Набор синтетических олигонуклеотидов для детектирования количества копий гена бета-глюкуронидазы в трансгенных растениях

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для детектирования количества копий бета-глюкуронидазы в трансгенных растениях, включающему проведение полимеразной цепной реакции с помощью праймеров и разрушаемой пробы. Изобретение позволяет эффективно детектировать количество копий бета-глюкуронидазы в трансгенных растениях. 1 ил., 1 табл., 1 пр.

 

Изобретение относится к области молекулярной биологии и генной инженерии растений. Может быть использовано для выявления копийности рекомбинантного гена бета-глюкуронидазы в трансгенных растениях.

Для исследований в области генной инженерии растений, оптимизации методов трансформации и генетических конструкций часто используют репортерные гены, в том числе ген бета-глюкуронидазы [Jefferson R.A., Kavanagh T. A., and Bevan M.W. (1987) GUS fusions: beta-glucuronidase a sasensitive and versatile gene fusion marker, in higher plants // EMBOJ. 6(13): 3901-3907]. Ген бета-глюкуронидазы является удобным модельным объектом при конструировании и трансфекции в связи с простотой в визуализации трансгенных участков в ходе биохимической цветной реакции расщепления экспрессируемым продуктом субстрата - 5-бромо-4-хлоро-3-индолил-β-D-глюкуронида. В результате генетической модификации возможно добиться максимального количества копий рекомбинантной ДНК и увеличить экспрессию репортерного гена, который в последующем возможно заменить на целевой ген, не оптимизируя метод трансфекции и конструкцию заново.

Известно, что наиболее часто для определения копийности рекомбинантной конструкции в трансгенных растениях используют Саузерн-блот анализ [Southern Е.М. (1975) Detection of specific sequences among DNA fragments separated by gelelectrophoresis // J Mol Biol. 98 (3): 509-517]. Для выявления количества копий трансгена используют тотальную ДНК исследуемого образца, фрагментированную рестриктазами с высокочастотой встречаемости сайтов рестрикции. Фрагментированную ДНК разделяют в электрофорезном геле и переносят на нитроцеллюлозную мембрану с последующим осуществлением гибридизации радиоактивно (флюоресцентно) меченной пробой с известной последовательностью ДНК. После гибридизации избыток пробы отмывают с мембраны и визуализируют продукты гибридизации путем авторадиографии. Недостатками метода является трудоемкость, длительность, а также существует возможность ошибки, в случае если несколько копий рекомбинантной конструкции находятся между сайтами рестрикции, что во время визуализации мембраны может быть интерпретировано как одна копия.

Известно использование обратной дот-блот гибридизации для детектирования копий рекомбинантной ДНК [Patent US WO 1993009245 A1, 13.05.1993 Reverse dot blot hybridization using tandem head-to-tail monomers containing probes synthesized by staggered complementary primers]. Способ обнаружения присутствия или отсутствия последовательности нуклеиновой кислоты на основе связывания с полимерным субстратом, выбранных олигонуклеотидных зондов с комплементарными областями в последовательности нуклеиновой кислоты, которая должна быть обнаружена. Основным недостатком данного метода является невозможность определения количества копий встроенной ДНК, т.к. метод позволяет только определить присутствие или отсутствие гена.

Из известных решений наиболее близким является использование полимеразной цепной реакции в реальном времени для детектирования копий гена бета-глюкуронидазы [Chen G.Q. and Lin J. (2010) Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri //American Journal of Agricultural and Biological Sciences 5 (3): 415-421]. Для проведения полимеразной цепной реакции используют праймеры - короткие ДНК-затравки, между которыми происходит синтез определенной последовательности, где в качестве праймеров используют последовательности ДНК со следующим нуклеотидным составом:

5′ACAACGTCGTGACTGGGAAAA3′

5′TGTGCTGCAAGGCGATTAAG3′

В качестве флуоресцентного красителя используется SYBR® Green, по мере увеличения копий ампликонов усиливается уровень флюоресценции, для сравнения используется положительный контроль. Впоследствии в результате математического расчета выводятся данные о количестве копий гена в выделенной ДНК.

