Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды



Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды
Применение фрагмента днк транскрибируемой области рибосомного повтора для повышения устойчивости мезенхимных стволовых клеток к действию агрессивных факторов окружающей среды

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2560270:

Федеральное государственное бюджетное научное учреждение "Медико-генетический научный центр" Российской академии медицинских наук (RU)
Российская Федерация, от имени которой выступает Министерство образования и науки Российской Федерации (RU)

Изобретение относится к области молекулярной биологии, молекулярной генетики и клеточной биологии, в частности к применению ДНК-конструкции для индуцирования в мезенхимных стволовых клетках выраженного адаптивного ответа. Указанная генетическая конструкция включает CpG- и GC-богатую вставку транскрибируемой области рибосомного повтора человека (область от -515 до 5321 (HSU13369, GeneBank)) и вектор pBR322 в низких концентрациях (10-50 нг/мл). Изобретение позволяет повысить устойчивость МСК к действию агрессивных факторов среды. 4 ил., 3 пр.

 

Изобретение относится к области молекулярной биологии, молекулярной генетики и клеточной биологии и может быть использовано в медицине для разработки новых подходов к терапии различных заболеваний стволовыми клетками.

Стволовые клетки (СК) применяются в клеточной терапии для лечения ряда заболеваний. Известно, что клетки, вводимые в организм с целью терапии, часто массово гибнут под влиянием агрессивной среды больного организма [1-3]. С целью повышения выживаемости МСК предложен метод, получивший название «процедура прекондиционирования СК» [4,5]. Метод предполагает обработку СК стимулирующими факторами, например TNFα [5], LPS [6,7] и лекарственными препаратами [8]. В ряде работ показано, что эффект прекондиционирования основан на стимулировании сигнальных путей, приводящих к активации известного транскрипционного фактора NF-кВ [5-9]. Активация NF-kB приводит к синтезу цитокинов (прежде всего, TNFα [8]), которые увеличивают устойчивость СК к действию различных агрессивных факторов, вызывающих массовую гибель СК. Стволовые клетки, в которых NF-kB предварительно активирован, имеют большие шансы на выживание в организме больного.

Кроме того, в ряде работ показано, что ингибирование р53-сигнального пути в СК способствует повышению жизнеспособности клеток и предотвращает апоптоз стволовых клеток после их трансплантации [14, 15]. Данные литературы позволяют предположить, что активация NF-kB-сигнального пути и ингибирование р53-сигнального пути будет являться безопасным методом повышения эффективности трансплантации СК при терапии в клинике [14].

Один из способов активации NF-kB заключается в использовании лигандов белков семейства TLR. Наиболее часто прибегают к стимуляции в СК рецептора TLR4 (взаимодействует с липополисахаридами, LPS [6, 7]). Таким образом, наиболее близким прототипом изобретения является метод использования в процедуре прекондиционирования LPS - лигандов TLR4 [6, 7]. Недостатком метода является высокая токсичность LPS и способность вызывать воспалительные реакции, в том случае, если вводимый в организм клеточный препарат недостаточно очищен от LPS.

Известно, что NF-kB может быть активирован лигандами рецептора TLR9 (взаимодействует с олигодезоксирибонуклеотидами, которые содержат CpG-последовательность [10]). В литературе не известны примеры использования олигодезоксирибонуклеотидов в процедуре прекондиционирования СК, но содержатся примеры использования олигодезоксирибонуклеотидов (CpG-ODN) в других областях медицины и клеточной биологии [10]. Основным недостатком использования CpG-ODN в терапии является их очень низкая устойчивость к действию экзо- и эндонуклеаз клеток, поэтому синтетические CpG-ODN применяют в очень высоких концентрациях (порядка нескольких тысяч нг/мл [10]), что значительно повышает стоимость лечения.

