Набор олигонуклеотидных праймеров для идентификации днк животных в кормах и мясных продуктах

Изобретение относится к области биотехнологии и представляет собой набор олигонуклеотидных праймеров для идентификации ДНК животных, входящих в группу: свинья, бык, курица, овца, индейка, мышь, крыса, собака, кошка, и ДНК человека в сухих или консервированных кормах для животных и в сырых или подвергшихся кулинарной обработке мясных продуктах. Набор содержит первую и вторую композиции праймеров для идентификации митохондриальной ДНК, которые обеспечивают возможность одновременного проведения в одинаковых температурных режимах двух мультипраймерных реакций амплификации методом ПЦР с повышенной специфичностью к выявляемым митохондриальным ДНК. Для проведения мультипраймерных реакций ПЦР используют соответственно первую и вторую композиции праймеров, где в первую композицию входят праймеры, входящие в группу SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, а во вторую композицию входят праймеры, входящие в группу SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21. 4 ил., 8 табл., 4 пр.

 

Область техники

Избретение относится к области молекулярной биологии и генной инженерии, в частности к одновременному выявлению и идентификации митохондриальной ДНК животных в кормах, подвергшихся термической обработке, комбикормах, сухих и консервированных кормах для животных, а также в сырых мясных продуктах (части туши, фарш), мясных продуктах, подвергшихся кулинарной обработке.

Уровень техники

Выявление и идентификация митохондриальной ДНК животных в кормах для животных представляет актуальную проблему. Это связано с тем, что в 1986 г в Великобритании у крупного рогатого скота впервые была выявлена губчатая энцефалопатия (BSE), которая распространилась на 26 стран мира [1]. Быстрое распространение было вызвано применением для сельскохозяйственных животных белковых добавок в виде мяса и костной муки, которые использовались для обеспечения незаменимых аминокислот для кормящих и быстро растущих животных.

Для прекращения распространения болезней был введен запрет на использование белковых добавок. Так, в 2000 г. такой запрет был распространен в Европе на белковые добавки, полученные из млекопитающих, а также птиц и рыб для всех выращиваемых животных, которые будут использоваться в производстве продуктов питания.

В целях обеспечения действия запрета встала необходимость выявления белковых добавок в кормах для животных. Из всех известных методов диагностирования наибольшее распространение получил метод, основанный на применении методов ПЦР для выявления и идентификации митохондриальной ДНК животных в кормах и продуктах питания.

Известны изобретения [2-5] и ряд публикаций [6-8,] в которых рассматриваются вопросы применения метода ПЦР для диагностики ДНК животных в кормах для животных.

В последнее время фирмой ООО "Компания Биоком" выпускается набор реагентов для выявления и идентификации тканей животного происхождения [9], и в 2007 г. разработан ГОСТ Р 52723-2007 «Продукты пищевые и корма. Экспресс-метод определения сырьевого состава (молекулярный)» [10].

Наиболее близкими к настоящему изобретению являются наборы для диагностики, выпускаемые по ГОСТР 52723-2007 [9-10], позволяющие осуществить обнаружение только трех типов митохондриальных ДНК. В состав известных наборов входят смеси праймеров (олигонуклеотидов) для амплификации и выявления нуклеотидных последовательностей геномов крупного рогатого скота, свиньи, курицы.

К недостатку приведенных выше технических решений можно отнести малое число анализируемых типов ДНК. Кроме этого целесообразно выявление тех продуктов животного происхождения, которые входят в состав продуктов питания (колбас, сосисок, сарделек), с целью выявления включения в состав изделий мяса собак, кошек, мышей и крыс.

Технический результат, на достижение которого направлено данное изобретение, заключается в расширении типов исследуемых ДНК и в разработке технических решений по одновременной диагностике до 10 различных типов митохондриальных ДНК, что позволяет повысить надежность и эффективность проверки кормов и продуктов питания на наличие белковых добавок.

