Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями



Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями
Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями
Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями
Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями
Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями
Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями
Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена des и выявления мутаций, ассоциированных с десминовыми кардиомиопатиями

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2556832:

Федеральное государственное бюджетное учреждение "Федеральный Центр сердца, крови и Эндокринологии имени В.А. Алмазова" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями. Мутации выявляют путем определения полной нуклеотидной последовательности кодирующей части гена DES. Осуществляют амплификацию кодирующей части гена DES с помощью 7 пар синтетических олигонуклеотидов при одной температуре и времени отжига, с последующим секвенированием полученных продуктов амплификации с помощью одной пары универсальных праймеров. Предложенное изобретение позволяет чувствительно и специфично определять мутации гена DES, при этом сокращаются время реакции амплификации, количество манипуляций, время внесения реактивов для реакции секвенирования и снижается вероятность ошибки при постановке реакции. 2 з.п. ф-лы, 1 ил.

 

Настоящее изобретение относится к области медицины, в частности к кардиологии и молекулярной биологии, и может быть использовано для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями различной природы, для определения тактики ведения больных десминовой кардиомиопатией и оценки рисков развития заболевания при выявлении семейных десминовых кардиомиопатий.

Мутации кодирующей части гена DES являются причиной приблизительно 2% всех кардиомиопатий, до 70% десминовых кардиомиопатий имеют семейный характер. Ранняя диагностика таких состояний позволит подбирать своевременное и адекватное лечение.

Кардиомиопатии - хронические заболевания миокарда, сопровождающиеся нарушением функции сердца. Одним из генов, описанных в связи с развитием дилатационной кардиомиоптии, является ген десмина (DES). Десмин, белок цитоскелета, относится к группе промежуточных филаментов. Он экспрессируется во всех трех типах мышечной ткани - гладкой, сердечной и поперечно-полосатой скелетной, являясь основным представителем группы промежуточных филаментов в зрелых мышечных клетках. Фенотипическим проявлением мутаций гена DES может являться кардиомиопатия или дистальная миопатия, однако в ряде случаев встречается сочетанный фенотип [Goldfarb LG, Vicart Ρ, Goebel EH and Dalakas MC (2004) Desmin myopathy. Brain, Vol.127, Pages 723-734].

Мутации гена DES могут являться причиной развития дилатационной кардиомиопатии и обусловливают развитие заболевания приблизительно в 2% случаев [Taylor MR, Slavov D, Ku L, Di Lenarda A, Sinagra G, Carniel E, Haubold K, Boucek MM, Ferguson D, Graw SL, Zhu X, Cavanaugh J, Sucharov CC, Long CS, Bristow MR, Lavori P, Mestroni L (2007) Prevalence of desmin mutations in dilated cardiomyopathy. Circulation, Vol.115, No 10, Pages 1244- 1251; Kostareva A, Gudkova A, Sjoberg G, Kiselev I, Moiseeva O, Karelkina E, Goldfarb L, Schlyakhto E, Sejersen T. (2006) Desmin mutations in a St. Petersburg cohort of cardiomyopathies. Acta Myologica, Vol.25, No 3, Pages 109-115].

Выявление генетической детерминированности, своевременная диагностика и лечение асимптоматических пациентов с кардиомиопатиями - тяжелыми хроническими заболеваниями сердца, имеющими плохой прогноз и высокую летальность, - являются важными для улучшения прогноза заболевания и выживаемости больных.

Поскольку одним из проявлений кардиомиопатий, вызванных мутациями кодирующей части гена DES, является нарушение работы проводящей системы сердца и возникновение атриовентрикулярных блокад, своевременное выявление мутаций гена DES с помощью генетических методов исследования позволит своевременно определить тактику ведения больного и определить показания к постановке электрокардиостимулятора.

Десмин - цитоскелетный белок с молекулярной массой 53 кДа, относящийся к классу промежуточных филаментов и являющийся специфичным для мышечной ткани. Ген десмина (DES) располагается на длинном плече 2-й хромосомы (2q35). В 1996 году последовательность гена была расшифрована, а позже была доказана связь мутаций десмина с дистальной миопатией и кардиомиопатией. Ген состоит из 9 экзонов, которые расположены на участке 8363 пар оснований, и является высококонсервативным среди позвоночных. Десмин экспрессируется в поперечнополосатых и гладких мышцах, а также в миокарде.

