Штамм lactobacillus plantarum в качестве гипохолестеринемических агентов (варианты) и их использование



Штамм lactobacillus plantarum в качестве гипохолестеринемических агентов (варианты) и их использование
Штамм lactobacillus plantarum в качестве гипохолестеринемических агентов (варианты) и их использование
Штамм lactobacillus plantarum в качестве гипохолестеринемических агентов (варианты) и их использование
Штамм lactobacillus plantarum в качестве гипохолестеринемических агентов (варианты) и их использование
Штамм lactobacillus plantarum в качестве гипохолестеринемических агентов (варианты) и их использование

 


Владельцы патента RU 2560440:

АБ-БИОТИКС С.А. (ES)

Группа изобретений относится к композиции, включающей штаммы Lactobacillus plantarum, и применению штаммов и композиции. Композиция со снижающей холестерин активностью эффективное количество по меньшей мере, одного из штаммов, выбранных из группы штамм Lactobacillus plantarum CECT 7527, штамм Lactobacillus plantarum CECT 7528 и штамм Lactobacillus plantarum CECT 7529. Указанные штаммы обладают пробиотическими свойствами, снижающей холестерин активностью. На основе предложенной композиции получают фармацевтический, ветеринарный или пищевой продукт. Композиция также пригодна для профилактики или лечения сердечно-сосудистых нарушений, а также снижения холестерина у животного, включая человека. Группа изобретений позволяет эффективно снижать общий холестерин сыворотки, холестерин липопротеидов низкой плотности и окисленных липопротеидов низкой плотности. 13 н. и 10 з.п. ф-лы, 1 ил., 17 табл., 9 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к областям медицины, микробиологии и питания и в частности к новым пробиотическим штаммам Lactobacillus plantarum для применения с целью снижения холестерина.

Известный уровень техники

Аномально высокие уровни холестерина (гиперхолестеринемия) тесно связаны с сердечно-сосудистым заболеванием, потому что они стимулируют развитие атеросклеротической бляшки в артериях.

Потенциальные гипохолестеринемические фармацевтические агенты и пищевые продукты непрерывно разрабатываются для того, чтобы контролировать холестерин сыворотки у индивидуумов с его аномально высокими уровнями. Эти фармацевтические агенты могут быть основаны на прерывании энтерогепатической циркуляции (EHC) солей желчных кислот. Метаболизм солей желчных кислот и метаболизм холестерина тесно взаимосвязаны. Соли желчных кислот представляют собой растворимые в воде экскретирующиеся конечные продукты холестерина и важны для эмульгации жиров в пищеварительном тракте. Они синтезируются в печени главным образом в виде глико- и тауро-конъюгатов. Соли желчных кислот секретируются несколько раз в день (в среднем шесть раз) в двенадцатиперстную кишку и проходят через тощую кишку в подвздошную кишку. В процессе прохождения через кишечник большинство солей желчных кислот реабсорбируется с возвращением в печень через портальную вену. Небольшая часть теряется с фекалиями, и эта потеря восполняется новым синтезом из эндогенного холестерина в печени. Рост количества солей желчных кислот, которые теряются с фекалиями, приводит к повышенному новому синтезу холестерина, таким образом эффективно снижая эндогенный пул холестерина. Группа используемых в настоящее время гипохолестеринемических лекарств, называемых смолами (холестирамин, колестипол, колезевелам), действует через этот механизм.

Помимо фармацевтических или хирургических попыток снизить уровни холестерина в сыворотке путем прерывания EHC, предполагается, что прием определенных бактериальных клеток также должен влиять на уровни холестерина. Бактерии кишечника могут влиять на уровни холестерина путем усвоения экзогенного холестерина пищи для бактериальных мембран или путем деконъюгации солей желчных кислот. В процессе прохождения через кишечник соли желчных кислот подвергаются ряду трансформаций бактериями, одной из наиболее важных из которых является деконъюгация солей желчных кислот. Способность деконъюгировать (гидролизовать) соли желчных кислот встречается у некоторых кишечных видов лактобактерий (LAB), но также и у других родов. При деконъюгации глицин или таурин высвобождается от стероидной части молекулы, приводя к образованию свободных (деконъюгированных) солей желчных кислот. Свободные соли желчных кислот с большей легкостью преципитируют при низком рН. Они также реабсорбируются менее эффективно, чем их конъюгированные аналоги. Следовательно, деконъюгированные соли желчных кислот с большей готовностью экскретируются с фекалиями, чем конъюгированные соли желчных кислот. Деконъюгация солей желчных кислот влияет на EHC путем повышения экскреции солей желчных кислот и, как считается, является намного более эффективной в плане снижения уровней холестерина крови, чем просто удержание экзогенного холестерина.

Гидролаза солей желчных кислот (BSH), фермент, ответственный за деконъюгацию солей желчных кислот в процессе EHC, выявлен у нескольких видов LAB, присущих желудочно-кишечному тракту. Танака и соавторы (см. «Screening of Lactic Acid Bacteria for Bile Salt Hydrolase Activity», Journal of Dairy Science 1999. vol. 82, p. 2530-35) провели скрининг более 300 штаммов LAB из родов Bifidobacterium и Lactobacillus и видов Lactococcus lactis, Leuconostoc mesenteroides и Streptococcus thermophilus. Результаты, полученные для 273 штаммов, показали, что активность BSH гетерогенно распределена между различными видами. В соответствии с этим исследованием почти все штаммы бифидобактерий обладают активностью BSH, тогда как у лактобактерий эта активность может быть найдена только у избранных штаммов.

Lactobacillus plantarum представляет собой грамположительную аэротолерантную LAB, обычно обнаруживаемую во многих подвергшихся ферментации пищевых продуктах, а также в анаэробных веществах растительного происхождения. Она также присутствует в слюне (из которой она впервые выделена). Штаммы L. plantarum особенно подходят для промышленного производства ферментированных пищевых продуктов благодаря их хорошему коэффициенту выживаемости в течение промышленного получения и периода консервации, а также их высокому профилю подкисления и хорошим органолептическим свойствам. Некоторые штаммы L. plantarum рассматриваются также в качестве пробиотиков. Пробиотики представляют собой живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина. Для причисления к пробиотику бактерии должны удовлетворять нескольким требованиям, относящимся среди прочего к отсутствию у них токсичности, к жизнеспособности при достижении нижних отделов желудочно-кишечного тракта (ЖКТ) и к адгезии на слизистой оболочке кишечника. Большинство бактерий-пробиотиков принадлежат к группе LAB, но, тем не менее, в целом известно, что свойства и благоприятные воздействия пробиотика крайне зависят от штамма, даже среди LAB одних и тех же видов.

Имеющийся в продаже штамм L. plantarum 299v обычно рассматривается как пробиотик и описан как снижающий уровни фибриногена и холестерина в сыворотке при питье в форме пробиотического напитка (см. Bukowska et al., "Decrease in fibrinogen and LDL-cholesterol levels upon supplementation of diet with Lactobacillus plantarum in subjects with moderately elevated cholesterol" Atherosclerosis 1998. vol. 137, p. 437-38). Однако снижение холестерина ЛПНП в этих исследованиях было очень умеренным и сопровождалось сходным слабым снижением холестерина ЛПВП. Никаких данных не опубликовано относительно BSHA L. plantarum 299v.

Следовательно, желательно предоставить новые улучшенные пробиотические штаммы для применения в качестве гипохолестеринемических агентов.

Краткое изложение сущности изобретения

В настоящем изобретении предлагаются новые улучшенные пробиотические штаммы для снижения холестерина крови и, следовательно, для профилактики и лечения сердечно-сосудистых нарушений.

Авторами настоящего изобретения предлагаются три новых пробиотических штамма Lactobacillus plantarum, выделенные из фекалий человека. Штаммы, как обнаружено, имеют неожиданно высокую активность BSH. Как указывалось выше, тесная взаимосвязь, существующая между высокой бактериальной активностью BSH и снижением холестерина, делает настоящие штаммы пригодными в качестве гипохолестеринемических агентов. Примеры осуществления изобретения, представленные ниже, показывают, что эти штаммы обладают существенно более высокой активностью BSH по сравнению с релевантными имеющимися в продаже штаммами L. plantarum, такими как L. plantarum 299v или штамм L. Plantarum, который присутствует в коммерческой пробиотической смеси VSL#3. Показано также, что штаммы по настоящему изобретению эффективны при культивировании в отношении снижения холестерина в средах, содержащих растворимый холестерин. Хотя для каждого из новых штаммов продемонстрированы свои собственные преимущества по сравнению с известными штаммами, эти преимущества увеличиваются, когда три штамма используются совместно, проявляя в результате этого синергичное действие.

Снижающая холестерин активность штаммов по изобретению продемонстрирована также in vivo. Представленный ниже пример показывает, что продукт, содержащий пробиотические штаммы по изобретению, особенно эффективен в плане снижения холестерина при введении индивидуумам с гиперхолестеринемией.

Соответственно, в первом аспекте изобретение относится к композиции, включающей эффективное количество, по меньшей мере, одного из штаммов, выбранных из группы, состоящей из Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 и Lactobacillus plantarum CECT 7529, или их мутантных штаммов, где мутантные штаммы получают с помощью использования в качестве исходного материала депонированных штаммов и где мутантные штаммы сохраняют или дополнительно улучшают снижающую холестерин активность исходных штаммов. В конкретном варианте осуществления изобретение относится к композиции, включающей эффективное количество, по меньшей мере, одного из штаммов, выбранных из группы, состоящей из Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 и Lactobacillus plantarum CECT 7529.

Применяемый в настоящем описании термин «эффективное количество» обозначает количество активного агента, достаточно высокое для обеспечения желаемого преимущества, но достаточно низкое, чтобы избежать серьезных побочных эффектов в рамках заключения медицинских экспертов.