В основе изобретения лежит использование длинного, двунитевого, CpG-богатого фрагмента ДНК в малых концентрациях (10-50 нг/мл) для проведения процедуры прекондиционирования мезенхимных стволовых клеток с целью повышения их выживаемости при действии агрессивных факторов среды. Фрагмент используемой генетической конструкции длиной ~11 т.п.н. включает CpG- и GC-богатую вставку транскрибируемой области рибосомного повтора человека (область -515 to 5321 (HSU 13369, GeneBank)) и вектор pBR322 (далее «генетическая конструкция»). Нуклеотидная последовательность вставки и вектора указана в приложении 1. Высокое содержание GC-nap в структуре обеспечивает повышенную устойчивость фрагмента к двунитевой фрагментации при действии эндонуклеаз, а 7 CpG-участков в структуре данного фрагмента являются наиболее оптимальными лигандами рецепторов TLR9 человека.

Пример 1. pHRGEE-B стимулирует в жтМСК устойчивость к повреждающему действию этанола.

Мезенхимные стволовые клетки жировой ткани (жтМСК) были получены из коллекции клеток ФГБУ МГНЦ РАМН. От регионального этического комитета получено разрешение на работу с МСК. Использовали культуры клеток 2-4-го пассажа. Клетки культивировали в среде «AmnioMax С_100 (Gibco), AmnioMax Supplement С 100» в СО2 инкубаторе при 37°C. Методом проточной цитометрии показано, что культивируемые МСК содержат маркеры МСК: белки МНС, HLA-ABC+, CD44+, CD54 (low), CD90+, CD106+, CD29+, CD49b (low), CD105+и не содержат маркеров CD34-, CD45-, HLA-DR-, CD117.

Стволовые клетки обладают чувствительностью к действию этилового спирта в концентрации 1% и выше. Спустя трое суток после культивирования жтМСК в присутствии 2% этанола клетки открепляются от носителя, их количество уменьшается и клетки обладают морфологическими признаками апоптотических клеток (фиг. 1). На рисунке изображено влияние генетической конструкции (ГК) на выживаемость МСК в присутствии 2% этилового спирта в среде культивирования. Варианты опыта указаны на рисунке. Пробы ДНК (50 нг/мл) добавляли за 1 час до добавления этанола. Время культивирования клеток в присутствии этанола - 72 часа. Далее клетки фотографировали, используя микроскоп с фазовым контрастом (увеличение 20). При пересеве такой культуры в среде, не содержащей этанол, не наблюдалось роста клеток. Если в среду культивирования одновременно с 2% этанолом вводили генетическую конструкцию в концентрации 50 нг/мл, то уровень гибели клеток значительно уменьшался, значительная часть клеток продолжала деление. При пересеве такой культуры, уровень пролиферации клеток не отличался от уровня контрольных. Геномная ДНК, в отличие от генетической конструкции, обладала очень слабым цитопротекторным действием.

Пример 2. Генетическая конструкция стимулирует в жтМСК устойчивость к повреждающему действию ионизирующего излучения (адаптивный ответ).

Данное утверждение проиллюстрировано на фиг. 2.

А, Б - Определение двунитевых разрывов хроматина с использованием антител к фосфорилированной форме гистона Н2АХ методом микроскопии (А) и проточной цитофлуориметрии (Б, обозначена область, содержащая клетки с двунитевыми разрывами хроматина).

В - Количественный анализ содержания клеток фракции R в популяции облученных МСК, которые культивировали 2 часа после облучения. Перед облучением клетки культивировали в присутствии проб ДНК (3 часа, 50 нг/мл среды). ГК - генетическая конструкция. (*) р<0,05.

Г - Влияние гДНК или генетической конструкции (ГК) на выживаемость МСК после облучения в дозе 2 Гр. Клетки сначала культивировали 24 часа в присутствии проб ДНК (50 нг/мл), далее облучали, меняли среду на свежую и культивировали 48 часов. Использовали стандартный МТТ-тест.A(0)i, A(2Гр)i - поглощение производного МТТ в контрольных и облученных клетках. (*) р<0,01.

