL-1R1

Последовательность RefSeqNM 00877 использовали как эталонную последовательность для человеческого IL-1R1. Внеклеточный домен (остатки 1-336) амплифицировали в ходе ПЦР с использованием кДНК печени человека как образца. Были использованы праймеры NC268 (5′-CACCATGAAAGTGTTACTCAGAC) и NC269 (5′-CTTCTGGAAATTAGTGACTGG). Амплифицированный продукт ПЦР клонировали в pENTR-D-TOPO от Invitrogen, следуя инструкции производителя. Получили и секвенировали несколько клонов. Клон 4 был идентичным эталонной последовательности и был отобран для дальнейшего использования.

Полиморфизм человеческого A124G генерировали с использованием стандартного сайт-направленного мутагенеза соответствующего кодона GCA до GCA в человеческом pENTR-D-topo IL-1R1 клоне 4.

Клонирование внеклеточного домена Cyno IL-1R1

Последовательность кДНК яванского макака, кодирующая IL-1R1, была доступна в базе данных EMBL (EMBL AY497008). Эта последовательность была в высокой степени гомологична человеческой последовательности, хотя отсутствовали первые 27 пар нуклеотидов на конце 5′ кодирующей последовательности, при сравнении с человеческим IL-1R1. кДНК, кодирующую растворимый внеклеточный домен IL-1R1 яванского макака (остатки 1-336), амплифицировали в ПЦР с использованием кДНК печени яванского макака как образца. Были использованы праймеры NC268, как описано выше, которые представляли собой 5′-праймер человеческого IL-1R1 и NC270 (5′-CTTCTGGAATTTAGTGACTGG) как обратный праймер. Амплифицированный продукт ПЦР клонировали в pENTR-D-TOPO от Invitrogen.

Секвенировали несколько клонов и нашли отличия от транслированной контрольной последовательности (EMBL AY497008).

Изменения были следующими:

1. S17F: ТСТ в опубликованной последовательности ТТТ во всех клонах (сигнальная последовательность)

2. V66I: GTA в опубликованной последовательности АТА во всех клонах.

3. H173N: САС в опубликованной последовательности и в клоне 5, ААС во всех других клонах.

Для проверки на валидность эти изменения последовательности, сравненные с опубликованной последовательностью амплифицированной кДНК, кодирующей внеклеточный домен, секвенировали непосредственно с использованием стандартного ди-дезокси флуоресцентного терминаторного секвенирования. Изменение S17F присутствовало в амплифицированном продукте ПЦР и, по-видимому, было естественным изменением опубликованной последовательности. Изменение V66I также присутствовало в амплифицированном продукте ПЦР и, по-видимому, было естественным изменением опубликованной последовательности. Изменение H173N, по-видимому, было естественным полиморфизмом, так как оба кодона - САС и ААС - присутствовали в одинаковых положениях с одинаковой интенсивностью. Прямое секвенирование продукта ПЦР идентифицировало дальнейший полиморфизм Е300К. В этом случае, реакция секвенирования четко показала равное количество кодонов GAA и AAA.

Клонирование внеклеточного домена крысиного IL-1R1

Последовательность кДНК крысы, кодирующую IL-1R1, получили из базы данных EMBL (EMBL ID RNIL1R) и использовали как эталонную последовательность. Внеклеточный домен (остатки 1-336) амплифицировали в ходе ПЦР с использованием кДНК печени крысы как образца. Были использованы праймеры NC288 (5′-CACCATGCTGCCGAGGCTTG) HNC289 (5′-ATTCTTGAAGTCAGGAACTGGGT).

Амплифицированный продукт ПЦР клонировали в pENTR-D-TOPO от Invitrogen по инструкции производителя. Получили и секвенировали несколько клонов. Клон 1 был идентичным эталонной последовательности и был отобран для дальнейшего использования.

Клонирование, экспрессия и очистка человеческого HIS FLAG IL-1Ra

Последовательность человеческого IL-1Ra получили из базы данных RefSeq (NM_173842) и использовали как эталонную последовательность. кДНК, кодирующую зрелую последовательность человеческого IL-1Ra (остатки 26-177), амплифицировали в ходе ПЦР из кДНК легкого человека.

Были использованы праймеры IL1RaF (5′-CCTCATATGGAAAACCT GTACTTCCAGTCTCGACCCTCTGGGAGAAA) и IL1RaR (5′-ATATCTCGAGCTACTCGTCCTCCTGGAAG), Спроектированный праймер IL1RaF был таким, что участок рестрикции протеазой вируса табачной мозаики (TEV) непосредственно прилегал к N-концевому остатку аргинина зрелого IL-1Ra. Амплифицированный продукт ПЦР клонировали в pCR4blunt-topo от Invitrogen по инструкции производителя. Получили несколько клонов и их сгенерированные последовательности. Клон с правильной кодирующей последовательностью, сравненной с эталонной последовательностью, выбрали для дальнейших манипуляций. Встроенную ДНК впоследствии субклонировали в экспрессирующий вектор рТ7 Е.coli с использованием сайта NdeI в каркасе N-концевого (HIS)6-FLAG tag.

Для экспрессии растворимого белка, меченого HIS-FLAG, экспрессирующую плазмиду трансформировали в химически компетентные BL21 (DE3) звездчатые клетки от Invitrogen. Клетки, содержащие экспрессирующую плазмиду, культивировали в Lysogeny Broth (LB, который содержал 10 г/л дрожжевого экстракта, 5 г/л NaCl) при 37°С до OD600 0,5. Затем добавляли IPTG в виде 1 М запасного раствора до конечной концентрации 50 мкМ. Клетки инкубировали при 37°С в течение 3 час. Клетки собирали центрифугированием при 6000 об/мин в течение 10 мин, и осадок в пробирке после центрифугирования хранили при -80°С. Клетки размораживали и ресуспендировали в 50 мМ Трис, рН 8,0, 10% глицерина, 0,3 М NaCl, 10 мМ имидазола (буфер А) плюс Полные ингибиторы протеаз (Roche). Клетки лизировали обработкой ультразвуком 3×30 с на льду с использованием устройства Heatsystems-Ultrasonics Inc. Лизат центрифугировали при 100000 g и 4°С в течение 30 мин. Супернатант подвергали аффинной хроматографии с использованием Ni-NTA Superflow (Qiagen). Связанный материал элюировали буфером А, содержащим 0,3 М имидазола. Фракции, содержащие IL-1Ra, объединяли и заменяли буфером на ФБР, используя обессоливающую колонку Hiprep 26/10 (GE Healthcare). Чистоту образца тестировали с использованием гель-электрофореза на геле натрия лаурилсульфата. Белок анализировали гель-фильтрационной хроматографией, и было обнаружено, что он является мономерным.

ЛПС извлекали из 5 мл (14 мл) очищенного IL-1Ra с использованием полимиксина А агарозы (Sigma Prod. No. P1411). Полимиксин агарозу Sigma промывали 3 раза свободным от ЛПС ФБР (Sigma D8537), наносили на пустую колонку BioRad Polyprep и осаждали гранулы силой тяжести. 1 мл упакованных гранул промывали 10 мл свободного от ЛПС ФБР. Образец IL-1ra наносили на колонку и пропускали через смолу под силой тяжести. Образец проходил через новую колонку с 1 мл полимиксина. Уровни ЛПС в образце IL-1Ra перед и после обработки полимиксином определяли с использованием анализа Pyrochrome LAL (Associates of Cape Cod Inc. C0180).

Молекулярную массу свободного от ЛПС белка измеряли с использованием интактного массового анализа, используя Q-ToF масс-спектроскопию. Измерена масса без 1 Да рассчитанной массы (203257Да) His-Flag-Tev-IL-1ra без N-концевого Мет.

Клонирование, экспрессия и очистка человеческого HIS FLAG-IL-1β

Последовательность человеческого IL-1β получали из базы данных RefSeq (NM_000576) и использовали как эталонную последовательность. кДНК, кодирующую зрелую последовательность человеческого IL-1β (остатки 117-269), амплифицировали в ПЦР из кДНК легкого человека.