Другой вариант осуществления настоящего изобретения относится к композиции, включающей эффективное количество Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 и Lactobacillus plantarum CECT 7529 или их мутантных штаммов, где мутантные штаммы получают с помощью использования в качестве исходного материала депонированных штаммов, и где мутантные штаммы сохраняют или дополнительно улучшают снижающую холестерин активность исходных штаммов. В конкретном варианте осуществления композиция по изобретению включает эффективное количество Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 и Lactobacillus plantarum CECT 7529.

Очевидно, что путем использования в качестве исходного материала депонированных штаммов специалист в данной области техники может общепринятым образом с помощью традиционных методов мутагенеза или повторного выделения получить их дополнительные мутанты или производные, которые сохраняют описанные в настоящем документе релевантные характеристики и преимущества. Соответственно, термин «их мутант» относится к мутантным штаммам, полученным с помощью использования в качестве исходного материала депонированных штаммов, причем указанные мутантные штаммы сохраняют или повышают снижающие холестерин свойства исходных штаммов. Специалист в данной области техники должен выбрать адекватный метод, применяемый для определения снижающей холестерин активности штаммов. Примеры возможных методов для измерения этой активности представлены в примерах ниже.

Штаммы по настоящему изобретению обладают тем преимуществом, что они особенно пригодны в качестве пробиотиков. Как указывалось выше, пробиотические бактерии должны удовлетворять нескольким требованиям, относящимся к отсутствию у них токсичности, к жизнеспособности, адгезии и благоприятным эффектам. Эти пробиотические характеристики зависят от штамма даже среди бактерий одного и того же вида. Следовательно, важно найти такие штаммы, которые имеют лучшие характеристики по всем требованиям, предъявляемым к пробиотикам. Примеры, представленные ниже, показывают, что штаммы по настоящему изобретению обладают прекрасными свойствами пробиотиков.

Для штаммов по изобретению продемонстрировано, что они высоко устойчивы к условиям желудочно-кишечного тракта млекопитающих (кислому окружению, высоким концентрациям лизоцимов, солей желчных кислот и пероксида кислорода), таким образом они способны выживать при прохождении через ЖКТ. Штаммы обладают также хорошей адгезией к эпителию кишечника, что позволяет им сохраняться в кишечном тракте и проявлять свои пробиотические эффекты. По сравнению с другими имеющимися в продаже штаммами, штаммы по настоящему изобретению проявляют лучшую устойчивость к условиям ЖКТ и более высокую адгезионную способность. Кроме того, продемонстрировано, что они являются безопасными, так как они не обладают токсическими эффектами, они не ведут ни к росту транслокации LAB, ни к облегчению транслокации энтеробактерий у хозяев-млекопитающих.

Кроме того, штаммы по настоящему изобретению обладают несколькими благоприятными эффектами у хозяина. В дополнение к своей снижающей холестерин активности они оказывают благоприятное воздействие на баланс микробиоты кишечника за счет своей антагонистической активности. Термин «антагонистическая активность» относится к ингибированию роста неблагоприятных бактерий желудочно-кишечного тракта в результате активности пробиотических бактерий. Состояние неадекватного баланса микробов желудочно-кишечного тракта известно как дисбиоз (дисбактериоз) и имеет множественные негативные последствия для самочувствия человека. Ниже будет показано, что штаммы имеют более высокую способность ингибировать рост патогенных штаммов по сравнению с другими имеющимися в продаже штаммами L. plantarum.

Штаммы также продуцируют большие количества жирных кислот с короткой цепью (SCFA). Продукция SCFA из не перевариваемых волокон является интересной способностью пробиотиков. Эта способность желательна для пробиотиков, так как продуцируемые SCFA проявляют некоторые благоприятные свойства у хозяина (см. Wong J., "Colonic health: fermentation and short chain fatty acids", J Clin Gastroenterol 2006, vol. 40, p. 235-43). Среди SCFA особый интерес для объема настоящего изобретения представляет продукция пропионовой и масляной кислот. Первая обладает противовоспалительным эффектом, полезным для снижения системного воспаления. Общее воспаление имеет место при атерогенезе, который является одним из наиболее важных факторов риска сердечно-сосудистых заболеваний (см. Naruszewicz M., "Potential parapharmaceuticals in the traditional Polish diet" 2005, Journal of Physiology and Pharmacology, vol. 56, suppl 1, p. 69-78). Масляная кислота обычно известна как благоприятная для эпителия ободочной кишки, так как она является основным энергетическим ресурсом для клеток ободочной кишки.

Как проявляющие некоторые благоприятные эффекты у человека-хозяина эти пробиотические бактерии полезны в качестве терапевтических или профилактических агентов. В частности, штаммы по настоящему изобретению эффективны в плане снижения уровней холестерина крови. Как объяснялось выше, высокие уровни холестерина тесно связаны с сердечно-сосудистым заболеванием, так как они стимулируют образование атеросклеротических бляшек в артериях. Таким образом, штаммы по изобретению полезны для предотвращения или лечения сердечно-сосудистых нарушений.

Соответственно, другой аспект изобретения относится к композиции, включающей эффективное количество, по меньшей мере, одного из штаммов по настоящему изобретению или их мутантных штаммов для применения в качестве профилактического и/или терапевтического агента. В предпочтительном варианте изобретения композиция по изобретению является применимой для профилактики или лечения сердечно-сосудистых нарушений у животного, включая человека. В другом предпочтительном варианте осуществления в изобретении предлагается применение композиции, как описано выше, для получения лекарства для профилактики и/или лечения сердечно-сосудистых нарушений. Это может быть альтернативно сформулировано как способ профилактики и/или лечения сердечно-сосудистых нарушений у животного, включая человека, включающий введение указанному животному, нуждающемуся в этом, эффективного количества композиции по изобретению.

В другом варианте осуществления композицию по изобретению используют в качестве гипохолестеринемического агента. В дополнительном варианте осуществления в изобретении предлагается применение композиции, как описано выше, для получения лекарства для снижения холестерина. Это может быть альтернативно сформулировано как способ снижения холестерина у животного, включая человека, включающий введение указанному животному, нуждающемуся в этом, эффективного количества композиции по изобретению.

Композицию по изобретению можно вводить здоровым индивидуумам, а также больным, страдающим нарушением коронарного кровоснабжения. В конкретном варианте осуществления индивидуум, получающий композицию по изобретению, страдает гиперхолестеринемией.

Пробиотические композиции по изобретению обладают дополнительным преимуществом в плане отсутствия побочных эффектов, присутствующих у растительных стеринов, которые описаны как противопоказанные в сочетании со статином у индивидуумов с гиперабсорбцией стеринов. Имеющиеся в настоящее время данные предполагают, что некоторый остаточный риск коронарного заболевания при монотерапии статином является следствием того, что статины действительно повышают риск коронарного заболевания у больных, которые гиперабсорбируют стерины, включая растительные стерины. Индивидуумы с гиперабсорбцией стеринов составляют около 25% популяции, и большинство из них, как показано, имеют полиморфизмы в аденозин-5'-трифосфат (АТФ)-связывающем кассетном (ABC) половинном транспортере ABCG8 (Goldstein M et al. "Statins, plant sterol absorption, and increased coronary risk". Journal of Clinical Lipidoloqy, 2008, vol. 2, p. 304-305). Более того, предполагается, что эффекты пищи, обогащенной растительными стеринами, и лечения статинами являются аддитивными в отношении повышения уровней растительных стеринов в крови и тканях, и что это особенно очевидно у индивидуумов с гиперабсорбцией стеринов. Пробиотическая композиция по изобретению не обладает этими недостатками и может быть введена любой популяции и в сочетании со статинами или любым другим снижающим холестерин лекарством.

Таким образом, в конкретном варианте осуществления композицию по изобретению вводят индивидуумам с гиперабсорбцией стеринов. В другом конкретном варианте осуществления композицию по изобретению вводят в сочетании со статином.

Штаммы по изобретению также содействуют иммуномодуляторным эффектам у хозяина, так как они индуцируют улучшенный паттерн секреции цитокинов из слизистой оболочки кишечника. Эти иммуномодуляторные эффекты являются благоприятными для хозяина, так как они помогают достичь улучшенной устойчивости к заболеваниям и сниженного риска аллергических реакций. Известно, что грамотрицательные бактерии, живущие в ЖКТ, экспонируют на своей клеточной поверхности молекулу ЛПС (липополисахарида), которая индуцирует продукцию маркеров воспаления клетками слизистой оболочки кишечника. Добавление пробиотиков может изменить эту ситуацию, содействуя более высокому присутствию грамположительных бактерий в ЖКТ (сгруппированных в группу лактобактерий), с лучшим экологическим соответствием или с антагонистическими свойствами против некоторых грамотрицательных микроорганизмов, в результате этого снижая присутствие ЛПС в слизистой оболочке кишечника. Тем не менее, некоторые пробиотические микроорганизмы сами по себе проявляют способность к модуляции продукции цитокинов, которые представляют собой молекулы-посредники, регулирующие иммунный и воспалительный ответы в организме. В частности, некоторые пробиотические бактерии индуцируют лучше сбалансированный профиль про/антивоспалительной сигнализации в слизистой оболочке кишечника (без снижения количества грамотрицательных бактерий). Как указывалось выше, эта стимулированная бактериями иммуномодуляция также обладает антиатеросклеротическим эффектом.

Как будет проиллюстрировано ниже, обнаружено, что штаммы по изобретению как таковые стимулируют снижение уровней провоспалительного фактора-α некроза опухолей (TNF-α) и повышают уровни противовоспалительного интерлейкина-10 (ИЛ-10), продуцируемых клетками слизистой оболочки кишечника, индуцируя в результате этого улучшенный профиль цитокинов, секретируемых слизистой оболочкой кишечника. Этот иммуномодуляторный эффект дополняется антагонистическими свойствами штаммов в плане снижения присутствия патогенных грамотрицательных бактерий в ЖКТ и снижением количества ЛПС в слизистой оболочке кишечника.