На жтМСК воздействовали ионизирующим излучением в дозе 2 Гр. Для этого использовали прибор Арина-2 (РФ) - источник гамма излучения, амплитуда напряжения 160 кВ, максимум 60 кВ мощность дозы 0,16 Гр/мин. После этого клетки культивировали в течение суток. Уровень повреждений оценивали по количеству двунитевых разрывов хроматина ядер (фиг. 2А). Двойные разрывы ДНК анализировали с использованием антител к фосфорилированной форме гистона Н2АХ методом проточной цитофлуориметрии (фиг. 2Б и В)

На фиг. 2Б приводится зависимость флуоресценции клеток, меченых флуорохромированными антителами к Н2АХ, от содержания ДНК в клетках, окрашенных дополнительно пропидий йодидом. Обозначена зона R, которая содержит клетки с двунитевыми разрывами. Пред облучением клетки культивировали три часа в отсутствие экзогенной ДНК (контроль), в присутствии 50 нг/мл гДНК или. Далее клетки облучали и культивировали еще 2 часа, после чего анализировали уровень двунитевых разрывов, который пропорционален количеству гистона Н2АХ в клетках [11]. После облучения количество контрольных клеток, содержащих двунитевые разрывы, увеличивается в 2 раза. Обработка МСК генетической конструкцией достоверно снижает количества клеток с двунитевыми разрывами, причем размер фракции R уменьшается, даже по сравнению с необлученным контролем.

Был проведен стандартный МТТ-тест на жизнеспособность облученных клеток спустя 48 часов после облучения [12]. Тест проводили в 96-луночном планшете. МТТ окрашивает жизнеспособные клетки с активно функционирующими митохондриями. После облучения уровень окраски снижается на 17%, что соответствует уменьшению количества жизнеспособных клеток на 33%. Геномная ДНК практически не влияла на жизнеспособность облученных клеток. Предварительная обработка клеток генетической конструкцией в концентрации 10-50 нг/мл в течение 24 часов значительно уменьшала токсический эффект от действия ионизирующего излучения в дозе 2 Гр - уровень окраски клеток снижался только на 6% (фиг. 2Г).

Пример 3. Генетическая конструкция в низких концентрациях стимулирует экспрессию генов NF-kB-сигнального пути, обеспечивая устойчивость к повреждающему действию этанола.

Данное утверждение проиллюстрировано на фиг. 3.

А - генетическая конструкция (ГК) стимулирует экспрессию на уровне РНК гена TLR9 (метод количественной ПЦР). Б - генетическая конструкция (ГК) стимулирует экспрессию белка TLR9 (метод проточной цитофлуориметрии).

В - генетическая конструкция (ГК) стимулирует экспрессию на уровне РНК ряда генов, ассоциированных с активацией транскрипционного фактора NF-kB (метод количественной ПНР). ТВР - ген внутреннего стандарта.

Г - генетическая конструкция (ГК) индуцирует увеличение концентрации TNFα в среде культивирования жтМСК, время культивирования указано по оси X (метод ELISA, использовали наборы «Cytokine» (Санкт-Петербург, РФ).

Д, Е - генетическая конструкция (ГК) стимулирует транслокацию фактора NF-kB в ядро клеток (метод флуоресцентной микроскопии, окраска антителами к р65 компоненте фактора, фирма US Biological, США). Число клеток, содержащих ядерный NF-kB подсчитывали визуально, анализируя 30 видеоизображении (увеличение 20).

Условия: концентрация добавленных проб ДНК (гДНК или генетической конструкции) составляла 10-50 нг/мл среды. Время культивирования - 3 часа (А); 0,5-3,5 часа (Б, Д); 24 часа (В).

(*) р<0,05, сравнение с контролем (статистика Манна-Уитни).

Ранее авторами заявки было показано, что генетическая конструкция в концентрации 50 нг/мл обладает свойством стимулировать транскрипционную активность генов TLR-зависимого сигнального пути и ингибировать апоптоз [13]. В среду культивирования жтМСК добавляли 10-50 нг/мл геномной ДНК человека (гДНК), ДНК вектора pBR322 или генетическую конструкцию. Клетки инкубировали 3 часа, далее из клеток выделяли РНК с использованием набора «Yellow Solve» (Clonogen, Санкт-Петербург). ПЦР в реальном времени проводили на приборе «StepOnePlus instrument (Applied Biosystems)». Использовали праймеры: TLR9 (F:CCCACCTGTCACTCAAGTACA, R:GTGGCTGAAGGTATCGGGATG); TBP (reference gene) (F:GCCCGAAACGCCGAATAT, R: CCGTGGTTCGTGGCTCTCT). Из трех образцов ДНК при низких концентрациях только генетическая конструкция, содержащая фрагмент рибосомного повтора человека, стимулирует 3-кратное увеличение количества PHKTLR9 (фиг. 3А). Экспрессия TLR9 на уровне белка в присутствии гентической конструкции возрастает в 4 раза (фиг. 3Б, метод проточной цитометрии). Геномная тотальная ДНК, напротив, вызывает уменьшение экспрессии белка TLR9.

