Способ диагностики йерсиниоза лососевых рыб, вызываемого yersinia ruckeri, методом полимеразной цепной реакции и диагностический набор для осуществления способа



Способ диагностики йерсиниоза лососевых рыб, вызываемого yersinia ruckeri, методом полимеразной цепной реакции и диагностический набор для осуществления способа
Способ диагностики йерсиниоза лососевых рыб, вызываемого yersinia ruckeri, методом полимеразной цепной реакции и диагностический набор для осуществления способа
Способ диагностики йерсиниоза лососевых рыб, вызываемого yersinia ruckeri, методом полимеразной цепной реакции и диагностический набор для осуществления способа

 


Владельцы патента RU 2560570:

Государственное научное учреждение Всероссийский научно-исследовательский институт экспериментальной ветеринарии имени Я.Р. Коваленко (ВИЭВ Россельхозакадемии) (RU)

Предлагаемая группа изобретений относится к области биотехнологии, а именно к способу диагностики йерсиниоза лососевых рыб и набору для его осуществления. Данная группа изобретений может быть использована для выявления возбудителя йерсиниоза лососевых - Yersinia ruckeri - в пробах для диагностики болезней рыб в ветеринарии. Способ включает проведение полимеразной цепной реакции для выявления соответствующих фрагментов нуклеиновых кислот с использованием праймеров, имеющих следующую структуру: 5'CTAACACTACAGGTTATCGCCTCTG3' (Yr-rA-1), 5'GGCTCATCATACGAGCGGCAAGTCC3' (Yr-rA-2), 5'CTTGTTTGACGATATTCGCTTTGGC3' (Yr-gA-1), 5'CTGGGGGAACCGGGAAGTAACC3' (Yr-gA-2), 5'GCGAAAGCTTGCGTGAGCTGTCG3' (Yr-gB-1), 5'GGAAACCATCATTCCACTGCAAG3' (Yr-gB-2). О наличии в образце ДНК Yersinia ruckeri судят по специфическому фрагменту размером 294 п.о. для пары Yr-rA-1,2; размером 154 п.о. для пары Yr-gA-1,2; размером 225 п.о. для пары Yr-gB-1,2. Предложенное изобретение позволяет диагностировать йерсиниоз лососевых рыб с высокой специфичностью. 2 н.п. ф-лы, 3 ил., 1 табл., 3 пр.

 

Предлагаемое изобретение относится к области ветеринарной биотехнологии, молекулярной биологии и может быть использовано для выявления генетического материала возбудителя йерсиниоза лососевых - Yersinia ruckeri - в пробах как для диагностики болезней рыб в ветеринарии, так и для научных исследований.

Среди инфекционных болезней радужной форели, выращиваемой в пресной воде, серьезную опасность представляет йерсиниоз - ERM (Enteric Red Month, «кишечная красноротость»), вызываемый бактерией Yersinia ruckeri, представителем семейства Enterobacteriaceae. Симптомы йерсиниоза у больной рыбы включают геморрагии различных тканей и органов, особенно около рта, в жабрах, мускулатуре, брюшной стенке, полостном жире, а также в переднем и заднем отделе кишечника. При заболевании характерны желтые выделения из анального отверстия.

Йерсиниоз признан энзоотической инфекцией в ряде регионов, активно занимающихся форелеводством - в Северной Америке, Европе, Австралии, Южной Африке. Впервые заболевание зарегистрировано в аквакультуре в 60-е годы в США, позднее, в 1981 году, во Франции, далее в Германии. В настоящее время в связи с массовыми, но практически бесконтрольными международными перевозками рыбопосадочного материала болезнь распространена достаточно широко.

С 2010 года йерсиниоз выявляется и в Российской Федерации, где в список карантинных заболеваний не входит, но за счет массовой гибели и порчи товарного вида продукции наносит тяжелый урон рыбоводческим хозяйствам. Помимо форели Yersinia ruckeri выделена от разных видов лососевых, сиговых рыб, в частности кумжи, гольца, сига, а также щуки, угря, карпа, окуня, плотвы, осетров и налима, более того, известны случаи выявления возбудителя от других пресноводных гидробионтов, что может быть вектором передачи бактерий в окружающей среде культивируемой рыбе.