Композиции по изобретению, которые включают эффективное количество, по меньшей мере, одного из депонированных штаммов или их мутантов, могут быть составлены в виде пищевых продуктов, фармацевтических или ветеринарных продуктов, в которых указанные штаммы являются единственными активными агентами или смешаны с одним или несколькими другими активными агентами, и/или смешаны с фармацевтически или ветеринарно приемлемыми наполнителями (в случае фармацевтического или ветеринарного продукта), или адекватными добавками (в случае пищевого продукта). В конкретном варианте осуществления изобретения продукты дополнительно содержат один или несколько дополнительных активных агентов. Предпочтительно дополнительный активный агент или агенты представляют собой другие пробиотические бактерии. В зависимости от состава штаммы могут быть добавлены в виде очищенных бактерий, в виде бактериальной культуры, в виде части бактериальной культуры, в виде бактериальной культуры, которую использовали после обработки, и в одиночку или совместно с подходящими носителями или ингредиентами. Могут быть также добавлены пребиотики, создавая более высокий уровень симбиотической композиции. В конкретном варианте осуществления композиции по изобретению дополнительно содержат пребиотик, выбранный из группы, состоящей из фруктоолигосахаридов и галактоолигосахаридов.

В другом аспекте в изобретении предлагается фармацевтический и/или ветеринарный продукт, который содержит эффективное количество композиции, включающей, по меньшей мере, один из депонированных штаммов или их мутантов, совместно с адекватными количествами фармацевтически или ветеринарно-приемлемыми наполнителями. В этом случае фармацевтический продукт может быть получен для перорального введения в форме таблеток, пилюль, капсул, микрокапсул, гранул, суспензий, сиропов, лиофилизованных порошков, жидких препаратов и т.д. Выбор наполнителей и наиболее подходящие методы их составления с точки зрения конкретной цели применения композиции находится в сфере обычных специалистов в области фармацевтической технологии. Хотя пероральное введение является предпочтительным, возможны другие формы введения, такие как инъекции, ректальное или местное введение.

Используемый в настоящем описании термин «фармацевтически приемлемые» относится к соединениям, веществам, композициям и/или лекарственным формам, которые находятся в сфере законного медицинского разрешения, подходят для использования в контакте с тканями индивидуума (например, человека) без чрезмерных токсичности, раздражения, аллергического ответа или других проблем или осложнений, соответствуют обоснованному соотношению преимущество/риск. Каждый носитель, наполнитель и т.д. должен быть также «приемлемым» в плане совместимости с другими ингредиентами состава. Подходящие носители, наполнители и т.д. могут быть найдены в стандартных фармацевтических руководствах. Подобно этому термин «ветеринарно-приемлемый» означает подходящий для использования в контакте с тканями животного, не являющегося человеком.

Штаммы по изобретению можно также включать в разнообразные пищевые продукты, такие как молочные продукты, йогурт, творог, сыр (например, зернистый, кремообразный, обработанный, мягкий и твердый), ферментированное молоко, порошковое молоко, продукт ферментации на основе молока, мороженое, ферментированный продукт на основе злаков, порошок на основе молока, напиток, приправа и пищевой продукт для животных. Термин «пищевой продукт» используется в настоящем описании в своем самом широком значении, включая любой тип продукта в любой форме представления, который может употребляться животным, но исключая фармацевтические и ветеринарные продукты. Примерами других пищевых продуктов являются мясные продукты (например, печеночный паштет, сосиска «франкфуртер» и колбаса салями или мясные пасты), шоколадные пасты, наполнители (например, трюфель, крем) и глазурь, шоколад, кондитерские изделия (например, карамель, помадки или ириски), выпечка (кексы, пирожные), соусы и супы, фруктовые соки и забеливатели кофе. Особенно интересными пищевыми продуктами являются пищевые добавки и составы для детей. В смысле настоящего изобретения пищевые добавки включают также нутрицевтики, которые, как известно, являются экстрактами пищевых продуктов, имеющими лечебное воздействие на здоровье человека. Фураж в качестве корма для животных также включается в объем изобретения. Композиции по изобретению могут быть также использованы в качестве ингредиента в других пищевых продуктах.

Соответственно, в другом аспекте изобретения предлагается пищевой продукт, который содержит композицию по изобретению совместно с подходящими количествами пищевых ингредиентов. Предпочтительно композиция по изобретению представляет собой пищевую добавку.

Эффективное количество колониеобразующих единиц, (КОЕ), для каждого штамма в композиции должно быть определено специалистом в данной области техники и должно зависеть от конечного состава. Например, в пищевых продуктах штамм или штаммы присутствуют в количестве от приблизительно 105 КОЕ/г до приблизительно 1012 КОЕ/г, предпочтительно в количестве от приблизительно 107 КОЕ/г в соответствии с текущим законодательством. Термин «колониеобразующая единица» («КОЕ») определяется как количество бактериальных клеток, выявляемых при микробиологических подсчетах на агаровых чашках.

Пищевые добавки обычно содержат пробиотические штаммы в количестве в диапазоне от 107 до 1012 КОЕ/г. В конкретном варианте осуществления композиция по изобретению представляет собой пищевую добавку, включающую между 109-1011 КОЕ/г, предпочтительно около 1011 КОЕ/г депонированных штаммов. В другом варианте осуществления пищевая добавка включает 109 КОЕ штамма или штаммов по изобретению.

Подходящие схемы введения композиции по изобретению могут быть установлены специалистом в данной области техники. Композицию по изобретению можно вводить один раз в день, один раз в неделю, несколько дней в неделю или несколько раз в день. В другом варианте осуществления суточная доза составляет 109 КОЕ штамма или штаммов по изобретению.

Штаммы по изобретению получают путем культивирования бактерий в подходящей среде и в подходящих условиях. Штаммы можно культивировать по отдельности для образования чистой культуры или в виде смешанной культуры вместе с другими микроорганизмами, или путем культивирования бактерий разных типов отдельно и последующего их объединения в желаемых пропорциях. После культивирования получают клеточную суспензию и используют как таковую или обрабатывают желаемым образом, например, путем концентрирования или лиофилизации, для последующего применения при получении фармацевтических или пищевых продуктов. Иногда препарат пробиотиков подвергают иммобилизации или процессу инкапсулирования для улучшения срока хранения. В данной области техники известно несколько способов иммобилизации или инкапсулирования бактерий (см. Kailasapathy et al., "Microencapsulation of Probiotic Bacteria: Technology and Potential Applications", Curr Issues Intest Microbiol 2002. vol. 3, p. 39-48).

Если композицию по изобретению используют в качестве пищевой добавки, она может быть введена как таковая, может быть смешана с подходящей жидкостью для питья, такой как вода, йогурт, молоко или фруктовый сок, или она может быть смешана с твердой или жидкой пищей. В этом контексте пищевая добавка может быть в форме таблеток, пилюль, капсул, гранул, порошков, суспензий, саше, пастилок, конфет, пластинок, сиропов и соответствующих форм для введения, обычно в форме стандартной дозы. Предпочтительно композицию по изобретению вводят в форме таблеток, капсул, сиропов или пилюль, полученных традиционными способами получения фармацевтических продуктов.

Как показано в примерах ниже, каждый из предлагаемых штаммов имеет улучшенные характеристики по сравнению с имеющимися в продаже штаммами L. plantarum, такими как L. plantarum 299v или L. plantarum VSL#3. Особенно три штамма обладают улучшенными гипохолестеринемическими эффектами, благодаря их неожиданно высокой активности BSH. Следовательно, каждый из этих штаммов может быть использован в композиции по изобретению либо как таковой, либо в сочетании с другими штаммами по изобретению. Например, композиция по изобретению может включать эффективное количество штамма L. plantarum CECT 7527, одного или совместно с фармацевтически приемлемыми наполнителями или пищевыми ингредиентами, консервантами и т.д. Также композиция по изобретению может содержать эффективное количество штамма L. plantarum CECT 7527 в сочетании со штаммом L. plantarum CECT 7528 и/или штаммом L. plantarum CECT 7529 совместно с фармацевтически приемлемыми наполнителями или пищевыми ингредиентами, консервантами и т.д.

В дополнительном аспекте в изобретении предлагается штамм Lactobacillus plantarum, выбранный из группы, состоящей из Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 и Lactobacillus plantarum CECT 7529 или их мутантных штаммов, где мутантные штаммы получают с помощью использования в качестве исходного материала депонированных штаммов и где мутантные штаммы сохраняют или дополнительно улучшают снижающую холестерин активность исходных штаммов. В конкретном варианте осуществления штамм выбран из одного из депонированных штаммов.

В следующих разделах описаны гипохолестеринемические способности штаммов по изобретению, а также их таксономические характеристики и их специфические пробиотические свойства, включая их влияние на иммунную систему. Эти примеры не предназначены для ограничения настоящего изобретения. Полученные результаты показывают, что штаммы по изобретению обладают улучшенными пробиотическими характеристиками по сравнению с имеющимся в продаже штаммом L. plantarum 299v. Более того, показано, что композиция, включающая штаммы по изобретению, обладает лучшей снижающей холестерин активностью in vivo, чем известные составы, содержащие растительные стерины.

Если не указано иначе, все технические и научные термины, используемые в настоящем описании, имеют то же значение, что и обычно понимаемое специалистом в той области техники, к которой принадлежит настоящее изобретение. Методы и материалы, сходные или эквивалентные описанным в настоящем документе, могут быть использованы в практике настоящего изобретения.

Во всем описании и формуле изобретения слово «включает» и его варианты не предназначены для исключения других технических свойств, добавок, компонентов или стадий. Дополнительные цели, преимущества и свойства изобретения должны становиться очевидными специалистам в данной области техники при изучении описания или с ними можно ознакомиться при применении изобретения на практике. Следующие примеры и фигуры предлагаются в качестве иллюстрации, и они не предназначены для ограничения настоящего изобретения. Более того, настоящее изобретение покрывает все возможные сочетания конкретных и предпочтительных вариантов осуществления, описанных в настоящем документе.

