Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)



Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)
Система анализа для обнаружения близкородственных серотипов вируса папилломы человека (впч)

 


Владельцы патента RU 2558236:

Бектон, Дикинсон энд Кампани (US)

Изобретение относится к биохимии. Описан способ обнаружения присутствия или отсутствия нескольких серотипов вируса папилломы человека (ВПЧ) в биологическом образце с помощью многоканальной системы анализа, где указанная система анализа обнаруживает большее количество серотипов, чем существует каналов обнаружения. Особенностью способа является то, что используются первый и второй наборы праймеров и зондов, являющихся вырожденными по отношению друг к другу. А также то, что каждый вырожденный зонд имеет сигнальную группировку, каждая из которых излучает сигнал, обнаружимый на одном и том же канале. При этом третий набор праймеров и зондов не является вырожденным по отношению к двум другим наборам праймеров и зондов и является отличительным для третьего серотипа, не относящегося к серотипам, к которым преимущественно происходит отжиг вырожденных наборов праймеров и зондов и где третий набор праймеров и зондов имеет сигнальную группировку, которая излучает сигнал при длине волны, которая является такой же или отличается от длины волны, излучаемой сигнальной группировкой вырожденных зондов. Представлены соответствующие праймеры и зонды. Изобретение позволяет обнаруживать большее количество типов ВПЧ, чем существует каналов детекции в системе анализа. 3 н. и 8 з.п. ф-лы, 3 ил., 6 табл.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Данная заявка испрашивает приоритет по дате подачи предварительной заявки на патент США 61/304941, поданной 16 февраля 2010, описание которой полностью включено в данную заявку посредством ссылки.

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

[0002] Настоящая заявка содержит перечень последовательностей, который был подан с помощью электронной системы подачи через Интернет EFS-Web, и полностью включен в данную заявку посредством ссылки. Указанная копия в формате кодировки ASCII, созданная 31 января 2011, называется "Перечень последовательностей для обнаружения родственных серотипов ВПЧ" и имеет размер 7,55 килобайт.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

[0003] Идентифицировано более 80 типов вирусов папилломы человека (ВПЧ или HPV - human papillomavirus). Различные типы ВПЧ вызывают широкое разнообразие биологических фенотипов, от доброкачественных пролиферативных бородавок до злокачественных карцином (в качестве обзора см. McMurray et al., Int. J. Exp, Pathol. 82(1):15-33 (2001)). ВПЧ 6 и ВПЧ 11 являются типами, чаще всего ассоциированными с доброкачественными бородавками, тогда как ВПЧ 16 и ВПЧ 18 являются типами высокого риска, чаще всего ассоциированными со злокачественными образованиями. Определение конкретного типа ВПЧ в клиническом образце, таким образом, принципиально для предсказания риска развития ВПЧ-ассоциированного заболевания.

[0004] До настоящего времени для идентификации и количественного определения специфичных типов ВПЧ в клинических образцах использовали несколько способов, основанных на использовании нуклеиновых кислот, как, например, обнаружение вирусной нуклеиновой кислоты путем гибридизации in situ, анализа с помощью Норзерн-блоттинга, гибридной ловушки (hybrid capture) или полимеразной цепной реакции (ПЦР). В анализе Hybrid Capture® II (Qiagen, Inc., Valencia, CA) используют улавливание с помощью антитела и нерадиоактивное обнаружение сигнала, но при этом обнаруживают только одну мишень из заданного набора типов ВПЧ (см., например, Clavel et al., British J. Cancer 80 (9):1306-11 (1999)). Кроме того, поскольку в анализе Hybrid Capture® II используют смесь РНК зондов (смеси зондов доступны для типов ВПЧ высокого риска или низкого риска), он не дает информации о конкретном типе ВПЧ, обнаруженном в образце, но является только положительным или отрицательным в отношении присутствия ВПЧ высокого риска или низкого риска. Подобным образом, многие способы, основанные на ПЦР, часто включают амплификацию единственной конкретной последовательности-мишени ВПЧ с последующим блоттингом полученного в результате ампликона на мембрану и гибридизацией с радиоактивно меченым олигонуклеотидным зондом.

[0005] В других способах используют высокую гомологию между специфичными генами ВПЧ различных типов, применяя имеющиеся в продаже консенсусные праймеры, способные к ПЦР-амплификации многочисленных типов ВПЧ, присутствующих в образце. Затем присутствие конкретного типа ВПЧ идентифицируют, используя типоспецифический олигонуклеотидный зонд. См., например, Kleter et al., Journal of Clinical Microbiology 37(8):2508-2517 (1999); Gravitt et al., Journal of Clinical Microbiology 38(1):357-361 (2000). Подобным образом, системы анализа, в которых используют вырожденные праймеры для ПЦР, имеют преимущество, заключающееся том, что гомология между типами ВПЧ дает возможность обнаруживать большее количество типов ВПЧ, чем в случае способов, в которых используют специфичные наборы праймеров. См., например, Harwood et al., Journal of Clinical Microbiology 37(11):3545-3555 (1999). Такие системы анализа также требуют проведения дополнительных экспериментов для идентификации конкретных типов ВПЧ.

[0006] Вышеописанные способы ПЦР могут быть связаны с несколькими проблемами. Например, различия в эффективности реакций у разных типов ВПЧ могут привести в результате к непропорциональной амплификации нескольких типов относительно других. Кроме того, равновесие амплификации будет сдвинуто в направлении нескольких типов, которые присутствуют в образце в большем количестве копий, потребляющих компоненты реакции ПЦР, что таким образом делает амплификацию минорных типов ВПЧ менее вероятной.

[0007] В уровне техники также описан 5' экзонуклеазный флуорогенный анализ на основе ПЦР (ПЦР Taq-Man), который дает возможность обнаружения продуктов ПЦР в реальном времени и устраняет необходимость в радиоактивности. См., например, патент США №5538848; Holland et al, Proc. Natl. Acad. Sci. USA 88:7276-7280 (1991). В данном способе используют меченый зонд, содержащий флуоресцентный репортер (флуорофор) и гаситель, который гибридизуется с ДНК-мишенью между праймерами ПЦР. Возбуждение флуорофора приводит в результате к высвобождению флуорофором флуоресцентного сигнала, который гасится гасителем. Ампликоны можно обнаружить с помощью 5'-3' экзонуклеазной активности Taq ДНК полимеразы, которая расщепляет двунитевую ДНК, с которой она контактирует во время удлинения ПЦР-праймера, высвобождая, таким образом, флуорофор из зонда. После этого флуоресцентный сигнал больше не гасится, и аккумуляцию флуоресцентного сигнала, которая непосредственно коррелирует с количеством ДНК-мишени, можно обнаружить в реальном времени автоматическим флуориметром.

[0008] Системы ПЦР-анализа Taq-Man адаптированы для детекции типов ВПЧ. В статье Swan et al. (Journal of Clinical Microbiology 35(4):886-891 (1997)) раскрыта система анализа, включающая флуорогенные зонды, в которой используют типоспецифические праймеры к ВПЧ, которые амплифицируют часть гена L1, в сочетании с типоспецифическими зондами. В системе анализа согласно Swan et al. измеряют флуоресцентный сигнал в конце фиксированного количества циклов ПЦР (конечное считывание), а не в реальном времени.

[0009] В статье Josefsson et al. (Journal of Clinical Microbiology 37(3):490-96 (1999)) описана система анализа Taq-Man, которая направлена на высококонсервативную часть гена Е1 в сочетании с типоспецифическими зондами, меченными различными флуоресцентными красителями. Ряд типов ВПЧ был амплифицирован с использованием смеси специфичных и вырожденных праймеров. Josefsson et al. использовали вплоть до трех типоспецифических зондов на анализ, которые были сконструированы таким образом, чтобы обнаруживать части гена Е1 из различных типов ВПЧ. В отличие от системы анализа согласно Swan et al., Josefsson et al. измеряли аккумуляцию флуоресценции в реальном времени.

[0010] В статье Tucker et al. (Molecular Diagnosis 6(1):39-47 (2001)) описана система анализа, которая направлена на консервативный участок, охватывающий связку Е6/Е7. Как и в системе анализа согласно Josefsson, Tucker et al. использовали обнаружение в реальном времени и типоспецифические флуоресцентные зонды. Tucker et al. также использовали многоканальную ПЦР, чтобы одновременно обнаруживать последовательности-мишени ВПЧ и либо актиновый, либо глобиновый клеточный локус в одной и той же реакционной пробирке.

[0011] Одна из особенных проблем при обнаружении ВПЧ состоит в том, что существует много типов ВПЧ, представляющих клинический интерес. Хотя многоканальные системы анализа для обнаружения ВПЧ известны, эти многоканальные системы анализа ограничены количеством колориметрических каналов детекции. Этими каналами являются различные длины волн света (или диапазоны или полосы длин волн). Каждый канал выявляет сигнал, излучаемый сигнальной группировкой, которая излучает свет в определенном интервале длины волны. Количество типов ВПЧ, которые можно обнаруживать, следовательно, ограничено количеством различных сигнальных группировок в системе анализа, которые возможно определять по отдельности.

[0012] Несмотря на разработку вышеописанных систем анализа ВПЧ, было бы предпочтительно разработать многоканальную систему анализа, которая обладает высокой чувствительностью и воспроизводимостью, и которая требует меньших трудозатрат в человеко-часах по сравнению со способами, раскрытыми в уровне техники. С учетом множества типов ВПЧ было бы полезно обнаруживать большее количество типов ВПЧ, чем существует каналов детекции в системе анализа.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

[0013] Настоящее изобретение направлено на ПЦР-амплификацию в реальном времени, в которой задействованы химические принципы системы Taq-Man, для того, чтобы одновременно обнаруживать большее количество типов ВПЧ, чем существует каналов детекции. Иными словами, в анализе, где количество каналов составляет N, количество обнаруживаемых типов ВПЧ составляет по меньшей мере N+1.

[0014] В данной системе анализа задействован набор праймеров/зондов для обнаружения каждого типа ВПЧ, для обнаружения которого сконструирована эта система анализа. Различные серотипы, которые можно успешно обнаруживать с помощью этого анализа, включают, например, ВПЧ типов 33, 39, 51, 56, 58, 59, 66 и 68. Специалисту в данной области техники понятно, что описанные в данной заявке наборы зондов/праймеров можно комбинировать с другими наборами праймеров/зондов для других типов ВПЧ (например, 16, 18 и 45). По меньшей мере один тип обнаруживают, используя единственный набор праймеров/зондов. В контексте ПЦР-амплификации с использованием системы анализа Taq-Man набор праймеров/зондов представляет собой по меньшей мере прямой праймер, обратный праймер и зонд. По меньшей мере два типа выбирают с помощью наборов праймеров/зондов с олигонуклеотидными последовательностями, которые являются вырожденными по отношению друг к другу. "Вырожденные последовательности", как это понятие используют в данной заявке, представляют собой два олигонуклеотидных праймера или зонда, которые являются комплементарными одному и тому же локусу одного и того же гена различных близкородственных типов и которые имеют минорные вариации последовательности по отношению к друг к другу, позволяющие различить два типа.

[0015] В одном воплощении настоящего изобретения вырожденные наборы праймеров/зондов предназначены для обнаружения ВПЧ типов 39 и 68. Мишенью этого набора праймеров/зондов является один и тот же локус гена Е6 обоих типов. Длина мишени составляет 91 нуклеотид, и она проиллюстрирована на Фиг.1. Мишень представляет собой только сегмент полноразмерного гена Е6. Мишень для вырожденного набора праймеров/зондов для ВПЧ типов 39 и 68 представляет собой SEQ ID NO. 36. В предпочтительном воплощении сигнальные группировки для обоих зондов представляют собой цианиновую метку, имеющуюся в продаже под наименованием CY5.

[0016] В данном воплощении набор праймеров и зондов, который не является вырожденным, является отличительным для ВПЧ типа 51. Мишень этого набора праймеров/зондов для типа 51 также находится в гене Е6, но в другом локусе. В предпочтительном воплощении сигнальные группировки для данного зонда в данном наборе праймеров и зондов представляют собой метку FAM, которая конкретно идентифицирована ниже.