Полимеразная цепная реакция является прямым методом выявления ДНК, он обладает высокой специфичностью и чувствительностью. В основе метода ПЦР лежит естественный процесс репликации ДНК - комплементарное достраивание ДНК матрицы, осуществляемое с помощью фермента ДНК-полимеразы. Процесс удвоения нуклеиновых кислот можно использовать для получения копий коротких участков ДНК, специфичных для конкретных микроорганизмов, т.е. целенаправленный поиск специфичных участков является целью генодиагностики для выявления возбудителя йерсиниоза. Для эффективного проведения ПЦР необходимы ДНК-затравки - праймеры (синтетические олигонуклеотиды) определенного размера, строго специфичные для искомого возбудителя. Сложность выбора праймеров обусловлена их требованием строгой видоспецифичности. Праймеры должны быть комплементарны нуклеотидным последовательностям ДНК на границах специфического фрагмента и ориентированы таким образом, что достраивание новой цепи ДНК, катализируемое ДНК-полимеразой, протекает только между ними. В целом выбор специфического фрагмента и подбор праймеров играет решающую роль в специфичности проведения амплификации, что сказывается на качестве проведения анализа, а значит, обеспечивает точность диагностики заболевания.

В доступной литературе нами обнаружено только три статьи, авторы которых использовали ПЦР для работы с Yersinia ruckeri. В публикациях Jeffrey T. LeJeune & Fred R. Rurangirwa [J. Vet. Diagn.Invest., 2000, №12, p. 558-561] и A. del Cerro, I. Marquez & J.A. Guijarro [J. App. & Env. Microbiol., 2002, Vol. 68., №10, p. 5177-5180] используются праймеры, разработанные на основе гена 16S рРНК, это, несомненно, консервативный участок гена, однако современными исследованиями показано, что использование праймеров, сконструированных на основе рибосомальных генов, часто дает ложноположительные результаты. То есть было показано, что праймеры, комплементарные последовательностям гена 16S рРНК, детектируют не только Yersinia ruckeri, но и ДНК других представителей семейства Enterobacteriaceae, что недопустимо при дифференциальной диагностике, поэтому авторы в работе рекомендуют дополнительно использовать секвенирование для подтверждения специфичности синтезируемых в реакции ампликонов, что, в свою очередь, затратно и не всегда доступно.

В статье M. Kotetishvili, A. Kreger, G. Wauters, J.G. Morris, A. Sulakvelidze & O.C. Stine [Jour.of Clin.Microbiol., 2005, Vol. 43, №6, p. 2674-2684] использовали праймеры на основе фрагментов генов рибосомальной РНК, глютаминсинтетазы А, гиразы Б, рекомбинантного белка А для мультилокусного секвенирования и изучения филогенетических взаимоотношений йерсиний разных видов, а именно Yersinia aldovae, Y.bercovieri, Y.intermedia, Y.pestis, Y.pseudotuberculosis, Y.rohdei, Y.ruckeri, Y.enterocolitica, Y.frederiksenii, Y.kristensenii, Y.molaretii. В ходе исследования было установлено, что Yersinia ruckeri является наиболее генетически однородной и наиболее отдаленной группой внутри рода, однако вопросы достоверных межвидовых отличий от других представителей семейства Enterobacteriaceae не изучались.

Задача настоящего изобретения - разработка олигонуклеотидных праймеров для идентификации Yersinia ruckeri методом полимеразной цепной реакции и создание на их основе диагностического набора для дифференциальной диагностики йерсиниоза лососевых рыб.

Предлагаемое изобретение позволяет обнаруживать ДНК Yersinia ruckeri, которая вызывает йерсиниоз лососевых рыб, при этом аналогичные диагностические наборы не известны.

Задачу достигают конструированием специфичных олигонуклеотидных праймеров для идентификации ДНК Yersinia ruckeri методом мультилокусной полимеразной цепной реакции, имеющих следующие характеристики (Таблица 1 - см. в конце описания).