К настоящему времени описано более 40 мутаций кодирующей части гена DES, большинство из которых локализованы в С-терминальной части белка, что соответствует 5-му и 6-му экзонам.

Выявление мутаций кодирующей части гена DES рекомендовано для использования в практическом здравоохранении у больных различными видами кардиомиопатий для определения генетической причины заболевания. Однако в настоящее время в рутинной практике медицинских лабораторий не проводится скрининг мутаций кодирующей части гена DES, поскольку все известные способы определения последовательности кодирующей части гена DES требуют больших затрат времени, включают большое количество манипуляций и приводят к большому количеству ошибок из-за сложности постановки реакций.

Из уровня техники известен способ определения последовательности кодирующей части гена DES, описанный в: Li D, Tapscoft Τ, Gonzalez О, Burch PE, Quiñones MA, Zoghbi WA, Hill R, Bachinski LL, Mann DL, Roberts R (1999) Desmin Mutation Responsible for Idiopathic Dilated Cardiomyopathy. Circulation; Vol.100, No 5, Pages 461-464. При осуществлении этого способа геномную ДНК выделяют из образцов крови пациентов, применяя стандартную методику выделения ДНК. На выделенной ДНК проводят амплификацию методом полимеразной цепной реакции (ПЦР) с использованием 7 пар синтетических нуклеотидов, называемых также праймерами, сконструированных для 9 экзонов гена десмина. Последовательности праймеров приведены ниже:

exon 1F, CTGATGTCAGGAGGGATACA;

exon 1R, AGAAGGCAGGTGGTGACAG;

exon 2-3F, CTTTATCACCCGCAACTGTC;

exon 2-3R, TATTCCCAGCCAGAGCCTC;

exon 4-5F, AGGCTCTGGCTGGGAATAG;

exon 4-5R, ATGGCCAAGGTCACAAAGTG;

exon 6F, TTTGGGCTGCTAGTGTCCTC;

exon 6R, ATCAGTAATCTCGAGCCTCC;

exon 7F, ATGGTCTCGATCTCCTGACC;

exon 7R, CCCTTTTCTTCCCTAGCTC;

exon 8F, GAAGTAACAAGCCTGTCTTG;

exon 8R, GATCTCTCTTGCCCACTAGC;

exon 9F, CGTCATCCTGCTAGCACATG;

exon 9R, CTGGCAGTCAAGACAACAGG.

ПНР проводят с использованием 200 нг геномной ДНК, в присутствии 20 ммоль/л Tris-HCl (рН 8,4), 50 ммоль/л KCl, 1,5 ммоль/л MgCl2, 50 мкмоль/л каждого деоксинуклеотидтрифосфата, 0,2 мкмоль/л прямого праймера, 0,2 мкмоль/л обратного праймера, 2,5 ед. Taq-полимеразы в конечном объеме 50 мкл. Для каждой пары праймеров подбирают свои условия ПЦР - время и температуру отжига. В результате ПЦР получают фрагменты ДНК размером 709, 385, 621, 361, 299, 329, и 859 пар оснований соответственно. Продукты ПЦР очищают с помощью стандартной методики. Очищенные продукты ПЦР секвенируют на генетическом анализаторе ABI 310 (Applied Biosystems) с помощью набора реагентов «Big Dye Terminator sequencing kit» компании Perkin-Elmer и указанных выше праймеров.

Однако этот способ очень трудоемкий и занимает много времени: из-за разной температуры и времени отжига, ПЦР для каждой пары праймеров нужно проводить отдельно. На стадии внесения реагентов в микропланшет для проведения секвенирования много времени уходит на проверку соответствия внесенных праймеров и продуктов амплификации. На этом этапе допускается основная масса ошибок, приводящих к необходимости проведения повторного определения последовательности кодирующей части гена DES. Эти особенности делают невозможным широкое применение упомянутого способа в рутинной лабораторной практике для скрининга мутаций кодирующей части гена DES.

Из уровня техники не выявлен прототип данного изобретения.

Техническим результатом, на достижение которого направлено изобретение, является сокращение времени, затрачиваемого в процессе амплификации, уменьшение количества манипуляций на стадии секвенирования, а также повышение точности и достоверности диагностики путем снижения вероятности ошибок при определении последовательности экзонов гена DES.