[0017] Во втором воплощении настоящего изобретения вырожденные наборы праймеров/зондов предназначены для обнаружения типов ВПЧ 33 и 58. Мишенью этого набора праймеров/зондов является один и тот же локус гена Е6 обоих типов. Длина мишени составляет 138 нуклеотидов, и она проиллюстрирована на Фиг.2. Мишень представляет собой только сегмент полноразмерного гена Е6. Мишень для вырожденного набора праймеров/зондов для типов ВПЧ 33 и 58 представляет собой SEQ ID NO. 37. В предпочтительном воплощении сигнальные группировки для обоих зондов представляют собой метку FAM.

[0018] В данном воплощении набор праймеров и зондов, который не является вырожденным, является отличительным для ВПЧ типа 59. Мишенью этого набора праймеров/зондов для типа 59 также является ген Е6, но не обязательно тот же локус. В предпочтительном воплощении сигнальные группировки для данного зонда в данном наборе праймеров и зондов представляют собой метку CY5, которая конкретно идентифицирована ниже.

[0019] В третьем воплощении настоящего изобретения вырожденные наборы праймеров/зондов предназначены для обнаружения типов ВПЧ 56 и 66. Мишенью этого набора праймеров/зондов является один и тот же локус гена Е6 обоих типов. Длина мишени составляет 79 нуклеотидов, и она проиллюстрирована на Фиг.3. Мишень представляет собой только сегмент полноразмерного гена Е6. Мишень для вырожденного набора праймеров/зондов для типов 56 и 66 представляет собой SEQ ID NO. 38. В предпочтительном воплощении сигнальные группировки для обоих зондов представляют собой CY5.

[0020] В данном воплощении набор праймеров и зондов, который не является вырожденным, является отличительным для ВПЧ типа 59. Мишенью этого набора праймеров/зондов для типа 59 является ген Е6. В предпочтительном воплощении сигнальные группировки для данного зонда в данном наборе праймеров и зондов представляют собой CY5, которая конкретно идентифицирована ниже. В данном воплощении ту же сигнальную группировку, которую используют для ВПЧ типа 59, также используют для ВПЧ типов 56 и 66. Поскольку одни и те же красители находятся в одном и том же канале, в данном воплощении отсутствует оптическое различие между ВПЧ типов 59 и 56-66.

[0021] В данном воплощении рассмотрена многоканальная система анализа, в которой задействован еще один отличающийся набор праймеров/зондов (либо вырожденный, либо отличительный) еще для одного серотипа ВПЧ (например, вырожденный набор праймеров/зондов для ВПЧ серотипов 33 и 58). Сигнальной группировкой для этого другого серотипа ВПЧ является не CY5, и эта группировка излучает на длине волны, которая обнаружимо отличается от длины волны, на которой излучает Су5 (например, FAM).

[0022] В других воплощениях сигнальной группировкой для зонда ВПЧ типа 59 является FAM, которую можно оптически отличить от сигнальной группировки CY5 для вырожденного набора праймеров/зондов для ВПЧ серотипов 56 и 66.

[0023] В альтернативных воплощениях предложена система анализа, либо набор зондов, либо набор с любыми и со всеми комбинациями наборов праймеров/зондов и вырожденным набором праймеров/зондов, описанным в данной заявке. В частности, любой из наборов праймеров/зондов для ВПЧ серотипа ВПЧ 51 или ВПЧ 59 можно комбинировать с любым из вырожденных наборов праймеров/зондов для серотипов ВПЧ 39-68; ВПЧ 33-58 и ВПЧ 56-66. В частности, предложена система анализа, либо набор зондов, либо набор, в котором набор праймеров/зондов для ВПЧ 51 скомбинирован с вырожденным набором праймеров и зондов для одного или более чем одного из типов ВПЧ 39-68; ВПЧ 33-58 и ВПЧ 56-66; система анализа, либо набор зондов, либо набор, в котором набор праймеров/зондов для ВПЧ 59 скомбинирован с вырожденным набором праймеров и зондов для одного или более чем одного из типов ВПЧ 39-68; ВПЧ 33-58 и ВПЧ 56-66. Предложены воплощения, где сигнальные группировки для зондов представляют собой одинаковые или разные красители. Поскольку предложена многоканальная система анализа, наборы праймеров/зондов можно комбинировать с другими наборами праймеров/зондов, сконструированными для обнаружения присутствия или отсутствия других серотипов ВПЧ. В этих воплощениях, где сигнальная группировка для зонда с детектором в вырожденных наборах праймеров/зондов является такой же, как сигнальная группировка для набора праймеров/зондов для серотипа ВПЧ 51 или 59, предусматривается, чтобы многоканальный анализ включал четвертый набор праймеров/зондов для четвертого серотипа ВПЧ (например, ВПЧ 31, ВПЧ 52, ВПЧ 45 и т.д.), и чтобы четвертый набор праймеров/зондов имел сигнальную группировку, которая отличается от сигнальных группировок для зондов с детектором вырожденных наборов праймеров/зондов и наборов праймеров/зондов для ВПЧ 51 или 59. В данной заявке также предложены многоканальные системы анализа, в которых два вырожденных набора праймеров/зондов объединены в одной системе анализа. Например, в одной микролунке первый вырожденный набор праймеров/зондов для обнаружения присутствия серотипов ВПЧ 33 и 58 может быть объединен со вторым вырожденным набором праймеров/зондов для обнаружения присутствия или отсутствия серотипов ВПЧ 56 и 66. В этих воплощениях зонды первого вырожденного набора праймеров и зондов имеют сигнальную группировку, которая излучает с длиной волны, обнаружимо отличающейся от длины волны, с которой излучает сигнальная группировка для второго вырожденного набора праймеров/зондов. В данном примере сигнальная группировка для зондов серотипов ВПЧ 33 и 58 будет представлять собой FAM, а сигнальная группировка для зондов серотипов ВПЧ 56 и 66 будет представлять собой CY5.

[0024] В дополнение к вышеописанным сигнальным группировкам, зонды также содержат нефлуоресцентный темный гаситель. Одним из примеров подходящего темного гасителя является BHQ™ 1 (Biosearch Technologies), который пригоден для использования с флуорофором FAM. Другим примером подходящего гасителя является BHQ™ 2 (Biosearch Technologies), который пригоден для использования с флуорофором CY5. Другие примеры сигнальных группировок хорошо известны специалистам в данной области техники и подробно не описаны в данной заявке.

[0025] Термин "праймер", как его используют в данной заявке, относится к олигонуклеотиду, который способен действовать в качестве точки инициации синтеза вдоль комплементарной нити, когда он помещен в условия, при которых катализируется синтез продукта удлинения праймера, комплементарного нити нуклеиновой кислоты. Такие условия включают присутствие четырех различных дезоксирибонуклеозидтрифосфатов и агента, индуцирующего полимеризацию, такого как ДНК-полимераза или обратная транскриптаза, в подходящем буфере ("буфер" включает компоненты, которые являются кофакторами, или которые влияют на ионную силу, рН и т.д.) и при подходящей температуре. Как этот термин используют в данной заявке, олигонуклеотидный праймер может иметь природное происхождение, как в очищенном продукте рестрикции, или может быть получен синтетическим путем. Для максимальной эффективности амплификации праймер предпочтительно является однонитевым.

[0026] Термин "пара праймеров", как его используют в данной заявке, относится к двум праймерам, прямому праймеру и обратному праймеру, которые способны участвовать в ПЦР-амплификации сегмента нуклеиновой кислоты в присутствии полимеразы нуклеиновой кислоты с получением ПЦР-ампликона. Праймеры, которые составляют пару праймеров, могут быть специфичны к одному и тому же гену ВПЧ, что приводит в результате к образованию ампликона, который состоит из последовательности нуклеотидов, имеющей происхождение от единственного гена ВПЧ. Альтернативно праймеры, которые составляют пару праймеров, могут быть специфичны к различным генам ВПЧ, которые находятся в близком соседстве друг с другом в пределах генома ВПЧ, с получением в результате ампликонов, которые состоят из последовательности нуклеотидов, имеющей происхождение более чем из одного гена.

[0027] Термин "спектры, дающие различающиеся изображения", как его используют в данной заявке, по отношению к флуорофорам по настоящему изобретению означает, что каждый флуорофор излучает энергию при максимуме излучения, отличающемся от максимумов всех других флуорофоров, используемых в конкретном анализе. Использование флуорофоров с уникальными максимумами излучения дает возможность одновременного обнаружения флуоресцентной энергии, излучаемой каждым из множества флуорофоров, используемых в конкретной системе анализа.

[0028] Термин "отличительный", как его используют в данной заявке, когда он используется по отношению к олигонуклеотидным праймерам и зондам по настоящему изобретению, означает, что указанные праймеры и зонды специфичны к единственному типу ВПЧ. Он включает праймеры и зонды к ВПЧ, специфичные к единственному типу ВПЧ, но обладающие некоторой гомологией с другими типами ВПЧ. "Отличительные" праймеры и зонды по настоящему изобретению включают те олигонуклеотиды, у которых отсутствует 3' гомология с другими типами ВПЧ по меньшей мере в одном или более чем одном нуклеотиде. Такой остаток, который является уникальным для определенного типа ВПЧ в конкретном положении и обеспечивает возможность отличить данный тип ВПЧ от других при выравнивании, называют "отличительным основанием". Термин "отличительный" по отношению к олигонуклеотидам не включает праймеры и зонды, которые специфичны более чем к одному типу ВПЧ, то есть к тем, которые обладают полной гомологией более чем с одним типом ВПЧ. В этом отношении вырожденные наборы праймеров/зондов, раскрытые в данной заявке, не являются отличительными для типа ВПЧ, для которого они сконструированы. Например, в случае вырожденного набора праймеров/зондов, мишенью которого является ВПЧ типов 39 и 68, набор праймеров/зондов для ВПЧ типа 39 преимущественно взаимодействует с ВПЧ типа 39 по сравнению с ВПЧ типа 68, но не является отличительным для ВПЧ типа 39 по отношению к ВПЧ типа 68. Поскольку вырожденные наборы праймеров/зондов не позволяют различить типы ВПЧ, зонды предпочтительно имеют одинаковую сигнальную группировку. Такая система анализа сконструирована таким образом, чтобы определять присутствие или отсутствие этих типов ВПЧ в агрегате, поэтому нет необходимости использовать два оптических канала для этой цели. Кроме того, когда вырожденный набор праймеров/зондов комбинируют с другими наборами праймеров/зондов в одной микролунке для многоканального анализа, сигнальные группировки для других наборов праймеров/зондов (либо отличительных, либо не отличительных) могут быть одинаковыми или разными. Выбор сигнальных группировок для системы анализа во многом зависит от организации системы. Специалист в данной области техники использует одни и те же сигнальные группировки для наборов праймеров/зондов в одной и той же микролунке, когда необходимо установить, присутствует ли определенный тип ВПЧ. Одну и ту же сигнальную группировку можно использовать в наборах праймеров/зондов для различных серотипов ВПЧ, когда достаточно знать, присутствует ли только один из этих типов.

[0029] Термин "ампликон", как его используют в данной заявке, относится к конкретному продукту реакции ПЦР, который продуцируется в результате ПЦР-амплификации образца, содержащего нуклеиновую кислоту, в присутствии полимеразы нуклеиновой кислоты и специфичной пары праймеров. Ампликон может состоять из нуклеотидной последовательности, имеющей происхождение из единственного гена одного типа ВПЧ, либо ампликон может состоять из нуклеотидной последовательности, имеющей происхождение более чем из одного гена одного типа ВПЧ.

[0030] Термин "набор праймеров/зондов", как его используют в данной заявке относится к группе из пары олигонуклеотидных праймеров и олигонуклеотидного зонда, который гибридизуется со специфичной нуклеотидной последовательностью одного типа ВПЧ. Указанный набор олигонуклеотидов состоит из: (а) прямого отличительного праймера, который гибридизуется с первым положением последовательности нуклеиновых кислот какого-либо типа ВПЧ; (b) обратного отличительного праймера, который гибридизуется со вторым положением последовательности нуклеиновых кислот указанного типа ВПЧ, расположенным в направлении 5'-3' от первого положения, и (с) флуоресцентного зонда, меченного флуорофором и гасителем, который гибридизуется с положением последовательности нуклеиновых кислот указанного типа ВПЧ, находящимся между праймерами. Иными словами, набор олигонуклеотидов состоит из набора специфичных праймеров ПЦР, способных к инициации синтеза ампликона, специфичного к одному типу ВПЧ, и флуоресцентного зонда, который гибридизуется с ампликоном.

[0031] Термин "множество", как его используют в данной заявке, означает два или более чем два.