Были использованы праймеры IL1bF (5′-CCTCATATGGAAAACCTGTACTTCCAG TCTGCACCTGTACGATCACTG) и IL1bR (5′-ATATCTCGAGTTAGGAAGACACA AATTGCATGG). Спроектированный праймер IL1bF был таким, что участок рестрикции протеазой вируса табачной мозаики (TEV) непосредственно прилегал к N-концевому остатку аланина зрелого IL-1β. Амплифицированный ПЦР продукт клонировали в pCR4blunt-topo от Invitrogen по инструкции производителя. Получили несколько клонов и их сгенерированные последовательности. Клон с правильной кодирующей последовательностью, сравненной с эталонной последовательностью, выбрали для дальнейших манипуляций. Встроенную ДНК впоследствии субклонировали в экспрессирующий вектор рТ7 Е.coli с использованием сайта Ndel в каркасе N-концевого (HIS)6-FLAG tag.

Для экспрессии меченого HIS-FLAG растворимого белка IL-1β экспрессирующую плазмиду трансформировали в химически компетентные BL21 (DE3) звездчатые клетки от Invitrogen. Клетки, содержащие экспрессирующую плазмиду, культивировали в LB при 37°С до OD600 0,5. Затем добавляли IPTG из 1 М запасного раствора до конечной концентрации 50 мкМ. Клетки инкубировали при 37°С в течение часов. Клетки собирали центрифугированием при 6000 об/мин в течение 10 мин, и осадок в пробирке после центрифугирования хранили при -80°С. Клетки размораживали и ресуспендировали в 50 мМ Трис, рН 8,0, 10% глицерина, 0,3 М NaCl, 10 мМ имидазола (буфер А) плюс Полные ингибиторы протеазы (Roche). Клетки лизировали обработкой ультразвуком 3×30 с на льду с использованием устройства Heatsystems-Ultrasonics Inc. Лизат центрифугировали при 100000 g и 4°С в течение 30 мин. Супернатант подвергали аффинной хроматографии с использованием Ni-NTA Superflow (Qiagen). Связанный материал элюировали буфером А, содержащим 0,3 М имидазола. Фракции, содержащие IL-1β, объединяли и заменяли буфером в ФБР, используя обессоливающую колонку Hiprep 26/10 (GE Healthcare). Чистоту образца тестировали с использованием гель-электрофореза на геле натрия лаурилсульфата. Белок анализировали гель-фильтрационной хроматографией, и было обнаружено, что он мономерный.

ЛПС удаляли из очищенного IL-1β в основном таким же способом, как описано выше, с использованием полимиксин А агарозы (Sigma Prod. No. P1411).

Молекулярную массу свободного от ЛПС IL-1β белка измеряли с использованием интактного массового анализа, используя Q-ToF масс-спектроскопию. Измерена масса без 1Да рассчитанной массы (20325.67Да) His-Flag-Tev-IL-1β без N-концевого Мет.

Пример 3: Измерение аффинности Антитела 6 и AMG108

Сродство антител по изобретению к IL-1R1 измеряли двумя способами, оба с использованием технологии KinExA™ (118). KinExA™ (Kinetic Exclusion Assay) основан на технологии жидкостной флуориметрии и может быть использован для правильного определения взаимодействий с высоким сродством, включая такие в субпикомолярной степени (119). Во-первых, мономеризированный FAb приводили в равновесие с sIL-1R1-Fc (растворимый sIL-1R1-Fc), или IgG приводили в равновесие с sIL-1R1 (немеченый). Эти равновесные растворы взаимодействующих молекул анализировали с использованием технологии KinExA™. 3200. Кратко, для каждого равновесного образца, прибор KinExA™. 3200 автоматически пакует свежую колонку sIL-1R1 конъюгированных микрогранул. Образец, содержащий антитело (или FAb фрагмент), антиген и Ab/антиген (или FAb/антиген) комплекс (в ФБР Дульбекко, 1 мг/мл альбумина телячьей сыворотки, 0,025%, масс/об азида натрия) пропускали быстро (0,25 мл/мин) через колонку для того, чтобы контактное время образца с гранулами антигена было очень коротким. Быстрый контакт приводил к тому, что для взаимодействий высокого сродства (медленная диссоциация), диссоциация комплекса была пренебрежимо малой на протяжении этого короткого времени контакта. Свободные антитела связывались с IL-1R1-гранулами. Су5™ (цианин), флуоресцентно меченое вторичное антитело, мышиный анти-человеческий IgG (тяжелая и легкая специфическая цепь) далее пропускали через колонку. Меченное вторичное антитело связывалось с антителом, связанным с колонкой. Промывали буферным раствором для удаления избытка меток, генерирующих флуоресцентный сигнал на гранулах колонки прямо пропорционально к количеству свободных рецепторов в исходном образце. С помощью титрования ряда концентраций антитела и sIL-1R1, а также измерения свободного антитела после каждого состояния, оценивали KD для антитела по отношению к рецептору (подбор кривой методом наименьших квадратов, с использованием модели обратного биомолекулярного взаимодействия в программном обеспечении KinExA™. Pro). Хотя оценка сродства с использованием технологии BIAcore (Surface Plasmon Resonance) была сравнительной, чрезвычайно медленная диссоциация означала, что оценка методом KinExA™ дает более достоверные измерения сродства со значениями KD<10 пМ.

Результаты измерения сродства анти-IL-1R1 FAb к растворимому человеческому IL-1R1 и растворимому IL-1R1 яванского макака приведены в табл.10 ниже. Результаты показывают, что данное антитело связывается с человеческим IL-1R1 и IL-1R1 яванского макака с равно высоким сродством, и, несмотря на связывание с эпитопом, если конкуренция с IL-1-альфа, -бета и антагонистом рецептора IL-1(IL-1ra) была возможной, сродство к рецептору было очень высоким. Сродство к человеческому sIL-1R1 сравнивали для образца антитела, как формат IgG1TM с AMG108 IgG2. AMG108 IgG2 не связывается с IL-1R1-Fc яванского макака, и AMG108, как IgG2, с трудом формирует мономерные стабильные гомогенные фрагменты FAb. Таким образом, была возможна только конкуренция между полноразмерными IgG. Результаты в табл.11 демонстрируют, что сродство к человеческому sIL-1R1 было соизмеримым между образцом антитела и AMG108. В предыдущей публикации (Международная патентная заявка WO 2004/022718) были раскрыты антитела, которые конкурируют с IL-1ra, тем не менее, они демонстрировали меньшее сродство и активность (обозначены как второй класс идентифицированных антител). И наоборот, здесь мы демонстрируем антитело, которое конкурирует за связывание с IL-1ra и все еще демонстрирует очень высокое родство к IL-1R1, Результаты для FAb и IgG1TM для Антитела 6 были подобными.

Таблица 10
Антитело KD человеческий IL1-R1-Fc KD Cyno IL1-R1-Fc
Антитело 6 FAb 2,5 пМ 2,8 пМ
Таблица 11
Антитело KD человеческий sIL-1R1
Антитело 6 IgG1TM 3,05 пМ
AMG108 IgG2 4,12 пМ

Методы:

Мономеризация FAb

Антитело 6 IgG1TM (тройной мутант, 234F, 235Е и 331S) расщепляли в растворе с использованием активированного папаина. Папаин (SIGMA) (6,2 мг) активировали с помощью растворения в 620 мкл физиологического раствора с фосфатным буфером Дульбекко (Д-ФБР) и инкубировали в 62 мкл 100 мМ L-пистеина в Д-ФБР, и затем в 10 мкл 1 М NaHCO3 в Д-ФБР. Раствор далее обессоливали на уравновешенной Д-ФБР колонке Sephadex G25 (PD-10) и собирали фракции по 2,75-3,85 мл. Этот просветленный нежелательный остаточный L-цистеин и ингибиторные низкомолекулярные продукты аутолиза папаина. 250 мкл Антитела 6 IgG1TM (9,32 мг/мл) с 25 мкл раствора NaHCO3 в Д-ФБР (для увеличения рН до 8-8,5) и 50 мкл активированного L-цистеином папаинового элюата PD-10 (как описано выше) смешивали, и реакционную смесь инкубировали при комнатной температуре. Протекание реакции отслеживали, вводя по 50 мкл на колонку для эксклюзионной хроматографии Superdex 75, которую уравновешивали Д-ФБР при 0,5 мл/мин.