Стимуляция экспрессии рецептора TLR9 в присутствии генетической конструкции приводит к увеличению экспрессии ряда генов сигнального пути, приводящего к активации транскрипционного фактора NF-kB (фиг. 3В). Активация фактора подтверждается его транслокацией из цитоплазмы в ядра клеток (фиг. 3Д, Е). В результате в среде культивирования умеренно возрастает концентрация цитокина TNFa (фиг. 3Г), который является одним из медиаторов, повышающих устойчивость СК к стрессу [8]. Геномная ДНК и вектор pBR322 в низкой концентрации практически не влияют на уровень TNFα в среде культивирования.

На фиг. 4 показано следующее.

Генетическая конструкция (ГК) на фоне 2% этилового спирта стимулирует экспрессию на уровне РНК ряда генов, ассоциированных с активацией транскрипционного фактора NF-kB (Б), генов р-53- сигнального пути, гена репарации BRCA1 (Г), антиапоптотических генов (Е). Уровень экспрессии генов в МСК при действии 2% этилового спирта (А, В, Д). Метод количественной ПЦР. ТВР - ген внутреннего стандарта. Используемые праймеры:

Условия: концентрация генетической конструкции составляла 50 нг/мл среды. Время культивирования - 24 часа (Б, Г); Д, Е - указано на рисунке.

(*) р<0,05, сравнение с контролем (статистика Манна-Уитни).

При действии 2% этилового спирта большинство генов NF-kB-сигнального пути не повышает или снижает транскрипционную активность по сравнению с контролем (фиг. 4А). При одновременном добавлении генетической конструкции и 2%-ного этилового спирта происходит активация транскрипции многих генов NF-kB-сигнального пути (фиг. 4Б).

2% этиловый спирт активирует транскрипционную активность генов р53-сигнального пути по пути индукции процесса апоптоза в МСК: через 24 часа после добавления к стволовым клеткам 2%-ного этилового спирта увеличивается уровень экспрессии генов CDKN2 и CDKN1A - ингибиторов клеточного цикла, снижается экспрессия гена BRCA1, участвующего в процессах репарации ДНК, на 60-70% повышена экспрессия проапоптотических генов В АХ и APAF1, на 40% повышен уровень экспрессии супрессора опухолевого роста р53, но снижена экспрессия гена MDM2, ингибитора р53 (фиг. 4В). Уровень экспрессии антиапоптотических генов несколько возрастает при действии спирта в течение 3 часов - клетки активируют защитные механизмы, повышая экспрессию антиапоптотических генов, но уже через 24 часа уровень экспрессии генов BCL2, BCL2A1, BCL2L1, BIRC2(c-IAP1) и BIRC3 (с-1АР2) падает ниже контрольного уровня - уровня экспрессии генов в культуре клеток без добавления спирта (фиг. 4Д).

При активации р53-сигнального пути запускаются процессы, задерживающие деление клеток, в результате чего-либо репарируются повреждения ДНК, либо клетка подвергается апоптозу [14]. В присутствии генетической конструкции при культивировании МСК в присутствии спирта, повышается уровень экспрессии гена р53 на 30%, но при этом уровень экспрессии гена MDM2, ингибитора р53, повышается в большей степени - на 60%; незначительно повышен уровень экспрессии генов CDKN2 и CDKN1A, не изменяется уровень экспрессии проапоптотического гена APAF1 и снижен уровень экспрессии гена ВАХ; в 2,3 раза, повышен уровень экспрессии гена BRCA1 (фиг. 4Г).