[0032] Термин "специфично гибридизуется", как его используют в данной заявке, в отношении наборов олигонуклеотидов, олигонуклеотидных праймеров или олигонуклеотидных зондов означает, что указанные олигонуклеотидные наборы, праймеры или зонды гибридизуются с последовательностью нуклеиновых кислот одного типа ВПЧ.

[0033] Термин "ген", как его используют в данной заявке, означает сегмент нуклеиновой кислоты, вовлеченный в продуцирование полипептидной цепи. Он включает как транслируемые последовательности (кодирующую область), так и 5' и 3' нетранслируемые последовательности (некодирующие области), а также вставочные последовательности (интроны) между индивидуальными кодирующими сегментами (экзонами). Для целей описания воплощений настоящего изобретения геном ВПЧ имеет множество генов: например, L1, L2 и Е1, Е2, Е4-Е7.

[0034] Термин "локус", как его используют в данной заявке, относится к положению на хромосоме, в котором находится ген, отвечающий за какой-либо признак. Термин "локус" включает любой из аллелей конкретного гена. Он также включает гомологичные гены различных типов ВПЧ. Например, системы ПЦР-анализа, которые позволяют обнаружить ген L1 ВПЧ 16 и ВПЧ 6, представляют собой однолокусные анализы, несмотря на то, что они позволяют обнаруживать последовательности из различных типов ВПЧ. Напротив, например, анализы, которые позволяют обнаружить ген L1 и ген Е1 одного типа ВПЧ, представляют собой многолокусные анализы, даже несмотря на то, что обнаруживается один тип ВПЧ.

[0035] Термин "ВПЧ", как его используют в данной заявке, означает вирус папилломы человека. "ВПЧ" является общим термином, используемым для обозначения любого типа ВПЧ, как известного в настоящее время, так и описанного впоследствии.

[0036] Термин "флуорофор", как его используют в данной заявке, относится к флуоресцентной репортерной молекуле, которая при возбуждении лазерной, вольфрамовой, ртутной или ксеноновой лампой или светодиодом высвобождает энергию в форме света с определенным спектром. В результате процесса резонансного переноса энергии флуоресценции (FRET - fluorescence resonance energy transfer) свет, излучаемый из флуорофора, может возбуждать вторую молекулу, спектр возбуждения которой перекрывается со спектром излучения флуорофора. Перенос энергии возбуждения флуорофора на другую молекулу гасит излучение флуорофора. Вторая молекула известна как молекула-гаситель. Термин "флуорофор" в данной заявке используют взаимозаменяемо с термином "флуоресцентный репортер".

[0037] Термины "гаситель" или "молекула-гаситель", как их используют в данной заявке, относятся к молекуле, которая при связывании с флуоресцентным зондом, содержащим флуорофор, способна к принятию энергии, излучаемой флуорофором, в результате чего излучение флуорофора гасится. Гаситель может быть флуоресцентным, который высвобождает принятую энергию в виде света, или не флуоресцентным, который высвобождает принятую энергию в виде тепла, и может быть присоединен в любом положении по всей длине зонда.

[0038] Термин "темный гаситель", как его используют в данной заявке, относится к нефлуоресцентному гасителю.

[0039] Термин "зонд", как его используют в данной заявке, относится к олигонуклеотиду, который способен к образованию дуплексной структуры с последовательностью, находящейся в нуклеиновой кислоте-мишени, за счет комплементарности по меньшей мере одной последовательности зонда с последовательностью в области-мишени или в области, подлежащей обнаружению. Термин "зонд" включает олигонуклеотид, как описано выше, с флуорофором или без флуорофора и с присоединенной молекулой-гасителем. Термин "флуоресцентный зонд" относится к зонду, содержащему флуорофор и молекулу-гаситель.

[0040] Термин "FAM", как его используют в данной заявке, относится к флуорофоруб-карбоксифлуоресцеину.

[0041] В других воплощениях изобретения используют различные олигонуклеотидные последовательности, которые связываются с областью генов Е6/Е7 ВПЧ. Олигонуклеотиды, описанные в данной заявке, имеют последовательность, которая способна к связыванию с последовательностью нуклеиновых кислот, представляющей собой мишень (и комплементарной ей нитью). Олигонуклеотиды, описанные в данной заявке, можно также использовать, либо отдельно, либо в комбинации, чтобы способствовать обнаружению посредством амплификации последовательности нуклеиновых кислот генов ВПЧ Е6/Е7. В одном воплощении зонды сконструированы для проведения ПЦР-анализа Taq-Man® в реальном времени участка-мишени гена. Примеры трех вырожденных наборов зондов, используемых для ПЦР-анализа Taq-Man® в реальном времени, описанные в отношении их олигонуклеотидных последовательностей, описаны ниже.

[0042] В частности, в первом воплощении, где первый вырожденный набор праймеров/зондов направлен на ВПЧ типов 39 и 68, набор праймеров/зондов, который преимущественно взаимодействует с ВПЧ типа 39, представляет собой последовательности SEQ ID NO:3 и 5. Набор праймеров/зондов, который преимущественно взаимодействует с ВПЧ типа 68, представляет собой последовательности SEQ ID NO. 2, 4 и 6. Обе последовательности SEQ ID NO 1 и 2 представляют собой прямые праймеры Taq-Man и являются вырожденными по отношению друг к другу. Обе последовательности SEQ ID NO 3 и 4 представляют собой обратные праймеры Taq-Man и являются вырожденными по отношению друг к другу. Обе последовательности SEQ ID NO 5 и 6 представляют собой зонды Taq-Man и являются вырожденными по отношению друг к другу. Вырожденные наборы праймеров/зондов для ВПЧ типов 33 и 58 представляют собой последовательности SEQ ID NO. 7-16, которые включают две альтернативные последовательности обратных праймеров, причем последовательности SEQ ID NO. 13 и 14 являются предпочтительными. Вырожденные наборы праймеров/зондов для ВПЧ типов 56 и 66 представляют собой последовательности SEQ ID NO. 17-23. Последовательности праймеров/зондов, которые являются селективными или отличительными для ВПЧ серотипа 51, представляют собой последовательности SEQ ID NO. 24-29. Последовательности праймеров/зондов, которые являются селективными или отличительными для ВПЧ типа 59, представляют собой последовательности SEQ ID NO. 30-35. Все вышеописанные последовательности перечислены в таблице 1 ниже. В приведенной ниже таблице "D" означает детектор (detector), "FP" означает прямой праймер (forward primer), и "RP" означает обратный праймер (reverse primer).

ТАБЛИЦА 1
SEQ ID NO. Название Описание Олигонуклеотидная последовательность: 5'-3'
SEQ ID NO:1 GR39 68E6 FP2 (39) ВПЧ 39 прямой праймер Е6 Taq-Man CCACTAGCTGCATGCCAATC
SEQ ID NO:2 GR39 68E6 FP2 (68) ВПЧ 68 прямой праймер Е6 Тает-Man CCATTAGCTGCATGCCAATC
SEQ ID NO:3 GR39 68E6 RP4 (39) ВРЧ 39 обратный праймер Е6 Taq-Man CTAATGTAGTTGCATACACCGA
SEQ ID NO:4 GR39 68E6 RP4 (68) ВПЧ 68 обратный праймер Е6 Taq-Man CTAATGTTGTTGCATACACCGA
SEQ ID NO:5 GR39 68D5 (39) ВПЧ 39 зонд Е6 Taq-Man GAGTAATATCGTAGCTCCCGTATTTT
SEQ ID NO:6 GR39 68D5 (68) ВПЧ 68 зонд Е6 Taq-Man GAGTAATATCGTAGTTCCCGTATTTT
SEQ ID NO:7 GR33 58FP2 (33) ВПЧ 33 прямой праймер Е6 Taq-Man TGTGCCAAGCATTGGAGACA
SEQ ID NO:8 GR33 58FP2 (58) ВПЧ 58 прямой праймер Е6 Taq-Man TGTGTCAGGCGTTGGAGACA
SEQ ID NO:9 GR33 58RP2 (33) ВПЧ 33 обратный праймер Е6 Taq-Man CAAATGGATTTCCCTCTCTATA
SEQ ID NO:10 GR33 58RP2 (58) ВПЧ 58 обратный праймер Е6 Taq-Man CAAATGGATTTCCATCTCTATA
SEQ ID NO:11 GR33 58RP3 (33) ВПЧ 33 обратный праймер Е6 Taq-Man CCTCTCTATATACAACTGTTAAA
SEQ ID NO:12 GR33 58RP3 (58) ВПЧ 58 обратный праймер Е6 Taq-Man ССАТСТСТАТАСАСТАТТСТТААА
SEQ ID NO:13 GR33 5 8RP4 (33) ВПЧ 33 обратный праймер Е6 Taq-Man AAATGGATTTCCCTCTCTATATAC
SEQ ID NO:14 GR33 58RP4 (58) ВПЧ 58 обратный праймер Е6 Taq-Man AAATGGATTTCCATCTCTATACAC
SEQ ID NO:15 GR33 58D1 (33) ВПЧ 33 зонд Е6 Taq-Man TCATATACCTCAGATCGTTGCAAAG
SEQ ID NO:IS GR33 58D1 (58) ВПЧ 58 зонд Е6 Taq-Man TCATATACCTCAGATCGCTGCAAAG
SEQ ID NO:17 MP56 66FP (56) ВПЧ 56 прямой праймер Е7 Taq-Man ACCTAATACACGTACCTTGTT
SEQ ID NO:18 MP56 66FP (66) ВПЧ 66 прямой праймер Е7 Taq-Man ACCTAATTCACGTACCTTGTT
SEQ ID NO:19 MP56 66RP (56) ВПЧ 56 обратный праймер Е7 Taq-Man ACACGCAGGTCCTCTTTGGT
SEQ ID NO:20 MP56 66RP (66) ВПЧ 66 обратный праймер Е7 Taq-Man ACACGTAGCTCCTCTTTGGT
SEQ ID NO:21 MP56 66D (56) ВПЧ 56 зонд Е7 Taq-Man TGTAAGTTTGTGGTGCAGTTGGACA
SEQ ID NO:22 MP56 66D (66.1) ВПЧ 66 зонд Е7 Taq-Man rGTGAGCTTGTGGTGCAGTTGGACA
SEQ ID NO:23 MP56 66D (66.2) ВПЧ 66 зонд Е7 Taq-Man TGTGAGTTGGTGGTGCAGTTGGACA
SEQ ID NO:24 51E6 FP ВПЧ 51 прямой праймер Е6 GCAGTATGCAAACAATGTTCAC
SEQ ID NO:25 51E6 RP ВПЧ 51 обратный праймер Е6 TAGTAATTGCCTCTAATGTAGTA
SEQ ID NO:26 51E6 D ВПЧ 51 зонд Е6 Taq-Man CCTGCTATAACGTCTATACTCTCTA
SEQ ID NO:27 51E7 FP ВПЧ 51 прямой праймер Е7 CTCAGAGGAGGAGGATGAAG
SEQ ID NO:28 51E7 RP ВПЧ 51 обратный праймер Е7 TGAACACCTGCAACACGGAG
SEQ ID NO:29 51E7 D ВПЧ 51 зонд Е7 Taq-Man CTACCAGAAAGACGGGCTGGAC
SEQ ID NO:30 59E6 FP ВПЧ 59 прямой праймер Е6 GGAGAAACATTAGAGGCTGAA
SEQ ID NO:31 59E6 RP ВПЧ 59 обратный праймер Е6 ATAGAGGTTTTAGGCATCTATAA
SEQ ID NO:32 59E6 D ВПЧ 59 зонд Е6 Taq-Man ACCGTTACATGAGCTGCTGATACG
SEQ ID NO:33 59E7 FP ВПЧ 59 прямой праймер Е7 GAAGTTGACCTTGTGTGCTAC
SEQ ID NO:34 59E7 RP ВПЧ 59 обратный праймер Е7 ATTAACTCCATCTGGTTCATCTT
SEQ ID NO:35 59E7 D ВПЧ 59 зонд Е7 Taq-Man ATTACCTGACTCCGACTCCGAGAA
SEQ ID NO:36 Область-мишень для вырожденных наборов праймеров для ВПЧ типов 39 и 68 91-нуклеотидная область-мишень CCATTAGCTGCATGCCAATCATGTATTA AATTTTATGCTAAAATACGGGAACTACG ATATTACTCAGAATCGGTGTATGCAACA ACATTAG
SEQ ID NO. 37 Область-мишень для вырожденных наборов праймеров для ВПЧ типов 33 и 58 138-нуклеотидная область-мишень TGTGCCAAGCATTGGAGACAACTATACA CAACATTGAACTACAGTGCGTGGAATGC AAAAAGACTTTGCAACGATCTGAGGTAT ATGATTTTGCATTTGCAGATTTAACAGT
SEQ ID NO. 38 Область-мишень для вырожденных наборов праймеров для ВПЧ типов 56 и 66 79-нуклеотидная область-мишень ACCTAATACACGTACCTTGTTGTXAGTG TAAGTTTGTGGTGCAGTTGGACATTCAG AGTACCAAAGAGGACCTGCGTGT

Положения областей-мишеней для наборов праймеров/зондов, описанных в приведенной выше таблице, описаны в приведенной ниже таблице 1А:

Таблица 1А
Положение областей-мишеней
Генотип № по каталогу GenBank Координаты области-мишени
39 М62849 287-377
68 EU918769 181-271
33 М12732 152-288
58 D90400 153-289
56 Х74483 747-825
66 EF177190 747-825

[0043] Хотя между областями-мишенями для вырожденных наборов праймеров/зондов существует гомология, координаты этих областей зависят от генотипа.