Краткое описание чертежей

Фиг. 1. Паттерны электрофореза в пульсирующем поле геномной ДНК, обработанной рестриктазами Sma-1 (A) и Sfi-I (B): 1, Lactobacillus plantarum 299v; 2, F2099; 3, F3147; 4, Lactobacillus plantarum VSL#3; 5, F3276.

Примеры

1. Гипохолестеринемическая активность новых штаммов in vitro

Штаммы по настоящему изобретению были выделены из фекалий младенцев и выбраны из других 500 бактериальных штаммов благодаря их высокой производительности при скрининге на активность гидролазы солей желчных кислот (BSH) с помощью описанного ниже метода. Отобранные штаммы проявляли четкое грам+ окрашивание, а также морфологию бацилл и не образовывали споры. Штаммы были депонированы в соответствии с Будапештским соглашением в Colección Española de Cultivos Tipo (CECT, Universidad de Valencia, Edificio de investigación, Campus de Burjassot, 46100 Burjassot, Valencia). Был выдан соответствующий сертификат на жизнеспособность, и штаммам были присвоены следующие регистрационные номера: Lactobacillus plantarum CECT 7527 (в настоящем описании именуемый также F2099), Lactobacillus plantarum CECT 7528 (в настоящем описании именуемый также F3147), и Lactobacillus plantarum CECT 7529 (в настоящем описании именуемый также F3276). Датой поступления в CECT для штаммов F3276 и F2099 было 07.05.2009, а для штамма F3147 - 15.07.2009.

Гипохолестеринемическую активность штаммов дополнительно исследовали in vitro и сравнивали с имеющимися в продаже контрольными штаммами L. plantarum 299v (впредь Lp 299v) и штамм L. plantarum, содержащийся в имеющейся в продаже культуре VSL#3 (впредь Lp VSL#3). Как сообщалось выше, было описано два механизма снижения уровня холестерина, вызываемого кисломолочными бактериями, т.е. через синтез холестерина de novo, вызываемый деконъюгацией желчных кислот, и через усвоение экзогенного холестерина из пищи. Поэтому все штаммы были подвергнуты анализу на активность BSH и тесту на снижение холестерина в культуре. Кроме того, были проанализированы смешанные культуры, содержащие различные сочетания новых штаммов, для выяснения того, имеются ли синергические эффекты штаммов в отношении активности BSH и снижения холестерина в культуре. Экспериментальные процедуры осуществляли, как описано Hyeong-Jun Lim et al. (см. "Isolation of cholesterol lowering lactic acid bacteria from human intestine for probiotic use", J Vet Sci 2004, vol. 5, p. 391-5), с небольшими модификациями.

1.1. Гидролазная активность в отношении солей желчных кислот

Штаммы культивировали в течение ночи на среде MRS (pH 6,4) при 30°С в атмосфере, содержащей 5% CO2. После инкубации культуры стандартизовали до 108 КОЕ/мл и готовили следующие смешанные культуры: F2099+F3147, F2099+F3276, F3147+F3276, F2099+F3147+F3276. Смешанные культуры содержали равные количества составляющих их штаммов и такую же суммарную концентрацию бактерий, что и культуры с одним штаммом. И культуры с одним штаммом, и смешанные культуры анализировали на активность BSH. Культурами пропитывали стерилизованные бумажные диски на чашках агара MRS с добавлением 4% (масс./об.) натриевой соли тауродезоксихолевой кислоты (TDCA, Sigma, USA) и 0,37 г/л CaCl2. Чашки инкубировали в анаэробных условиях при 37°С в течение 72 час, и измеряли диаметр зоны преципитации вокруг дисков. После этого рассчитывали активность BSH путем вычитания диаметра диска (DD) из диаметра зоны ингибирования (IZD) и деления этой разности на два по следующей формуле GI=(IZD-DD)/2 (см. таблицу 1).

Таблица 1
Гидролазная активность в отношении солей желчных кислот (BSH)
Активность BSH
F2099 2,10
F3147 2,53
F3276 3,17
F2099+F3147 2,63
F2099+F3276 3,35
F3147+F3276 2,90
F2099+F3147+F3276 3,65
Lp 299V 1,70
Lp VSL#3 2,00

Эти результаты показывают, что штаммы по настоящему изобретению обладают высокой деконъюгирующей активностью в отношении солей желчных кислот. Более того, активность BSH каждого из штаммов F2099, F3147 и F3276, взятых отдельно, превышает активность имеющихся в продаже штаммов Lp 299v и Lp VSL#3, причем наибольшая активность свойственна штамму F3276. Кроме того, при сочетании штаммов в смешанной культуре активность BSH смешанной культуры превышает активность культур изолированных штаммов при одной и той же суммарной концентрации бактерий. Активность BSH особенно сильно возрастает при объединении трех штаммов с получением активности BSH, которая, грубо говоря, в два раза превышает активность Lp 299v. Таким образом, представляется, что имеется синергизм между штаммами по изобретению в отношении активности BSH.

1.2. Способность к снижению холестерина в среде

Тест на снижение холестерина проводили с использованием бульона MRS с растворимым холестерином. Культуры отдельных штаммов и их смесей готовили, как объяснено выше. Растворимый холестерин (полиоксиэтанилхолестерина себацинат, Sigma, USA) фильтровали через 0,45 мкм фильтр Millipore и добавляли к автоклавированному, содержащему 0,05% L-цистеин бульону MRS до конечной концентрации 300 мг/мл. Объем инокуляции составлял 15 мкл раствора бактериальной культуры, полученной, как описано выше (108 КОЕ/мл), на 1 мл бульона холестерин-MRS, и содержимое инкубировали в анаэробных условиях при 37°С в течение 24 час. Бульон MRS без инокуляции также инкубировали в тех же условиях. После инкубации бактериальные клетки удаляли центрифугированием, и культуральные супернатанты L. plantarum и неинокулированный контроль анализировали затем на содержание в них оставшегося холестерина с помощью автоматизированного анализатора (Olympus AU400). Такой же эксперимент проводили с бульоном MRS, содержащим 1% масс./об. солей желчных кислот (соли желчных кислот от SIGMA C4951), поскольку это последнее сочетание в большей мере соответствует среде в кишечнике. Результаты этих анализов, представленные в виде % снижения холестерина по отношению к контролю без инокуляции, можно видеть в таблице 2.

Таблица 2
Способность бактериальных культур снижать холестерин в среде
% Снижения холестерина % Снижения холестерина (1% соли желчных кислот)
F2099 10,10 42,70
F3147 9,60 42,70
F3276 9,30 42,00
F2099+F3147 9,84 43,00
F2099+F3276 11,82 47,20
F3147+F3276 10,72 44,27
F2099+F3147+F3276 13,01 50,85
Lp 299V 4,58 26,70
Lp VSL#3 7,40 27,80

И вновь результаты демонстрируют, что штаммы по изобретению обладают лучшим гипохолестеринемическим действием по сравнению с хорошо известными имеющимися в продаже штаммами Lp 299v и Lp VSL#3. Кроме того, показано, что снижающее холестерин действие лучше проявляется при объединении трех штаммов по изобретению в смешанной культуре.

2. Таксономическая характеристика штаммов

Для таксономической характеристики штаммы по изобретению выращивали в течение ночи на среде MRS (pH 6,4) при 30°С в атмосфере, содержащей 5% CO2. После этого бактерии собирали, промывали, ресуспендировали в предлизисном буфере (480 мкл 50 мМ ЭДТА pH 8,0; 120 мкл 10 мг/мл лизоцима) и дополнительно инкубировали при 37°С в течение 60 мин. ДНК экстрагировали с помощью набора для очистки геномной ДНК Wizard (Promega). После центрифугирования предварительно обработанных бактерий при 14000 g в течение 2 мин для удаления супернатанта следовали протоколу Promega. Вкратце, бактерии ресуспендировали в растворе для лизиса ядер и инкубировали при 80°С в течение 5 мин, после чего охлаждали до комнатной температуры. Клеточные лизаты инкубировали в растворе РНКазы при 37°С в течение 60 мин, и белки осаждали добавлением раствора для осаждения белков и перемешиванием при высокой скорости. Образцы охлаждали и центрифугировали при 15000 g в течение 3 мин. Супернатанты, содержащие ДНК, переносили в чистые 1,5-мл микроцентрифужные пробирки и смешивали с 600 мкл изопропанола путем переворачивания. ДНК собирали центрифугированием при 15000 g в течение 2 мин и тщательным отделением супернатанта. Образцы ДНК промывали 600 мкл 70% этанола путем осторожного переворачивания пробирки несколько раз. Этанол удаляли отсасыванием после центрифугирования при 15000 g в течение 2 мин. Наконец, осадок ДНК ресуспендировали в 100 мкл раствора для повторной гидратации путем инкубации при 65°С в течение 1 час. Образцы хранили при 2-8°С.

2.1. Родовая и видовая генетическая идентификация

16S рРНК амплифицировали с помощью ПЦР с использованием универсальных праймеров Eub27f и Eub1492r, которые обеспечивают получение фрагмента почти полноразмерной последовательности 16S (более 1000 нуклеотидов) (таблица 3). После этого полученную, как объяснено выше, ДНК промывали с помощью набора Quiaquick (Quiagene). Для каждого образца производили четыре консекутивные реакции секвенирования на генетическом анализаторе 3130 (Applied Biosystems) с использованием набора BigDye v.3.1 и праймеров, показанных в таблице 3. Для сбора данных и хроматограмм использовали программу DNA Sequence Analysis v.5.2 (Applied Biosystems), и результаты проверяли визуальным анализом с помощью Chromas (Technelysium Pty Ltd.) и BioEdit (Ibis Biosciences).

Идентификацию рода производили с использованием Ribosomal Database Project tool (Q. Wang et al., "Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy", Appl. Environ. Microbiol. 2007, vol. 73, p. 5261-7). Идентификацию вида производили путем сравнения полученной последовательности с последовательностями 16S известных организмов из базы данных RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) с помощью BLASTN, и из Ribosomal Database Project (http://rdp.cme.msu.edu/, J.R. Cole et al., "The Ribosomal Database Project (RDP-II): introducing myRDP space and quality controlled public data" Nucl. Acids Res. 2007, vol. 35, p. 169-72). Инструментарий RDP идентифицировал три штамма F2099, F3147 и F3276 как относящиеся к виду Lactobacillus plantarum.