Генетическая конструкция, добавленная к МСК на фоне спирта и одновременно со спиртом, активирует антиапоптотические процессы в клетках, вызывая повышение экспрессии антиапоптотических генов BCL2, BCL2A1, BCL2L1, BIRC2(c-IAP1) и BIRC3 (с-1АР2) в СК (фиг. 4Д).

Таким образом, р53-сигнальный путь при действии ГЦ-богатой плазмиды активирован в направлении, противоположном, чем при действии спирта - происходит временная остановка клеточного цикла с активацией процессов репарации, при этом не активируются процессы апоптоза.

Список цитируемой литературы

1. Pouzet В, Vilquin JT, Hagege AA et al. Factors affecting functional outcome after autologous skeletal myoblast transplantation. Ann Thorac Surg. 2001; 71: 844-850.

2. Niagara MI, Haider HKh, Jiang S et al. Pharmacologically preconditioned skeletal myoblasts are resistant to oxidative stress and promote angiomyogenesis via release of paracrine factors in the infarcted heart. Circ Res. 2007; 2; 100(4): 545-55.

3. Toma C. Pittenger MF. Cahill KS. et al. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation. 2002; 1: 93-98.

4. Haider HKh, Ashraf M. Strategies to promote donor cell survival: combining preconditioning approach with stem cell transplantation. J Mol Cell Cardiol. 2008; 45(4): 554-66.

5. Kim YS, Park HJ, Hong MH et al. TNF-alpha enhances engraftment of mesenchymal stem cells into infarcted myocardium. Front Biosci. 20091; 14: 2845-56.

6. Yao Y, Zhang F, Wang L et al. Lipopolysaccharide preconditioning enhances the efficacy of mesenchymal stem cells transplantation in a rat model of acute myocardial infarction. J Biomed Sci. 2009 Aug 20; 16:74.

7. Wang ZJ, Zhang FM, Wang LS et al. Lipopolysaccharides can protect mesenchymal stem cells (MSCs) from oxidative stress-induced apoptosis and enhance proliferation of MSCs via Toll-like receptor(TLR)-4 and PI3K/Akt. Cell Biol Int. 2009; 33(6): 665-74.

8. Afzal MR, Haider HKh, Idris NM et al. Preconditioning promotes survival and angiomyogenic potential of mesenchymal stem cells in the infarcted heart via NF-kappaB signaling. Antioxid Redox Signal. 2010; 12(6): 693-702.

9. Sarkar FH, Li Y, Wang Z, Kong D. NF-kappaB signaling pathway and its therapeutic implications in human diseases. Int Rev Immunol. 2008; 27(5): 293-319.

10. Akira S, Sato S. Toll-like receptors and their signaling mechanisms. Scand J Infect Dis 2003; 35(9): 555-62.

11. M. Lobrich, A. Shibata, A. Beucher et al. yH2AX foci analysis for monitoring DNA double-strand break repair. Strengths, limitations and optimization. Cell Cycle 2010; 9: 662-669.

12. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983; 65(1-2): 55-63.

13. C.B. Костюк, E.M. Малиновская, A.B. Ермаков и др. Фрагменты внеклеточной ДНК усиливают транскрипционную активность генома мезенхимальных стволовых клеток человека, активируют TLR-зависимый сигнальный путь и ингибируют апоптоз. Биомедицинская химия. 2012; 58(6): 673-683.

14. A. Insinga, A. Cicalese, М. Faretta et al. DNA damage in stem cells activates p.21, inhibits p.53, and induces symmetric self-renewing divisions. Proc Natl Acad Sci USA. 2013; 110(10): 3931-3936.

15. M. Khan, S. Akhtar, S. Mohsin et al. Growth factor preconditioning increases the function of diabetes-impaired mesenchymal stem cells. Stem Cells Dev. 2011; 20(1): 67-75.

Применение генетической конструкции, включающей CpG- и GC-богатую вставку транскрибируемой области рибосомного повтора человека (область от -515 до 5321 (HSU13369, GeneBank)) и вектор pBR322, в низких концентрациях (10-50 нг/мл) для индуцирования в мезенхимных стволовых клетках выраженного адаптивного ответа, который повышает устойчивость МСК к последующему действию агрессивных факторов среды.