[0044] В следующем воплощении способ включает обработку образца с использованием по меньшей мере одного вырожденного набора праймеров/зондов для отбора двух различных, но близкородственных типов ВПЧ и набора праймеров/зондов, который является отличительным для третьего типа ВПЧ, где сигнальная группировка вырожденных зондов излучает сигнал одинаковой длины волны и предпочтительно представляет собой одну и ту же сигнальную группировку для этих двух вырожденных зондов. Сигнальная группировка набора праймеров/зондов, который является отличительным для третьего типа ВПЧ, излучает сигнал при длине волны, которая является отличающейся, и, следовательно, может быть обнаружена отдельно от длины волны, излучаемой сигнальными группировками вырожденных зондов. Эти наборы праймеров/зондов используют в реакции амплификации нуклеиновой кислоты для обнаружения присутствия или отсутствия амплифицированного продукта, представляющего собой нуклеиновую кислоту.

[0045] В другом воплощении предложен набор для обнаружения ВПЧ. Этот набор включает по меньшей мере один вырожденный набор праймеров/зондов, который позволяет отобрать два различных, но близкородственных типа ВПЧ, и набор праймеров/зондов, который является отличительным для третьего типа ВПЧ, где сигнальная группировка вырожденных зондов излучает сигнал одинаковой длины волны и предпочтительно представляет собой одну и ту же сигнальную группировку для этих двух вырожденных зондов. Сигнальная группировка набора праймеров/зондов, который является отличительным для третьего типа ВПЧ, излучает сигнал при длине волны, которая является отличающейся, и, следовательно, может быть обнаружена отдельно от длины волны, излучаемой сигнальными группировками для вырожденных зондов. Наборы праймеров/зондов способны к амплификации последовательности-мишени, которую можно использовать для обнаружения данного организма. Набор содержит один или более чем один олигонуклеотид и буферный реагент для проведения анализов амплификации.

[0046] Еще в одном аспекте этого набора могут пристуствовать олигонуклеотиды и реагенты для целей ПЦР Taq-Man. В данном аспекте присутствуют три олигонуклеотида. Два из этих трех являются праймерами амплификации, а третий олигонуклеотид сконструирован как детектор.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

[0047] На фиг.1 проиллюстрирована область-мишень гена Е6 для ВПЧ типа 68 и схематически изображена вырожденность этой последовательности-мишени среди различных мутаций ВПЧ типа 68, ВПЧ типа 39 и мутаций ВПЧ типа 39 по всей длине вырожденного набора праймеров/зондов для ВПЧ типов 39 и 68;

[0048] На фиг.2А-В проиллюстрирована область-мишень гена Е6 ВПЧ типа 33 и схематически изображена вырожденность этой последовательности-мишени среди различных мутаций ВПЧ типа 33, ВПЧ типа 58 и мутаций ВПЧ типа 33 по всей длине вырожденного набора праймеров/зондов для ВПЧ типов 33 и 58; и

[0049] На фиг.3 проиллюстрирована мишень гена Е7 для ВПЧ типа 66 и схематически изображена вырожденность этой последовательности-мишени среди различных мутаций ВПЧ типа 66, ВПЧ типа 56 и мутаций ВПЧ типа 56 по всей длине вырожденного набора праймеров/зондов для ВПЧ типов 56 и 66.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0050] Олигонуклеотидные зонды и наборы зондов, описанные в данной заявке, специально сконструированы для отбора или различения типов ВПЧ. В частности, вырожденные наборы праймеров/зондов, которые являются в той или иной степени селективными в отношении одного или двух близкородственных типов ВПЧ, комбинируют по меньшей мере с одним другим набором праймеров/зондов, который является отличительным для еще одного третьего типа ВПЧ, который отличается от близкородственных типов ВПЧ.

[0051] Наборы праймеров/зондов дают обнаружимый сигнал, если конкретный тип ВПЧ присутствует в образце.

[0052] В предпочтительных воплощениях используют способ обнаружения с помощью ПЦР (например, ПЦР Taq-Man), хотя также рассматривают другие способы (например, ТОА (транскрипционно опосредованная амплификация) и ЛЦР (лигазная цепная реакция)). Кроме того, раскрыт набор для обнаружения большего количества типов ВПЧ, чем имеется каналов для обнаружения.

[0053] Как показано на фиг.1, вырожденные наборы праймеров/зондов, специфичные к типам ВПЧ, описаны в отношении их выравнивания с иллюстративной областью-мишенью гена Е6. На фиг.1 проиллюстрирована область 10 прямого праймера, область 20 детектора Taq-Man и область 30 обратного праймера. На фиг.1 также показаны вырожденные прямые праймеры 11, 12, вырожденные обратные праймеры 31, 32 и вырожденные зонды 21 по отношению к соответствующей им области в последовательности-мишени 40. В боксах 60, 70 и 80 проиллюстрированы только вариации в последовательности-мишени 40 в отношении области прямого праймера, области обратного праймера и областей детектора. Отмечена вырожденность последовательности между этими областями, и на этом основании можно установить, что эти области являются менее желательными в связи с повышенной вариабельностью последовательности в этих областях.

[0054] Например, в боксе 60 можно видеть, что существуют однонуклеотидные полиморфизмы (Т, С) между участком последовательности-мишени 40, ограниченным боксом 60, и тем же участком Е6 мишени ВПЧ типа 39. Боксы 60, 70 и 80 иллюстрируют полиморфизмы нуклеотидов относительно мишени для различных штаммов ВПЧ типов 68 и 39. Эти различные штаммы, а также количество и положение полиморфизмов нуклеотидов (относительно мишени) представлены в таблице 2.

Таблица 2
Полиморфизмы, проиллюстрированные на фиг.1, относительно мишени
Тип/Штамм Количество полиморфизмов (положение с 5')
Тип 68
68, А7, высокий, 45240-DQ80079. посл. 3 [Т(@6); G(@66); T(@84)]
68, А7, высокий, 45240-EU918769. посл. Нет
BD115-68 900 п.о. посл. 3 [С(@21);А(@46);С(@81)]
BD-637-68 900 п.о. посл. 1 [G(@31)]
Т276-68 900 п.о. посл. Нет
Т1177-68 900 п.о. посл. 3 [Т или С (@6); С(@81); Т или Т(@84)
Т1610-68 900 п.о. 071309. посл. 2 [G(@53); C(@81)]
Тип 39
23, А7, высокий, 10568, М62849. посл. 6 [С(@4); А(@27); G (@51) G(@66); C(@69); Т(@84)]
S4 92-39 900 п.о. посл. 8 [Т(@3); С(@4); А(@27); G (@51) G(@66); C(@69); G(@80); T(@84)]
Т296-39 900 п.о. посл. 7 [С(@4); А(@27); G(@51); C(@57); G(@66); С(@69); Т(@84)]
п.о. посл. - пар оснований в последовательности

[0055] Прямой праймер 11 для ВПЧ 39 имеет однонуклеотидный полиморфизм и, следовательно, является вырожденным по отношению к прямому праймеру 12 для ВПЧ 68. Прямой праймер 11 представляет собой SEQ ID NO. 1, и прямой праймер 12 представляет собой SEQ ID NO. 2. Вырожденность между двумя последовательностями легко можно увидеть:

CCACTAGCTGCATGCCAATC

CCATTAGCTGCATGCCAATC

Соответствующая вырожденность указана подчеркиванием.

[0056] Вследствие вырожденности прямой праймер преимущественно связывается с ВПЧ типа 39, а прямой праймер 12 преимущественно связывается с ВПЧ типа 68. Вырожденные наборы праймеров/зондов преимущественно связываются с мишенью одного типа ВПЧ по сравнению с другим типом, но не являются отличительными. К контексте фигур наборы праймеров/зондов описаны по отношению к мишени. Боксы 60, 70 и 80 содержат информацию относительно вырожденности среди ВПЧ типов 39 и 68 по отношению к области-мишени 40, ограниченной боксами 60, 70 и 80. Это относится к положению, но не относится к гибридизации. В частности, обратные праймеры 31 и 32 (SEQ ID NO. 3 и 4) имеют последовательности, обратно комплементарные последовательности в соответствующем им положении в мишени 40. Подобным образом, зонды-детекторы 21 и 22 (SEQ ID NO. 5 и 6) обратно комплементарны последовательности в соответствующем им положении в мишени 40. Прямые праймеры 11 и 12 (SEQ ID NO. 1 и 2) гомологичны последовательности в соответствующем им положении в мишени 40.

[0057] Фиг.2А-В подобна фиг.1, но относится к вырожденным наборам праймеров/зондов, которые являются селективными к ВПЧ типов 33 и 58. Боксы 160, 170 и 180 иллюстрируют нуклеотидные полиморфизмы относительно мишени для различных штаммов ВПЧ типов 33 и 58. Эти различные штаммы, а также количество и положение нуклеотидных полиморфизмов (относительно мишени) представлены в таблице 3. Положение полиморфизмов проиллюстрировано на фиг.2.

Таблица 3
Полиморфизмы, проиллюстрированные на фиг.2А-В, относительно мишени
Тип/Штамм Количество полиморфизмов
Тип 33
33 А9 Высокий 10586 EF422125. посл. 3 [С(@30); А(@62); С(@63)]
33 А9 Высокий 10586 EF422126. посл. 3 [С(@62); С(@63); Т(@52)]
33 А9 Высокий 10586 EF566920. посл. 3 [С(@62); С(@63); А(@99)]
33_А9 Высокий 10586 ЕР566921. посл. 2 [С(@62); С(@63)]
33_А9_Высокий)_I05 86 EF918766. посл. 4 [G(@58); C(@62); C(@63); G(@122)]
33 А9 Высокий 10586 G0374550. посл. 1 [A(@62)]
33 А9 Высокий 10586 G0374551. посл. 2 [G(@54); A(@62)]
33 А9 Высокий 10586 G0374552. посл. 2 [T(@10); A(@62)]
33_A9 Высокий 10586 М12732. посл. 2 [A(@62); C(@63)]
BD670 grp33 900 п.о. посл. 1 [A(@62)]
BD783-33 900 п.о. посл. 3 [C(@62); C(@63); C(@92)]
BD783-33 клон 900 п.о. посл. 2 [C(@62); C(@63)]
TI093-33 900 п.о. посл. 2 [G(@54); A(@62)]
Тип 58
HPV_58 D60400. посл. 23 [См. положение на фиг.2А-В]
Т-275-58 900 п.о. посл. 22 [См. положение на фиг.2А-В]
Т-276-58 900 п.о. посл. 24 [См. положение на фиг.2А-В]
Т-817-58 клон 900 п.о. посл. 23 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 AF478160 23 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 AF478167 22 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 AF234531 23 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 AF478157 23 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 EU080239 25 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 FJ407192 24 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 G0248229 23 [См. положение на фиг.2А-В]
58_А9 Высокий Е6 10598 G0248253 22 [См. положение на фиг.2А-В]

[0058] На фиг.2А-В проиллюстрирована область прямого праймера 110, область обнаружения Taq-Man 120 и область обратного праймера 130. На фиг.2А-В также проиллюстрированы вырожденные прямые праймеры 111, 112, вырожденные обратные праймеры 131, 132 и вырожденные зонды 121 и 122 по отношению к соответствующей им области в последовательности-мишени 140. В боксах 160 проиллюстрированы только вариации в последовательности-мишени 140 по отношению к области прямого праймера, области обратного праймера и областей обнаружения (фиг.2А), 170 и 180 (фиг.2В).

