Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia slovaca



Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia slovaca
Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia slovaca
Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia slovaca

 


Владельцы патента RU 2560422:

Федеральное государственное учреждение науки "Омский научно-исследовательский институт природноочаговых инфекций" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia slovaca. Представлено применение штамма Rickettsia slovaca "Карпунино-19/69", депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под номером 155, для получения препаратов для диагностики риккетсиоза, вызываемого Rickettsia slovaca. Штамм риккетсий "Карпунино - 19/69" изолирован на территории РФ и является этиологическим агентом лимфоаденопатии от присасывания клеща - синдрома TIBOLA: от «tick-borne lymphoadenopathy». Охарактеризованное решение может быть использовано для идентификации риккетсий группы клещевой пятнистой лихорадки и получения диагностических препаратов. 3 пр.

 

Изобретение относится к области биотехнологии. Штамм риккетсий "Карпунино-19/69" является первым представителем вида Rickettsia slovaca, изолированным на территории РФ. На основании изучения фенотипических и генотипических признаков штамм отнесен к порядку Rickettsials, семейству Rickettsiaceae, роду Rickettsia, виду Rickettsia slovaca. По результатам изучения и сравнения нуклеотидных последовательностей гена gltA и гена ompA имеет 100% гомологии с Rickettsia slovaca, типовым штаммом "13-В". Штамм "Карпунино-19/69" культивируется в культуре клеток Vero.

R.slovaca впервые была выделена в бывшей Чехословакии (Brezina R. et al., 1969 и др.). Установлено распространение риккетсий этого вида в большистве стран Западной и Восточной Европы (Parola P. et al., 2005, Oteo J.A et al., 2006; Vitorino L. et al., 2007). В отличие от типового штамма R.slovaca «13-В», выделенного в Словакии, заявляемый нами штамм "Карпунино-19/69" выделен в биопробе и патогенен для морских свинок, вызывая лихорадочную реакцию с умеренно выраженным периорхитом у части животных. Ввиду наличия феномена внутривидовой гетерогенности R.slovaca (Eremeeva М., et al, 1993), наиболее оптимальным вариантом считается выбор штаммов-продуцентов для производства диагностических препаратов среди «местных» штаммов, циркулирующих в регионе, в котором планируется применение данных диагностических препаратов.

В 2001 г. R.slovaca была генотипирована в иксодовых клещах рода D.marginatus на двух административных территориях Европейской части России - в Воронежской области и Ставропольском крае (Шпынов С.Н. и др., 2001).

В последнее время R.slovaca рассматривается как этиологический агент лимфоаденопатии от присасывания клеща - синдрома TIBOLA: от «tick-borne lymphoadenopathy». Первый случай инфекционного заболевания, вызванного R.slovaca, описан в 1997 году (Raoult D. et al., 1997). В настоящее время в Европе подтверждены несколько случаев синдрома TIBOLA, связанных с R.slovaca, главным образом в Венгрии, Франции и Испании (Lacos А., 1997; Ibarra V. et al., 2003; Cazorla С et al., 2003). Заболеваемость синдромом TIBOLA, вызываемым R.slovaca, в настоящее время в России не регистрируется, поскольку диагностические препараты для верификации данного риккетсиоза в РФ не выпускаются. Диагноз риккетсиоза, ассоцированного с R.slovaca, может быть поставлен только при лабораторном обследовании с использованием тест-систем на основе производственных штаммов R.slovaca.

Штамм "Карпунино-19/69" выделен в 1969 году в биопробе на морских свинках из имаго клещей Dermacentor marginatus, собранных с растительности в окрестностях с. Карпунино Мокроусовского района Курганской области.

Штамм R.slovaca "Карпунино-19/69" хранится во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под инвентарным номером 155 от 5 октября 2010 г.

Задача изобретения - оригинальный штамм Rickettsia slovaca, который может быть использован для разработки и изготовления диагностических препаратов (наборов реагентов).

Технический результат - использование штамма Rickettsia slovaca "Карпунино-19/69" в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого Rickettsia slovaca. Заявляемый штамм обладает биологически и технологически значимыми свойствами, такими как: генетическая идентичность типовому штамму R.slovaca, способность активно размножаться на культуре клеток Vero и накапливать производственную биомассу в процессе культивирования, что позволяет использовать его для серийного (коммерческого) выпуска диагностических препаратов (наборов реагентов). Использование штамма Rickettsia slovaca "Карпунино-19/69" в качестве продуцента диагностических препаратов позволяет оптимизировать лабораторную диагностику риккетсиозов.

Выделенный штамм R.slovaca "Карпунино-19/69" характеризуется следующими признаками.

Морфологические признаки. Типичны для риккетсий, но чаще других встречаются кокковидные и палочковидные формы (типы a и b по классификации П.Ф. Здродовского). Грамотрицательны.