 

Похожие патенты:

Настоящее изобретение относится к миметикам ПАР и способу их получения для создания новых медицинских препаратов общей формулы где Y - остаток нуклеозида, аминопроизводного алифатического соединения, флуоресцентного красителя; Z - остаток нуклеозида, (k+1)·m=1-200; X является О или S; R1 и R2 являются остатком дисахаридного нуклеозида или остаток формул где n=2-6; 2-6 или 1-4 соответственно, N=остаток нуклеозида, или -((CH2)nO)m-(P=X(OH))O-N-, где n=2-6, m=1-6, R3 представляет собой разветвитель формулы где N′- остаток дисахаридного нуклеозида, n число до 100, или остаток формул n=2-6; или n=2-6; или n=1-4 где В=аденин-9-ил, урацил-1-ил, цитозин-1-ил или гуанин-9-ил.

Изобретение относится к области биотехнологии, конкретно к использованию антисмыслового олигонуклеотида ISIS 301012 для долгосрочного понижения уровней АроВ, и может быть использовано в медицине.

Изобретение относится к генной инженерии, а также к медицине, а именно к нейрохирургии и травматологии. Описана геннотерапевтическая конструкция, кодирующая эндотелиальный сосудистый фактор роста (VEGF) и фактор роста фибробластов (FGF-2).

Изобретение относится к области биохимии, в частности к способам получения растения с повышенной устойчивостью к засухе и действию солей по сравнению с диким видом растения путем снижения экспрессии/функции белка-фактора транскрипции у растения.

Изобретение относится к области биохимии, в частности к кодон-оптимизированным последовательностям ДНК. Заявлены кодон-оптимизированные кДНК, кодирующие фактор стромальных клеток 1 альфа и сосудистый эндотелиальный фактор роста изоформы 165, а также содержащая их рекомбинантная плазмида.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного.

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа.

Изобретение относится к олигопептидам, содержащим последовательность NLSSAEVVV (SEQ ID NO:6), в которой одна или две аминокислоты могут быть замещены, имеющим индуцибельность цитотоксических Т-клеток, их фармацевтическим композициям и применению для изготовления противораковых вакцин.

Изобретение относится к биотехнологии и предоставляет собой способ получения полезных метаболитов с использованием бактерии семейства Enterobacteriaceae, в частности бактерии, принадлежащей к роду Escherichia, которая модифицирована таким образом, что она содержит генетическую экспрессионную систему, включающую транскрипционный аппарат, регулируемый белком типа LysR, и модифицированную таким образом, что самоиндуцируемая положительная регуляция по типу обратной связи указанной системы опосредована коиндуктором.

Настоящее изобретение относится к области иммунологии. Предложен выделенный пептид, обладающий способностью индуцировать цитотоксические Т-лимфоциты (ЦТЛ) в присутствии антигенпредставляющих клеток (АПК), несущих HLA-A*2402, и представляющий собой фрагмент белка FOXM1. Также рассмотрены: выделенный полинуклеотид, кодирующий пептид по изобретению; композиция для индуцирования ЦТЛ и фармацевтическая композиция для лечения и/или профилактики рака, экспрессирующего FOXM1, и/или предупреждения его послеоперационных рецидивов, содержащие в качестве активного начала пептид по изобретению; способы индуцирования АПК и ЦТЛ; выделенная АПК со способностью индуцировать ЦТЛ; а также способ индуцирования иммунного ответа против рака, экспрессирующего FOXM1, у субъекта. Данное изобретение обеспечивает индуцирование иммунного ответа против клеток, экспрессирующих FOXM1, что может найти дальнейшее применение в терапии различных заболеваний, в том числе злокачественных, связанных с повышенной экспрессией белка FOXM1. 8 н. и 3 з.п. ф-лы, 3 ил., 2 табл.