Основными недостатками данного метода является:

1. Производится расчет количества копий конструкции в «пробирке», что не позволяет оценить количество копий на геном;

2. Использование неспецифических красителей, таких как SYBR® Green (Life technolodies, США), возводит высокие требования к специфичности реакции - любая двуцепочечная ДНК, в том числе димеры праймеров, будет генерировать флуоресценцию, что повышает риск ошибки», кроме того возможно ингибирование реакции, соответственно эффективность детекции копий гена бета-глюкуронидазы ближайшего аналога D1 сильно зависит от условий ПЦР и качества ПЦР смеси. Кроме того, владелец торговой марки SYBR Green и ДНК-зонда TaqMan (Life technologies Inc.) в спецификации к красителю не указывает возможность его применения для диагностики количества копий генов [http://www.lifetechnologies.com/ru/ru/home/life-science/pcr/real-time-pcr/qpcr-education/taqman-assays-vs-sybr-green-dye-for-qpcr.html], таблица.

Задачей данного изобретения является подбор универсальных олигонуклеотидов, применимых для точного измерения количества копий репортерного гена бета-глюкуронидазы в исследуемых трансгенных растениях.

Поставленная задача решается посредством определения последовательности праймеров, а именно для детектирования количества копий гена бета-глюкуронидазы в трансгенных растений предложена пара олигонуклеотидов совместно с флуоресцентно меченным гибридизационным зондом следующего нуклеотидного состава:

primerGUS-f GATCGCGAAAACTGTGGAAT

primerGUS-r TAATGACTGACCGCATCGAA

probe GUS Q 5′ TATAGACTGACCGCATCGAA F 3′, где F - флуорофор, Q - гаситель.

Заявляемый набор синтетических олигонуклеотидов для детектирования копий гена бета-глюкуронидазы проверяют на различных видах трансгенных сосудистых растениях.

Ход работы с применением набора синтетических олигонуклеотидов для детектирования гена бета-глюкуронидазы трансгенных растений состоит из следующих шагов.

1) Растительный материал перед проведением ПЦР с помощью заявляемого набора проводится через процедуру пробоподготовки, например с использованием набора Diamont DNA kit (ООО «АБТ», Россия) в соответствии с инструкцией производителя; в ходе этой процедуры из растительного материала выделяется ДНК, которую, в свою очередь, используют для ПЦР.

2) В качестве стандарта используют агробактериальный вектор, содержащий ген бета-глюкуронидазы. Концентрации исследуемого образца и стандарта доводят до одинакового значения. Размер стандарта (пг) рассчитывают из количества пар оснований и их молекулярных масс. Размер генома образца исследуют с помощью проточной цитометрии (пг). Осуществляют десятикратные разведения (1х, 10х, 100х, 1000х, 10000х). В программном обеспечении прибора - амплификатора CFX96 (Bio-Rad, США) - виртуально обозначают лунки стандарта с условными разведениями 104, 103, 102, 10, 1.

3) Полимеразную цепную реакцию проводят на амплификаторе CFX96. Амплификация проводится по следующей программе:

1 цикл: 95°С - 180 сек, 39 циклов: 95°С - 10 сек, 60°С - 30 сек, 72°С - 30 сек; завершающая стадия: 72°С - 10 мин, охлаждение при 4°С.

Инкубационная смесь конечным объемом 25 мкл содержит: 16,5 мкл H2O; 2 мкл ДНК; 2,5 мкл 10Х буфер; по 1 мкл 10 мкМ каждого праймера; зонд 10 мкМ 0,5 мкл; 1 мкл 60 мМ dNTPs; 1 ед. Taq-полимеразы.

4) Продукты амплификации детектируются аналитической частью прибора. Достоверность данных ОЕФ полимеразной цепной реакции подтверждают данными калибровочной кривой ПЦР-РВ (Е, R^2, Уклон) (рис.1)

5) Расчет количества копий гена проводят из соотношения порядкового номера порогового цикла амплификации образца и стандарта.

Пример 1

Расчет количества копий бета-глюкуронидазы для трансгенного щавеля кислого (Rumex acetosa L.) трансформированного вектором pBIK102iGs.