[0059] Например, в боксе 160 можно видеть, что существуют однонуклеотидные полиморфизмы (Т, G, G) между участком последовательности-мишени 140, ограниченным боксом 60, и тем же участком Е6 мишени ВПЧ типа 33. Однако прямой праймер 112 для ВПЧ 58 имеет три однонуклеотидных полиморфизма и, следовательно, является вырожденным по отношению к прямому праймеру 111 для ВПЧ 33. Прямой праймер 111 представляет собой SEQ ID NO. 7, и прямой праймер 112 представляет собой SEQ ID NO. 8. Вырожденность между двумя последовательностями можно легко увидеть:

TGTGCCAAGCATTGGAGACA

TGTGTCAGGCGTTGGAGACA

Соответствующая вырожденность указана подчеркиванием.

[0060] Вследствие вырожденности прямой праймер 111 преимущественно связывается с ВПЧ типа 33, а прямой праймер 112 преимущественно связывается с ВПЧ типа 58. Вырожденные наборы праймеров/зондов преимущественно связываются с мишенью одного типа ВПЧ по сравнению с другим типом, но не являются отличительными. В контексте фигур наборы праймеров/зондов описаны по отношению к мишени. Боксы 160, 170 и 180 содержат информацию о вырожденности среди ВПЧ типов 33 и 58 по отношению к области мишени 140, ограниченной боксами 160, 170 и 180. Это относится к положению и не относится к гибридизации. В частности, обратные праймеры 131 и 132 (например, SEQ ID NO. 13 и 14) имеют последовательности, которые являются обратно комплементарными последовательности соответствующего им положения в мишени 140. Подобным образом, обратные зонды 121 и 122 (SEQ ID NO. 15 и 16) обратно комплементарны последовательности соответствующего им положения в мишени 140. Прямые праймеры 111 и 112 (SEQ ID NO. 7 и 8) гомологичны последовательности в соответствующем им положении в мишени 140.

[0061] Фиг.3 подобна фиг.1 и 2, но для вырожденных наборов праймеров/зондов, которые являются селективными для ВПЧ типов 56 и 66. На фиг.3 проиллюстрирована область прямого праймера 210, область обнаружения Taq-Man 220 и область обратного праймера 230. Боксы 260, 270 и 280 иллюстрируют нуклеотидные полиморфизмы относительно мишени для различных штаммов ВПЧ типов 66 и 56. Эти различные штаммы, а также количество и положение нуклеотидных полиморфизмов (относительно мишени) представлены в таблице 4.

Таблица 4
Полиморфизмы, проиллюстрированные на фиг.3, относительно мишени
Тип/Штамм Количество полиморфизмов (положение с 5' конца)
Тип 66
66_А6_Высокий 37119-EF177191 6 [Т(@8); А(@24); G(@30) C(@33); G(@71); А(@74)]
66_А6_Высокий_3 7119-EF17718 8 7 [Т(@8); Т(@9); А(@24); G(@30) С(@33); G(@71); A(@74)]
66_А6_Высокий_3 7119-EF17718 6 6 [T(@8); A(@24); G(@30) G(@35); G(@71); A(@74)]
Тип 56
56 А6 Высокий 37119-EF177176 2 [G(@24); C(@56)]
56 А6 Высокий 37119-EF177178 3 [C(@20); C(@23); C(@24)]
56 А6 Высокий 37119-EF177179 1 [C(@24)]
56 А6 Высокий 37119-EF177180 1 [G(@24)]
BD616 grp56 E7 3 [G(@24); T(@54); C(@56)]
Т1631-56 Е7 1 [А(@24)]

[0062] На фиг.3 также проиллюстрированы вырожденные прямые праймеры 211, 212, вырожденные обратные праймеры 231, 232 и вырожденные зонды 221 и 222 по отношению к соответствующей им области в последовательности-мишени 240. В боксах 260, 270 и 280 проиллюстрированы только вариации в последовательности-мишени 240 по отношению к области прямого праймера, области обратного праймера и областям обнаружения.

[0063] Например, в боксе 260 отмечено, что существует два однонуклеотидных полиморфизма (Т, С) между участком последовательности-мишени 240, ограниченным боксом 260, между мишенью ВПЧ 66 и мишенью ВПЧ 56. Однако прямой праймер 212 для ВПЧ 56 имеет однонуклеотидный полиморфизм и, следовательно, является вырожденным по отношению к прямому праймеру 211 для ВПЧ 66. Прямой праймер 211 представляет собой SEQ ID NO. 17, а прямой праймер 212 представляет собой SEQ ID NO. 18. Вырожденность между двумя последовательностями можно легко увидеть:

ACCTAATACACGTACCTTGTT

ACCTAATTCACGTACCTTGTT

Соответствующая вырожденность указана подчеркиванием.

[0064] Вследствие вырожденности прямой праймер 211 преимущественно связывается с ВПЧ типа 56, а прямой праймер 212 преимущественно связывается с ВПЧ типа 66. Вырожденные наборы праймеров/зондов преимущественно связываются с мишенью типа ВПЧ по сравнению с другим типом, но не являются отличительными. В контексте фигур наборы праймеров/зондов описаны по отношению к мишени. Боксы 260, 270 и 280 содержат информацию относительно вырожденности среди ВПЧ типов 56 и 66 по отношению к области мишени 240, ограниченной боксами 260, 270 и 280. Это относится к положению и не относится к гибридизации. В частности, обратные праймеры 231 и 232 (SEQ ID NO. 19 и 20) имеют последовательности, которые обратно комплементарны последовательности в соответствующем им положении в мишени 240. Подобным образом, зонды 221 и 222 (SEQ ID NO. 22 и 23) обратно комплементарны последовательности в соответствующем им положении в мишени 240. Прямые праймеры 211 и 212 (SEQ ID NO. 17 и 18) гомологичны последовательности в соответствующем им положении в мишени 240. Хотя это специально не обсуждается, вырожденность между обратными праймерами и зондами в вырожденных наборах праймеров и зондов легко можно увидеть.

[0065] В дополнение к примерам вырожденных наборов праймеров/зондов, описанным в данной заявке, специалист на основании описания, приведенного в данной заявке, и сопроводительных графических материалов способен идентифицировать другие области-мишени близкородственных серотипов, для которых можно сконструировать вырожденные наборы праймеров/зондов. Как можно легко увидеть на фигурах, желаемые области-мишени будут иметь несколько полиморфизмов между индивидуальными серотипами. В конструкции вырожденного набора праймеров/зондов можно учесть присутствующие полиморфизмы в соответствии со способом, описанным в данной заявке.

[0066] Как описано ниже, праймеры и зонды могут связываться с последовательностями-мишенями, даже несмотря на то, что они являются менее чем на 100% комплементарными этим областям. Заданная степень комплементарности зависит от ряда факторов, включающих жесткость условий связывания. В зависимости от жесткости используемых условий праймеры и зонды можно модифицировать, включая другие основания в их последовательность, и они будут оставаться комплементарными в достаточной степени, чтобы связываться с областью-мишенью нуклеиновой кислоты. Термин "в достаточной степени комплементарный", как его используют в данной заявке, включает комплементарность 70% или более. В предпочтительных воплощениях комплементарность праймеров/зондов их последовательности-мишени составляет по меньшей мере 80% по всей длине участка связывания праймеров/зондов. Более предпочтительно комплементарность праймеров/зондов их последовательностям-мишеням составляет 90% или более.

[0067] Иными словами, в настоящем изобретении рассматриваются праймеры и зонды, которые обладают по меньшей мере 70% гомологией с праймерами и зондами, конкретно обозначенными в данной заявке как SEQ ID. В предпочтительных воплощениях рассматриваются праймеры/зонды, которые обладают по меньшей мере 80% гомологией с праймерами и зондами, конкретно обозначенными в данной заявке как SEQ ID. Более предпочтительно рассматриваются праймеры/зонды, которые обладают по меньшей мере 90% гомологией с праймерами и зондами, конкретно обозначенными в данной заявке как SEQ ID.

[0068] Хотя олигонуклеотиды, описанные в данной заявке, должны обладать достаточной комплементарностью для связывания соответствующих им участков мишени ВПЧ, в отношении которой они являются отличительными, следует понимать, что в некоторый момент последовательность олигонуклеотидов становится в меньшей степени комплементарной ее мишени и может связывать другие последовательности нуклеиновых кислот. Поэтому желательно, чтобы олигонуклеотидные зонды оставались в достаточной степени комплементарными соответствующему им участку гена-мишени и не теряли селективности к соответствующему им сайту связывания мишени.

[0069] Последовательность, связывающая мишень, в олигонуклеотидном праймере амплификации может быть, как правило, локализована в его 3' конце. Последовательность, связывающая мишень, может составлять примерно 10-25 нуклеотидов в длину и может проявлять специфичность гибридизации к праймеру амплификации. Таким образом, понятно, что специалист в данной области техники может модифицировать последовательность, связывающую мишень, таким образом, чтобы эффективно изменить специфичность гибридизации праймера амплификации и направить гибридизацию на альтернативную последовательность.

[0070] Специалисту в данной области техники понятно, что олигонуклеотиды, которые используют в амплификационных анализах, можно до некоторой степени модифицировать без потери их применимости или специфичности в отношении последовательности-мишени. Например, как известно в данной области техники, гибридизацию комплементарных и частично комплементарных последовательностей нуклеиновых кислот можно выполнять, регулируя условия гибридизации с увеличением или уменьшением жесткости (то есть регулируя температуры гибридизации или содержания солей в буфере). Такие небольшие модификации раскрытых последовательностей и любые необходимые корректировки условий гибридизации для сохранения специфичности к мишени требуют только рутинного экспериментирования и находятся в пределах компетенции обычного специалиста в данной области техники.

[0071] В качестве общего руководства при конструировании олигонуклеотидов, полезных в качестве праймеров, Tm снижается примерно на 1°С-1,5°С при каждом снижении гомологии последовательности на 1%. Температурные диапазоны могут варьировать примерно от 60°С до 70°С, но праймеры могут быть сконструированы как оптимальные при 60°С±4°С, а зонды могут быть сконструированы как оптимальные при 70°С±4°С. При конструировании праймеров амплификации дополнительным соображением может быть содержание гуанина и цитозина. Как правило, содержание GC в праймере может составлять примерно 60-70%, но оно может быть также ниже и может быть соответствующим образом подобрано специалистом в данной области техники. Отжиг комплементарных и частично комплементарных последовательностей нуклеиновых кислот может быть осуществлен путем модифицирования условий отжига с увеличением или уменьшением жесткости (то есть регулирования температуры отжига или содержания соли буфера). Модификации, как, например, в отношении раскрытых последовательностей, и любая необходимая корректировка условий отжига для сохранения генной специфичности требует только рутинного экспериментирования и находится в пределах компетенции обычного специалиста в данной области техники.

[0072] Реакции амплификации с использованием праймеров, описанные в данной заявке, могут включать тимин, как описано Walker et al., см. выше, либо 2'-дезоксиуридин-5'-трифосфат в реакции может быть полностью или частично заменен ТТР, чтобы уменьшить перекрестную контаминацию последовательных реакций амплификации, например, как описано в ЕР 0624643. dU (уридин) включается в продукты амплификации и может быть вырезан путем обработки урацил-ДНК-гликозилазой (UDG). Эти участки с удаленными азотистыми основаниями делают продукт амплификации недоступным для амплификации в последующих реакциях амплификации. UDG может быть инактивирована ингибитором урацил-ДНК-гликозилазы (Ugi) перед проведением последующей амплификации, чтобы предотвратить вырезание dU во вновь образовавшихся продуктах амплификации.