Изобретение относится к генной инженерии, биохимии, биотехнологии и иммунологии. Описано получение синтетических генов D3S, D3E и D3D, оптимизированных для гетерологичной экспрессии в непатогенных лабораторных штаммах Escherichia coli. Указанные гены кодируют рецептор-связывающие домены III белка Ε оболочки вируса клещевого энцефалита (ВКЭ). На основе генов D3S, D3E и D3D получают рекомбинантные плазмиды pDBD2-D3S, pDBD2-D3E и pDBD2-D3D, которые кодируют бифункциональные рекомбинантные белки, различающиеся по аминокислотному составу в позициях 166, 170, 184, 211 и определяющие принадлежность к трем основным генетическим типам вируса. Изобретение также включает штаммы-продуценты химерных белков Е. coli M15 [pREP4, pDBD2-D3S], Ε. coli M15 [pREP4, pDBD2-D3E] и Ε. coli M15 [pREP4, pDBD2-D3D], а также способ иммобилизации, концентрирования и очистки полученных белков на декстрансодержащем сорбенте. Изобретение относится к рекомбинантным белкам DBD2-D3S, DBD2-D3E и DBD2-D3D, предназначенным для использования в качестве антигенов, иммобилизованных в лунках 96-луночного планшета или стрипах, в составе набора диагностических маркеров для выявления антител к ВКЭ в сыворотке крови и ликворе человека методом ИФА, а также к иммуногенной композиции, содержащей иммобилизованные на декстране рекомбинантные белки и направленной на специфическую активацию иммунитета и формирование иммунологической памяти в отношении вируса. Изобретение позволяет получать штаммы-продуценты, обеспечивающие высокий уровень продукции рекомбинантных белковых антигенов DBD2-D3S, DBD2-D3E и DBD2-D3D, с целью последующего использования для иммунопрофилактики ВКЭ, дифференциальной диагностики флавивирусных инфекций и оценки напряженности иммунитета. 7 н. и 7 з.п. ф-лы, 7 ил.

Настоящее изобретение относится к биотехнологии и представляет собой выделенный вариант субтилизина Bacillus, где указанный вариант субтилизина является зрелой формой, обладающей активностью субтилизина и содержащий замену в положениях 118 и 213, где нумерация положений соответствует аминокислотной последовательности субтилизина BPN′ В. Amyloliquefaciens с последовательностью SEQ ID NO: 1, где указанный субтилизин Bacillus представляет собой FNA, и где указанный вариант субтилизина дополнительно содержит комбинации замен. Изобретение относится также к способу очистки ткани с использованием указанного варианта субтилизина. Изобретение позволяет получать варианты субтилизина с увеличенным уровнем экспрессии белка. 5 н.п. ф-лы, 5 ил., 4 табл. 4 пр.

Изобретение относится к биотехнологии и представляет собой дипептид-продуцирующую бактерию рода Escherichia, которая модифицирована таким образом, что она содержит ДНК, кодирующую белок с дипептид-синтезирующей активностью. Изобретение относится также к способу получения дипептида или его соли с использованием такой бактерии или с использованием белка с дипептид-синтезирующей активностью. Изобретение позволяет эффективно получать дипептиды. 3 н. и 13 з.п. ф-лы, 28 ил., 12 табл., 14 пр.

Изобретение относится к биохимии. Представлен набор олигонуклеотидных праймеров, инициирующий амплификацию полной нуклеотидной последовательности СР-гена PVY методом ОТ-ПЦР. Набор представлен следующими праймерами - «PVY-CP-f1»: 5′-СТТАТGААGТАСАССАТСААG-3′ и «PVY-CP-r2»: 5′-TACAGGAAAAGCCAAAATACT-3′. Изобретение позволяет оценить полиморфизм концевых последовательностей гена оболочечного белка данного вируса. 4 ил., 2 табл.

Изобретение относится к области биохимии, в частности к соединениям и композициям для ослабления экспрессии гентингтина. Заявлены варианты одноцепочечного модифицированного олигонуклеотида, ингибирующего экспрессию гентингтина. Олигонуклеотид содержит гэп-сегмент из десяти дезоксинуклеозидов, 5′-фланкирующий сегмент из пяти нуклеозидов и 3′-фланкирующий сегмент из пяти нуклеозидов. Гэп-сегмент расположен между 5′- и 3′-фланкирующими сегментами, где все нуклеозиды фланкирующих сегментов содержат 2′-O-метоксиэтил-модифицированный сахар. Межнуклеозидные связи в гэп-сегменте, связи, соединяющие гэп-сегмент с 5′- или 3′-фланкирующим сегментом, и связи для самого крайнего с 5′-конца и самого крайнего с 3′-конца нуклеозидов каждого из фланкирующих сегментов являются фосфоротиоатными связями; межнуклеозидные связи, соединяющие остальные нуклеозиды обоих фланкирующих сегментов, являются фосфодиэфирными связями. Все цитозины являются 5-метилцитозинами. Также заявлены композиция и способы для лечения, профилактики, замедления или облегчения болезни Гентингтона или ее симптомов. Изобретение позволяет повысить ингибирующую активность в ингибировании экспрессии гентингтина. 10 ил., 95 табл., 21 пр.