Предварительно проводят ПЦР стандарта и ПЦР образца (каждый в отдельной пробирке):

Условия:

Разбавление 1/104

По калибровочному графику ПЦР стандарта получены следующие значения концентраций:

Концентрация стандарта в ПЦР смеси=0,02*106 пг

Концентрация образца в ПЦР смеси=0,02*106 пг

Размер генома стандарта=1,664*10-5 пг

Размер генома образца (C-value)=3,3 пг

ОЕФэксп (относительное разбавление)=0,563

Количество копий гена в пробирках:

для стандарта=0,02*106 пг/1,664*10-5 pg=0,012*1011 копий

для образца=0,563*0,012*1011/10000=0,0067*107 копий

Кол-во геномов щавеля в пробирке=0,02*107 пг/3,3 пг=0,006 геномов

Количество копий гена на геном щавеля=0,0067*107/0,006*106=1,1

Данные о количестве копий, подсчитанные предлагаемым методом и методом Саузерн-блот при анализе, различаются лишь на десятые доли и при округлении являются равными (Таблица 1). Набор для синтеза, детектирования и последующего расчета количества копий бета-глюкуронидазы в трансгенных растениях является более эффективным.

Исходя из учета требуемых усилий и времени для проведения Саузерн-блоттинга, заявленное изобретение является более эффективным. При условии использования различных подходов к генерации флуоресцентного сигнала применение флуоресцентного ДНК-зонда является более эффективным в связи с более высокой специфичностью и устойчивостью реакции. Кроме того, использование дополнительной разрушаемой пробы увеличивает чувствительность реакции и позволяет использовать для анализа следовые количества ДНК, тогда как для различного рода блоттингов необходима концентрация 5-10 мг/мл. Использование метода проточной цитометрии позволяет непосредственно перед экспериментом установить относительное содержание ДНК в растении, тем самым возможно производить расчеты индивидуально для каждого образца.

Набор синтетических олигонуклеотидов для детектирования количества копий бета-глюкуронидазы в трансгенных растениях, включающий проведение полимеразной цепной реакции с помощью праймеров и разрушаемой пробы, отличающийся тем, что используют набор синтетических олигонуклеотидов для детектирования копий гена бета-глюкуронидазы с праймерами и гибридизационным зондом в следующей последовательности:
primerGUS-f GATCGCGAAAACTGTGGAAT
primerGUS-r TAATGACTGACCGCATCGAA
probe 5' Q TATAGACTGACCGCATCGAA 3' F, где
F - флуорофор, Q - гаситель.



 

Похожие патенты:

Изобретения относятся к области биотехнологии и касаются олигонуклеотидных праймеров и способа выявления ДНК Mycobacterium avium с их использованием. Охарактеризованные олигонуклеотидные праймеры комплементарны специфичной области mig-гена Mycobacterium avium и имеют следующий нуклеотидный состав: 5'-CGT CAA AAG CGA ACT GCA-3' и 5'-ТАА ТТС GTT GCC CGA СТС-3'. Способ выявления ДНК Mycobacterium avium выключает выделение ДНК, проведение амплификации ДНК с использованием олигонуклеотидных праймеров, перенос продукта амплификации на гель с последующим детектированием результатов анализа на трансиллюминаторе.

Изобретение относится к области биотехнологии и может быть использовано для идентификации гетеромультимерных убиквитинов со способностью связываться с лигандом-антигеном.

Изобретение относится к биотехнологии, в частности к способу выделения микроРНК из биологических жидкостей, содержащих экзосомы. Способ включает последовательное центрифугирование, ультрафильтрацию и ультрацентрифугирование культуральной конденсированной среды.

Группа изобретений относится к многоканальным устройствам, модифицированным нанослоями анилинсодержащих полимеров. Предложен многоканальный наконечник для выделения нуклеиновых кислот, белков, пептидов и способ изготовления многоканального элемента, входящего в состав многоканального наконечника.

Группа изобретений относится к области биотехнологии, в частности к автоматическому устройству и способу очистки и выделения целевой нуклеиновой кислоты из биологического образца, причем устройство обеспечивает возможность предотвратить загрязнение выделенной целевой нуклеиновой кислоты от аэрозоля и которое может быть применено ко всем видам оборудования выделения и очистки нуклеиновых кислот из множества биологических образцов, использующего магнитный стержень или мультипипеточный блок, движущийся в двух или трех осевых направлениях.

Изобретение относится к области молекулярной биологии, биохимии и генетической инженерии. Предложен геном фага, фагмида и нитчатый фаг для использования в фаговом дисплее, система фагового дисплея, набор и фаговая библиотека для определения продукта экзогенного гена.