Уменьшение затраченного времени достигается в результате проведения амплификации всех экзонов гена DES одновременно при одной и той же температуре и времени отжига праймеров за счет использования предлагаемого набора праймеров с последовательностями Seq ID NO:1-14.

Дополнительно, уменьшение количества манипуляций и вследствие этого дополнительное уменьшение затраченного времени и снижение вероятности ошибок достигается в результате последующего секвенирования полученных продуктов амплификации с использования одной пары универсальных праймеров за счет присоединения к последовательностям Seq ID NO:1-14 с 5'-конца последовательности одного из упомянутой пары универсальных праймеров.

В частности, в качестве таких универсальных праймеров могут быть использованы прямой праймер pUC/M13(-21) Seq ID NO:15 и обратный праймер М13(-29) Seq ID NO:16.

В настоящем изобретении предлагается набор праймеров для определения последовательности экзонов гена DES, с использованием которого амплификацию всех экзонов можно проводить одновременно при одной температуре и времени отжига праймеров, а последующее секвенирование продуктов амплификации можно проводить с использованием одной пары универсальных праймеров.

Создание специфических праймеров для амплификации

Выбор специфических праймеров для амплификации интересующего фрагмента ДНК осуществляют способом, хорошо известным специалистам в данной области. Работа над созданием праймеров строится обычно следующим образом:

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей в целевом геноме выбирают уникальный участок, содержащий область интереса исследователя.

2) На основании выбранного участка генома с помощью специального программного обеспечения подбирают последовательность олигонуклеотидов, используемых для проведения ПНР, как правило, 2 праймера. Многие из таких программ находятся в свободном доступе, например, Primer3 (http://frodo.wi.mit.edu/), Primer designing tool (NCBI), PerlPrimer (http://perlprimer.sourceforge.net/).

3) Пары праймеров дополнительно проверяют на полиморфизмы целевой последовательности в области, комплементарной 3'-концевому участку праймера.

4) К последовательностям прямых праймеров с 5'-конца присоединяют последовательность одного из универсальных праймеров, а к последовательностям обратных праймеров с 5'-конца присоединяют последовательность другого универсального праймера, отличную от той, которая присоединена к прямым праймерам.

4) Праймеры синтезируют на заказ в специализированном сервисном центре, например НПК Синтол.

5) С помощью практических экспериментов доказывают пригодность подобранных последовательностей праймеров для конкретных целей.

Выбор праймеров, являющихся предметом настоящего изобретения, характеризуется тем, что праймеры подбирали таким образом, чтобы оптимальные температура и время отжига всех праймеров для экзонов гена DES была одинаковой.

Предлагаемый набор праймеров для амплификации экзонов гена DES характеризуется тем, что содержит

1) праймеры следующего нуклеотидного состава:

Экзон гена DES Праймер Последовательность Номер последовательности
1F1 Des1f1 GCTGATGTCAGGAGGGATAC Seq ID NO:1
1R1 Des1r1 GGTCATTGATCGTTGGTGCG Seq ID NO:2
1F2 Des1f2 ACGCCCTCCTCCTACGGCGC Seq ID NO:3
1R2 Des1f2 GAAGGCAGGAGGTGACAGCG Seq ID NO:4
2-3F Des2-3f CTGCCTCTACCCAGCACCA Seq ID NO:5
2-3R Des2-3r ATTCCCAGCCAGAGCCTCA Seq ID NO:6
4-5F Des4-5f AAGCCCAGTCATGCCCTACAG Seq ID NO:7
4-5R Des4-5r AGTGAGGGTGTGAACTGCAGACAG Seq ID NO:8
6F Des6f GCCTGCCAGCCCAAAGCTTTCTTTG Seq ID NO:9
6R Des6r TGAGGTAATCAGTAATCTCGAGCCTCC Seq ID NO:10
7F Des7f GGCCGATGGGAGGGTTCTTA Seq ID NO:11
7R Des7r AGTGCCCATGCTGGACTCCT Seq ID NO:12
8-9F Des8-9f GAAGAAGTAACAAGCCTGTCT Seq ID NO:13
8-9R Des8-9r TGTGATTTGGAGGACTGAGGC Seq ID NO:14