[0073] ПЦР ДНК полимераза, использование которой предусматривается в настоящем изобретении, обладает 5'-3' экзонуклеазной активностью (например, используют Sequencing Grade Taq от фирмы Promega или Deep VentR™ (экзо-) ДНК от фирмы New England BioLabs). Зонд гибридизуется с мишенью, расположенной в направлении 5'-3' по отношению к праймерам для ПЦР-амплификации. Зонд смещается по мере того, как протекает эндонуклеазный синтез вниз от праймеров, между которыми расположен зонд. Поскольку особенностью амплификации путем ПЦР является термоциклирование, рестрикционную эндонуклеазу предпочтительно добавляют при низкой температуре после конечного цикла отжига и удлинения праймеров для конечного обнаружения амплификации. Однако термофильная рестрикционная эндонуклеаза, которая остается активной на протяжении всех высокотемпературных фаз реакции ПЦР, может присутствовать во время амплификации, чтобы обеспечить анализ в реальном времени. Линеаризация вторичной структуры и разделение пары красителей уменьшает гашение флуоресценции, где изменение в параметре флуоресценции, таком как интенсивность, служит показателем амплификации мишени.

[0074] Изменение флуоресценции, являющееся результатом развертывания или линеаризации детекторных олигонуклеотидов, может быть обнаружено в избранной конечной точке реакции. Однако поскольку линеаризованные вторичные структуры образуются одновременно с гибридизацией или удлинением праймеров, мониторинг изменения флуоресценции можно также проводить по мере протекания реакции, то есть в "реальном времени". Этот гомогенный формат анализа в реальном времени можно использовать для получения полуколичественной или количественной информации об исходном количестве присутствующей мишени. Когда присутствует большее количество исходных копий последовательности-мишени, донор флуоресценции может быстрее достигать выбранного порогового значения (то есть более короткое время до положительности). Время снижения флуоресценции акцептора до достижения положительного значения, определяемое как время, требующееся для достижения выбранного минимального значения, также является более коротким. Кроме того, скорость изменения параметров флуоресценции в ходе реакции является более высокой в образцах, содержащих более высокие исходные количества мишени, чем в образцах, содержащих меньшие исходные количества мишени (то есть увеличенный наклон кривой флуоресценции). Эти или другие измерения, известные в данной области техники, можно осуществлять для получения указания на присутствие мишени или указанич на амплификацию мишени. Исходное количество мишени, как правило, определяют путем сравнения экспериментальных результатов с результатами для известных количеств мишени.

[0075] Анализы на присутствие выбранной последовательности-мишени в соответствии со способами по изобретению можно осуществлять в растворе или в твердой фазе. Гомогенные анализы в реальном времени или по конечной точке, где детекторный олигонуклеотид функционирует в качестве праймера, как правило, проводят в растворе. Гибридизационные анализы с использованием детекторных олигонуклеотидов по изобретению можно также проводить в растворе (например, в виде гомогенных анализов в реальном времени), но они также особенно хорошо подходят для твердофазных анализов на обнаружение мишени в реальном времени или в конечной точке. При твердофазном анализе детекторные олигонуклеотиды могут быть иммобилизованы на твердой фазе (например, на гранулах, на мембранах или на реакционном сосуде) посредством внутренних или концевых меток с использованием способов, известных в данной области техники. Например, меченный биотином детекторный олигонуклеотид может быть иммобилизован на твердой фазе, модифицированной авидином, где он даст изменение флуоресценции при воздействии мишени в соответствующих условиях гибридизации. Улавливание мишени таким путем облегчает отделение мишени от образца и дает возможность удаления в образце веществ, которые могут препятствовать обнаружению сигнала или другим аспектам анализа.

[0076] Для коммерческого удобства олигонуклеотиды, пригодные для специфичного обнаружения и идентификации нуклеиновых кислот ВПЧ, могут быть упакованы в виде набора. Как правило, такой набор содержит по меньшей мере один олигонуклеотид, описанный в данной заявке. Вместе с ВПЧ-специфичными олигонуклеотидами в него также могут быть включены реагенты для проведения реакции амплификации нуклеиновой кислоты. Например, могут быть включены буферы, другие олигонуклеотиды, нуклеотидтрифосфаты, ферменты и т.д. Компоненты набора могут быть упакованы вместе в общем контейнере. Возможно, могут быть включены инструкции, которые иллюстрируют одно описанное воплощение для осуществления конкретного воплощения способов по изобретению. В набор могут быть также включены другие возможные компоненты, например, олигонуклеотид, меченный меткой, подходящей для использования в качестве зонда для анализа, и/или реагенты или средства для обнаружения метки.

[0077] Кроме того, набор может включать олигонуклеотиды и реагенты в высушенном или в жидком формате. Компоненты набора могут быть более стабильными и простыми в обращении, когда они находятся в высушенном состоянии. Высушенные компоненты набора можно добавлять или предварительно обрабатывать с получением твердой фазы, такой как микротитрационный планшет, микрочип или другое подходящее вместилище для образцов, где необходимо только добавить образец и буфер. Данный формат облегчает анализ нескольких образцов одновременно и полезен в способах высокой пропускной способности. Можно использовать приборы BD ProbeTec™ и Viper™ XTR.

[0078] Приведенные ниже примеры иллюстрируют конкретные воплощения изобретения, описанные в данной заявке. Как должно быть очевидно специалистам в данной области техники, различные изменения и модификации являются возможными и рассматриваются в пределах объема описанного изобретения.

[0079] Система ПЦР Taq-Man для обнаружения ВПЧ дополнительно описана ниже с использованием наборов праймеров/зондов согласно Таблице 1 в качестве примера. Наборы праймеров/зондов, описанных выше в Таблице 1, были сконструированы для проведения ПЦР Taq-Man на ВПЧ типов 39 и 68 и 51. В частности, в первом воплощении, где первый вырожденный набор праймеров/зондов направлен на ВПЧ типов 9 и 68, набор праймеров/зондов, который преимущественно взаимодействует с ВПЧ типа 39, представляет собой последовательность SEQ ID NO:1, 3 и 5. Набор праймеров/зондов, который преимущественно взаимодействует с ВПЧ типа 68, представляет собой последовательность SEQ ID NO:2, 4 и 6.

[0080] ПЦР в реальном времени Taq-Man представляет собой количественный тип ПЦР. В Taq-Man используют флуорогенный зонд, который представляет сбой однонитевой олигонуклеотид из 20-26 нуклеотидов и сконструирован так, чтобы связывать только последовательность ДНК между двумя праймерами ПЦР. В Taq-Man к зонду присоединены красители-репортеры и красители-гасители. Зонд отжигают с ДНК путем чередования температуры для денатурации и повторного отжига ДНК. Taq полимераза добавляет нуклеотиды к ДНК-мишени и, таким образом, удаляет зонд Taq-Man из матричной ДНК. Когда краситель-репортер отделяется от красителя-гасителя, краситель-репортер излучает энергию, которая может быть обнаружена. Эту энергию определяют количественно с помощью компьютера, который обеспечивает сигнал, указывающий на то, что мишень обнаружена. Только специфичный продукт ПЦР может генерировать флуоресцентный сигнал в ПЦР Taq-Man.

[0081] В примере, приведенном в данной заявке, рассмотрено термоциклирование. После первоначальной стадии денатурации при 95°С в течение 15 минут ПЦР смесь набора праймеров/зондов и образца для обнаружения присутствия или отсутствия мишени подвергают термическому циклу при 55°С в течение 1 минуты, а затем 95°С в течение 30 секунд для сорока циклов.

[0082] Для практического осуществления ПЦР Taq-Man используют праймеры для ПЦР с размером предпочтительного продукта 50-150 пар оснований и зонд с флуоресцентным репортером или флуорофором (например, 6-карбоксифлуоресцеином (FAM) и тетрахлорфлуоресцеином (ТЕТ)) и гасителем, таким как тетраметилродамин (TAMRA), или темным гасителем, таким как описано выше, которые ковалентно присоединены к его 5' и 3' концам. Подходящие флуоресцентные репортеры и флуорофоры хорошо известны и подробно не описываются в данной заявке.

Таблица 5
Примеры наборов зондов ПЦР Taq-Man для анализа Taq-Man ВПЧ типов 39, 68 и 51
SEQ ID NO: Описание зонда Олигонуклеотидная 5'-3' последовательность Локализация ОРС (п.о.) Номер по каталогу в Genbank ()
SEQ ID NO:1 ВПЧ 39 Е6 Taq-Man Прямой праймер CCACTAGCTGCATGCCAATC 287-306 (М62849)
SEQ ID NO:2 ВПЧ 68 Е6 Taq-Man Прямой праймер CCATTAGCTGCATGCCAATC 181-200 (EU918769)
SEQ ID NO:3 ВПЧ 39 Е6 Taq-Man Обратный праймер CTAATGTAGTTGCATACACCGA 356-377 (М62849)
SEQ ID NO:4 ВПЧ 68 Е6 Taq-Man Обратный праймер CTAATGTTGTTGCATACAC CGA 250-271 (EU918769)
SEQ ID NO:5 ВПЧ 39 Е6 Taq-Man зонд GAGTAATATCGTAGCTCCCGTATTTT 326-351 (М62849)
SEQ ID NO:6 ВПЧ 68 Е6 Taq-Man зонд GAGTAATATCGTAGTTCCCGTATTTT 220-245 (EU918769)
SEQ ID NO:24 ВПЧ 51 Е6 Прямой праймер GCAGTATGCAAACAATGTTCAC 277-298 (M62877)
SEQ ID NO:25 ВПЧ 51 Е6 Обратный праймер Т AGT AATTG С СТ С TAATGTAGT А 351-373 (M62877)
SEQ ID NO:26 ВПЧ 51 Е6 Taq-Man зонд CCTGCTATAACGTCTATACTCTCTA 315-339 (M62877)
SEQ ID NO:27 ВПЧ 51 Е7 Прямой праймер CTCAGAGGAGGAGGATGAAG 652-671 (M62877)
SEQ ID NO:28 ВПЧ 51 Е7 Обратный праймер TGAACACCTGCAACACGGAG 738-757 (M62877)
SEQ ID NO:29 ВПЧ 51 Е7 Taq-Man зонд CTACCAGAAAGACGGGCTGGAC 692-713 (M62877)

[0083] Зонды сконструированы для отжига в положении ОРС (открытой рамки считывания) в гене ВПЧ Е6/Е7, которое отмечено в таблице. В этом отношении в приведенной ниже таблице приведены положения ОРС для набора праймеров/зондов для ВПЧ 59 для обоих генов Е6 и Е7.

Таблица 6
Положения ОРС на Е6/Е7 для набора праймеров/зондов для ВПЧ типа 59
SEQ ID NO: Описание зонда Олигонуклеотидная 5'-3' последовательность Локализация ОРС (п.о.) Номер по каталогу в Genbank ()
SEQ ID NO:30 ВПЧ 59 Е6 Прямой праймер GGAGAAACATTAGAGGCTGAA 313-333 (Х77858)
SEQ ID NO:31 ВПЧ 59 Е6 Обратный праймер ATAGAGGTTTTAGGCATCTATAA 369-391 (Х77858)
SEQ ID NO:32 ВПЧ 59 Е6 Taq-Man зонд ACCGTTACATGAGCTGCTGATACG 342-365 (Х77858)
SEQ ID NO:33 ВПЧ 59 Е7 Прямой праймер GAAGTTGACCTTGTGTGCTAC 605-625 (Х77858)
SEQ ID NO:34 ВПЧ 59 Е7 Обратный праймер ATTAACTCCATCTGGTTCATCTT 660-682 (Х77858)
SEQ ID NO:35 ВПЧ 59 Е7 Taq-Man зонд ATTAACTCCATCTGGTTCATCTT 631-654 (Х77858)

[0084] Кроме праймеров и зондов, для ПЦР Taq-Man требуются реагенты, которые используют в обычной ПЦР (например, полимераза, свободные нуклеотиды), а также аппарат для ПЦР в реальном времени для анализа данных. Реагенты и оборудование хорошо известны специалистам в данной области техники и подробно не обсуждаются в данной заявке.

[0085] Хотя изобретение в данной заявке описано со ссылкой на конкретные воплощения, следует понимать, что эти воплощения приводятся исключительно в целях иллюстрации принципов и применений изобретения, описанного в данной заявке. Поэтому понятно, что можно осуществить разнообразные модификации иллюстративных воплощений, и что можно использовать другие устройства без отклонения от сущности и объема изобретения, описанного в данной заявке, как определено прилагаемой формулой изобретения.