Подбор синтетических олигонуклеотидов проводили с использованием компьютерных программ Primer Select (Laser Gene 7.0) и Oligo 7.0 (США) на основе нуклеотидных последовательностей, представленных в международной базе данных GeneBank NCBI (www.ncbi.nlm.nih.gov), проанализированных с помощью пакета программ DNAStar Lasergene (США). Праймеры проверяли на отсутствие гомологии с последовательностями других бактерий и генома человека программой Blast с помощью web-ресурса Национального центра биотехнологической информации (NCBI). Оценка специфичности сконструированных праймеров подтвердила гомологичность с нуклеотидной последовательностью генов recA, glnA и gurB и отсутствие значимой гомологии с нуклеотидными последовательностями бактерий семейства Enterobacteriaceae и других видов. При анализе выбранных праймеров установлено отсутствие самокомлементарных участков внутри праймеров и комплементарности друг к другу, во избежание возникновения вторичных структур и «димеров» праймеров, которые могут блокировать реакцию или привести к неспецифической амплификации.

Разработанные олигонуклеотидные праймеры заказываются в коммерческом сервисном центре и являются составной частью набора следующих веществ:

- Пробирки с ПЦР-реакционной смесью, запаянной парафином, в состав которой входят указанные праймеры, дезоксирибонуклеотидтрифосфаты четырех типов, MgCl2, буферный раствор (ПЦР-смесь-2-blue) и деионизированная вода - приготовленную таким образом смесь можно хранить при t +8°C до 6 мес;

- Раствор фермента Taq-полимеразы;

- Положительный контрольный образец - ДНК генома Yersinia ruckeri, который вносится в пробирку по аналогии с исследуемыми (опытными) образцами, чтобы иметь возможность сравнивать результаты этих образцов с заведомо положительными;

- Отрицательный контрольный образец, который входит в состав набора для контроля загрязнения реактивов продуктами ранее проведенных реакций. Положительный результат в этом образце свидетельствует о необходимости поверить реактивы и переставить эксперимент.

ПРИМЕР 1. Амплификация специфических фрагментов ДНК генома Yersinia ruckeri с помощью предлагаемого набора на основе разработанных праймеров.

Эксперименты проводили на 12 штаммах Y. ruckeri из коллекции лаборатории ихтиопатологии ВИЭВ имени Я.Р. Коваленко, видовая принадлежность которых была ранее определена культурально-биохимическими и серологическими методами.

Для исключения неспецифического отжига праймеров до достижения заданных температурных параметров использовали режим «горячего старта», который обеспечивается приготовлением реакционной смеси, состоящей из двух слоев, разделенных прослойкой воска.

До начала ПЦР-анализа с помощью набора предлагаемых компонентов проводили пробоподготовку, заключающуюся в выделении ДНК из биоматериала с помощью любого коммерческого набора для выделения нуклеиновых кислот (что не является отличием данного патента).

Отбирали и маркировали необходимое количество пробирок с реакционной смесью, равное количеству анализируемых проб плюс два контроля (положительный и отрицательный).

В каждую промаркированную пробирку, не повреждая слой парафина, вносили раствор Taq-полимеразы в объеме 0,5 мкл. В пробирки вносили образцы анализируемой ДНК в объеме 5 мкл, в пробирку К- - отрицательный контроль, К+ - положительный контроль. Сверху наслаивали по 30 мкл минерального масла.

Пробирки устанавливали в блок амплификатора, условия проведения реакции: 1) 95°C - 5 мин - 1 цикл; 2) 94°C - 45 с, 61°C - 45 с, и 72°C - 60 с - 35 циклов; 3) 72°C - 5 мин - 1 цикл. Могут быть использованы амплификаторы любых производителей.

Анализ результатов амплификации проводили путем электрофореза продуктов реакции в 2% агарозном геле с добавление бромистого этидия, сравнивая их подвижность с подвижностью полос маркеров молекулярного веса (50+bp). При использовании разработанного набора в реакции амплификации с ДНК возбудителя йерсиниоза Y. ruckeri синтезируемые ампликоны соответствуют расчетным данным (табл. 1).