2) дополнительно, к последовательностям праймеров Seq ID NO:1, Seq ID NO:3, Seq ID NO:5, Seq ID NO:7, Seq ID NO:9, Seq ID NO:11, Seq ID NO:13, называемых «прямыми праймерами», с 5'-конца присоединена последовательность одного универсального праймера, например прямого праймера pUC/M13(-21) Seq ID NO: 15, а к последовательностям праймеров Seq ID NO:2, Seq ID NO:4, Seq ID NO:6, Seq ID NO:8, Seq ID NO:10, Seq ID NO:12, Seq ID NO:14, называемых «обратными праймерами», с 5'-конца присоединена последовательность другого универсального праймера, например обратного праймера М13(-29) Seq ID NO: 16.

Помимо предлагаемых праймеров, в реакционную смесь для амплификации входят следующие компоненты:

- смесь дезоксирибонуклеотидтрифосфатов четырех типов (dATP, dTTP, dGTP, dCTP);

- фермент Taq-полимераза;

- реакционный буфер: 100 ммоль Tris-HCl, рН 8,8 при 25°С, 500 ммоль KCl, 20 ммоль MgCl2.

Амплификация экзонов гена DES

Кодирующая часть гена DES длиной 2268 пар нуклеотидов состоит из 9 фрагментов, или экзонов. В случае небольших экзонов предлагаемый набор праймеров позволяет амплифицировать 2 целых экзона с находящимся между фрагментами некодирующим участком гена, или интроном. В случае больших экзонов, например экзона 1, амплификацию проводят в виде двух перекрывающихся фрагментов. Амплификацию проводят из расчета 7 реакций на один образец геномной ДНК по следующей схеме:

Номер
реакционной
смеси
Номер экзона Используемые пары праймеров
1 1 Des1f1, Des1r1
2 1 Des1f2, Des1r2
3 2-3 Des2-3f, Des2-3r
4 4-5 Des4-5f, Des4-5r
5 6 Des6f, Des6r
6 7 Des7f, Des7r
7 8-9 Des8-9f, Des8-9r

Реакцию амплификации проводят одновременно для всех реакционных смесей с использованием специализированного оборудования - амплификатора Veriti® Thermal Cycler, Applied Biosystems, США согласно следующему температурному режиму:

Температура Время Количество циклов
1 95°С 5 мин 1
2 95°С 45 с 30
3 60°С 30 с
4 72°С 30 с
5 72°С 11 мин 1

Секренирование экзонов гена DES

После окончания реакции амплификации полученные на первом этапе анализа продукты амплификации используют для постановки реакции секвенирования. В реакции секвенирования продуктов амплификации, полученных в результате первого этапа анализа, используют универсальные праймеры, например прямой праймер pUC/M13(-21) Seq ID NO: 15 и обратный праймер М13(-29) Seq ID NO:16. При этом праймеры смешивают с реакционным буфером перед работой, и таким образом исключают стадию внесения разных праймеров в лунки микропланшета, в которых будет проходить реакция секвенирования, это существенно снижает риск допустить ошибку во время внесения компонентов и уменьшает время внесения реактивов более чем в два раза.

Реакцию секвенирования проводят с применением набора меченых дидезоксирибонуклеотидтрифосфатов (BigDye Terminator Cycle Sequencing Kit, версия 3.0, Applied Biosystems, США) и специализированного оборудования - амплификатора Veriti® Thermal Cycler, Applied Biosystems, США, согласно следующему температурному режиму:

Температура Время Количество циклов
1 95°С 5 мин 1
2 95°С 45 с 30
3 60°С 30 с
4 72°С 30 с
5 72°С 11 мин 1

Электрофоретический анализ продуктов секвенирования производят на секвенаторе ABI PRISM 377, Applied Biosystems, США. Обработку полученных данных производят с помощью программы BioEdit или другого аналогичного программного обеспечения.

Изобретение иллюстрируется следующим графическим материалом.

На фиг.1 представлено графическое изображение результатов секвенирования, полученных при использовании заявляемых праймеров для амплификации и определения нуклеотидной последовательности 2 экзона гена DES. Обнаружена IVS3+1G→А мутация гена DES.