Для достижения данного технического результата в диагностический тест включен набор олигонуклеотидов-праймеров, позволяющих выявить не только геномы рогатого скота, свиньи, курицы, но и дополнительно выявить геномы овцы, индейки, собаки, кошки, мыши, крысы и человека. Кроме этого в рамках изобретения для осуществления эффективной мультиплексной ПЦР были разработаны новые конструкции праймеров, обладающие повышенной специфичностью к исследуемым ДНК. Благодаря включению в состав диагностического теста первого и второго наборов специфичных пар праймеров, приведенных в таблице №1, многократно повышается вероятность выявления, по меньшей мере, одного генома митохондриальных ДНК в случае его присутствия в исследуемой пробе. Первичная последовательность праймеров обеспечивает специфичность их взаимодействия с искомыми последовательностями ДНК.

Таким образом, снабжение диагностического теста первым и вторым наборами, содержащими специфичные пары праймеров , для обнаружения 10 различных типов митохондриальных ДНК, обеспечивает возможность выполнения поставленной технической задачи.

Сущностью изобретения является диагностический тест для выявления митохондриальной ДНК животных в кормах и мясных продуктах, содержащий первый комплект для выделения ДНК, второй комплект, включающий реагенты для проведения мультипраймерной реакции амплификации методом ПЦР, а также два набора праймеров, перечни последовательностей которых приведены соответственно на фиг.1 и фиг.2, а также третий комплект для проведения электрофореза в ПААГ. При этом в первый набор входят праймеры с нуклеотидной последовательностью SEQ ID NO: 1 по SEQ ID NO: 10, комплементарные к участкам ДНК, входящим в группу, состоящую из: Sus scrofa domesticus (свинья домашняя), Bos taurus taunts (домашний бык), Gallus gallus (домашняя курица), Ovis aries (домашняя овца), Meleagris gallopavo (обыкновенная индейка), и праймеры внутреннего контроля SEQ ID NO: 20 и SEQ ID NO: 21, а во второй набор входят олигонуклеотиды SEQ ID NO: 11 по SEQ ID NO: 19, комплементарные к участкам ДНК, входящим в группу, состоящую из: Mus musculus domesticus (мышь домовая), Rattus rattus (norvegicus) (крыса черная (серая)), Canis lupus familiaris (собака домашняя), Homo sapiens (человек разумный), Felis catus (домашняя кошка), и праймеры внутреннего контроля SEQ ID NO: 20 и SEQ ID NO: 21.

Краткое описание чертежей.

На фиг.1 приведен перечень праймеров первого набора, входящего во второй комплект диагностического теста для выявления митохондриальной ДНК животных в кормах и мясных продуктах.

На фиг.2 приведен перечень праймеров второго набора, входящего во второй комплект диагностического теста для выявления митохондриальной ДНК животных в кормах и мясных продуктах.

На фиг.3 приведена электрофореграмма мультипраймерного ПЦР-анализа ДНК, выделенной из образцов тканей индейки, овцы, курицы, быка, свиньи, кошки, человека, собаки, крысы, мыши.

На фиг.4 приведен пример мультипраймерного ПЦР-анализа ДНК образцов коммерчески доступных колбас. В первом образце колбасы (поз.1-1) обнаружено мясо свиньи, курицы, овцы. Во втором образце колбасы (поз.2-1) обнаружено мясо свиньи. В третьем образце колбасы (поз.3-1) обнаружено мясо свиньи, курицы, быка. В четвертом образце колбасы (поз.4-1) обнаружено мясо свиньи, быка. В исследованных образцах колбасы отсутствует мясо кошки (поз.1-2), человека (поз.2-2), собаки (поз.3-2), крысы и мыши (поз 4-2).

Осуществление изобретения

Диагностический тест предназначен для одновременного выявления и идентификации в исследуемых пробах митохондриальной ДНК животных, а именно Bos taurus taurus (домашний бык), Sus scrofa domesticus (свинья домашняя), Ovis aries (домашняя овца), Gallus gallus (домашняя курица), Meleagris gallopavo (обыкновенная индейка), Canis lupus familiaris (собака домашняя), Felis catus (домашняя кошка), Mus musculus domesticus (мышь домовая), Rattus rattus (norvegicus) (крыса черная (серая)) и Homo sapiens (человек разумный).

Для проведения диагностики диагностический тест содержит три комплекта реагентов.