ПРИМЕР 2. Определение чувствительности реакции амплификации на основе разработанных праймеров.

Анализировали пробы ДНК, выделенные из серийных десятикратных разведений чистых культур возбудителя йерсиниоза. Исследование проводили по методике, описанной в примере 1. Последним разведением, в котором на электрофореграмме обнаруживалась специфическая полоса, считали 10-8 от исходной концентрации, что соответствует 1×102-1×104м.кл./мл. Электрофореграмма результатов ПЦР представлена на Рисунке 1.

ПРИМЕР 3. Определение специфичности диагностического набора на основе разработанных олигонуклеотидных праймеров проводили по методике, описанной в примере 1 в одном из двух вариантов.

-1-й (моноспецифический) вариант - «ПЦР в разных пробирках» - предусматривает проведение реакции в трех разных пробирках на одну пробу, содержащих реакционную смесь и одну пару праймеров.

-2-й (мультилокусный) вариант - «ПЦР в одной пробирке» - предусматривает проведение реакции в одной пробирке, содержащей реакционную смесь и три пары праймеров.

Специфичность диагностикума проверяли на образцах Y. ruckeri, других представителях рода Yersinia - Y. enterocolitica; микроорганизмах других семейств - Pseudomonadaceae, Vibrionaceae и гетерологичных организмов - Homo sapiens. Положительный результат получали только с образцами ДНК Y. ruckeri, с другими пробами в 100% случаев получен отрицательный результат (рис. 2 и рис. 3).

Полученные результаты свидетельствуют о высокой специфичности сконструированных праймеров и разработанного набора в отношении Yersinia ruckeri, что позволяет использовать их для дифференциальной диагностики йерсиниоза лососевых рыб в пробах биологического материала в короткие сроки с достоверностью 100%.

Диагностикум разработан и апробирован с положительным результатом в лаборатории ихтиопатологии ВИЭВ имени Я.Р. Коваленко в период октябрь 2013 - март 2014 года.

Предложенный способ может быть применен в научных исследованиях для получения новых знаний о распространении и закономерностях циркуляции йерсиний вида Yersinia ruckeri в аквакультуре, а также представляет практический интерес использования данного набора для диагностики в системе мониторинга, проводимого органами ветеринарной службы страны, что позволит контролировать заболеваемость йерсиниозом и сохранять здоровье культивируемых рыб.

Источники информации

1. Jeffrey T.LeJeune & Fred R.Rurangirwa. Polimerase chain reaction for definitive identification of Yersinia ruckeri / J.Vet.Diagn.Invest., 2000, №12, p.558-561.

2. A.del Cerro, I.Marquez & J.A.Guijarro. Simultaneous detection of Aeromonas salmonicida, Flavobacterium psychrophilum, and Yersinia ruckeri, three major fish pathogens, by Multiplex PCR / J. App.&Env.Microbiol., 2002, Vol.68., №10, p.5177-5180.

3. M.Kotetishvili, A.Kreger, G.Wauters, J.G.Morris, A.Sulakvelidze & O.C.Stine. Multilocus sequence typing for studying genetic relationships among Yersinia species / Jour.of Clin.Microbiol., 2005, Vol.43, №6, p.2674-2684 (прототип).

1. Способ диагностики йерсиниоза лососевых рыб, вызываемого Yersinia ruckeri, методом полимеразной цепной реакции, отличающийся тем, что для выявления соответствующих фрагментов нуклеиновых кислот используют праймеры, имеющие следующую структуру:
Yr-rA-1 - 5′CTAACACTACAGGTTATCGCCTCTG 3′;
Yr-rA-2 - 5′GGCTCATCATACGAGCGGCAAGTCC 3′;
Yr-gA-1 - 5′CTTGTTTGACGATATTCGCTTTGGC 3′;
Yr-gA-2 - 5′CTGGGGGAACCGGGAAGTAACC 3′;
Yr-gB-1 - 5′GCGAAAGCTTGCGTGAGCTGTCG 3′;
Yr-gB-2 - 5′GGAAACCATCATTCCACTGCAAG 3′;
о наличии в образце ДНК Yersinia ruckeri судят по специфическому фрагменту размером 294 п. о. для пары Yr-rA-1,2; размером 154 п. о. для пары Yr-gA-1,2; размером 225 п. о. для пары Yr-gB-1,2.