Весь оставшийся гидролизат добавляли к 0,43 г (влажная масса) протеин G Sepharose 4 Fast Flow. Пик, соответствующий мономерному фрагменту Fab, собрали и концентрировали до объема 105 мкл с использованием Amicon Ultra 4 10,000 MWCO концентрирующей центрифуги (Millipore, Billerica, MA, USA). Далее его переносили на колонну Superdex 75 и собирали пик, соответствующий фракции FAb. Фракцию со временем удерживания 21,0-21,8 мин с конечного этапа очистки Superdex 75 использовали как источник чистого FAb Антитела 6. FAb повторно анализировали на колонке Superdex 75 через 3 дня хранения при 4°С и обнаружили <0,4% мультимера, демонстрируя, что мономерный FAb препарат достаточно стабилен для анализа сродства. Чистота мономерного FAb также подтвердилась с использованием SDS-PAGE в восстанавливающих и невосстанавливающих условиях, и масс-спектрометрических анализов MALDI-TOF в восстанавливающих и невосстанавливающих условиях.

Анализы KinExA™

IL-1R-Fc, человеческие (SEQ ID NO: 134; ожидаемая базовая масса пептидной последовательности 65 036,92 Да, как полностью восстановленного мономера; 133 039,8 Да как димера -Fc; 11 071 нМ как концентрация мономера) или яванского макака (SEQ ID NO: 136; ожидаемая базовая масса пептидной последовательности 65 213,14 Да, как полностью восстановленного, Swiss Prot, 130 392,3 Да как димера-Fc, концентрация мономера 7 974 нМ) использовали как антиген для измерения сродства с Антителом 6 FAb (прямое сопоставление сродства с IL-1R человека и яванского макака). Человеческий IL-1R1 (R&D Systems, ожидаемая базовая масса пептидной последовательности 49 503 Да) использовали как антиген в экспериментах для измерения сродства AMG108 и Антитела 6 как IgG (для прямого сопоставления сродства AMG108 и Антитела 6 IgG). Из-за долгого времени уравновешивания, все буферы, которые использовали в экспериментах KinExA™, стерилизовали с помощью фильтра с размером пор 0,2 мкм. Для колонки (общей для измерений на базе FAb и IgG) использовали человеческий IL-1R1 (R&D Systems), и ковалентная связь с 100 мг (1 мкг IL-1R1 на мг гранул) гранул азлактона UltraLink Biosupport (Thermo Fisher Scientific, Rockford, IL, USA)) в 3 мл 50 мМ карбоната натрия (рН=8,4) при комнатной температуре с постоянным возбуждением на протяжении 50 мин. Промывание и блокирование осуществляли с помощью 10 мг/мл альбумина телячьей сыворотки в 1 М Трис, рН 8,7 (однократное промывание 1 мл, после центрифугирования гранул, 2 мл при перемешивании 25 об/мин на протяжении 1,5 час при комнатной температуре после второго центрифугирования). Осажденные гранулы в конце переносят еще раз в 2 мл свежего буфера, содержащего альбумин телячьей сыворотки, и хранят при 4°С до использования. В заключение эту суспензию гранул добавляли к 60 мл Д-ФБР + 0,02% азида натрия, и соединяли в аппарате загрузочного устройства гранул.

Конъюгат мышиного анти-человеческого IgG (H+L) и Су5 приготовили с концентрацией 1,4 мг/мл в 0,01 М фосфата натрия, 0,25 М NaCl (pH 7,6) с 15 мг/мл альбумина телячьей сыворотки и 0,05% азида натрия. Его выдерживали при 4°С до использования. FAb и IgG разбавляли до 50 нМ или 250 пМ или 100 пМ или 10 пМ. FcR разбавляли в 2-кратной серии разведения, включая Антитело 6 FAb или Антитело 6 Ab/AMG108 Ab с серией разведения от 25 или 5 нМ до 0,1525 пМ (в Дульбекко ФБР, 1 мг/мл альбумина телячьей сыворотки, 0,02%, масс/об азида натрия).

Комплексы были уравновешены при 18°С (комнатная температура) на протяжении 12-16 дней, и далее их пропускали через колонку после сигнального тестирования. Свободное от связей антитело обнаруживали с использованием 50 мкл Су5 меченного вторичного антитела. Обработку информации и анализов осуществляли с использование программного обеспечения KinExA™. Pro (v 2.0.0.17).

Пример 4: Анализ цельной крови

Активность антител изучали в анализе цельной крови, где инкубация IL-1бета (GIBCO, лиофилизированный, свободный от носителей) приводит к высвобождению IL-6. Если коротко, антитела разбавляли до концентрации 15 мкг/мл в физиологическом растворе с фосфатным буфером, содержащим 1% альбумина телячьей сыворотки, и далее титровали сериями в разведениях 1:3 в ФБР/1% АТС. 10 мкл каждой концентрации антитела или контроль ФБР/1% АТС инкубировали с 80 мкл цельной человеческой крови на протяжении 30 мин при комнатной температуре. 10 мкл IL-1бета в ФБР/1% АТС или ФБР/АТС добавляли для получения конечной концентрации в анализе 30 пМ и инкубировали на протяжении 22±2 час при 37°С в увлажненном инкубаторе, 5% СO2. 100 мкл ФБР добавляли в лунки и после центрифугирования при 300 g на протяжении 10 мин супернатант удаляли и анализировали на предмет содержания IL-6 с использованием коммерчески доступного набора huIL-6 ELISA (R&D Systems Duoset, по инструкции).

Активность Антитела 6 IgGlTM в данном анализе составила 311 пМ (83 пМ - 1,2 нМ) (Среднее значения IC50, 95% доверительный интервал)

Пример 5: Картирование эпитопа взаимодействия Антитела 6 с использованием химерных человеческих/мышиных IL-1R1 внеклеточных участков

5.1 Генерирование полноразмерного домена, замещенного химерными IL-1R1 молекулами.

Антитело 6 связывается с человеческим IL-1R1 но не с мышиным IL-1R1. С использованием этого свойства, химерные IL-1R1 молекулы генерировали для картирования эпитопа. Цельные домен-замещенные химеры создавали с помощью замещения домена 1 (D1) (M1-Y122), домена 2 (D2) (N123-V227) или домена 3 (D3) (I228-K336) человеческого эктодомена IL-1R1 соответствующей мышиной последовательностью IL-1R1. Субдомен-замещенные химеры генерировали с помощью замещения участков, которые известны как взаимодействующие с IL1β [120] и IL1ra [121] из человеческого IL1ra1 с соответствующими участками, взятыми из мышиного IL-1R1. HTRF (гомогенная флуоресценция с временным разрешением) конкурентного анализа использовали для определения связывания химер с антителом. В анализе антитело, меченое Eu3+ криптатом, взаимодействовало с человеческим IL-1R1, меченным биотипом. Взаимодействие обнаруживали с помощью сигнала FRET (Fluorescence Resonance Energy Transfer) между Eu3+ криптатом и XLent!, меченым стрептавидином [122].