Изобретение относится к биотехнологии и представляет собой плазмиду pET40CmAP/MBL-T, определяющую синтез гибридного бифункционального полипептида CmAP/MBL-T со свойствами высокоактивной щелочной фосфатазы морской бактерии Cobetia marina (CmAP) и маннан-связывающего лектина С-типа дальневосточного трепанга Apostichopus japonicus (MBL-T).

Изобретение относится к области биотехнологии и касается способа прогнозирования длины тела человека в рамках русской популяции. Представленный способ основан на исследовании ДНК, в котором с помощью метода ПЦР и при использовании определенных праймеров проводят исследование участков генов амелогенина (AML), используя локусы генов секреторного рецептора гормона роста (GSHR), ко-репрессороподобного лигандзависимого ядерного рецептора (LCORL) и связывающего белка циклин-зависимых киназ (CABLES1) в образцах ДНК мужского пола и генов хейджхок-взаимодействующего белка (HHIP) и ядерного белка с цинковыми пальцами (JAZF1) в образцах ДНК женского пола.

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ селекции эукариотической клетки-хозяина, экспрессирующей желаемый уровень интересующего полипептида, включающий трансфекцию клеток гетерологичной нуклеиновой кислотой, содержащей по меньшей мере одну кассету, содержащую по меньшей мере первый полинуклеотид, кодирующий интересующий полипептид, стоп-кодон, расположенный по направлению экспрессии относительно первого полинуклеотида, второй полинуклеотид, расположенный по направлению экспрессии относительно стоп-кодона, кодирующий иммуноглобулиновый трансмембранный якорный домен, культивирование клеток-хозяев для экспрессии интересующего полипептида так, чтобы по меньшей мере часть рассматриваемого полипептида экспрессировалась в виде слитого полипептида, содержащего иммуноглобулиновый трансмембранный якорный домен, причем такой слитый полипептид экспонируется на поверхности указанной клетки-хозяине, селекцию клетки по наличию или количеству слитого полипептида, экспонируемого на клеточной поверхности.

Изобретение относится к области биохимии, в частности к cпособу получения препаративных количеств вирусного антигена - белка вируса скручивания листьев картофеля (ВСЛК, PLRV), в составе химерных вирусных частиц, имитирующих вирионы ВСЛК, включающий создание рекомбинантной ДНК, содержащей кДНК вируса просветления жилок турнепса (ВПЖТ, TVCV), принадлежащего к тобамовирусам, где кДНК ВПЖТ находится под контролем растительного промотора, на ее конце имеется терминатор транскрипции, а ген белка оболочки ВПЖТ заменен на ген мажорного белка оболочки ВСЛК, включающий создание агробактериального вектора (плазмиды) pCambia 1300, способного встраиваться в геном растения-хозяина и вызывать системную инфекцию, перенос созданной рекомбинантной ДНК в агробактериальный вектор pCambia, трансформацию растения-хозяина Nicotiana benthamian агробактериальным вектором pCambia, размножение химерного вируса, состоящего из РНК вируса, в растении-хозяине Nicotiana benthamian, выделение химерного вируса, содержащего кДНК вируса просветления жилок турнепса (ВПЖТ, TVCV), ген оболочки которого заменен на ген мажорного белка оболочки ВСЛК, из зараженных листьев растения-хозяина Nicotiana benthamian.

Изобретение относится к области биотехнологии. Предложен способ экстракции ДНК из клеток крови. Добавляют в образец магнитные частицы и ферромагнитные наносферы CoNiFe2O4 50 нм. Лизируют биологический материал. Промывают ДНК и снимают ДНК с носителя. Преимуществом заявленного способа является повышение количества ДНК в полученном образце. 3 ил., 1 пр.