2. Диагностический набор для осуществления способа диагностики йерсиниоза, вызываемого Yersinia ruckeri, содержащий ПЦР-реакционную смесь, отличающийся тем, что ПЦР-реакционная смесь включает разработанные пары праймеров Yr-rA-1, 2; Yr-gA-1, 2; Yr-gB-1,2, аналогичные п. 1 в моноспецифическом и в мультилокусном варианте.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к одновременной идентификации токсигенных штаммов геновариантов Vibrio cholerae О1 серогруппы биовара Эль Тор и их дифференциации по эпидемическому потенциалу.

Изобретение относится к области биотехнологии. Система состоит из следующих элементов: а) модуля подготовки образца, выполненного с возможностью захвата аналита из биологического образца в немикрожидкостном объеме на захватывающей частице, реагирующей на магнитное поле, и направления связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, через первый микрожидкостный канал; б) реакционного модуля, включающего реакционную камеру, имеющую жидкостное сообщение с первым микрожидкостным каналом, и выполненного с возможностью иммобилизации связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, и проведения реакции амплификации множества STR-маркеров аналита.

Настоящее изобретение предоставляет способ предсказания ответа трижды негативного рака молочной железы на терапию противоопухолевым средством. Способ включает: (a) лизирование опухолевых клеток, взятых от трижды негативной опухоли молочной железы, для получения клеточного экстракта; (b) определение уровня экспрессии VEGFR2 в клеточном экстракте; и (c) сравнение уровня экспрессии VEGFR2 в клеточном экстракте, полученном на стадии (b), с эталонным уровнем экспрессии VEGFR2.
Изобретение относится к области медицины и предназначено для детекции гриба Microsporum canis. Осуществляют выделение тотальной нативной ДНК из образца кожи и волос, проводят полимеразную цепную реакцию и амплификацию фрагмента гена 5.8S рРНК Microsporum canis с использованием специфических праймеров.

Изобретение относится к области биохимии. Предложен способ выделения коротких РНК из биологических жидкостей.

Представленное изобретение относится к области биотехнологии и касается способа обнаружения провируса лейкоза крупного рогатого скота. Охарактеризованный способ включает выявление фрагмента LTR (Long Terminal Repeat) - последовательности провируса лейкоза.

Изобретение относится к биохимии. Описан способ обнаружения присутствия или отсутствия нескольких серотипов вируса папилломы человека (ВПЧ) в биологическом образце с помощью многоканальной системы анализа, где указанная система анализа обнаруживает большее количество серотипов, чем существует каналов обнаружения.

Изобретения относятся к области ДНК-генеалогии и касаются способа определения гаплогрупп Y-хромосомы человека, тест-системы и олигонулкотидных праймеров. Охарактеризованный способ осуществляют в два этапа.

Изобретение относится к области медицины и предназначено для определения риска развития рака тела матки у женщин с гиперпластическими процессами эндометрия. Осуществляют выделение ДНК из периферической венозной крови, проводят генотипирование гена APOE, выявляют полиморфные аллели APOE*2, APOE*3, APOE*4 и при наличии генотипов, содержащих аллели APOE*2 прогнозируют высокий риск рака эндометрия.
Изобретение относится к медицине, а именно к способу прогнозирования развития профессиональных гиперкератозов. Сущность способа состоит в том, что выделяют ДНК из лимфоцитов периферической венозной крови, проводят генотипирование полиморфизма rs1625895 гена ТР53 методом полимеразной цепной реакции с последующим рестрикционным анализом.