Таблица 3
Праймеры, использованные для амплификации и секвенирования гена 16S
Стадия Праймер Ориентация Последовательность 5'→3'
Амплификация Eub27f прямая GAGTTTGATCCTGGCTCAG (SEQ ID NO: 1)
Eub1492r обратная TACGGYTACCTTGTTACGACTT (SEQ ID NO: 2)
Секвениро-
вание
27f прямая AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 3)
357f прямая CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACGGGAGGCAGCAG (SEQ ID NO: 4)
907r обратная CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 5)
1492r обратная GGTTACCTTGTTACGACTT (SEQ ID NO: 6)

2.2. Генотипирование штаммов

Снятие характеристик производили путем гидролиза генома и гель-электрофореза в пульсирующем поле. Штаммы F2099, F3147 и F3276 обрабатывали в соответствии с ранее описанным протоколом (A.M. Rodas et al., "Polyphasic study of wine Lactobacillus strains: taxonomic implications", Int J Svst Evol Microbiol 2005, vol. 55, p. 197-207). В анализ были включены также Lp VSL#3 и Lp 299v в качестве контрольных штаммов. Все штаммы выращивали на чашках агара MRS и инкубировали при 37°С, 5% CO2 в течение 18 час. Клетки собирали и промывали три раза в 8 мл PET (10 мМ трис pH 7,6, 1 М NaCl), после чего центрифугировали при 6000 об/мин в течение 10 мин. Осадки ресуспендировали в 700 мкл лизирующего буфера (6 мМ трис, 1 М NaCl, 0,1 М ЭДТА, 0,5% SLS, 0,2% дезоксихолевой кислоты; 1 мг/мл лизоцима; 40 Е/мл мутанолизина; 20 г/мл РНКазы). К ресуспендированным клеткам добавляли равный объем 1,6% агарозы с низкой точкой плавления (FMC BioProducts, Rockland, ME, USA), и смеси давали застыть при 4°С в течение 1 час. Вставки переносили к 2 мл лизирующего буфера II (0,5 М ЭДТА, pH 9,2, 1% N-лаурилсаркозина и 1 мг/мл проназы) и инкубировали при 50°С в течение 48 час. После этого вставки промывали при комнатной температуре буфером TE (10 мМ трис, 1 мМ ЭДТА pH 8,0). Гидролиз суммарной ДНК производили с помощью ферментов рестрикции Sfi-I и Sma-I (Roche Diagnostics).

Электрофорез в пульсирующем поле проводили с помощью аппарата CHEF DRIII (BioRad Laboratories). Вставки вносили в 1% агарозный гель (SeaKem ME agarose, FMC BioProducts, ME, USA). В таблице 4 описаны условия электрофореза для каждого фермента. Маркеры мол. массы ДНК представляли собой Lambda ladder PFG Marker и Low Range PFG Marker (New England Biolabs). После электрофореза гели окрашивали этидия бромидом и визуализировали в УФ с использованием GelDoc System (BioRad).

Таблица 4
Условия электрофореза для геномной ДНК из штаммов F2099, F3147 и F3276, гидролизованной Sfi-I и Sma-I
Фермент Блок Исходный импульс (сек) Последний импульс (сек) Время (часы)
Sfi-I 1 2 10 10
2 15 25 6
Sma-I 1 0,5 5 16

Как показано на фиг. 1, паттерны фрагментов рестрикции Sfi-I и Sma-I при электрофорезе в пульсирующем поле для штаммов F2099, F3147 и F3276 различались, что тем самым подтверждает их принадлежность к трем разным штаммам. Как и ожидалось, эти паттерны отличались также от паттернов штаммов Lp 299v и Lp VSL#3. В литературе было описано, что, в отличие от других Lactobacillus, вид L. plantarum проявляет высокую генетическую неоднородность (I. Sanchez et al., "Polyphasic study of the genetic diversity of lactobacilli associated with 'Almagro' eggplants spontaneous fermentation, based on combined numerical analysis of randomly amplified polymorphic DNA and pulsed-field gel electrophoresis patterns" Journal of Applied Microbiology 2004, vol. 97, p. 446-58). Судя по их PFGE, штаммы F2099, F3147 и F3276 выглядят генетически очень близкими, так что они могли возникнуть из одного и того же клона (F.C. Tenover et al., "Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing" J Clin Microbiol 1995, vol. 33, p. 2233-9).

3. Устойчивость к среде желудочно-кишечного тракта

Для оценки устойчивости штаммов F2099, F3147 и F3276 к прохождению через ЖКТ были произведены анализы в условиях, имитирующих среду желудочно-кишечного тракта млекопитающих. Таким образом, количественно оценивали выживаемость после обработки лизоцимом, перекисью кислорода, кислотной средой и солями желчных кислот. Результаты сравнивали с результатами, полученными для Lp 299v and Lp VSL#3.

3.1. Устойчивость к лизоциму: 20-мкл аликвоты культуры каждого из бактериальных штаммов, выращенных в течение ночи в MRS при 37°С, помещали в 96-луночный планшет и добавляли 200 мкл среды с добавкой 100, 200 или 300 мкг/мл лизоцима (Sigma). Планшеты инкубировали при 37°С, 5% CO2. Рост бактерий количественно определяли измерением повышения оптической плотности при 620 нм на ридере для ELISA между 0 и 6 час инкубации. Результаты представлены в виде % по отношению к контролю, представляющему собой максимальный рост каждого из штаммов в бульоне MRS без добавки лизоцима (таблица 5).

3.2. Устойчивость к перекиси кислорода: 20-мкл аликвоты культуры каждого из бактериальных штаммов, выращенных в течение ночи в MRS при 37°С, помещали в 96-луночный планшет. В лунки добавляли 200 мкл MRS с добавкой 10, 20 и 30 мкг/мл H2O2, и планшеты инкубировали 30 мин при 37°С перед считыванием при 620 нм через 0 и 6 час инкубации (таблица 6).

3.3. Устойчивость к кислой среде: 20-мкл аликвоты культуры каждого из бактериальных штаммов, выращенных в течение ночи в MRS при 37°С, помещали в 96-луночный планшет, после чего в лунки с бактериями помещали 200-мкл аликвоты среды MRS с различными величинами pH, доведенными HCl. Планшеты затем хранили при 42°С, и повышение оптической плотности считывали на спектрофотометре при 620 нм между 0 и 6 час. Результаты представлены в виде % по отношению к контролю, представляющему собой максимальный рост каждого из штаммов в бульоне MRS при pH 7,2 (таблица 7).

3.4. Устойчивость к солям желчных кислот: 20-мкл аликвоты культуры каждого из бактериальных штаммов, выращенных в течение ночи в MRS при 37°С, помещали в 96-луночный планшет. В лунки добавляли 200 мкл с добавкой 0,3%, 0,5% и 0,1% (масс./об.) солей желчных кислот (SIGMA B8756-10G, 096K1213), и pH доводили до 3. Образцы также анализировали в 200 мкл 0,3% (масс./об.) соли желчной кислоты в MRS без доведения pH. Планшеты хранили при 37°С, 5% CO2, и считывали через 0 и 6 час на спектрофотометре при 620 нм (таблица 8).

Таблица 5
Результаты определения оптической плотности (ОП), выраженные в виде % от контрольной MRS, после инкубации при различных концентрациях лизоцима
Концентрация лизоцима (мкг/мл)
100 200 300
F2099 99,23 99,65 97,55
F3147 96,45 95,72 93,66
F3276 98,45 98,12 94,67
Lp 299v 92,86 90,02 85,19
Lp VSL#3 89,23 87,12 81,19
Таблица 6
Результаты определения оптической плотности, выраженные в % от контрольной MRS, после инкубации при различных разведениях H2O2
Концентрация H2O2 (мкг/мл)
10 20 30
F2099 96,12 95,77 90,9
F3147 98,45 96,80 94,35
F3276 95,12 92,38 89,99
Lp 299v 95,34 93,24 87,45
Lp VSL#3 97,12 90,88 85,45
Таблица 7
Результаты определения оптической плотности, выраженные в % от контрольной MRS, после инкубации при различных значениях pH
pH
2 2,5 3 3,5 4 4,5 5 5,5 6
F2099 60,45 62,67 66,58 70,23 71,89 77,34 80,24 85,28 93,45
F3147 62,08 65,80 71,20 74,32 76,45 84,12 88,95 95,40 97,20
F3276 58,24 58,23 60,22 63,56 64,58 68,34 74,56 86,34 92,10
Lp 299v 52,34 51,56 57,34 58,03 63,20 63,99 78,23 83,20 87,30
Lp VSL#3 55,34 56,74 61,10 62,45 63,76 67,77 72,34 82,12 84,23
Таблица 8
Результаты определения оптической плотности, выраженные в % от контрольной MRS, после инкубации при различных концентрациях солей желчных кислот. * Без доведения pH.
Концентрация солей желчных кислот (% масс./об.)
0,3* 0,3 pH 3 0,5 pH 3 1 pH 3
F2099 117,85 109,34 103,23 87,12
F3147 136,08 128,01 107,34 95,66
F3276 109,80 104,30 93,67 72,56
Lp 299v 102,45 94,35 89,34 51,56
Lp VSL#3 104,65 99,49 92,12 65,23

Эти результаты показывают, что штаммы по изобретению обладают хорошим показателем жизнеспособности в условиях, имитирующих среду желудочно-кишечного тракта. В таблицах 5 и 6 показано, что штаммы устойчивы к высоким концентрациям бактерицидных агентов, имеющихся во рту (лизоцим и перекись кислорода). Жизнеспособность штаммов является очень хорошей даже при концентрациях, превышающих физиологические (30 мкг/мл лизоцима и 10 мкг/мл H2O2). Что касается кислотных условий желудка, то жизнеспособность штаммов также является удовлетворительной. Более того, штаммы по изобретению обладают выдающейся устойчивостью к солям желчных кислот (см. таблицу 8) даже в сочетании с кислым pH, как это обычно имеет место при опорожнении желудка. В совокупности результаты показывают, что штаммы по настоящему изобретению жизнеспособны после прохождения через ЖКТ. Более того, результаты показывают, что штаммы по изобретению обладают лучшими качествами по сравнению с имеющимися в продаже штаммами Lp 799v и Lp VSL#3 в исследованных условиях.