5.1.1 Материалы и методы - клонирование, экспрессия и очистка химер

Молекулы кДНК, кодирующие химеры человеческого IL-1R1 внеклеточного домена (аминокислотные остатки 1-336 NP_000868) и мышиный IL-1R1 внеклеточный домен (аминокислотные остатки 1-338 NP_032388) синтезировали с помощью клонирования ПЦР с удлиненным праймером и клонировали в pDONR221 (Invitrogen, кат. №12536-017). Фрагменты кДНК, кодирующие IL-1R1 внеклеточного домена химер, далее переносили на вектор экспрессии млекопитающего pDEST12.2 (Invitrogen) с использованием LR Gateway Clonase II фермента в соответствии с инструкциями производителя (Invitrogen, кат. №12538-120). Вектор pDEST12.2 модифицировали, чтобы он содержал фрагмент человеческого IgGI Fc и 6xhis tag (SEQ ID NO: 134) внутрирамочно с встроенным исследуемым геном, и также с помощью вставки oriP оригинала репликации из вектора рСЕР4 (Invitrogen, кат. №V044-50), позволяющего репликацию эписомальной плазмиды на основании трансфекции в клеточные линии, экспресирующие генный продукт EBNA-1 (такие как клетки СНО трансфицированные, геном EBNA-1 [CHO-EBNA]). Экспрессированный белок в супернатанте СНО-гена EBNA очищали с использованием аффинной хроматографии с применением протеина G (HiTrap протеин G HP колонка [GE Healthcare, кат. №17-0404-03]) после эксклюзионной хроматографии (колонка Superdex 200 [GE Healthcare, кат. №17-1069-01]).

Последовательность внеклеточного домена человеческого IL-1R1 (аминокислотные остатки 1-336 NP_000868), последовательность вектора, кодирующего человеческий IgGI Fc tag и 6xhis tag, раскрыты в SEQ ID NO: 134. Последовательность внеклеточного домена мышиного IL-1R1 (аминокислотные остатки 1-338 NP_032388), последовательность кодирующего вектора.

5.1.2 Связывание антитела с химерами IL-1R1

Антитело метили криптатом с помощью маркировочного набора Eu3+ криптата в соответствии с инструкциями производителя (CisBio International, кат. №62 EUSPEA), и IL-1R1/Fc (SEQ ID NO: 134, см. «Материалы и методы») метили биотином с помощью EZ Link Sulfo-NHS-Biotin (Perbio, кат. №21335) в соответствии с инструкциями производителя. Условия анализа были следующими: 0,25 нМ меченого криптатом антитела, 0,3 нМ меченого биотином IL-1R1/Fc, 2,5 нМ стрептавидина XLent! (CisBio International, кат. №611 SAXLB) в 1 х Д-ФБР, 0,1% АТС, 0,4 М фторида калия в общем объеме 20 мкл на 384-луночном планшете для микроанализа Costar (3676). В лунки добавляли серии разведения (от максимального значения 100 нМ до 0,0017 нМ) исследуемых белков и инкубировали на протяжении 3 час при комнатной температуре. Сигнал FRET детектировали на планшет-ридере PerkinElmer EnVision с использование 320 нм фильтра возбуждения и 620 нм и 665 нм эмиссионных фильтров. Результаты рассчитывали на основе соотношения 665/620 как процент специфического связывания (сигнал с неконкурентным антигеном). Результаты анализировали с помощью Prism (GraphPad Software) с использованием сигмовидной модели дозозависимого эффекта.

5.2 Результаты

Антитело, связывающееся с химерными молекулами, тестировали в конкурентном анализе HTRF (гомогенная флуоресценция с временным разрешением). Молекулы, которые связывались с антителом при таком же паратопе, что и человеческий IL-1R1, ингибировали взаимодействие связывания, что вело к ослаблению сигнала. На основе кривых ингибирования рассчитаны значения IC50 для человеческого IL-1R1, человеческого IL-1R1 и химерных молекул (табл.12). Если молекула не полностью ингибировала связывание, то показан процент ингибирование при наивысшей концентрации. Химеры, которые давали подобные значения IC50 к природному человеческому IL-1R1, все еще содержали эпитоп. Химеры, которые не полностью ингибировали связывание IL-1R1 с антителом, или показывали повышение значения IC50, не содержали полного эпитопа. Эти данные делали возможной локализацию эпитопа антитела.

Таблица 12:
ICC50 (в нМ) химерных молекул IL-1R1, конкурирующих с человеческим IL-1R1 за связывание с антителом. Химеры, состоящие из аминокислотной последовательности человеческого (NP_000868) или мышиного (NP_032388) IL-1R1 тестировали на способность к конкуренции с человеческим IL-1R1 за связывание с антителом. Значения IC50 рассчитывали после получения полной кривой конкуренции. * Если химера неспособна к полному ингибированию связывания человеческого IL-1R1 с антителом, то показан процент ингибирования при наивысшей концентрации
Химера Последовательность от NP_000868 Последовательность от NP032388 IC50 (нМ) в конкурентном анализе
HulL-1R1 M1-K336 0,174
MoIL-1R1 M1-K338 66% ингибирование*
MoD1-D2 HuD3 IL1R1 M1-S17; I228-K336 L20-V230 53% ингибирование*
MoD2 HuD1
HuD3 IL1R1
M1-Y122; I228-K336 S126-V230 37% ингибирование*
MoD3 HuD1-D2 IL1R1 M1-V227 I231-K338 0,147
MoD2-D3 HuD1 IL1R1 M1-Y122 S126-K338 18% ингибирование*
MoD1b IL1R1 M1-R42; T54-K336 K45-D56 0,201
MoD2a IL1R1 M1-Y122; A135-K336 S126-I137 4,6
MoD2b IL1R1 M1-G139;L158-K336 D140-E160 0,583
Химера Последовательность от NP_000868 Последовательность от NP_032388 IC50 (нМ) в конкурентном анализе
MoD2c IL1R1 M1-V177; L181-K336 K181-K183 0,637
MoD2d IL1R1 MI-I213; I234-K336 T220-V230 0,204
MoD3a1 IL1R1 M1-V246; V278-K336 T254-P275 0,156
MoD3a2 IL1R1 M1-P272; S290-K336 F276-K292 0,268
MoD3b IL1R1 M1-P309; Y329-K336 F313-331 0,337

Связывание химерных человеческих/мышиных IL-1R1 химер сделало возможной локализацию человеческого эпитопа IL-1R1, связывающегося с антителом. Полные домен-замещенные химеры, локализовавшие эпитоп к D2 человеческому IL1R1 (остатки N123-V227), как все химеры, которые содержат мышиный D2 домен IL1R1 замещающий человеческий D2 IL1R1 (MoIL-1R1; MoD1-D2 HuD3 IL1R1; MoD2 HuD1 HuD3 IL1R1; MoD2-D3 HuD1) утратили способностью к полному ингибирования человеческого IL1R1, тогда как содержащие D2 человеческого IL1R1 (HuIL-1R1; MoD3 HuD1-D2) были способны к конкуренции с человеческим IL-1R1 (табл.12).

Человеческий IL-1R1 содержит 7 бета цепей и 4 петлевых участка, которые распространяются поперек трех участков, находящихся в непосредственной близости к 1L1β в кристаллической структуре [123]. Также человеческий IL1R1 содержит 3 бета цепи и 7 петлевых участков, которые находятся в непосредственной близости к IL1ra в кристаллической структуре (Schreuder et al., Nature 386:194-200, 1997). Химеры с заменой бета цепей или петель позволяют локализацию эпитопа человеческого IL-1R1 в основном компоненте домена 2, включающем бета цепь а2 (остатки N123-V134) и основных компонентах петли b2-с2 (остатки L140-K157) (Vigers et al., Nature 386:190-194, 1997) и петли d2-e2 (остатки K178-R180) (Schreuder et al., Nature 386:194-200, 1997), Химеры без человеческой бета цепи а2 дают в 26 более высокое значение IC50, чем человеческий IL1R1, связывающийся с антителом, и химеры без петли b2-с2 или d2-e2 дают в >3 раза более высокое значение IC50, чем человеческий IL-1R1 (табл.х). В соответствии с данными для доменных замен, бета цепь а2, петли b2-с2 и d2-e2 локализованы в домене 2 (Vigers et al., Nature 386:190-194, 1997).