Изобретение относится к области биотехнологии и представляет собой набор олигонуклеотидных праймеров для идентификации ДНК животных, входящих в группу: свинья, бык, курица, овца, индейка, мышь, крыса, собака, кошка, и ДНК человека в сухих или консервированных кормах для животных и в сырых или подвергшихся кулинарной обработке мясных продуктах. Набор содержит первую и вторую композиции праймеров для идентификации митохондриальной ДНК, которые обеспечивают возможность одновременного проведения в одинаковых температурных режимах двух мультипраймерных реакций амплификации методом ПЦР с повышенной специфичностью к выявляемым митохондриальным ДНК. Для проведения мультипраймерных реакций ПЦР используют соответственно первую и вторую композиции праймеров, где в первую композицию входят праймеры, входящие в группу SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, а во вторую композицию входят праймеры, входящие в группу SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21. 4 ил., 8 табл., 4 пр.

Изобретение относится к молекулярной биологии, генетической инженерии, медицине и предназначено для типирования вируса гриппа А. Предлагаемый способ типирования вируса гриппа основан на проведении двухэтапной полимеразной цепной реакции (ПЦР) кДНК вируса с последующей гибридизацией меченных биотином ампликонов с ДНК-микрочипом, содержащим соответствующие дискриминирующие гибридизационные зонды. Использование этого способа позволяет определять все 9 субтипов гена нейраминидазы и 14 субтипов гена гемагглютинина вируса гриппа А. 2 н.п. ф-лы, 6 ил., 7 пр.

Изобретение относится к области биохимии, в частности к несортовому растению кукурузы с увеличенным по сравнению с контролем урожаем, включающему набор аллелей из соответствующего набора QTL, каждый из которых вносит вклад в фенотипический признак урожая зерна, причем указанный набор аллелей обоюдно комплементарен набору аллелей, имеющихся в линии Zea mays, выбранной из группы, состоящей из линии NP 1902, депонированной под номером NCIMB 41577, линии NP 1941, депонированной под номером NCIMB 41576, и линии NPNW 0351, депонированной под номером NCIMB 41578, а также к зерну или семени, им продуцируемому. Раскрыто применение вышеуказанного растения для получения продуктов переработки кукурузы, в частности зерна и зернышек кукурузы, а также способ получения растения кукурузы с увеличенным по сравнению с контролем урожаем с его использованием. Изобретение позволяет эффективно получать растение кукурузы с увеличенным по сравнению с контролем урожаем. 4 н. и 10 з.п. ф-лы, 1 ил., 18 табл., 8 пр.

Изобретение относится к области биохимии, в частности к способу определения геновариантов штаммов возбудителя чумы методом мультилокусного секвенирования. Заявленный способ предусматривает выделение хромосомной ДНК исследуемого штамма, амплификацию ДНК мишеней в полимеразной цепной реакции с использованием сконструированных праймеров, секвенирование амплифицированных фрагментов. Геновариант исследуемого штамма возбудителя чумы определяют по вариабельным нуклеотидам, маркерным для отдельных геновариантов. Способ позволяет эффективно и надежно определять геноварианты штаммов Y.pestis. 1 табл., 4 пр.

Изобретение относится к молекулярной биологии и касается биочипа для типирования вирусов Lassa (LASV), Junin (JUNV), Machupo (MACV), Guanarito (GTOV) и вирусов Ebola (EBOV) и Marburg (MARV), а также способа типирования указанных вирусов. Охарактеризованный биочип содержит гибридизационные зонды, ковалентно присоединенные непосредственно к микроматрице, имеющие структуру дискриминирующих ДНК-полинуклеотидов. Предлагаемый способ основан на проведении полимеразной цепной реакции кДНК вирусов с последующей гибридизацией меченных флуоресцентной меткой ампликонов с биочипом, содержащим дискриминирующие гибридизационные зонды. Представленные изобретения позволяют определять все известные субтипы вирусов LASV, JUNV, MACV, GTOV, EBOV и MARV. 2 н.п. ф-лы, 5 ил., 2 табл., 5 пр.