Культуральные свойства. Успешно пассируются в культуре клеток Vero с накоплением до 3 крестов в поле зрения, с локализацией как в цитоплазме, так и в ядрах клеток. Размножается в развивающихся куриных эмбрионах с накоплением до 3 крестов в поле зрения, вызывает гибель эмбрионов на 5-6 день после заражения.

Пассажная характеристика. Штамм выделен в 1969 г. в биопробе на морских свинках и высушен на 2 пассаже. Культура штамма R.slovaca "Карпунино-19/69" рекультивирована в культуре клеток Vero и повторно лиофильно высушена на 4 пассаже в 2008 г.

Антигенные свойства. Антигенные детерминанты R. slovaca выявляются методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы КПЛ люминесцирующими, сухими (НПО «Биомед»).

Вирулентные свойства. При внутрибрюшинном заражении морских свинок-самцов штамм вызывает 2-6-дневную лихорадочную реакцию с умеренно выраженным периорхитом у части животных.

Генотипические характеристики.

Определена нуклеотидная последовательность гена цитратсинтазы длиной 1234 п.о. штамма "Карпунино-19/69", которая имеет 100% гомологии с депонированной в GenBank нуклеотидной последовательностью Rickettsia slovaca (U 59725):

Последовательность нуклеотидов гена ompA штамма "Карпунино-19/69" длиной 590 п. о. имеет 100% гомологии с депонированной в GenBank нуклеотидной последовательностью Rickettsia slovaca (U43808):

На основании морфологических, антигенных и генетических признаков изолированный штамм относят к роду Rickettsia виду Rickettsia slovaca.

Изобретение иллюстрируется следующими примерами.

Пример 1. Идентификация на основании генотипических признаков. Экстракция ДНК.

Экстракцию риккетсиальной ДНК из пробы культур клеток осуществляют, применяя QIAamp Tissue Kit (QIAGEN, Hilden, Germany) и протеиназу К в концентрации 2,0 мг/мл (Boehringer Mannheim, Mannheim, Germany) в соответствии с протоколом QIAamp Tissue Kit.

Полимеразная цепная реакция (ПЦР) и секвенс-реакция.

Полимеразную цепную реакцию (ПЦР) и секвенс-реакцию выполняют, применяя праймеры, специфичные для Rickettsiae, используют две пары праймеров, амплифицирующие gltA ген, кодирующий цитрат синтетазу: CS1d (5-ATGACTAATGGCAATAATAA-3) и CS535r (5-GAATATTTATAAGACAT-TGC-3), CS409d (5-CCTATGGCTATTATGCTTGC-3) и RP1258n (5-ATTGCAAAAAGTACAGTGAACA-3), а также праймеры 190.70 (ATGGCGAATATTTCTCCAAAA), 190.180 (GCAGCGATAATGCTGAGTA) и 190.701 (GTTCCGTTAATGGCAGCATCT), амплифицирующие ompA ген, кодирующий белок наружной мембраны (Roux, V., et al., 1997; Fournier, P-E., et al., 1998).

ПЦР выполняют в термоцикл ере Peltier модель РТС-200 (Mj Research, Inc, Watertown, MA). Реакционная смесь для каждой пробы содержит 10 pmol каждого праймера, 0,5 единиц полимеразы (Elongase, GibcoBRL), 20 mM каждого дезоксинуклеозидтрифосфата, 1,8 mM MgCl2 и 7,5 мкл ДНК от каждой пробы, финальный объем составляет 25 мкл. Амплификацию выполняют по следующей программе: 3 мин инициальной денатурации при 94°C, в последующих 44 циклах 30 сек денатурации при 94°C, 30 сек отжиг праймеров при температуре 55°C, 90 сек элонгации при 68°C и 7 мин финальная элонгация при температуре 68°C. Каждая постановка ПЦР включает отрицательный контроль (дистиллированная вода) и положительный контроль (ДНК R. montanensis).

Пурификацию ПЦР-продукта проводят, применяя QIAquick PCR Purification Kit (Germany) в соответствии с протоколом.

Секвенс-реакцию с ПЦР-продуктами выполняют, применяя d-Rhodamine Terminator Cycle Sequencing Ready Reaction kit (Applied Biosistems, Warrington, UK). Секвенирование выполняют на ABI 3100 PRISM (Applied Biosystems) автоматическом секвенаторе. Анализ полученных нуклеотидных последовательностей для сравнения степени гомологии с последовательностями Банка данных GenBank проводят с помощью программы BLAST в режиме прямого доступа.

Пример 2. Идентификация на основании фенотипических (культуральных и антигенных) свойств.

Культивирование риккетсий.