Изобретение относится к области биотехнологии, конкретно к новым гетеромультимерным белкам, полученным из модифицированного убиквитина, и может быть использовано в медицине для лечения или диагностики заболеваний, ассоциированных с гиперпродукцией экстрадомена В фибронектина (ED-B). Белок включает два мономерных убиквитиновых звена, по-разному модифицированных путем замещений по меньшей мере 6 аминокислот в положениях 4, 6, 8, 62, 63, 64, 65 и 66 SEQ ID NO: 1. При этом в 1-м мономерном звене замещения включают: F4W, K6(Н,W или F), Q62N, Е64(K,R или Н), S65(L,F или W), Т66(S или Р), а во 2-м мономерном звене: K6(Т,N,S или Q), L8(Q,Т,N или S), Q62(W или F), K63(S,Т,N или Q), Е64(N, S, Т или Q), S65(F или W), Т66(Е или D). Изобретение позволяет получить модифицированный гетеродимерный белок убиквитина, способный связывать ED-B с высоким сродством. 20 н. и 8 з.п. ф-лы, 18 ил., 3 табл., 7 пр.

Изобретение относится к области генной инженерии и биотехнологии и представляет собой рекомбинантную плазмиду pET40CmAP/CGL, определяющую синтез гибридного бифункционального полипептида CmAP/CGL со свойствами высокоактивной щелочной фосфатазы морской бактерии Cobetia marina (СmАР) и галактозоспецифичного лектина мидии Crenomytilus grayanus (CGL). Плазмида включает NcoI/SalI - фрагмент плазмиды pET-40b(+) (Novagen) и фрагмент ДНК размером 2028 пар оснований, который является химерным геном, кодирующим структурные гены щелочной фосфатазы CmAP и галактозоспецифичного лектина CGL, соединенных между собой полинуклеотидом, кодирующим аминокислотную последовательность линкера (G4S)3EL и сайта энтерокиназы D4K. Предложен также рекомбинантный штамм E. coli Rosetta(DE3)/pET40CmAP/CGL, трансформированный указанной плазмидой, - продуцент гибридного бифункционального белка CmAP/CGL, включающего аминокислотные последовательности рекомбинантной щелочной фосфатазы CmAP и галактозоспецифичного лектина CGL. Предложен способ получения гибридного бифункционального белка CmAP/CGL. Изобретение позволяет получать высокоочищенный препарат гибридного белка CmAP/CGL со свойствами рекомбинантной высокоактивной щелочной фосфатазы CmAP и галактозоспецифичного лектина CGL и может быть использован для выявления различий в гликозилировании онкофетальных антигенов. 3 н.п. ф-лы, 2 ил., 3 пр.

Изобретение относится к области биохимии. Предложен способ выделения коротких РНК из биологических жидкостей. Способ включает обработку образца денатурирующим буферным раствором, сорбцию коротких РНК на стекловолоконном сорбенте в присутствии хаотроптного агента с последующей отмывкой сорбента от несвязавшихся биополимеров и химических реагентов и элюцией целевого продукта. Образец биологической жидкости подвергают двухстадийной денатурации, при этом на первой стадии к образцу добавляют два объема денатурирующего буферного раствора, а на второй стадии к полученной смеси добавляют два объема 96% этанола и равный объем хлороформа с последующим перемешиванием и отделением осадка центрифугированием. Отмывку сорбента от несвязавшихся биополимеров осуществляют дважды буферным раствором, а элюцию целевого продукта с сорбента осуществляют буферным раствором. Изобретение обеспечивает упрощение способа, сокращение его длительности и повышение выхода коротких РНК. 2 з.п. ф-лы, 3 табл., 4 пр.

Изобретение относится к области биотехнологии, конкретно к рекомбинантным вакцинам против Candida albicans, и может быть использовано в медицине. Вакцина для лечения или предупреждения кандидозной инфекции содержит выделенный полипептид с SEQ ID NO: 2 в эффективном количестве, который может быть слит с партнером слияния. Вакцина также может содержать адъювант. Изобретение позволяет повысить эффективность лечения или предупреждения кандидозной инфекции. 2 н. и 9 з.п. ф-лы, 6 ил., 1 табл., 2 пр.

Изобретение относится к области биотехнологии, генной инженерии и иммунологии. Предложены способы получения библиотек последовательностей ДНК, кодирующих гомологичные полипептиды, и к применению таких библиотек для идентификации естественно диверсифицированных полипептидных вариантов. Изобретение также относится к способам, подходящим для получения коллекций синтетических фрагментов антител, в которых один или несколько гипервариабельных участков (CDR) заменены коллекцией соответствующих CDR, полученных из природного источника. Изобретение также относится к способам, подходящим для диверсификации фрагмента полипептида путем вставки диверсифицированной последовательности синтетического или природного происхождения, не требующей модификации последовательности, кодирующей исходный полипептид. Предложенная группа изобретений может быть использована в медицине. 4 н. и 32 з.п. ф-лы, 30 ил., 19 пр.