4. Адгезия к кишечнику

4.1. Адгезия к слизи

Способность к адгезии штаммов F2099, F3147 и F3276 сравнивали с таковой имеющегося в продаже штамма Lp 299v.

Слизь получали промывкой кишечника ЗФР с pH 7,4, содержащим 0,01% желатин и ингибитор протеаз (Complete®, Sigma). Слизистую оболочку соскабливали и помещали в буфер 10 мМ HEPES-соли Хенка с pH 7,4 и теми же ингибиторами. Слизь затем промывали центрифугированием при 13000 об/мин в течение 10 мин с использованием того же буфера. Собирали супернатанты и оценивали содержание слизи по методу Брэдфорда.

Меченные тритием культуры получали следующим образом. 150 мкл аксенной культуры каждого из микроорганизмов помещали в среду MRS с добавкой меченного тритием тимидина (5 мкл в 3 мл MRS) и инкубировали в течение ночи при 30°С и 5% CO2. Препараты центрифугировали, и осадки ресуспендировали в буфере ЗФР до концентрации 108 КОЕ/мл. Сигнал трития, включенного в микроорганизмы, рассчитывают, исходя из исходного сигнала трития (мкл меченного тритием тимина, добавленных к среде) и сигнала в супернатанте. Отношение этой величины (сигнала, включенного в биомассу) к суммарному количеству микроорганизмов в культуре дает величину расп/мин/КОЕ (сигнал/бактерию).

За 24 час до анализа адгезии 1 мл раствора слизи с концентрацией 0,5 мг/мл инкубировали в лунках планшета для ELISA. После промывки в лунки добавляли 1×108 КОЕ/мл препаратов микроорганизмов, меченных тритием, и инкубировали в течение 60 мин при 37°С. Супернатанты из каждой лунки удаляли, лунки промывали средой MEM Alpha (Gibco) и скоблили для выделения из лунок слизи с микроорганизмами. Адгезию штаммов рассчитывали измерением на сцинтилляционном ридере (Wallac 1410) сигнала трития в препарате слизи с микроорганизмами в лунках и делением на величину расп/мин/КОЕ, полученную, как описано выше. Результат представляет собой количество бактерий, удерживающихся на единице поверхности слизи. 6,80×105, 6,58×106 и 7,31×106 КОЕ штаммов F2099, F3147 и F3276, соответственно, могут связаться с 2 см2 слизи кишечника. По сравнению с имеющимся в продаже штаммом Lp 299v штаммы по настоящему изобретению обладают значительно лучшей адгезионной способностью.

4.2. Адгезия к клеткам Caco-2

Клетки Caco-2 ECACC N˚: 86010202 были получены от Американской коллекции типовых культур (ATCC). Экспериментальная процедура измерения количества бактерий, прикрепленных к единице поверхности клеток caco-2, является по существу такой же, что и объясненная выше процедура для адгезии к слизи. Результаты показывают, что с 2 см2 клеток caco-2 могут связаться 3,12×106, 2,11×106 и 5,19×105 КОЕ штаммов F2099, F3147 и F3276, соответственно. И вновь, по сравнению с имеющимся в продаже штаммом Lp 299v штаммы по настоящему изобретению обладают лучшей адгезионной способностью.

5. Анализ токсичности

Заранее определенную смешанную культуру штаммов F2099, F3147 и F3276 (эта смешанная культура впредь будет называться AB-LIFE) вводили в количестве 5×1010 КОЕ/кг шести 9-недельным крысам Вистар (самцам и самкам) в течение двух последовательных дней в суммарной дозе 1011 КОЕ/кг. Животные получали корм (Teklacd 2014) и воду по потребности. Введение производили после приема пищи на полный желудок с помощью трубки для введения в желудок через горло. Такой же режим питания использовали для 6 контрольных крыс, которые получали только ЗФР. Через каждые два дня определяли состояние здоровья путем количественной оценки таких параметров, как масса, поведение и ответ на стимулы. Общую сумму баллов получали как сумму величин, полученных для каждого параметра: масса + поведение + ответ на стимулы. В итоге, во время исследования не было отмечено негативного действия на состояние здоровья животных.

Животных забивали на 7 день ингаляцией CO2. Для выявления макроскопических повреждений органов производили полное вскрытие. Отбирали образцы лимфатических узлов мезентерия и печени для анализа бактериальной транслокации. Приблизительно 5 мг каждого образца гомогенизировали в 1 мл ЗФР с 0,01% желатином. 100 мкл этого гомогената помещали либо на чашки McConkey, либо на чашки MRS. После инкубации при 37°С в течение 48 час подсчитывали колонии. Результаты представлены в таблице 9 и таблице 10. В чашках MRS с материалом от контрольных и получавших AB-LIFE животных имелись немногочисленные колонии LAB, что соответствует нормальной базальной транслокации LAB (J.S. Zhou et al., "Acute oral toxicity and bacterial translocation studies on potentially probiotic strains of lactic acid bacteria", Food Chem Toxicol 2000, vol. 38, p. 153-61).

В заключение, результаты показывают, что пероральное введение культуры AB-LIFE является безопасным, поскольку не ведет к повышению транслокации LAB и оно не облегчает транслокацию кишечных бактерий. На протяжении исследования все животные показали сходную прибавку массы тела. Не наблюдалось существенных различий в потреблении корма и воды. Не наблюдалось ни клинических симптомов, ни отклонений в состоянии здоровья животных. Не было обнаружено макроскопических повреждений в органах и полостях при гистопатологическом обследовании.

Таблица 9
Бактериальная транслокация в печень получавших AB-LIFE животных. Числа указывают количество животных с позитивным бактериальным ростом и максимальное количество КОЕ/мг ткани.
Группа Пол Кишечные бактерии (КОЕ/мг) Молочнокислые бактерии (КОЕ/мг) Максимальная наблюдаемая транслокация (КОЕ/мг)
Контроль Самцы 0/3 0/3 0
Самки 0/3 0/3 0
AB-LIFE Самцы 0/3 1/3 1
Самки 0/3 0/3 0
Таблица 10
Бактериальная транслокация в лимфатические узлы мезентерия получавших AB-LIFE животных. Числа указывают количество животных с позитивным бактериальным ростом и максимальное количество КОЕ/мг ткани.
Группа Пол Кишечные бактерии (КОЕ/мг) Молочнокислые бактерии (КОЕ/мг) Максимальная наблюдаемая транслокация (КОЕ/мг)
Контроль Самцы 0/3 1/3 1
Самки 0/3 1/3 1
AB-LIFE Самцы 0/3 1/3 1
Самки 0/3 1/3 1

6. Антагонистические свойства

Для оценки того, проявляют ли штаммы F2099, F3147 и F3276 антагонистическую активность, использовали протокол Кемпбелла с применением шашек агара, засеянных бактериальными патогенами в среде Oxoid. Использованные в этом исследовании патогены были выбраны из тех, которые обычно находятся в желудочно-кишечном тракте человека (см. таблицу 11). Чашки однородно засевали и выращивали до конфлюентности при подходящих температурах в 5% CO2-инкубаторе. После этого цилиндрический фрагмент однородно засеянной, конфлюентной чашки агара с F2099, F3147 или F3276 помещали вертикально на чашку с патогеном и инкубировали в течение ночи при 37°С. На следующий день измеряли зоны ингибирования путем помещения чашки с агаром на плоскую линейку. Затем рассчитывали ингибирующую рост активность путем вычитания диаметра цилиндра (CD) из диаметра зоны ингибирования (IZD) и деления этой разности на два по формуле GI=(IZD-CD)/2. Ингибирующую способность штаммов по изобретению сравнивали с таковой имеющихся в продаже штаммов Lp299v и Lp VSL#3.

Штаммы F2099, F3147 и F3276 ингибировали рост большинства патогенных штаммов, представленных в таблице 11. Таким образом, они оказывают благоприятное действие на баланс кишечной микробиоты благодаря своей способности ингибировать рост патогенных штаммов. Штаммы по настоящему изобретению в целом обладали лучшими антагонистическими свойствами по сравнению с имеющимися в продаже контрольными штаммами.

7. Оценка in vitro иммуномодулирующей способности продукции цитокинов в модели слизистой оболочки кишечника

Выбранная модель слизистой оболочки представляет собой клеточную линию моноцитов THP-1 благодаря ее чувствительности к компонентам бактерий, подобным ЛПС (в качестве индуктора воспалительного ответа) и их способности модулировать продукцию цитокинов при наличии в среде молекул, подходящих для индукции продукции противовоспалительного паттерна цитокинов.

Полученные от ATCC клетки THP-1 выращивали в среде DMEM в 24-луночных планшетах для ELISA до конечной концентрации приблизительно 106 моноцитов/лунку. Клетки стимулировали 10 нг/мл ЛПС в течение 2,5 часов перед добавлением бактериальных штаммов. Штаммы F2099, F3147, F3276 и Lp 299v предварительно выращивали в течение ночи в среде MRS при 37°С в атмосфере 5% CO2. После инкубации рассчитывали концентрацию микроорганизмов с помощью счетной камеры Ньюбауэра и соответствующим образом разбавляли с получением конечного соотношения 25:1 (2,5×107) КОЕ/моноциты в 500 мкл DMEM в лунках для ELISA с клетками THP-1. Каждое разбавление производят средой DMEM с добавкой гентамицина (50 мкг/мл), ампициллина (10 мкг/мл) и хлоранфеникола (12 мкг/мл).