Клеточные культуры выращивают по стандартной методике Соловьева, Бектемирова 1972 г., в качестве ростовой среды используют Игла MEM с двойным набором аминокислот с добавлением 10% эмбриональной сыворотки. Отпимальная посевная доза 100-150 тыс. клеток на 1 мл. На следующие сутки после образования монослоя клеточную культуру используют для заражения.

Заражение культур клеток.

Клеточную культуру во флаконе заражают 50% суспензией, полученной из высушенной культуры штамма, в дозе 0,5 мл на флакон. Флаконы с зараженными клетками центрифугируют при 800 об/мин при температуре 22° в течение 30 мин, после центрифугирования во все флаконы добавляют среду поддержки (Игла MEM с добавлением 1% эмбриональной сыворотки) в объеме 1,5 мл на флакон (Raouit D., 2000). Флаконы с зараженными клетками культивируют в углекислотном термостате при температуре 37°C в течение 8 суток. После завершения инкубации все флаконы подвергают замораживанию в низкотемпературном холодильнике при -20°C, затем размораживают для разрушения клеток и максимального выхода из них микроорганизмов. После оттаивания материал центрифугируют 10 минут при 3000 об/мин, супернатант в объеме 0,5 мл берут на следующий пассаж, а из 0,2 мл делают мазки, остатки супернатанта хранят в криопробирках в низкотемпературном холодильнике. Инфицированность и стерильность культуры клеток определяют в мазках, окрашивая их по Романовскому-Гимза.

Полученные образцы исследуют методом флюоресцирующих антител по стандартной методике, используют иммуноглобулины диагностические для выявления риккетсий группы КПЛ, люминесцирующие сухие (ФГУП «НПО «Микроген» г. Пермь). Изучение морфологических и тинкториальных свойств проводят по методу Здродовского (Здродовский, Голиневич, 1972).

Пример 3.

Приготовление цельнорастворимых антигенов.

Для приготовления антигена зараженные культуры клеток подвергают центрифугированию при 6000 оборотах в минуту в течение 20 минут, далее удаляют супернатант, а из полученной взвеси делают мазки, которые окрашивают по Романовскому-Гимза.

После микроскопического контроля во взвесь зараженных клеток добавляют физиологический раствор и 0,5% фенол. После встряхивания в шейкере пробирки с зараженной клеточной взвесью помещают в рефрижератор на 3-4 дня для осаждения посторонних белковых примесей.

После этого клеточную взвесь подвергают многократной эфирной обработке по Craigie (1945 г.). При первой эфирной обработке к материалу добавляют 1,5-2 объема наркозного эфира и после встряхивания оставляют при комнатной температуре до следующего дня в темном месте. Затем водную фазу отделяют и второй раз обрабатывают эфиром (равный объем эфира в отношении водной фазы), встряхивают и оставляют на 2 часа, затем водную фазу вновь отделяют и в третий раз обрабатывают эфиром (1/2 объема эфира по отношению к объему водной фазы) таким же образом.

После третьей обработки при образовании среднего тканевого слоя делают повторную эфирную обработку. После окончания эфирной обработки производят отгонку эфира под небольшим вакуумом. Пробирки с антигеном оставляют в течение суток в холодильнике для испарения эфира. Полученные серии антигенов испытывают в реакции связывания комплемента РСК на антикомплементарность, специфичность, чувствительность и устанавливают титр. Также антигены стандартизуют по уровню аминного азота методом формольного титрования (%) и белка с помощью биуретовой реакции (%). После испытания антигены разливают в ампулы по 1,0 мл и лиофильно высушивают. Высушенный антиген хранят при температуре -20C.

Приготовление корпускулярного антигена.

После завершения культивирования культуру зараженных клеток замораживают при -20C°, а потом оттаивают для разрушения клеток и максимального выхода из них риккетсий. Материал центрифугируют 10 минут при 3000 оборотах в минуту. Супернатант используют для нанесения корпускулярного антигена на стекла и проведения реакции непрямой иммунофлюоресценции для исследования сывороток больных клещевыми инфекциями.

Изучение антигенных свойств.

А) Антигенные детерминанты штамма R.slovaca "Карпунино-19/69" в культуре клеток выявляют методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы КПЛ, люминесцирующими сухими (ФГУП «НПО «Микроген», г. Пермь);

Б) Для выявления антител к R.slovaca сыворотки крови больных исследуют в реакции непрямой флюоресценции с корпускулярным антигеном штамма "Карпунино-19/69", полученным в культуре клеток Vero. Визуализацию реакции антиген-антитело выполняют с использованием иммуноглобулинов диагностических флуоресцирующих антивидовых против иммуноглобулинов человека, сухих («ИНГАМАЛ» г. Москва).

Таким образом, штамм имеет 100% гомологии с типовым штаммом Rickettsia slovaca "13-В" по результатам сравнения нуклеотидных последовательностей гена gltA и гена ompA, активно размножается на культуре клеток Vero, что позволяет в процессе культивирования накапливать производственную биомассу. С учетом этого он может быть использован в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого Rickettsia slovaca.