Первый комплект предназначен для выделения ДНК. В состав комплекта входят флаконы: с лизирующим буфером, с первым и вторым промывочным буфером, с элюирующим буфером, с деионизованой водой, с раствором контроля выделения ДНК, с сорбентом - С.

Второй комплект предназначен для проведения мультипраймерной реакции амплификации. В состав комплекта входят флаконы: с реакционным буфером, с Taq ДНК-полимеразой, с урацил гликозилазой, с раствором положительного контрольного образца, с раствором отрицательного контрольного образца, с маслом для ПЦР. Кроме этого во второй комплект включены два набора олигонуклеотидных праймеров. Первый набор содержит праймеры с нуклеотидной последовательностью SEQ ID NO: 1 по SEQ ID NO: 10 (см. фиг.1), комплементарные к участкам ДНК, входящим в группу, состоящую из: Sus scrofa domesticus (свинья домашняя), Bos taurus taurus (домашний бык), Gallus gallus (домашняя курица), Ovis aries (домашняя овца), Meleagris gallopavo (обыкновенная индейка,) и праймеры внутреннего контроля SEQ ID NO: 20 и SEQ ID NO: 21.

Второй набор, входящий во второй комплект, содержит праймеры с нуклеотидной последовательностью SEQ ID NO: 11 по SEQ ID NO: 19, комплементарные к участкам ДНК, входящим в группу, состоящую из: Mus musculus domesticus (мышь домовая), Rattus rattus (norvegicus) (крыса черная (серая)), Canis lupus familiaris (собака домашняя), Homo sapiens (человек разумный), Felis catus (домашняя кошка), и праймеры внутреннего контроля SEQ ID NO: 20 и SEQ ID NO: 21 (см. фиг.2). Следует отметить, что из-за близости ДНК у мышей и крыс, в набор включены не четыре праймера, а три. Праймер SEQ ID NO: 16 используется одновременно в двух парах праймеров как для идентификации ДНК мышей (SEQ ID NO: 19 и SEQ ID NO: 16), так и при идентификации ДНК крыс (SEQ ID NO: 15 и SEQ ID NO: 16).

В таблице №1 приведен общий перечень праймеров, используемых при формировании диагностического теста.

Таблица №1
Перечень праймеров диагностического теста
ID SEQ No Название генов Нуклеотидная последовательность примеров
1 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Bos/taurus taurus (домашний бык) AACATGACTGACAATGATCTTATCAATATTCTTGA
2 ATAGTAGGCTTGGGAATAGTACGATAAGGGTT
3 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Sus scrofa domesticus (свинья домашняя) GCCACAACTAGATACATCCACATGATTCATTAC
4 TTGTTGGATCGAGATTGTGCGGTT
5 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Ovis arie (домашняя овца) CTCAAAACACAACTTCTACCACAACCCAG
6 AACAATGAGGGTAACGAGGGGGAGA
7 Фрагмент митохондриальной ДНК, кодирующий тРНК лизина и 8 субъединицы АТФ-азы Gallus gallus (домашняя курица) CAATTAAACCCAAACCCATGATTCТССA
8 GATTCCTAGTAGGCAGGGGCTTGAGAAT
9 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Meleagris gallopavo (обыкновенная индейка) CCATAAACAAACCTTCAACAACAAAACCAAT
10 GGAGGGCCGGGAGAAGTAGAGATG
11 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Canis lupus familiaris (собака домашняя) CGATAACCAAATCTGCTAAAATTGCTGG
12 AATGGAGATTAACCGATTATTGATTAGGCG
13 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Felis catus (домашняя кошка) CACTAAAACAACGGAATCCCTGAGAAAAA
14 TAGGTGAAGGGAATAAAATGCTTGGAAATATA
15 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Rattus rattus (крыса черная (серая)) AAAATTGTAGCCACAGGAAAAACAGACAAT
16 GTGCTCAGGTTCGTCCTTTTGGTGT
17 Фрагмент митохондриальной ДНК, кодирующий 8 и 6 субъединицы АТФ-азы Homo sapiens (человек разумный) AAAGCCCATAAAAATAAAAAATTATAACAAACCC
18 TTGGAGGTGGGGATCAATAGAGGG
19 Фрагмент митохондриальной ДНК, кодирующий 8 субъединицы АТФ-азы Mus musculus domesticus (мышь домовая) ACTAAAAGTCTCATCACAAACATTCCCACTG
20 GTGCTCAGGTTCGTCCTTTTGGTGT
21 Праймер внутреннего контроля CGCTCGAGTCTAGAGGGCCCG
22 GCAAACAACAGATGGCTGGCAACTA

Дополнительно, в состав второго комплекта входят пробирки для ПЦР вместимостью по 0,5 мл.