Полученные данные показывают, что антитело связывается с аминокислотами в прерывающемся эпитопе из 33 аминокислот в трех участках человеческого IL-1R1; N123-V134, L140-K157 и K178-R180.

Биологические депозиты

Биологические депозиты в Е coli ТОР 10 были сделаны:

NCIMB Limited

Ferguson Building,

Craibstone Estate,

Bucksburn,

Aberdeen,

AB21 9YA.

Шотландия

Великобритания

В соответствии с Будапештским договором.

Указание депонированных штаммов Размер вектора (пар нуклеотидов) Размер вставки Дата депозита Номер доступа
Антитело 6 VHGL 28PL GL VH 2965 385 3 Ноября 2009 NCIMB41673
Антитело 6 VLGL 28PL GL VL 2921 341 3 Ноября 2009 NCIMB 41674
Антитело 9 VHGL 28Q1 GL VH 2968 388 3 Ноября 2009 NCIMB 41671
Антитело 9 VLGL 28Q1 GL VL 2927 347 3 Ноября 2009 NCIMB41672

Вышеуказанные депозиты представляют другие варианты изобретения.

Ссылки

Все ссылки, процитированные в данном описании, включая цитируемые выше, включены в данное описание путем ссылки в полном объеме и для всех целей.

1. Dinarello CA (2002) Clin Exp Rhematol 20 (5) S27, S1-S13

2. Dunn et al. (2001) Trends Immunol 22 (10) 533-6

3. Schmitz et al (2005) Immunity 23, 279-90

4. Patterson D et al (1993) Genomics 15 (1), 173-6

5. Steinkasserer A et al (1992) Genomics 13 (3), 654-7

6. Black RA et al (1988) J Biol Chem 263 (19), 9437-42

7. Niki Y et al (2004) J Immunol 172 (1) 577-84

8. Wessendorf JH et al (1993) J Biol Chem 268 (29) 22100-4

9. Carter DB et al (1990) Nature 344 (6267) 633-8

10. Eisenberg SP et al (1990) Nature 343 (6256) 341-6

11. Dewberry R et al (2000) Arterioscler Thromb Vase Biol 20 (11) 2394-400

12. Muzio M et al (1995) J Exp Med 182 (2) 623-8

13. Gabay С et al (1997) J Immunol 159 (12) 5905-13

14. Sims JE (2002) Current Opinion in Immunology 14, 117-122

15. Sims JE et al (1994) Clin Immunol Immunopathol 72 (1) 9-14

16. Colotta F et al (1994) Immunol Today 15 (12) 562-6

17. Vigers GP et al (1997) Nature 386 (6621) 190-4

18. Schreuder H et al (1997) Nature 386 (6621) 194-200

19. Boraschi D et al (1995) J Immunol 155 (10) 4719-25

20. Casadio R et al (2001) FEBS Lett 499 (1-2) 65-8

21. D′Ettorre C et al (1997) Eur Cyt Netw 8 (2) 161-71

22. Greenfeder SA et al (1995) J Biol Chem 270 (23) 13757-65

23. Hanmum et al (1990) Nature 343, 336-340

24. Lang D et al (1998) J Immunol 161 6871-77

25. Re et al (1996) J Exp Med 183, 1841-1850

26. Jiang Z et al (2002) Molecular and Cellular Biology 22 (20) 7158-7167

27. Osborn O et al (2008) Cytokine 44 (1); 141-8, 2008

28. Sauter et al (2008) Endocrinology 149:2208-2218

29. Larsen et al (2007) N Engl J Med 356:1517-1526

30. Wanderer (2008) Clinical Immunology 128:127-132

31. Ikonomidis et al (2008) Circulation 117:2662-2669

32. Dinarello CA (1996) Blood 87 (6) 2095-147

33. Mizel et al 1987 J Immunol 138, 2906-2912

34. Qwarnstrom et al 1988 J Biol Chem 263, 8261-8269

35. Dripps et al 1991 J Biol Chem 266, 10331-10336

36. Kabat, E.A. et al. Sequences of Proteins of Immunological Interest. 4th Edition. US Department of Health and Human Services. 1987

37. Altschul et al. (1990) J. Mol. Biol. 215:405-410

38. Pearson and Lipman (1988) PNAS USA 85:2444-2448

39. Smith and Waterman (1981) J. Mol Biol. 147:195-197

40. Voet & Voet, Biochemistry, 2nd Edition, (Wiley) 1995.

41. Gram et al., 1992, Proc. Natl. Acad. Sci., USA, 89:3576-3580

42. Barbas et al., 1994, Proc. Natl. Acad. Sci., USA, 91:3809-3813

43. Schier et al., 1996, J. Mol. Biol. 263:551-567

44. Holliger & Hudson (2005) Nature Biotechnology 23 (9):1126-1136

45. Ward, E.S. et al., Nature 341, 544-546 (1989)

46. McCafferty et al (1990) Nature, 348, 552-554

47. Holt et al (2003) Trends in Biotechnology 21, 484-490

48. Bird et al, Science, 242, 423-426, 1988

49. Huston et al, PNAS USA, 85, 5879-5883, 1988

50. Holliger, P. et al, Proc. Natl. Acad. Sci. USA 90 6444-6448, 1993

51. Reiter, Y. et al, Nature Biotech, 14, 1239-1245, 1996

52. Hu, S. et al, Cancer Res., 56, 3055-3061, 1996

53. Holliger and Bohlen 1999 Cancer and metastasis rev. 18:411-419

54. Holliger, P. and Winter G. Current Opinion Biotechnol 4, 446-449 1993

55. Glennie M J et al., 1987 J. Immunol. 139, 2367-2375

56. Repp R. et al., 1995 J. Hemat. 377-382

57. Staerz U.D. and Bevan M.J. 1986 PNAS 83

58. Suresh M.R. et al., 1986 Method Enzymol. 121:210-228

59. Merchand et al., 1998 Nature Biotech. 16:677-681

60. Ridgeway, J.B.B. et al, Protein Eng., 9, 616-621, 1996

61. Haan & Maggos (2004) BioCentury, 12 (5); A1-A6

62. Koide et al. (1998) Journal of Molecular Biology, 284:1141-1151.

63. Nygren et al. (1997) Current Opinion in Structural Biology, 7:463-469

64. Wess, L. In: BioCentury, The Bernstein Report on BioBusiness, 12 (42), A1-A7, 2004

65. Robinson, J.R. ed., Sustained and Controlled Release Drug Delivery Systems, Marcel Dekker, Inc., New York, 1978

66. Ledermann J.A. et al. (1991) Int. J. Cancer 47:659-664

67. Bagshawe K.D. et al. (1991) Antibody, Immunoconjugates and Radiopharmaceuticals 4:915-922

68. Hunter W.M. and Greenwood F.C. (1962) Nature 194:495

69. Plückthun, A. Bio/Technology 9:545-551 (1991)

70. Chadd HE and Chamow SM (2001) Current Opinion in Biotechnology 12:188-194

71. Andersen DC and Krummen L (2002) Current Opinion in Biotechnology 13:117

72. Larrick JW and Thomas DW (2001) Current Opinion in Biotechnology 12:411-418

73. Sambrook and Russell, Molecular Cloning: a Laboratory Manual: 3rd edition, 2001, Cold Spring Harbor Laboratory Press

74. Ausubel et al, eds., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, John Wiley & Sons, 4th edition 1999

75. Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y., pp.726, 1988

76. Köhler and Milstein, Nature, 256:495-497, 1975

77. Kontermann, R & Dubel, S, Antibody Engineering, Springer-Verlag New York, LLC; 2001, ISBN: 3540413545

78. Mendez, M. et al. (1997) Nature Genet, 15 (2):146-156

79. Knappik et al. J. Mol. Biol. (2000) 296, 57-86

80. Krebs et al. Journal of Immunological Methods 254 2001 67-84

81. Wold, et al. Multivariate data analysis in chemistry. Chemometrics - Mathematics and Statistics in Chemistry (Ed.: B.Kowalski), D.Reidel Publishing Company, Dordrecht, Holland, 1984 (ISBN 90-277-1846-6)