Заявляемый набор праймеров применяют следующим образом:

1) Получение биологического материала от пациента. В качестве образцов для проведения анализа могут быть использованы биоптаты тканей, кровь, соскобы буккального эпителия.

2) Выделение и очистка препаратов ДНК из исходных образцов. Способы выделения ДНК из биологического материала хорошо известны специалистам и, как правило, включают стадии лизиса клеток, выделения ДНК и ее очистки. Быстрое и качественное выделение ДНК можно проводить с использованием коммерчески доступных наборов реагентов, например «Flexi Gene DNA kit» (не являются предметом данного патента).

3) Амплификация полученных препаратов геномной ДНК с применением предлагаемого набора праймеров, специфичных к экзонам гена DES, 7 реакций при одинаковых условиях, 1 загрузка амплификатора. Электрофоретическое разделение и последующая очистка продуктов амплификации.

4) Секвенирование продуктов амплификации, полученных в п.3 с применением пары коммерчески доступных универсальных праймеров, 7 реакций. Очистка продуктов реакции секвенирования и последующий капиллярный электрофорез.

5) Анализ результатов реакции секвенирования с использованием специализированного программного обеспечения, например BioEdit.

1. Набор синтетических олигонуклеотидов для определения нуклеотидной последовательности кодирующей части гена DES и выявления мутаций, ассоциированных с кардиомиопатиями, включающий праймеры следующей нуклеотидной последовательности:

GCTGATGTCAGGAGGGATAC Seq ID NO:1
GGTCATTGATCGTTGGTGCG Seq ID NO:2
ACGCCCTCCTCCTACGGCGC Seq ID NO:3
GAAGGCAGGAGGTGACAGCG Seq ID NO:4
CTGCCTCTACCCAGCAGCCA Seq ID NO:5
ATTCCCAGCCAGAGCCTCA Seq ID NO:6
AAGCCCAGTCATGCCCTACAG Seq ID NO:7
AGTGAGGGTGTGAACTGCAGACAG Seq ID NO:8
GCCTGCCAGCCCAAAGCTTTCTTTG Seq ID NO:9
TGAGGTAATCAGTAATCTCGAGCCTCC Seq ID NO:10
GGCCGATGGGAGGGTTCTTA Seq ID NO:11
AGTGCCCATGCTGGACTCCT Seq ID NO:12
GAAGAAGTAACAAGCCTGTCT Seq ID NO:13
TGTGATTTGGAGGACTGAGGC Seq ID NO:14,

необязательно соединенные с универсальными праймерами.

2. Набор синтетических нуклеотидов по п.1, в котором к последовательностям Seq ID NO:1, Seq ID NO:3, Seq ID NO:5, Seq ID NO:7, Seq ID NO:9, Seq ID N0:11, Seq ID NO:13 с 5'-конца присоединена последовательность первого универсального праймера, а к последовательностям Seq ID NO:2, Seq ID NO:4, Seq ID NO:6, Seq ID NO:8, Seq ID NO:10, Seq ID NO:12, Seq ID NO:14 с 5'-конца присоединена последовательность второго универсального праймера, при этом в качестве первого и второго универсального праймера используют разные универсальные праймеры.

3. Набор синтетических нуклеотидов по п.2, в котором в качестве одного из первого или второго универсальных праймеров используют прямой праймер pUC/M13(-21) Seq ID NO:15, а в качестве другого универсального праймера используют обратный праймер М13(-29) Seq ID NO:16.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к ингибиторам сигнального пути AXL, и может быть использовано в медицине. Получают растворимый вариант полипептида AXL без трансмембранного домена AXL, который содержит по меньшей мере одну модификацию аминокислоты в положении номер n, где n выбран из 32, 72, 87, 92 или 127 или их сочетание, где n+7 соответствует нумерации SEQ ID NO: 1 - последовательности AXL дикого типа, в котором указанная модификация повышает сродство связывания полипептида AXL со специфически задерживающим рост белком 6 (GAS6), которое, по меньшей мере, примерно в 2 раза сильнее, чем сродство полипептида AXL дикого типа.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia pseudomallei и дифференциации от возбудителя сапа методом полимеразной цепной реакции с флуоресцентной детекцией.

Изобретение относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения полиморфизма гена GP6 человека, кодирующего гликопротеин VI, по полиморфной позиции rs 1613662, основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами.