Применение штамма Rickettsia slovaca "Карпунино-19/69", депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под номером 155, для получения препаратов для диагностики риккетсиоза, вызываемого Rickettsia slovaca.



 

Похожие патенты:

Представленное изобретение относится к области биотехнологии и касается способа обнаружения провируса лейкоза крупного рогатого скота. Охарактеризованный способ включает выявление фрагмента LTR (Long Terminal Repeat) - последовательности провируса лейкоза.

Группа изобретений относится к области лизиса клеток. Предложен способ избирательного лизиса животных клеток, а также прибор для обнаружения микроорганизмов.

Изобретения относятся к области медицинской микробиологии и касаются способа дифференциации токсигенных генетически измененных штаммов V.cholerae биовара Эль Тор и тест-системы.

Изобретение относится к медицинской микробиологии. Может быть использовано для культивирования и идентификации урогенитальных микоплазм, в частности Mycoplasma hominis.
Группа изобретений относится к биотехнологии. Варианты питательной среды для селективного накопления энтеробактерий содержат панкреатический гидролизат рыбной муки, либо пептон мясной, либо панкреатический гидролизат рыбной муки и пептон мясной (в соотношении 1:1), желчь очищенную модифицированную (ЖОМ), натрий хлористый, глюкозу, калий фосфорнокислый однозамещенный и бриллиантовый зеленый в заданном соотношении.
Изобретение касается набора олигонуклеотидных праймеров и зондов для идентификации и субтипирования ДНК бактерии Pasteurella multocida серотипов А, B, D, E, F методом ПЦР в режиме реального времени.

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами.
Изобретение относится к пищевой микробиологии, в частности к получению питательной среды для определения в кондитерских изделиях, микроорганизмов, вырабатывающих липазы.

Изобретение относится к электрохимическим методам анализа, а именно к иммуноанализу, в частности к определению содержания патогенных микроорганизмов в различных объектах и средах.
Изобретение относится к медицине и может быть использовано для выявления продуцирующих уреазу микроорганизмов, в частности Helicobacter pylori. Для этого проводят экспресс-анализ на диагностических дисках для определения уреазной активности образцов.

Изобретение относится к области микробиологии. Штамм бактерий Kocuria sp., обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Kocuria sp.

Изобретение относится к области микробиологии. Штамм бактерий Serratia plymuthica ELA-9, обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Serratia plymuthica VKM B-2819D и может быть использован для очистки почв и водоемов, загрязненных нефтью и нефтепродуктами, в широком диапазоне температур от +4 до +30°C.
Изобретение относится к области биотехнологии. Предложен способ получения ксантана.
Изобретение относится к биотехнологии и может быть использовано при производстве препаратов для борьбы с колорадским жуком. Штамм Bacillus thuringiensis 16T100/18 (ВИЗР) обладает высокой инсектицидной активностью в отношении личинок и имаго колорадского жука.

Изобретение относится к области микробиологии. Штамм бактерий Rhodococcus sp.
Изобретение относится к биотехнологии. Штамм споровых бактерий Bacillus megaterium 501 GR, обладающий ростостимулирующим эффектом, депонирован в ГНУ ВНИИСХМ Россельхозакадемии под регистрационным номером RCAM00875 и может быть использован в качестве полифункционального средства для растениеводства, улучшая фосфорное питание растений, а также способствуя биоремедиации загрязненных пестицидами почв.
Изобретение относится к биотехнологии. Описан штамм бактерий Halobacterium salinarum ВКПМ В-11850 - продуцент бактериородопсина.
Получен штамм бактерий Halobacterium salinarum D96N ВКПМ В-11953 - продуцент бактериородопсина, значительно превосходящий по продуктивности (биомассы и бактериородопсина) как ближайший аналог, так и другие, выбранные в качестве контролей штаммы в различных условиях культивирования.

Изобретение относится к области биотехнологии. Предложен способ получения нанодисперсной добавки для бетона.
Изобретение относится к биотехнологии и может быть использовано в микробиологии. Питательная среда содержит дигидрофосфат калия, гидрофосфат калия, сульфат магния гептагидрат, хлорид натрия, сульфат кальция дигидрат, молибдат натрия, сульфат железа(II), сахарозу, нановермикулит и дистиллированную воду в заданном соотношении компонентов.

Изобретение относится к области биотехнологии. Предложено применение соли угольной кислоты в качестве стабилизатора цвета в бактериальной композиции, содержащей бактериальные клетки, относящиеся к роду Bifidobacterium, и аскорбат. Изобретение позволяет снизить красное окрашивание в бактериальной композиции, содержащей клетки Bifidobacterium и аскорбат. 1 з.п. ф-лы, 2 ил., 2 пр.
Наверх