82. Norman et al. Applied Regression Analysis. Wiley-Interscience; 3rd edition (April 1998) ISBN: 0471170828

83. Kandel, Abraham & Backer, Eric. Computer-Assisted Reasoning in Cluster Analysis. Prentice Hall PTR, (May 11, 1995), ISBN: 0133418847

84. Krzanowski, Wojtek. Principles of Multivariate Analysis: A User′s Perspective (Oxford Statistical Science Series, No 22 (Paper)). Oxford University Press; (December 2000), ISBN: 0198507089

85. Witten, Ian H. & Frank, Eibe. Data Mining: Practical Machine Learning Tools and Techniques with Java Implementations. Morgan Kaufmann; (October 11, 1999), ISBN: 1558605525

86. Denison David G.T. (Editor), Christopher C. Holmes, Bani K. Mallick, Adrian F. M. Smith. Bayesian Methods for Nonlinear Classification and Regression (Wiley Series in Probability and Statistics). John Wiley & Sons; (July 2002), ISBN: 0471490369

87. Ghose, Arup К. & Viswanadhan, Vellarkad N.. Combinatorial Library Design and Evaluation Principles, Software, Tools, and Applications in Drug Discovery. ISBN: 0-8247-0487-8

88. Chothia C. et al. Journal Molecular Biology (1992) 227, 799-817

89. Al-Lazikani, et al. Journal Molecular Biology (1997) 273(4), 927-948

90. Chothia, et al. Science, 223, 755-758 (1986)

91. Whitelegg, N.R.u. and Rees, A.R (2000). Prot. Eng., 12, 815-824

92. Guex, N. and Peitsch, M.C. Electrophoresis (1997) 18, 2714-2723

93. Marks et al Bio/Technology, 1992, 10:779-783

94. Kay, В.К., Winter, J., and McCafferty, J. (1996) Phage Display of Peptides and Proteins: A Laboratory Manual, San Diego: Academic Press

95. Kabat, E.A. et al. (1991) Sequences of Proteins of Immunological Interest, 5th Edition. US Department of Health and Human Services, Public Service, NIH, Washington

96. Segal et al., PNAS, 71:4298-4302, 1974

97. Amit et al., Science, 233:747-753, 1986

98. Chothia et al., J. Mol. Biol., 196:901-917, 1987

99. Chothia et al., Nature. 342:877-883, 1989

100. Caton et al., J. Immunol., 144:1965-1968, 1990

101. Sharon et al., PNAS, 87:4814-4817, 1990

102. Sharon et al., J. Immunol., 144:4863-4869, 1990

103. Kabat et al., J. Immunol., 147:1709-1719, 1991

104. Vaughan, Т.J., et al. (1996). Nature Biotechnology 14, 309-314.

105. Hutchings, C. Generation of Naїve Human Antibody Libraries, in Antibody Engineering, R.Kontermann and S.Dubel, Editors. 2001, Springer Laboratory Manuals, Berlin, p.93

106. Vaughan, TJ. et al. Nature Biotechnology 14 (3):309-14, 1996

107. Hutchings, С.Generation of Naїve Human Antibody Libraries, in Antibody Engineering, R.Kontermann and S.Dubel, Editors. 2001, Springer Laboratory Manuals, Berlin, p.93

108. Thompson, J. et al. J Mol Biol. 256 (1):77-88, 1996

109. Osbourn, JK. et al. Immunotechnology, 2 (3):181-96, 1996

110. Bannister, D. et al. Biotechnology and Bioengineering. 94 (5):931-7, 2006.

111. Persic, L. et al. Gene. 187 (1):9-18, 1997

112. Mach et al. Anal. Biochem. 200 (1):20-26, 1992

113. Tomilinson I (1997) V base, The Database of human antibody genes. (http://vbase.mrc-cpe.cam.ac.uk)

114. Foote J and Winter G (1992) J Mol Biol 224 (2) 487-99

115. Clackson, T. and Lowman, H.B. Phage Display - A Practical Approach, 2004. Oxford University Press

116. Groves, M.A.T and Osbourn, J.K. (2005) Expert opin. Biol. Ther. 5 (1); 125-135

117. Groves, M. et al. (2006). Journal of Imm. Methods 313 (129-139)

118. Darling, R.J. and Brault P-A, 2004, Kinetic Exclusion Assay Technology: Characterization of Molecular Interactions. Assay and Drug Devlopment Technologies, Volume 2, no. 6, 647-657

119. Rathanaswami, P., Roalstad, S., Roskos, L, Qiaojuan, J.S., Lackie, S and Babcook, J., 2005, Demonstration of an in vivo generated sub-picomolar affinity fully human monoclonal antibody to interleukin-8. Biochemical and Biophysical Research Communications, 334, 1004-1013

120. Vigers et al., Nature 386:190-194, 1997

121. Schreuder et al., Nature 386:194-200, 1997

122. Mathis et al., Clin Chem 41:1391-1397, 1995

123. Vigers et al., Nature 386:190-194, 1997

1. Выделенное антитело, специфичное в отношении IL-1R1, включающее серию CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, где:
HCDR1 имеет аминокислотную последовательность SEQ.ID.NO:93;
HCDR2 имеет аминокислотную последовательность SEQ.ID.NO:94;
HCDR3 имеет аминокислотную последовательность SEQ.ID.NO:95;
LCDR1 имеет аминокислотную последовательность SEQ.ID.NO:98;
LCDR2 имеет аминокислотную последовательность SEQ.ID.NO:99;
LCDR3 имеет аминокислотную последовательность SEQ.ID.NO:100;
и где HCDR3 (SEQ ID NO 95) имеет одну или более аминокислотных замен, выбранных из группы, состоящей из:
остаток Kabat 100Е заменен Т;
остаток Kabat 100F заменен на V или L;
остаток Kabat 100G заменен на D;
остаток Kabat 100H заменен на А или Р;
остаток Kabat 100I заменен на А или Р;
остаток Kabat 101 заменен на V или G; и
остаток Kabat 102 заменен на D или V;
или LCDR3 (SEQ ID NO 100) имеет одну или более аминокислотных замен, выбранных из группы, состоящей из:
остаток Kabat 94 заменен на Η или А;
остаток Kabat 95 заменен на А;
остаток Kabat 95А заменен на Ε или R;
остаток Kabat95B заменен на Q или V; и
остаток Kabat 97 заменен на Η или L.

2. Выделенное антитело, специфичное в отношении IL-1R1, включающее серию CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, где:
HCDR1 имеет аминокислотную последовательность SEQ. ID. NO:103;
HCDR2 имеет аминокислотную последовательность SEQ.ID.NO:104;
HCDR3 имеет аминокислотную последовательность SEQ.ID.NO:105;
LCDR1 имеет аминокислотную последовательность SEQ.ID.NO:108;
LCDR2 имеет аминокислотную последовательность SEQ.ID.NO:109;
LCDR3 имеет аминокислотную последовательность SEQ.ID.NO:110,
и где HCDR3 (SEQ ID NO 105) имеет одну или более аминокислотных замен и/или делений, выбранных из группы, состоящей из:
остаток Kabat 100А заменен на А или Е;
остаток Kabat 100В заменен на Р, Q, или А;
остаток Kabat 100С заменен на Ρ, Y, S или L;
остаток Kabat 100D заменен на Р, G или А;
остаток Kabat 100Е заменен на L или V;
остаток Kabat 100F заменен на G, V или Р;
остаток Kabat 100G заменен на V;
остаток Kabat 100Н заменен на Y;
остаток Kabat 100I заменен на G или D;
остаток Kabat 100J заменен на А или удален;
остаток Kabat 101 заменен на F; и
остаток Kabat 102 заменен на V;
или где LCDR3 (SEQ ID NO 110) имеет одну или более аминокислотных замен, выбранных из группы, состоящей из:
остаток Kabat 94 заменен на А, V, D, Н, L или R;
остаток Kabat 95 заменен на G, R или А;
остаток Kabat 95А заменен на G, L, А, V или D;
остаток Kabat 95В заменен на Н, R, А или D;
остаток Kabat 96 заменен на Η, P или А; и
остаток Kabat 97 заменен на Η, V или Q.