Изобретение относится к области биотехнологии. Предложен способ подготовки культур сульфидогенных бактерий для выделения ДНК. В способе используют 15 мл культуральной жидкости. Центрифугируют культуральную жидкость при 1000 об/мин. Проводят трехкратную отмывку клеток фосфатно-солевым буфером в соотношении 10:1. Перемешивают в течение 10 секунд и центрифугируют при 1000 об/мин в течение 10 мин. Преимуществом изобретения является эффективность выделения ДНК и возможность быстрого и точного проведения последующего молекулярно-биологического анализа. 2 табл., 2 пр.

Изобретение относится к области биотехнологии и может быть использовано для хранения препаратов ДНК в жидком виде. Получают композицию, содержащую буферный раствор, включающий 0,5-4% N-лаурилсаркозина, 5-20 мМ ЭДТА, 30-200 мМ Трис (гидроксиметил) аминометана и воду - остальное. Варианты композиции могут содержать 0,04-0,4% NaN3 (азида натрия) вместо Трис либо совместно с ним. Полученные композиции применяют для пропитки пористых носителей для хранения и/или транспортировки ДНК-содержащих препаратов или ДНК. Изобретение обеспечивает стабильность ДНК биообразцов в широком диапазоне температур в течение длительных периодов времени. 4 н. и 15 з.п. ф-лы, 4 ил., 6 табл., 4 пр.

Изобретение относится к области биотехнологии. Предложен способ специфического выделения полного ДНК-содержимого бактериальных возбудителей инфекции. Нежизнеспособные клетки отделяют от жизнеспособных путем центрифугирования. Используют промывочный раствор, содержащий детергент и электролит. Проводят лизис жизнеспособных клеток. ДНК лизата связывают с матрицей, промывают и элюируют. Преимуществом изобретения являются высокие показатели измерительной технологии, высокий выход ДНК бактерий, чувствительность методики, быстрота выполнения способа. 3 з.п. ф-лы, 6 ил., 3 пр.

Изобретение относится к области биотехнологии и представляет собой способ получения по меньшей мере одного варианта протеазы с улучшенной моющей эффективностью в порошкообразной или жидкой детергентной композиции, имеющей pH между 5 и 12,0, в сравнении с исходной протеазой. Указанный способ предусматривает: a) определение оптимальных суммарных зарядов поверхности протеазы для моющей активности в порошкообразной или жидкой детергентной композиции, имеющей pH между 5 и 12,0, тестированием в указанной среде множества вариантов замещенных протеаз, имеющих изменение суммарного заряда поверхности молекулы, при этом оптимальные суммарные заряды поверхности протеаз представляют собой заряды -2, или -1, или +1, или +2 относительно исходной протеазы; b) модификацию по меньшей мере одного аминокислотного остатка в одном или нескольких положениях, имеющих доступную для растворителя поверхность, большую чем 50%, на поверхности указанной исходной протеазы для получения по меньшей мере одного варианта протеазы, имеющего более положительный или более отрицательный заряд поверхности в сравнении с исходной протеазой для того, чтобы варианты протеазы имели оптимальный суммарный заряд поверхности, как определено на стадии а); и c) оценку моющей эффективности по меньшей мере одного варианта белка со стадии b) для идентификации варианта белка, который проявляет улучшенную моющую эффективность в указанном представляющем интерес тесте по сравнению с исходным белком. Изобретение позволяет получать протеазы с улучшенной моющей эффективностью в порошкообразной или жидкой детергентной композиции, имеющей pH между 5 и 12,0, в сравнении с исходной протеазой. 18 з.п. ф-лы, 13 ил., 20 табл., 13 пр.

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для детектирования количества копий бета-глюкуронидазы в трансгенных растениях, включающему проведение полимеразной цепной реакции с помощью праймеров и разрушаемой пробы. Изобретение позволяет эффективно детектировать количество копий бета-глюкуронидазы в трансгенных растениях. 1 ил., 1 табл., 1 пр.

Наверх