Изобретение относится к области биотехнологии, конкретно к интернализации терапевтических молекул внутрь клетки, и может быть использовано в медицине. Получают композицию для доставки молекул нуклеиновых кислот в клетки, содержащую по меньшей мере один пептид с по меньшей мере 92% идентичностью к GAAEAAARVYDLGLRRLRQRRRLRRERVRA (SEQ ID NO: 2); IREIMEKFGKQPVSLPARRLKLRGRKRRQR (SEQ ID NO: 3); или YLKVVRKHHRVIAGQFFGHHHTDSFRMLYD (SEQ ID NO: 4), присоединенный к одной или нескольким молекулам нуклеиновых кислот.

Изобретение относится к биотехнологии, а именно к способу анализа пригодности РНК, экстрагированной из ткани или клетки (клеток), фиксированных с помощью фиксатора, для анализа экспрессии генов.

Группа изобретений относится к области лизиса клеток. Предложен способ избирательного лизиса животных клеток, а также прибор для обнаружения микроорганизмов.

Изобретения относятся к области медицинской микробиологии и касаются способа дифференциации токсигенных генетически измененных штаммов V.cholerae биовара Эль Тор и тест-системы.

Изобретение относится к области биохимии, в частности к способу выявления мутаций в гене MYO7A, сопровождающихся развитием несиндромальной аутосомно-рецессивной глухоты или синдрома Ушера.
Изобретение относится к области биотехнологии и касается специфических олигонуклеотидных праймеров. Представленные праймеры включают сайты эндонуклеазного расщепления, фланкирующие участки генома, кодирующие гликопротеины Gn и Gc, а также нуклеопротеин N, для получения библиотеки генов, кодирующих гликопротеины Gn и Gc и нуклеопротеин N вируса лихорадки долины Рифт.

Изобретения относятся к области биотехнологии и касаются олигонуклеотидных праймеров и способа выявления ДНК Mycobacterium avium с их использованием. Охарактеризованные олигонуклеотидные праймеры комплементарны специфичной области mig-гена Mycobacterium avium и имеют следующий нуклеотидный состав: 5'-CGT CAA AAG CGA ACT GCA-3' и 5'-ТАА ТТС GTT GCC CGA СТС-3'. Способ выявления ДНК Mycobacterium avium выключает выделение ДНК, проведение амплификации ДНК с использованием олигонуклеотидных праймеров, перенос продукта амплификации на гель с последующим детектированием результатов анализа на трансиллюминаторе.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного.

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа.

Изобретение относится к олигопептидам, содержащим последовательность NLSSAEVVV (SEQ ID NO:6), в которой одна или две аминокислоты могут быть замещены, имеющим индуцибельность цитотоксических Т-клеток, их фармацевтическим композициям и применению для изготовления противораковых вакцин.

Изобретение относится к биотехнологии и предоставляет собой способ получения полезных метаболитов с использованием бактерии семейства Enterobacteriaceae, в частности бактерии, принадлежащей к роду Escherichia, которая модифицирована таким образом, что она содержит генетическую экспрессионную систему, включающую транскрипционный аппарат, регулируемый белком типа LysR, и модифицированную таким образом, что самоиндуцируемая положительная регуляция по типу обратной связи указанной системы опосредована коиндуктором.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242).

Изобретение относится к биохимии. Изобретение обеспечивает способ одновременной (мультиплексной) амплификации и флуоресцентного маркирования ДНК нескольких сегментов генома микобактерий туберкулезного комплекса (Mycobacterium tuberculosis, M.

Группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии. Представлена рекомбинантная плазмида pCFP10-DBD, состоящая из искусственного бактериального оперона химерного белка, включающего промоторную область раннего промотора бактериофага Т5, ген химерного белка, состоящий из последовательности белкового антигена CFP10 из Mycobacterium tuberculosis, слитой с последовательностью декстрансвязывающего домена (DBD) декстрансукразы Leuconostoc citreum KM20, и терминатор транскрипции, бактериального оперона бета-лактамазы и бактериального участка инициации репликации типа ColE1.

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз.

Изобретение относится к области биотехнологии, конкретно к созданию конъюгатов магнитная частица - нуклеиновая кислота, и может быть использовано для молекулярно-генетической диагностики.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного.
Наверх