3. Выделенное антитело по п. 1, где HCDR3 (SEQ ID NO 95) имеет одну или более аминокислотных замен, выбранных из группы, состоящей из:
остаток Kabat 100Е заменен Т;
остаток Kabat 100F заменен на V или L;
остаток Kabat 100G заменен на D;
остаток Kabat 100Н заменен на А или Р;
остаток Kabat 100I заменен на А или Р;
остаток Kabat 101 заменен на V или G; и
остаток Kabat 102 заменен на D или V;
и LCDR3 (SEQ ID NO 100) имеет одну или более аминокислотных замен, выбранных из группы, состоящей из:
остаток Kabat 94 заменен на Η или А;
остаток Kabat 95 заменен на А;
остаток Kabat 95А заменен на Ε или R;
остаток Kabat 95B заменен на Q или V; и
остаток Kabat 97 заменен на Η или L.

4. Выделенное антитело по п. 2, где HCDR3 (SEQ ID NO 105) имеет одну или более аминокислотных замен и/или делеций, выбранных из группы, состоящей из:
остаток Kabat 100А заменен на А или Е;
остаток Kabat 100В заменен на Р, Q, или А;
остаток Kabat 100С заменен на Ρ, Y, S или L;
остаток Kabat 100D заменен на Р, G или А;
остаток Kabat 100Е заменен на L или V;
остаток Kabat 100F заменен на G, V или Р;
остаток Kabat 100G заменен на V;
остаток Kabat 100Н заменен на Y;
остаток Kabat 100I заменен на G или D;
остаток Kabat 100J заменен на А или удален;.
остаток Kabat 101 заменен на F; и
остаток Kabat 102 заменен на V,
и где LCDR3 (SEQ ID NO 110) имеет одну или более аминокислотных замен, выбранных из группы, состоящей из:
остаток Kabat 94 заменен на А, V, D, Н, L или R;
остаток Kabat 95 заменен на G, R или А;
остаток Kabat 95А заменен на G, L, А, V или D;
остаток Kabat 95В заменен на Н, R, А или D;
остаток Kabat 96 заменен на Η, Ρ или А; и
остаток Kabat 97 заменен на Η, V или Q.

5. Выделенное антитело, специфичное в отношении IL-1R1, включающее серию CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, где
HCDR1 имеет аминокислотную последовательность SEQ.ID.NO:93;
HCDR2 имеет аминокислотную последовательность SEQ.ID.NO:94;
HCDR3 имеет аминокислотную последовательность SEQ.ID.NO:95;
LCDR1 имеет аминокислотную последовательность SEQ.ID.NO:98;
LCDR2 имеет аминокислотную последовательность SEQ.ID.NO:99;
LCDR3 имеет аминокислотную последовательность SEQ.ID.NO:100.

6. Выделенное антитело, специфичное в отношении IL-1R1, включающее серию CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, где
HCDR1 имеет аминокислотную последовательность SEQ.ID.NO:103;
HCDR2 имеет аминокислотную последовательность SEQ.ID.NO:104;
HCDR3 имеет аминокислотную последовательность SEQ.ID.NO:105;
LCDR1 имеет аминокислотную последовательность SEQ.ID.NO:108;
LCDR2 имеет аминокислотную последовательность SEQ.ID.NO:109;
LCDR3 имеет аминокислотную последовательность SEQ.ID.NO:110.

7. Выделенное антитело, специфичное в отношении IL-1R1, включающее серию CDR: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, где
HCDR1 имеет аминокислотную последовательность SEQ ID NO:63;
HCDR2 имеет аминокислотную последовательность SEQ.ID.NO:64;
HCDR3 имеет аминокислотную последовательность SEQ.ID.NO:65;
LCDR1 имеет аминокислотную последовательность SEQ.ID.NO:68;
LCDR2 имеет аминокислотную последовательность SEQ.ID.NO:69;
LCDR3 имеет аминокислотную последовательность SEQ.ID.NO:70.

8. Выделенное антитело, специфичное в отношении IL-1R1, содержащее VH домен, включающий аминокислотную последовательность SEQ.ID.NO:92, и VL домен, включающий аминокислотную последовательность SEQ.ID.NO:97.

9. Выделенное антитело, специфичное в отношении IL-1R1, содержащее VH домен, включающий аминокислотную последовательность SEQ.ID.NO:102, и VL домен, включающий аминокислотную последовательность SEQ.ID.NO:107.

10. Выделенное антитело, специфичное в отношении IL-1R1, содержащее VH домен, включающий аминокислотную последовательность SEQ.ID.NO:62, и VL домен, включающий аминокислотную последовательность SEQ.ID.NO:67.

11. Выделенное антитело, специфичное в отношении IL-1R1 по любому из пп. 1-10, которое связывается с эпитопом, содержащимся в 1-3 из следующих последовательностей I1-1R1:
(i) N123-V134;
(ii) L140-K157; и/или
(iii) K178-R180.

12. Выделенное антитело, специфичное в отношении IL-1R1, по п. 11, отличающееся тем, что связывается с прерывистым эпитопом, состоящим из следующих последовательностей I1-1R1:
(i) N123-V134;
(ii) L140-K157; и
(iii) K178-R180.

13. Выделенное антитело по любому из пп. 1-12, где антитело представляет собой моноклональное антитело.

14. Выделенное антитело по любому из пп. 1-13, где антитело дополнительно включает константный домен тяжелой цепи иммуноглобулина, выбранный из группы, состоящей из:
(a) константного домена IgM человека;
(b) константного домена IgG1 человека;
(c) константного домена IgG2 человека;
(d) константного домена IgG3 человека;
(e) константного домена IgG4 человека; и
(f) константного домена IgA человека.

15. Выделенное антитело по любому из пп. 1-13, где антитело дополнительно включает константный домен легкой цепи иммуноглобулина, выбранный из группы, состоящей из:
(a) константного домена Ig kappa человека; и
(b) константного домена Ig lambda человека.

16. Выделенная молекула нуклеиновой кислоты, кодирующая антитело по любому из пп. 1-15.

17. Клетка-хозяин, трансформированная молекулой нуклеиновой кислоты по п. 16, для применения для получения антитела по любому из пп. 1-15.

18. Способ получения антитела по любому из пп. 1-15, отличающийся тем, что включает культивирование клетки-хозяина по п. 17 в условиях продуцирования указанного антитела и выделение антитела, которое продуцируется клеткой.

19. Фармацевтическая композиция для применения в качестве лекарственного средства, содержащая антитело по любому из пп. 1-15 и фармацевтически приемлемое вспомогательное вещество.

20. Применение фармацевтической композиции по п. 19 для лечения расстройства, связанного с IL-1R1.

21. Применение по п. 20, где расстройство представляет собой одно или несколько заболеваний, выбранных из ревматоидного артрита, остеоартрита, астмы, хронического обструктивного заболевания легких, ВИЧ, солидной опухоли, лейкоза, синдром болезнь, диабет II типа, ишемическое заболевание и атеросклероз.



 

Похожие патенты:

Изобретение относится к области биотехнологии и может быть использовано для идентификации гетеромультимерных убиквитинов со способностью связываться с лигандом-антигеном.

Предложенное изобретение относится к иммунологии. Предложены варианты антител, нейтрализующих инфекцию субтипа группы 1 и субтипа группы 2 вируса гриппа А.