Совместную инкубацию клеток THP-1 со штаммами L. plantarum проводили в течение 24 часов с отбором аликвот через 6 часов и в конце эксперимента для последующего анализа. Аликвоты центрифугировали, и супернатанты анализировали на TNFα и ИЛ-10 с помощью проточной цитометрии с использованием имеющегося в продаже набора Human Soluble Protein Master Buffer (BD Cytometric Bead Array) в соответствии с указаниями производителя.

Для интерпретации полученных результатов получали нормализованный наклон между величинами, полученными через 6 и 24 часа. Нормализованный наклон рассчитывали по следующей формуле, предлагаемой производителем:

NS=((1-величина ИЛ 24 час/величина ИЛ 6 час)/24)×100;

где NS представляет собой нормализованный наклон, а величина ИЛ (или TNFα) представляет собой концентрацию ИЛ-10 или TNFα через 6 или 24 часа. Результаты выражены в пг/мл.

Причина выбора этого метода заключается в получении стандартной величины, которая обеспечивает перекрестное сравнение экспериментов (таблица 12), поскольку изменение концентрации цитокинов представляет больший интерес, чем ее абсолютная величина (пг/мл). Исходя из величин, полученных через 6 часов, клетки THP-1 все еще находятся под индуцирующим действием ЛПС; позднее концентрация TNFα возрастает, а концентрация ИЛ-10 снижается. Через 24 часа можно наблюдать обращение профиля цитокинов (снижение TNFα и повышение ИЛ-10).

Таблица 12
Нормализованные наклоны, показывающие индукцию (положительный наклон) или ингибирование (отрицательный наклон) ИЛ-10 и TNFα в индуцированных ЛПС клетках THP-1
ИЛ-10 TNF-α
F2099 20,56 -1,23
F3147 37,56 -1,61
F3276 31,46 -2,34
Lp 299v 21,42 -0,52

Как показано в таблице 12, в индуцированных ЛПС клетках THP-1 индуцируется продукция ИЛ-10 в присутствии штаммов L. plantarum, причем индукция ИЛ-10 особенно высока в присутствии штамма F3276. Кроме того, F2099, F3147 и F3276 обладают более высокой ингибирующей активностью в отношении продукции воспалительного TNFα по сравнению с имеющимся в продаже Lp 299v.

8. Продукция короткоцепочечных жирных кислот

Для оценки продукции пропионовой и масляной кислот штаммы по изобретению и контрольные штаммы выращивали на базальной среде с добавкой 1% масс/об. каждого из следующих волокон: инулина (SIGMA I2255), пектина (SIGMA 76282) и фруктоолигосахаридов (FOS) (SIGMA F8052), которые представляют собой волокна, имеющиеся в повседневной пище. Состав базальной среды представлен в таблице 13. Среду предварительно инкубировали в течение 12 часов в анаэробной атмосфере. После инокуляции каждым из штаммов Lp среду инкубировали в течение ночи при 37°С в анаэробных условиях. Ночные культуры затем центрифугировали, и супернатант быстро замораживали в жидком азоте для последующего анализа ВЭЖХ на хроматографе Agilent 1100 с использованием колонки с обращенной фазой Tracer Extrasil ODS2 (3 мкм, 15×0,4 см). Результаты для концентраций пропионовой и масляной кислот в образцах можно видеть в таблице 14.

Таблица 14
Продукция пропионовой и масляной кислот штаммами L. plantarum, выращиваемыми на базальной среде, содержащей инулин, пектин и FOS
Пропионовая кислота (мг/мл) Масляная кислота (мг/мл)
F2099 15,546 14,185
F3147 12,23 12,294
F3276 44,939 21,636
Lp 299v 12,898 9,195

На основании представленных выше результатов можно заключить, что штаммы по настоящему изобретению продуцируют большое количество пропионовой и масляной кислот, оказывая тем самым благоприятное действие на организм хозяина.

9. Гипохолестеринемическая активность in vivo

Снижающее холестерин действие пробиотической композиции по изобретению у индивидуумов с гиперхолестеринемией исследовали в рандомизированном, дважды слепом, контролируемом плацебо, параллельном клиническом испытании. В исследовании дополнительно рассматривали другие параметры, связанные с сердечно-сосудистой системой, а также переносимость пробиотической композиции и ее органолептические свойства.

В исследовании приняли участие 60 индивидуумов с гиперхолестеринемией в возрасте от 18 до 65 лет. Индекс массы тела (BMI) участников составлял от 19 до 30 кг/м2, общий холестерин сыворотки (total-C) составлял от 200 до 300 мг/дл, а холестерин липопротеидов низкой плотности (LDL-C) составлял от 130 до 190, за исключением индивидуумов, имеющих два или более факторов риска, у которых LDL-C составлял от 100 до 190 мг/дл. Ни один из участников не получал какого-либо гипохолестеринемического лечения на протяжении четырех недель, предшествовавших исследованию. Были исключены индивидуумы с гипертриглицеридемией выше 350 мг/дл или пострадавшие от приступа сердечно-сосудистой ишемии в пределах 6 месяцев до начала исследования. Были также исключены беременные или кормящие грудью женщины и индивидуумы с аллергией к любому из компонентов композиций. Различие между участниками-мужчинами и участниками-женщинами не превышало 20%. Все участники дали письменное информированное согласие на участие, и протокол исследования был рассмотрен и одобрен независимой комиссией по этике.

На протяжении 12 недель участники получали однократную ежедневную дозу либо контрольной композиции (плацебо), либо пробиотической композиции, включающей 1,2*109 КОЕ смешанной культуры из равных частей трех штаммов по изобретению, F2099, F3147 и F3276 (AB-LIFE 2). Состав композиций плацебо и AB-LIFE представлен в таблице 15. Обе композиции вводили в форме промышленно изготовленной желатиновой капсулы. На протяжении исследования у индивидуумов отслеживали LDL-C, total-C, ЛПНП/ЛПВП, окисленные ЛПНП, триглицериды, артериальное давление, базальную гликемию, массу, индекс талия/бедра, жир тела и состояние здоровья. Кроме того, оценивали органолептические свойства и переносимость композиций. Измеренные величины для группы, получавшей пробиотик AB-LIFE 2, и группы плацебо статистически анализировали с помощью программы SPSS.

Таблица 15
Состав композиций пробиотика AB-LIFE 2 и плацебо (величины в мг на капсулу)
AB-LIFE 2 Плацебо
F2099, F3147 и F3276: 100 Кукурузный крахмал: 100 мг
Микрокристаллическая целлюлоза (pH 10,2): 71,1 Микрокристаллическая целлюлоза (pH 10,2): 71,1
Тальк: 2,6 Тальк: 2,6
Стеарат магния: 1,3 Стеарат магния: 1,3

Результаты клинического испытания показаны в таблицах 16 и 17. Средние величины и стандартные отклонения для total-C, LDL-C и окисленных ЛПНП до и после лечения в обеих группах плацебо и пробиотика можно видеть в таблице 16. Процент снижения и статистический анализ внутри групп показаны в таблице 17. На этом основании сделано заключение, что AB-LIFE 2 является эффективным гипохолестеринемическим агентом. Более того, при сравнении с продуктами сходного назначения, подобными растительным стеринам, снижение total-C, вызываемое потреблением AB-LIFE 2, является более высоким (Plana N. et al., "Plant sterol-enriched fermented milk enhances the attainment of LDL-cholesterol goal in hypercholesterolemic subjects", Eur J Nutr., 2008, vol. 47, p. 32-39).

Таблица 16
Средние величины и стандартные отклонения для total-C, LDL-C и
окисленных ЛПНП. t0, исходные величины; tf, величины в конце
12-недельного лечения.
total-C_t0 total-C_tf
Среднее Ст.откл. Среднее Ст.откл.
Плацебо 252,63 23,47 242 22,676
AB-LIFE 247,43 31,28 213,77 18,68
LDL-C_t0 LDL-C_tf
Среднее Ст.откл. Среднее Ст.откл.
Плацебо 168,4 19,592 158,53 18,17
AB-LIFE 166,67 21,595 142,17 13,28
Окисленные ЛПНП_t0 Окисленные ЛПНП_tf
Среднее Ст.откл. Среднее Ст.откл.
Плацебо 56,42 9,99 55,38 9,71
AB-LIFE 54,68 10,99 47,23 8,32
Таблица 17
Процент снижения (и внутригрупповой статистический анализ) total-C, LDL-C и окисленных ЛПНП в группе пробиотика AB-LIFE.
Total-C 13,60% (p<0,05)
LDL-C 14,30% (p<0,05)
Окисленные ЛПНП 13,62% (p<0,05)

Ссылки, цитированные в заявке

Tanaka H, Doesburg K, Iwasaki T, Mierau I, “Screening of Lactic Acid Bacteria for Bile Salt Hydrolase Activity”. Journal of Dairy Science 1999, vol. 82, p. 2530-35.

Bukowska H, Pieczul-Mróz J, Jastrzebska M, Chełstowski K, Naruszewicz M, “Decrease in fibrinogen and LDL-cholesterol levels upon supplementation of diet with Lactobacillus plantarum in subjects with moderately elevated cholesterol”. Atherosclerosis 1998, vol. 137, p. 437-38.

Wong JM, de Souza R, Kendall CW, Emam A, Jenkins DJ, “Colonic health: fermentation and short chain fatty acids”. J Clin Gastroenterol 2006, vol. 40, p. 235-43.

Naruszewicz M, Kozłowska-Wojciechowska M, “Potential parapharmaceuticals in the traditional Polish diet”. Journal of Physiology and Pharmacology 2005, vol. 56, suppl 1, p. 69-78.

Goldstein M, Mascitelli L, Pezzetta F, “Statins, plant sterol absorption, and increased coronary risk”. Journal of Clinical Lipidology, 2008, vol. 2, p. 304-305.