1. Способ обнаружения присутствия или отсутствия нескольких серотипов вируса папилломы человека (ВПЧ) в биологическом образце с помощью многоканальной системы анализа, где указанная система анализа обнаруживает большее количество серотипов, чем существует каналов обнаружения, включающий:
получение биологического образца;
приведение биологического образца в контакт по меньшей мере с тремя наборами олигонуклеотидных праймеров и зондов, каждый из которых включает по меньшей мере один олигонуклеотидный зонд, который имеет обнаружимую метку и имеет нуклеотидную последовательность длиной от примерно 10 до примерно 50 нуклеотидов, и по меньшей мере два олигонуклеотидных праймера, каждый из которых имеет нуклеотидную последовательность длиной от примерно 10 до примерно 150 нуклеотидов, в условиях, в которых происходит отжиг зондов и праймеров к последовательности-мишени и где каждый набор праймеров и зондов по меньшей мере преимущественно взаимодействует со специфичным серотипом организма, где первый и второй наборы праймеров и зондов являются вырожденными по отношению друг к другу и где каждый вырожденный зонд имеет сигнальную группировку, каждая из которых излучает сигнал, обнаружимый на одном и том же канале, и где третий набор праймеров и зондов не является вырожденным по отношению к двум другим наборам праймеров и зондов и является отличительным для третьего серотипа, не относящегося к серотипам, к которым преимущественно происходит отжиг вырожденных наборов праймеров и зондов, и где третий набор праймеров и зондов имеет сигнальную группировку, которая излучает сигнал при длине волны, которая является такой же или отличается от длины волны, излучаемой сигнальной группировкой вырожденных зондов и где мишень для вырожденных наборов праймеров и зондов выбрана из группы, состоящей из последовательностей SEQ ID NOs. 36-38;
амплификацию последовательности-мишени, если она присутствует; и мониторинг для обнаружения метки как показателя гибридизации набора зондов с последовательностью-мишенью, что указывает на присутствие или отсутствие по меньшей мере одного из серотипов вируса папилломы человека (ВПЧ).

2. Способ по п. 1, где:
a) мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 36 и где третий набор праймеров и зондов сконструирован таким образом, что он является отличительным для ВПЧ серотипа 51 и не является вырожденным по отношению к первому или второму набору праймеров и зондов, где третий набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 24-29, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно на 90% гомологичными SEQ ID NOs. 24-29; первый набор праймеров и зондов является селективным к ВПЧ серотипа 39 и не является отличительным для ВПЧ серотипа 39 по отношению к ВПЧ серотипа 68, где первый набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 1, 3 и 5, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 1, 3 и 5; и второй набор праймеров и зондов является селективным к ВПЧ серотипа 68 и не является отличительным для ВПЧ серотипа 68 по отношению к ВПЧ серотипа 39, где второй набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 2, 4 и 6, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 2, 4 и 6; или
b) где мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 37 и где третий набор праймеров и зондов сконструирован таким образом, что он является отличительным для ВПЧ серотипа 59 и не является вырожденным по отношению к первому или второму набору праймеров и зондов, где третий набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 30-35, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 30-35; первый набор праймеров и зондов является селективным к ВПЧ серотипа 33 и не является отличительным для ВПЧ серотипа 33 по отношению к ВПЧ серотипа 58, где первый набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 7, 9, 11, 13 и 15, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 7, 9, 11, 13 и 15; и второй набор праймеров и зондов является селективным к ВПЧ серотипа 58 и не является отличительным для ВПЧ серотипа 58 по отношению к ВПЧ серотипа 33, где второй набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 8, 10, 12, 14 и 16, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно на 90% гомологичными SEQ ID NOs. 8, 10, 12, 14 и 16; или
с) где мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 38 и где третий набор праймеров и зондов сконструирован таким образом, что он является отличительным для ВПЧ серотипа 59 и не является вырожденным по отношению к первому или второму набору праймеров и зондов, где третий набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 30-35, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 30-35; первый набор праймеров и зондов является селективным к ВПЧ серотипа 56 и не является отличительным для ВПЧ серотипа 66 по отношению к ВПЧ серотипа 56, где первый набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 17, 19 и 21, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 17, 19 и 21; и второй набор праймеров и зондов является селективным к ВПЧ серотипа 66 и не является отличительным для ВПЧ серотипа 66 по отношению к ВПЧ серотипа 56, где второй набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 18, 20, 22 и 23, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 18, 20, 22 и 23.

3. Набор праймеров и зондов для обнаружения нескольких серотипов вируса папилломы человека (ВПЧ), содержащий по меньшей мере три набора олигонуклеотидных праймеров и зондов, каждый из которых включает по меньшей мере один олигонуклеотидный зонд, который имеет обнаружимую метку и имеет нуклеотидную последовательность длиной от примерно 10 до примерно 50 нуклеотидов, и по меньшей мере два олигонуклеотидных праймера, каждый из которых имеет нуклеотидную последовательность длиной от примерно 10 до примерно 150 нуклеотидов, где каждый набор праймеров и зондов по меньшей мере преимущественно взаимодействует со специфичным серотипом организма ВПЧ, где первый и второй наборы праймеров и зондов являются вырожденными по отношению друг к другу, и где каждый вырожденный зонд имеет сигнальную группировку, которая излучает сигнал, обнаружимый на одном и том же канале, и где третий набор праймеров и зондов не является вырожденным по отношению к двум другим наборам праймеров и зондов и является отличительным для третьего серотипа, не относящегося к серотипам, к которым преимущественно происходит отжиг вырожденных наборов праймеров и зондов, и где третий набор праймеров и зондов имеет сигнальную группировку, которая излучает сигнал при длине волны, которая является такой же или отличается от длины волны, излучаемой сигнальной группировкой первого и второго набора праймеров и зондов, и где мишень вырожденного набора праймеров и зондов выбрана из группы, состоящей из последовательностей SEQ ID NOs. 36-38.

4. Набор праймеров и зондов по п. 3, где:
а) мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 36 и где третий набор праймеров и зондов сконструирован таким образом, что он является отличительным для ВПЧ серотипа 51 и не является вырожденным по отношению к первому или второму набору праймеров и зондов, где третий набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 24-29, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 24-29; первый набор праймеров и зондов является селективным к ВПЧ серотипа 39 и не является отличительным для ВПЧ серотипа 39 по отношению к ВПЧ серотипа 68, где первый набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 1, 3 и 5, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 1, 3 и 5; и второй набор праймеров и зондов является селективным к ВПЧ серотипа 68 и не является отличительным для ВПЧ серотипа 68 по отношению к ВПЧ серотипа 39, где второй набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 2, 4 и 6, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 2, 4 и 6; или
b) где мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 37 и где третий набор праймеров и зондов сконструирован таким образом, что он является отличительным для ВПЧ серотипа 59 и не является вырожденным по отношению к первому или второму набору праймеров и зондов, где набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 30-35, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 30-35; первый набор праймеров и зондов является селективным для ВПЧ серотипа 33 и не является отличительным для ВПЧ серотипа 33 по отношению к ВПЧ серотипа 58, где первый набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 7, 9, 11, 13 и 15, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 7, 9, 11, 13 и 15; и третий набор праймеров и зондов является селективным к ВПЧ серотипа 58 и не является отличительным для ВПЧ серотипа 58 по отношению к ВПЧ серотипа 33, где второй набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 8, 10, 12, 14 и 16, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 8, 10, 12, 14 и 16; или
с) где мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 38 и где третий набор праймеров и зондов сконструирован таким образом, что он является отличительным для ВПЧ серотипа 59 и не является вырожденным по отношению к первому или второму набору праймеров и зондов, где набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 30-35, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 30-35; первый набор праймеров и зондов является селективным к ВПЧ серотипа 56 и не является отличительным для ВПЧ серотипа 66 по отношению к ВПЧ серотипа 56, где первый набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 17, 19 и 21, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 17, 19 и 21; и второй набор праймеров и зондов является селективным к ВПЧ серотипа 66 и не является отличительным для ВПЧ серотипа 66 по отношению к ВПЧ серотипа 56, где второй набор праймеров и зондов выбран по меньшей мере из одной из последовательностей, выбранных из группы, состоящей из SEQ ID NOs. 18, 20, 22 и 23, и последовательностей, которые являются по меньшей мере на 70%, предпочтительно по меньшей мере на 80% и более предпочтительно по меньшей мере на 90% гомологичными SEQ ID NOs. 18, 20, 22 и 23.

5. Набор для обнаружения нескольких серотипов вируса папилломы человека (ВПЧ), включающий по меньшей мере три набора олигонуклеотидных праймеров и зондов, каждый из которых включает по меньшей мере один олигонуклеотидный зонд, который имеет обнаружимую метку и имеет нуклеотидную последовательность длиной от примерно 10 до примерно 50 нуклеотидов, и по меньшей мере два олигонуклеотидных праймера, каждый из которых имеет нуклеотидную последовательность длиной от примерно 10 до примерно 150 нуклеотидов, для специфичного серотипа организма ВПЧ, где первый и второй наборы праймеров и зондов являются вырожденными по отношению друг к другу, и где каждый вырожденный зонд имеет сигнальную группировку, каждая из которых излучает сигнал, обнаружимый на одном и том же канале, и где третий набор праймеров и зондов не является вырожденным по отношению к двум другим наборам праймеров и зондов и является отличительным для третьего серотипа и не относится к серотипам, к которым преимущественно происходит отжиг вырожденных наборов праймеров и зондов, и где третий набор праймеров и зондов имеет сигнальную группировку, которая излучает сигнал при длине волны, которая является такой же или отличается от длины волны, излучаемой сигнальной группировкой вырожденного набора праймеров и зондов, и где мишень вырожденного набора праймеров и зондов для первого и второго наборов праймеров и зондов выбрана из группы, состоящей из последовательностей SEQ ID NOs. 36-38.

6. Набор по п. 5, где:
a) мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 36 и первый вырожденный набор праймеров и зондов включает SEQ ID NOs. 1, 3 и 5, а второй вырожденный набор праймеров и зондов включает SEQ ID NOs. 2, 4 и 6; или
b) где мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 37 и первый вырожденный набор праймеров и зондов включает SEQ ID NO. 7, SEQ ID NO. 15 и одну из SEQ ID NO. 9, 11 и 13, а второй вырожденный набор праймеров и зондов включает SEQ ID NO. 8, SEQ ID NO. 15 и одну из SEQ ID NO. 10, 12 и 14; или
c) где мишень вырожденного набора праймеров и зондов представляет собой последовательность SEQ ID NO. 38 и первый вырожденный набор праймеров и зондов включает SEQ ID NOs. 17, 19 и 21, а второй вырожденный набор праймеров и зондов включает SEQ ID NO. 18, SEQ ID NO. 20 и одну из последовательностей SEQ ID NO. 22 и 23.

7. Набор по п. 5, где третий набор праймеров и зондов выбран из группы, состоящей из SEQ ID NOs. 24-26, SEQ ID NOs. 27-29, SEQ ID NOs. 30-32 и SEQ ID NOs. 33-35.

8. Набор по n. 5, где третий набор праймеров и зондов является отличительным для ВПЧ серотипа 51 и выбран из группы, состоящей из SEQ ID NOs. 24-26 и SEQ ID NOs. 27-29.

9. Набор по п. 5, где третий набор праймеров и зондов является отличительным для ВПЧ серотипа 59 и выбран из группы, состоящей из SEQ ID NOs. 30-32 и SEQ ID NOs. 33-35.

10. Набор по п. 5, где сигнальная группировка детекторного зонда третьего набора праймеров и зондов излучает с длиной волны, которая является такой же, как длина волны, излучаемой детекторным зондом первого и второго наборов праймеров и зондов.

11. Набор по п. 5, где сигнальная группировка детекторного зонда третьего набора праймеров и зондов излучает с длиной волны, которая отличается от длины волны, излучаемой детекторным зондом первого и второго наборов праймеров и зондов.



 

Похожие патенты:

Изобретения относятся к области ДНК-генеалогии и касаются способа определения гаплогрупп Y-хромосомы человека, тест-системы и олигонулкотидных праймеров. Охарактеризованный способ осуществляют в два этапа.

Изобретение относится к области медицины и предназначено для определения риска развития рака тела матки у женщин с гиперпластическими процессами эндометрия. Осуществляют выделение ДНК из периферической венозной крови, проводят генотипирование гена APOE, выявляют полиморфные аллели APOE*2, APOE*3, APOE*4 и при наличии генотипов, содержащих аллели APOE*2 прогнозируют высокий риск рака эндометрия.
Изобретение относится к медицине, а именно к способу прогнозирования развития профессиональных гиперкератозов. Сущность способа состоит в том, что выделяют ДНК из лимфоцитов периферической венозной крови, проводят генотипирование полиморфизма rs1625895 гена ТР53 методом полимеразной цепной реакции с последующим рестрикционным анализом.