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ получения представляющего интерес белка, включающему введение вектора экспрессии белка, который включает генный фрагмент, содержащий ДНК, кодирующую представляющий интерес белок, и ген селектируемого маркера, а также транспозонные Tol1 или Tol2 последовательности на обоих концах генного фрагмента, в суспензионную клетку млекопитающего СНО, адаптированную к суспензионному культивированию, или клетку PER.C6, клетки крысиной миеломы YB2/3HL.Р2.G11.16Ag.20 (или также называемой YB2/0), или клетку мышиной миеломы NS0, адаптированную к суспензионному культивированию; интегрирование генного фрагмента, вставленного между парой транспозонных последовательностей, в хромосому клетки млекопитающего для получения клетки млекопитающего, способной экспрессировать представляющий интерес белок; и суспензионное культивирование клетки млекопитающего; при этом суспензионная клетка млекопитающего способна экспрессировать представляющий интерес белок, а также предложены способ получения клетки млекопитающего, соответствующая рекомбинантная клетка и применение вектора экспрессии. 6 н. и 23 з.п. ф-лы, 8 ил., 3 табл., 6 пр.

Изобретение относится к области генной инженерии и генной терапии и может быть использовано для стимуляции роста и регенерации нервов и восстановления иннервации ишемизированных тканей. Изобретение представляет собой способ стимуляции восстановления иннервации поврежденной ткани у млекопитающих с использованием оптимизированного для экспрессии в клетках млекопитающих гена, кодирующиего активатор плазминогена урокиназного типа (урокиназу, uPA). Изобретение также касается плазмидной конструкции, содержащей указанный оптимизированный ген урокиназы и последовательность Козак. Изобретение позволяет ускорить восстановление структуры и проводимости периферических нервов после травм и ишемии путем трансфекции мышц, иннервируемых поврежденным нервом. 3 н. и 2 з.п. ф-лы, 7 ил., 1 табл., 4 пр.

Изобретение относится к биотехнологии, в частности к генетической инженерии. Предложен способ доставки нуклеиновых кислот в эукариотические клетки, предусматривающий трансфекцию методом кальций-фосфатной преципитации в присутствии гистона Н1.3 в эффективном количестве. Способ повышает эффективность трансфекции. 9 ил.

Группа изобретений относится к области биотехнологии, в частности к антисмысловым олигомерам, используемым в качестве активного ингредиента в фармацевтических композициях для лечения мышечной дистрофии. Антисмысловой олигомер состоит из нуклеотидной последовательности, 100% комплементарной нуклеотидной последовательности-мишени или нуклеотидной последовательности, в которой 1 или 2 нуклеотида, не комплементарные нуклеотидной последовательности-мишени, содержатся в нуклеотидной последовательности, 100% комплементарной нуклеотидной последовательности-мишени. Нуклеотидная последовательность-мишень представляет собой любую из последовательностей, состоящую из нуклеотидов с 32-го по 56-й или с 36-го по 56-й с 5′-конца 53-го экзона в гене дистрофина человека. При этом 53-й экзон в гене дистрофина человека обладает нуклеотидной последовательностью, выбранной из (a) и (b): (a) нуклеотидная последовательность SEQ ID NO: 1 и (b) нуклеотидная последовательность, обладающая по меньшей мере 90% идентичностью с нуклеотидной последовательностью SEQ ID NO: 1. Данный олигомер эффективно обеспечивает вызов пропуска 53-го экзона в гене дистрофина человека. 2 н. и 11 з.п. ф-лы, 19 ил., 7 табл., 6 пр.
Наверх