Kailasapathy K, “Microencapsulation of Probiotic Bacteria: Technology and Potential Applications”. Curr Issues Intest Microbiol 2002, vol. 3, p. 39-48.

Lim HJ, Kim SY, Lee WK, “Isolation of cholesterol lowering lactic acid bacteria from human intestine for probiotic use”. J Vet Sci 2004, vol. 5, p. 391-5.

Wang Q, Garrity GM, Tiedje JM, Cole JR, "Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy". Appl. Environ. Microbiol 2007, vol. 73, p. 5261-7.

RefSeq data base, http://www.ncbi.nlm.nih.gov/RefSeg

Ribosomal Database Project, http://rdp.cme.msu.edu/

Cole JR, Chai B, Farris RJ, Wang Q, Kulam-Syed-Mohideen AS, McGarrell DM, Bandela AM, Cardenas E, Garrity GM, Tiedje JM, "The Ribosomal Database Project (RDP-II): introducing myRDP space and quality controlled public data" Nucl. Acids Res. 2007, vol. 35, p. 169-72.

Rodas AM, Ferrer S, Pardo I, "Polyphasic study of wine Lactobacillus strains: taxonomic implications", Int J Syst Evol Microbiol 2005, vol. 55, p. 197-207.

Sánchez I, Seseña S, Palop LL, “Polyphasic study of the genetic diversity of lactobacilli associated with 'Almagro' eggplants spontaneous fermentation, based on combined numerical analysis of randomly amplified polymorphic DNA and pulsed-field gel electrophoresis patterns”, Journal of Applied Microbiology 2004, vol. 97, p. 446-58.

Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B, “Interpreting chromosomal DNA restriction patterns produced by pulsed- field gel electrophoresis: criteria for bacterial strain typing” J Clin Microbiol 1995, vol. 33, p. 2233-9.

Zhou JS, Shu Q, Rutherfurd KJ, Prasad J, Gopal PK, Gill HS, “Acute oral toxicity and bacterial translocation studies on potentially probiotic strains of lactic acid bacteria”, Food Chem Toxicol 2000, vol. 38, p. 153-61.

Plana N, Nicolle C, Ferre R, Camps J, Cos R, Villoria J, Masana L; DANACOL group, “Plant sterol-enriched fermented milk enhances the attainment of LDL-cholesterol goal in hypercholesterolemic subjects”, Eur J Nutr., 2008, vol. 47, p. 32-39.

1. Композиция со снижающей холестерин активностью, включающая эффективное количество по меньшей мере одного из штаммов, выбранных из группы, состоящей из: штамма, депонированного в Испанской Коллекции Типовых Культур (CECT) под номером доступа 7527, штамма, депонированного в СЕСТ под номером доступа 7528, и штамма, депонированного в CECT под номером доступа 7529.

2. Композиция по п. 1, которая включает эффективное количество по меньшей мере одного из штаммов, выбранных из группы, состоящей из Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 и Lactobacillus plantarum CECT 7529.

3. Композиция по п. 1, которая включает эффективное количество штаммов Lactobacillus plantarum CECT 7527, Lactobacillus plantarum СЕСТ 7528 и Lactobacillus plantarum CECT 7529.

4. Фармацевтический продукт со снижающей холестерин активностью, включающий эффективное количество композиции по любому из пп. 1-3 вместе с подходящим количеством фармацевтически приемлемого наполнителя.

5. Ветеринарный продукт со снижающей холестерин активностью, включающий эффективное количество композиции по любому из пп. 1-3 вместе с подходящим количеством ветеринарно приемлемого наполнителя.

6. Пищевой продукт со снижающей холестерин активностью, включающий эффективное количество композиции по любому из пп. 1-3 вместе с подходящими количествами других пищевых ингредиентов.

7. Пищевой продукт по п. 6, который представляет собой пищевую добавку.

8. Пищевой продукт по п. 7, который представляет собой нутрицевтик.

9. Пищевой продукт по любому из пп. 7-8, который находится в форме таблетки, капсулы, сиропа или пилюли.

10. Пищевой продукт по п. 6, который представляет собой молочный продукт или мясной продукт.

11. Штамм Lactobacillus plantarum со снижающей холестерин активностью, представляющий собой штамм, депонированный в CECT под номером доступа 7527.

12. Штамм Lactobacillus plantarum со снижающей холестерин активностью, представляющий собой штамм, депонированный в CECT под номером доступа 7528.

13. Штамм Lactobacillus plantarum со снижающей холестерин активностью, представляющий собой штамм, депонированный в CECT под номером доступа 7529.

14. Способ профилактики или лечения сердечно-сосудистых нарушений у животного, включая человека, включающий введение нуждающемуся в этом указанному животному эффективного количества композиции по любому из пп. 1-3.

15. Способ по п. 14, который включает введение эффективного количества композиции по любому из пп. 1-3 в сочетании со статинами.

16. Способ по любому из пп. 14-15, где животное, включая человека, характеризуется гиперабсорбцией стеринов.

17. Способ снижения холестерина у животного, включая человека, включающий введение нуждающемуся в этом указанному животному эффективного количества композиции по любому из пп. 1-3.

18. Способ по п. 17, который включает введение эффективного количества композиции по любому из пп. 1-3 в сочетании со статинами.

19. Способ по любому из пп. 17-18, где животное, включая человека, характеризуется гиперабсорбцией стеринов.

20. Применение композиции по любому из пп. 1-3 в качестве пробиотика.

21. Применение композиции по любому из пп. 1-3 для профилактики или лечения сердечно-сосудистых нарушений у животного, включая человека.

22. Применение композиции по любому из пп. 1-3 в качестве гипохолестеринемического агента.

23. Применение композиции по любому из пп. 1-3 у индивидуумов с гиперабсорбцией стеринов.



 

Похожие патенты:

Изобретение относится к области биотехнологии. Предложено применение соли угольной кислоты в качестве стабилизатора цвета в бактериальной композиции, содержащей бактериальные клетки, относящиеся к роду Bifidobacterium, и аскорбат.

Изобретение относится к области микробиологии. Штамм бактерий Kocuria sp., обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Kocuria sp.

Изобретение относится к области микробиологии. Штамм бактерий Serratia plymuthica ELA-9, обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Serratia plymuthica VKM B-2819D и может быть использован для очистки почв и водоемов, загрязненных нефтью и нефтепродуктами, в широком диапазоне температур от +4 до +30°C.
Изобретение относится к области биотехнологии. Предложен способ получения ксантана.
Изобретение относится к биотехнологии и может быть использовано при производстве препаратов для борьбы с колорадским жуком. Штамм Bacillus thuringiensis 16T100/18 (ВИЗР) обладает высокой инсектицидной активностью в отношении личинок и имаго колорадского жука.

Изобретение относится к санитарной микробиологии и может быть использовано при лабораторных исследованиях. Способ предпосевной обработки патологического материала для выделения нокардиоформных актиномицетов предусматривает измельчение патологического материала с последующим смешиванием с дезинфекционным средством "Септустин" в концентрации 0,1% в объемном соотношении 1:2 в течение 180 минут при комнатной температуре с последующей двукратной в течение 15 минут отмывкой стерильным физиологическим раствором.

Изобретение относится к области микробиологии. Штамм бактерий Rhodococcus sp.

Изобретение относится к области медицинской микробиологии и биотехнологии. Штамм микромицета Trichoderma hamatum обладает антибактериальной активностью в отношении возбудителя сибирской язвы Bacillus anthracis.

Изобретение относится к биотехнологии и может быть использовано при производстве питательных сред для суспензионного культивирования клеток, в частности суспензионного культивирования клеток почки сирийского хомячка.
Изобретение относится к биотехнологии. Штамм гриба Aspergillus niger В-6 является продуцентом лимонной кислоты.

Изобретение относится к области биотехнологии. Предложено применение соли угольной кислоты в качестве стабилизатора цвета в бактериальной композиции, содержащей бактериальные клетки, относящиеся к роду Bifidobacterium, и аскорбат.

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia slovaca. Представлено применение штамма Rickettsia slovaca "Карпунино-19/69", депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им.

Изобретение относится к области микробиологии. Штамм бактерий Kocuria sp., обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Kocuria sp.

Изобретение относится к области микробиологии. Штамм бактерий Serratia plymuthica ELA-9, обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Serratia plymuthica VKM B-2819D и может быть использован для очистки почв и водоемов, загрязненных нефтью и нефтепродуктами, в широком диапазоне температур от +4 до +30°C.
Изобретение относится к области биотехнологии. Предложен способ получения ксантана.
Изобретение относится к биотехнологии и может быть использовано при производстве препаратов для борьбы с колорадским жуком. Штамм Bacillus thuringiensis 16T100/18 (ВИЗР) обладает высокой инсектицидной активностью в отношении личинок и имаго колорадского жука.

Изобретение относится к области микробиологии. Штамм бактерий Rhodococcus sp.
Изобретение относится к биотехнологии. Штамм споровых бактерий Bacillus megaterium 501 GR, обладающий ростостимулирующим эффектом, депонирован в ГНУ ВНИИСХМ Россельхозакадемии под регистрационным номером RCAM00875 и может быть использован в качестве полифункционального средства для растениеводства, улучшая фосфорное питание растений, а также способствуя биоремедиации загрязненных пестицидами почв.
Изобретение относится к биотехнологии. Описан штамм бактерий Halobacterium salinarum ВКПМ В-11850 - продуцент бактериородопсина.
Получен штамм бактерий Halobacterium salinarum D96N ВКПМ В-11953 - продуцент бактериородопсина, значительно превосходящий по продуктивности (биомассы и бактериородопсина) как ближайший аналог, так и другие, выбранные в качестве контролей штаммы в различных условиях культивирования.

Группа изобретений относится к медицине и касается способа лечения или профилактики RHD, связанного с инфекцией GAS, включающего введение пациенту по меньшей мере одного антигена GAS, выбранного из группы, включающей аминокислотные последовательности SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 или 8 или их функциональные эквиваленты.
Наверх