Предложенная группа изобретений относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения чувствительности клеток рака легкого к цисплатину, включающий определение уровня экспрессии генов MLH1, ERCC1, DDB2, AKR1B1, FTL в зависимости от IC50 цисплатина для известных клеточных линий, построение градуировочной прямой зависимости IC50 цисплатина для этих клеточных линий от полученного уровня экспрессии указанных генов и гибридизацию на микрочипе.
Изобретение относится к области биохимии, в частности к способу идентификации изменений в экспрессии генов, характерных для старения, в выбранной ткани. Выбранная ткань представляет собой сердечную, мышечную, мозговую или жировую ткань.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями.

Изобретение относится к области биотехнологии, конкретно к ингибиторам сигнального пути AXL, и может быть использовано в медицине. Получают растворимый вариант полипептида AXL без трансмембранного домена AXL, который содержит по меньшей мере одну модификацию аминокислоты в положении номер n, где n выбран из 32, 72, 87, 92 или 127 или их сочетание, где n+7 соответствует нумерации SEQ ID NO: 1 - последовательности AXL дикого типа, в котором указанная модификация повышает сродство связывания полипептида AXL со специфически задерживающим рост белком 6 (GAS6), которое, по меньшей мере, примерно в 2 раза сильнее, чем сродство полипептида AXL дикого типа.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia pseudomallei и дифференциации от возбудителя сапа методом полимеразной цепной реакции с флуоресцентной детекцией.

Изобретение относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения полиморфизма гена GP6 человека, кодирующего гликопротеин VI, по полиморфной позиции rs 1613662, основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами.

Изобретение относится к области биотехнологии, конкретно к интернализации терапевтических молекул внутрь клетки, и может быть использовано в медицине. Получают композицию для доставки молекул нуклеиновых кислот в клетки, содержащую по меньшей мере один пептид с по меньшей мере 92% идентичностью к GAAEAAARVYDLGLRRLRQRRRLRRERVRA (SEQ ID NO: 2); IREIMEKFGKQPVSLPARRLKLRGRKRRQR (SEQ ID NO: 3); или YLKVVRKHHRVIAGQFFGHHHTDSFRMLYD (SEQ ID NO: 4), присоединенный к одной или нескольким молекулам нуклеиновых кислот.

Представленное изобретение относится к области биотехнологии и касается способа обнаружения провируса лейкоза крупного рогатого скота. Охарактеризованный способ включает выявление фрагмента LTR (Long Terminal Repeat) - последовательности провируса лейкоза. Определение размера амплифицированного фрагмента нуклеотидной последовательности путем электрофоретического разделения в агарозном геле. В качестве праймеров используются олигонуклеотиды: BL1.F 5-GAGTTAGCGGCACCAGAAGC-3 и BL1.R 5-ATAGAGCTCGCGGTGGTCTC-3. Продукт синтеза составляет 175 пар нуклеотидов. Геномную ДНК выделяют сорбентным методом с последующим элюированием в буфере ТЕ, а амплификацию проводят в режиме: 95°С - 3 минуты 1 раз, 94°С - 20 секунд денатурация, 66°С - 20 секунд - отжиг праймеров, 74°С - 25 секунд элонгация, 45 раз, 74°С - 3 минуты - достраивание цепей. В качестве положительного контроля прохождения реакции используют препарат положительного контроля антигена ВЛКРС. Изобретение может быть использовано в молекулярно-генетической диагностике болезней животных и научных исследованиях в ветеринарии. 2 ил., 1 табл.

Изобретение относится к области биохимии. Предложен способ выделения коротких РНК из биологических жидкостей. Способ включает обработку образца денатурирующим буферным раствором, сорбцию коротких РНК на стекловолоконном сорбенте в присутствии хаотроптного агента с последующей отмывкой сорбента от несвязавшихся биополимеров и химических реагентов и элюцией целевого продукта. Образец биологической жидкости подвергают двухстадийной денатурации, при этом на первой стадии к образцу добавляют два объема денатурирующего буферного раствора, а на второй стадии к полученной смеси добавляют два объема 96% этанола и равный объем хлороформа с последующим перемешиванием и отделением осадка центрифугированием. Отмывку сорбента от несвязавшихся биополимеров осуществляют дважды буферным раствором, а элюцию целевого продукта с сорбента осуществляют буферным раствором. Изобретение обеспечивает упрощение способа, сокращение его длительности и повышение выхода коротких РНК. 2 з.п. ф-лы, 3 табл., 4 пр.
Изобретение относится к области медицины и предназначено для детекции гриба Microsporum canis. Осуществляют выделение тотальной нативной ДНК из образца кожи и волос, проводят полимеразную цепную реакцию и амплификацию фрагмента гена 5.8S рРНК Microsporum canis с использованием специфических праймеров. При электрофоретическом обнаружении продукта амплификации размером 182 п.н. определяют наличие возбудителя. Изобретение обеспечивает специфическую детекцию Microsporum canis в клиническом материале и может быть использовано для диагностики микроспории. 2 пр.

Настоящее изобретение предоставляет способ предсказания ответа трижды негативного рака молочной железы на терапию противоопухолевым средством. Способ включает: (a) лизирование опухолевых клеток, взятых от трижды негативной опухоли молочной железы, для получения клеточного экстракта; (b) определение уровня экспрессии VEGFR2 в клеточном экстракте; и (c) сравнение уровня экспрессии VEGFR2 в клеточном экстракте, полученном на стадии (b), с эталонным уровнем экспрессии VEGFR2. Наличие низкого уровня экспрессии VEGFR2 предсказывает ответ на терапию противоопухолевым средством, где противоопухолевое средство представляет собой комбинацию бевацизумаба (Авастин®), карбоплатина и паклитакселя. 15 з.п. ф-лы, 14 ил., 7 пр.

Изобретение относится к области биотехнологии. Система состоит из следующих элементов: а) модуля подготовки образца, выполненного с возможностью захвата аналита из биологического образца в немикрожидкостном объеме на захватывающей частице, реагирующей на магнитное поле, и направления связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, через первый микрожидкостный канал; б) реакционного модуля, включающего реакционную камеру, имеющую жидкостное сообщение с первым микрожидкостным каналом, и выполненного с возможностью иммобилизации связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, и проведения реакции амплификации множества STR-маркеров аналита. При этом модуль подготовки образца и реакционный модуль интегрированы в одноразовый картридж, который состоит из: 1) по меньшей мере одной совокупности жидкостных камер, 2) платы с реагентами или картриджа с реагентами и 3) одного или более чем одного пневматически активируемого MOVe-клапана; в) модуля анализа. Причем система сконфигурирована для захвата аналита, для проведения химической или биохимической реакции с аналитом и для проведения анализа продукта реакции менее чем за 4 часа. За счет использования в данной системе MOVe-клапанов осуществляется перенос текучих средств, устойчивый к утечкам, и появляется возможность уменьшить размеры устройства для подготовки образцов. Также с помощью данной системы можно отбирать организмы мишени из образцов с большим количеством фоновых примесей, различать два разных штамма бактерий, эффективно захватывать клетки и токсины, значительно уменьшить объем целевого образца. 1 н. и 29 з.п. ф-лы, 104 ил., 3 пр.

Изобретение относится к области биохимии, в частности к одновременной идентификации токсигенных штаммов геновариантов Vibrio cholerae О1 серогруппы биовара Эль Тор и их дифференциации по эпидемическому потенциалу. Способ характеризуется тем, что ПЦР проводят в один прием в двух реакционных смесях, каждая из которых содержит специально подобранное сочетание праймеров: первая - к фрагментам генов rfbO1, rfbR, rtxC, ctxA, вторая - к фрагментам генов ctxBClass, vc0502, vc0514. Для штаммов с низким эпидемическим потенциалом характерно наличие ампликонов генов rfbO1, rstC, ctxA, ctxBClass, vc0502, vc0514. Для штаммов с высоким эпидемическим потенциалом характерно наличие ампликонов фрагментов генов rfbO1, rstC, ctxA, ctxBClass и vc0514. Изобретение позволяет быстро и достоверно идентифицировать токсигенные штаммы геновариантов V. cholerae O1 биовара Эль Тор и дифференцировать их на основе анализа структуры острова пандемичности VSP-II на штаммы с низким и высоким эпидемическим потенциалом. 1 з.п. ф-лы, 1 ил., 3 табл., 1 пр.

Предлагаемая группа изобретений относится к области биотехнологии, а именно к способу диагностики йерсиниоза лососевых рыб и набору для его осуществления. Данная группа изобретений может быть использована для выявления возбудителя йерсиниоза лососевых - Yersinia ruckeri - в пробах для диагностики болезней рыб в ветеринарии. Способ включает проведение полимеразной цепной реакции для выявления соответствующих фрагментов нуклеиновых кислот с использованием праймеров, имеющих следующую структуру: 5'CTAACACTACAGGTTATCGCCTCTG3' (Yr-rA-1), 5'GGCTCATCATACGAGCGGCAAGTCC3' (Yr-rA-2), 5'CTTGTTTGACGATATTCGCTTTGGC3' (Yr-gA-1), 5'CTGGGGGAACCGGGAAGTAACC3' (Yr-gA-2), 5'GCGAAAGCTTGCGTGAGCTGTCG3' (Yr-gB-1), 5'GGAAACCATCATTCCACTGCAAG3' (Yr-gB-2). О наличии в образце ДНК Yersinia ruckeri судят по специфическому фрагменту размером 294 п.о. для пары Yr-rA-1,2; размером 154 п.о. для пары Yr-gA-1,2; размером 225 п.о. для пары Yr-gB-1,2. Предложенное изобретение позволяет диагностировать йерсиниоз лососевых рыб с высокой специфичностью. 2 н.п. ф-лы, 3 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии и представляет собой набор олигонуклеотидных праймеров для идентификации ДНК животных, входящих в группу: свинья, бык, курица, овца, индейка, мышь, крыса, собака, кошка, и ДНК человека в сухих или консервированных кормах для животных и в сырых или подвергшихся кулинарной обработке мясных продуктах. Набор содержит первую и вторую композиции праймеров для идентификации митохондриальной ДНК, которые обеспечивают возможность одновременного проведения в одинаковых температурных режимах двух мультипраймерных реакций амплификации методом ПЦР с повышенной специфичностью к выявляемым митохондриальным ДНК. Для проведения мультипраймерных реакций ПЦР используют соответственно первую и вторую композиции праймеров, где в первую композицию входят праймеры, входящие в группу SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, а во вторую композицию входят праймеры, входящие в группу SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21. 4 ил., 8 табл., 4 пр.

Изобретение относится к молекулярной биологии, генетической инженерии, медицине и предназначено для типирования вируса гриппа А. Предлагаемый способ типирования вируса гриппа основан на проведении двухэтапной полимеразной цепной реакции (ПЦР) кДНК вируса с последующей гибридизацией меченных биотином ампликонов с ДНК-микрочипом, содержащим соответствующие дискриминирующие гибридизационные зонды. Использование этого способа позволяет определять все 9 субтипов гена нейраминидазы и 14 субтипов гена гемагглютинина вируса гриппа А. 2 н.п. ф-лы, 6 ил., 7 пр.

Изобретение относится к области биохимии, в частности к несортовому растению кукурузы с увеличенным по сравнению с контролем урожаем, включающему набор аллелей из соответствующего набора QTL, каждый из которых вносит вклад в фенотипический признак урожая зерна, причем указанный набор аллелей обоюдно комплементарен набору аллелей, имеющихся в линии Zea mays, выбранной из группы, состоящей из линии NP 1902, депонированной под номером NCIMB 41577, линии NP 1941, депонированной под номером NCIMB 41576, и линии NPNW 0351, депонированной под номером NCIMB 41578, а также к зерну или семени, им продуцируемому. Раскрыто применение вышеуказанного растения для получения продуктов переработки кукурузы, в частности зерна и зернышек кукурузы, а также способ получения растения кукурузы с увеличенным по сравнению с контролем урожаем с его использованием. Изобретение позволяет эффективно получать растение кукурузы с увеличенным по сравнению с контролем урожаем. 4 н. и 10 з.п. ф-лы, 1 ил., 18 табл., 8 пр.
Наверх