Изобретения касаются инфекционной молекулы нуклеиновой кислоты, кодирующей инфекционный вирус Torque teNO свиней (PTTV), которая содержит по меньшей мере одну копию геномной последовательности, выбранной из группы, состоящей из последовательностей, соответствующих генотипам или подтипам PTTV1a-VA, PTTV1b-VA, PTTV2b-VA и PTTV2c-VA, а также биологически функциональной плазмиды или вирусного вектора, содержащего такую инфекционную нуклеотидную геномную последовательность, и клетки-хозяина, содержащей такую плазмиду или вектор.

Изобретение относится к области биотехнологии, конкретно к лентивирусной доставке апоптина в опухолевые ткани, и может быть использовано в медицине. Способ включает получение лентивирусного конструкта, экспрессирующего модифицированный апоптин, слитый с секреторным сигналом лактотрансферрина и трансдукторным сигналом (ST-CTP-апоптин), с последующим получением рекомбинантных лентивирусных частиц, дефектных по репликации и несущих модифицированный апоптин, которые затем вводятся в Т-лимфоциты (TILs), полученные при хирургическом удалении опухоли или в процессе получения биопсии, которые обладают способностью проникать в опухолевые ткани.
Изобретение относится к области биотехнологии и генетической инженерии. Предложен способ получения по меньшей мере одной трансфицированной эукариотической клетки-хозяина, экспрессирующей целевой продукт, включающий введение в клетку полинуклеотида, кодирующего целевой продукт, и полинуклеотида, кодирующего мутантный фермент дигидрофолатредуктазу по крайней мере одним вектором экспрессии, получение множества эукариотических клеток-хозяев, жизнеспособность которых зависит от потребления фолата, причем указанные эукариотические клетки-хозяева включают по меньшей мере чужеродный полинуклеотид, кодирующий целевой продукт, и чужеродный полинуклеотид, кодирующий фермент дигидрофолатредуктазу (ДГФР), культивирование указанного множества эукариотических клеток-хозяев в селективной культуральной среде, включающей метотрексат в концентрации 2,3-500 нМ и фолиевую кислоту в концентрации 12,5-50 нМ, и отбор по меньшей мере одной эукариотической клетки-хозяина, экспрессирующей целевой продукт.

Настоящее изобретение относится к области иммунологии. Предложено полностью человеческое моноклональное антитело, которое связывает инсулиноподобный фактор роста-II (IGF-II) и имеет перекрестную реактивность к IGF-I, а также его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии. Предложено выделенное антитело к белку ICOS человека с повышенной эффекторной функцией.

Изобретение относится к биотехнологии и иммунологии. Предложены оптимизированные гены легкой и тяжелой цепей инфликсимаб - антитела против фактора некроза опухоли альфа (ФНО-альфа), а также клеточная линия ВКПМ-Н-131 и способ биосинтеза антитела.

Настоящее изобретение относится к биотехнологии и представляет собой антитела против фактора роста нервов (ФРН). Настоящее изобретение также раскрывает фармацевтическую композицию для облегчения боли, ассоциированной с заболеванием или состоянием, при котором развитие или сохранение боли опосредовано ФРН, содержащую указанные антитела, а также набор для лечения связанного с ФРН заболевания, такого как, например, остеоартрит, нуклеиновые кислоты, кодирующие тяжелую или легкую цепь антитела, вектор экспрессии, клетку-хозяина для получения указанных антител, способ экспрессии указанных антител против ФРН, а также применение указанных антител в способе лечения боли и для получения лекарственного средства для лечения боли, ассоциированной с заболеванием или состоянием, при котором развитие или сохранение боли опосредовано ФРН.

Настоящее изобретение относится к области иммунологии. Предложено антитело, способное связываться с амплифицированным рецептором эпидермального фактора роста (EGFR) и с усеченным вариантом EGFR - de2-7 EGFR, и охарактеризованное последовательностями вариабельных доменов.

Изобретение относится к области получения и выделения однодоменных молекул (SDAB). Описан способ выделения или очистки SDAB молекулы, которая представляет собой трехвалентную молекулу нанотела ATN-103, направленную на TNFα и HAS, из смеси, содержащей указанную SDAB молекулу и одно или более загрязняющих веществ.

Изобретение относится к биотехнологии. Представлено моноклональное антитело против интерлейкина-6 человека, содержащее гипервариабельные участки тяжелой цепи CDRH-1: GFSLSTSGMGVG; CDRH-2: HIWWDDDKYYNPSLKS; и CDRH-3: RANYGTSYDYGMDY; и гипервариабельные участки легкой цепи CDRL-1: KASQSVSDVLT; CDRL-2: YASNRYT; и CDRL-3: QQGYRSPYT.

Изобретение относится к биохимии. Описано гуманизированное моноклональное антитело против TNF и его применение.

Изобретение относится к области иммунологии и биотехнологии. Описаны гуманизированное антитело и его антигенсвязывающий фрагмент (Fab), которые селективно связывают человеческий ИФН-γ и содержат вариабельный участок тяжелой цепи (VH) и вариабельный участок легкой цепи (VL), где VH и VL имеют последовательности аминокислот соответственно SEQ ID NO:1 и 2, представленные в описании.

Настоящее изобретение относится к области биотехнологии, конкретно к антагонистам гранулоцитарно-макрофагального колониестимулирующего фактора (GM-CSF), и может быть использовано в медицине.

Настоящее изобретение относится к области иммунологии. Предложены: антитело, связывающееся с интерлейкином-17 (ИЛ-17), характеризующееся 6 CDR из лёгкой и тяжёлой цепи, а также кодирующая нуклеиновая кислота и вектор для экспрессии указанного антитела.

Изобретение относится к медицине, а именно к лечению нарушений, связанных с инсулинорезистентностью. Способ лечения включает введение эффективного количества антагониста IL-17A и/или IL-17F, где указанный антагонист представляет собой антитело или его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии. Предложено гуманизированное антитело против IFN-α человека, полученное на основе мышиного антитела АСО-1.

Изобретение относится области иммунологии и биотехнологии. Предложено однодоменное антитело (VHH), способное связывать цитокин фактор некроза опухолей (ФНО, TNF) человека, фрагмент ДНК, кодирующий антитело по изобретению, способ получения антитела по изобретению, а также способ выявления и определения уровня содержания ФНО человека в биологическом образце.

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα).

Изобретение относится к лечению мезотелиомы. Терапевтический агент для мезотелиомы, который содержит антитело к рецептору интерлейкина-6 (IL-6) в качестве его активного ингредиента, где мезотелиома является плевральной мезотелиомой, где плевральная мезотелиома является злокачественной плевральной мезотелиомой, где антителом к IL-6-рецептору является моноклональное антитело к IL-6-рецептору, где антителом к IL-6-рецептору является моноклональное антитело к IL-6-рецептору человека, где антителом к IL-6-рецептору является моноклональное антитело к IL-6-рецептору мыши, где антителом к IL-6-рецептору является рекомбинантное антитело, где моноклональным антителом к IL-6-рецептору человека является антитело РМ-1, где моноклональным антителом к IL-6-рецептору мыши является антитело MR 16-1, где антителом к IL-6-рецептору является химерное антитело, гуманизированное антитело или человеческое антитело, где антителом к IL-6-рецептору является химерное антитело, гуманизированное антитело или человеческое антитело, где гуманизированным антителом к IL-6-рецептору является гуманизированное антитело РМ-1, где гуманизированным антителом к IL-6-рецептору является гуманизированное антитело РМ-1.

Изобретение относится к области биотехнологии и иммунологии. Описаны различные варианты антител, специфические в отношении IL-1R1. Раскрытые антитела могут быть пригодны для лечения расстройств, опосредованных IL-1R1, включая ревматоидный артрит, астму, хроническое обструктивное заболевание легких. Предложенная группа изобретений может быть использована в медицине. 13 н. и 8 з.п.ф-лы, 14 ил., 12 табл., 5 пр.

Наверх