Изобретение относится к области биотехнологии. Раскрываются способы и композиции для определения наличия рака у субъекта и оценки эффективности лечения у него же. Раскрывается способ использования полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) и техники мультиплексной полимеразной цепной реакции, а также шаблонная реакция обмена и экстензии (TEER) для обнаружения наличия точечных мутаций, усечения или слияния киназы анапластической лимфомы. Предложенная группа изобретений может быть использована в медицине. 3 н. и 21 з.п. ф-лы, 6 ил., 3 табл., 5 пр.

Изобретение относится к биотехнологии, а именно к способу количественного определения нуклеиновых кислот. Способ включает мечение универсального эталонного олигонуклеотида флуоресцентным маркером. Создают стандартную кривую, используя серийные разведения меченого универсального эталонного олигонуклеотида, путем построения графика зависимости интенсивности флуоресцентного маркера от концентрации меченого эталонного олигонуклеотида. Амплифицируют целевую нуклеиновую кислоту в присутствии флуоресцентного маркера, который метит амплифицированную целевую нуклеиновую кислоту, при этом универсальный эталонный олигонуклеотид не амплифицируют или совместно не амплифицируют с целевой нуклеиновой кислотой. Сравнивают в реальном времени интенсивность флуоресцентного маркера, связанного с меченой амплифицированной целевой нуклеиновой кислотой, со стандартной кривой. Определяют количество амплифицированной целевой нуклеиновой кислоты. Предложенное изобретение позволяет количественно определять нуклеиновые кислоты для исследования генной экспрессии без необходимости нормализовать данные к конститутивному гену или к синтетическому гену интереса. 14 з.п. ф-лы, 21 ил., 3 табл., 6 пр.

Изобретения относятся к области ветеринарной микробиологии и касаются олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D, а также способа с их использованием. Предложенный способ включает выделение культур микроорганизмов из патологического материала на искусственных питательных средах. Проведение ПЦР с синтетическими олигонуклеотидными праймерами, имеющими нуклеотидные последовательности SEQ ID NO:1 - 5' catcgcatccagaatagcaaact 3', SEQ ID NO:2 - 5' ctccgatgctttggttgtg 3' на район гена dcbF, отвечающего за синтез гепарозансинтетазы. Перенос продукта амплификации на гель и оценку проведения реакции. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 355 п.н. Представленные изобретения могут быть использованы в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл., 1 ил., 4 пр.
Изобретение относится к области генетической инженерии, молекулярной биологии и медицины. Предложен набор биомаркеров старения сердца, включающий множество полинуклеотидов, которые дифференциально экспрессируются в ткани сердца у старых субъектов по сравнению с молодыми субъектами, в котором полинуклеотиды выбирают из двух или более генов, вовлеченных в передачу Wnt-сигнала в ткани сердца, где гены представляют собой Dlgh1, Magi3, Akt1, Dab2, Rac1, Ctnnb1, Camk2d, Mapk1, Senp2, Smad3, Mark2, Ccnd1 и Pias4, а также соответствующая композиция и способ скрининга средства или режима на их способность замедлять старение сердца. 3 н. и 13 з.п. ф-лы, 4 табл., 1 пр.
Изобретение относится к области медицины, а именно к способу прогнозирования депрессии тяжелой степени у мужчин с ишемической болезнью сердца (ИБС). Сущность способа состоит в том, что у мужчин с ИБС устанавливают временную и структурную связь между ИБС и признаками депрессии, измеряют уровень личностной тревожности с помощью теста Спилбергера-Ханина. При уровне личностной тревожности менее 45 баллов определяют полиморфизмы -1438A/G гена рецептора серотонина типа 2А и Val66Met гена нейротрофического мозгового фактора, после чего у больных, являющихся носителями аллеля S полиморфизма 5-HTTLPR, аллеля G полиморфизма -1438A/G и генотипа ValVal полиморфизма Val66Met, прогнозируют депрессию тяжелой степени. Использование заявленного способа позволяет эффективно выявлять пациентов с высоким риском развития депрессии тяжелой степени и назначить им своевременную дифференцированную психофармакотерапию. 7 пр.
Наверх