Третий комплект предназначен для проведения электрофореза в ПААГ. В третий комплект входят флаконы, содержащие: 20% раствор акриламид/бис-акриламидом, 10×ТБЭ буфер для электрофореза, раствор ТЕМЕД, 5×буфер для нанесения на гель, раствор бромистого этидия, раствор маркеров молекулярных масс, а также порошок ПСА.

Все комплекты упакованы в отдельные емкости, выполненные из пластика.

Диагностику кормов и мясных продуктов проводят последовательно, используя первый, второй и третий комплекты на следующих этапах: 1) выделение нуклеиновых кислот из исследуемых проб, 2) проведение мультипраймерной реакции амплификации специфичных для каждого вида фрагментов ДНК, 3) проведение электрофоретической детекции продуктов ПЦР в полиакриламидном геле (ПААГ). Порядок проведения этапов описан в примерах 1-3. Продолжительность проведения пробоподготовки, ПЦР и электрофоретической детекции составляет 6 часов.

На фиг.3 приведена электрофореграмма мультипраймерного ПЦР-анализа ДНК, выделенной из образцов тканей индейки, овцы, курицы, быка, свиньи, кошки, человека, собаки, крысы, мыши.

На фиг.4 приведен пример мультипраймерного ПЦР-анализа ДНК образцов коммерчески доступных колбас.В первом образце колбасы (поз.1-1) обнаружено мясо свиньи, курицы, овцы. Во втором образце колбасы (поз.2-1) обнаружено мясо свиньи. В третьем образце колбасы (поз.3-1) обнаружено мясо свиньи, курицы, быка. В четвертом образце колбасы (поз.4-1) обнаружено мясо свиньи, быка. В исследованных образцах колбасы отсутствует мясо кошки (поз.1-2), человека (поз.2-2), собаки (поз.3-2), крысы и мыши (поз 4-2).

После трех этапов проводят этап интерпретации результатов, который проводят на основании сопоставления подвижности в геле ПЦР-фрагментов проб и положительного контроля ПЦР. Результаты анализа могут быть просканированы, математически обработаны и занесены в базу данных, хранящуюся в компьютере и/или. переданы в электронном виде заказчику, для которого проводился анализ, либо в более развитую электронную базу, в которой осуществляется сбор данных, анализ и выявление причин, вызывающих эпидемии у животных.

Примеры.

Данные примеры включают, но не ограничивают выбор значений параметров, характеризующих объемы, время проведения и температуры проведения операций с образцами при выделении ДНК из исследуемого материала и на этапе проведения электрофореза.

Пример 1. Выделение ДНК из исследуемого материала.

В промаркированные пробирки добавляют по 400 мкл лизирующего буфера и 5 мкл положительного контрольного образца. Затем, отдельными наконечниками с антиаэрозольными фильтрами в каждую пробирку добавляют по 100 мкл исследуемого материала, в пробирку отрицательного контроля выделения добавляют 100 мкл деионизованой воды. Перемешивают и инкубируют при 65°С в течение 5 минут. Если выделение ДНК проводят из твердого сухого материала, то термостатируют 30 минут.

После этого пробирки центрифугируют в течение 20 сек при 10 тыс.об/мин в том случае, если смесь содержит нерастворимый осадок. Аккуратно, не задевая осадок, переносят надосадочные жидкости в чистые промаркированные микропробирки. Отдельными наконечниками с антиаэрозольными фильтрами в каждую пробирку добавляют 20 мкл сорбента (непосредственно перед добавлением тщательно перемешать на вортексе содержимое флакона с сорбентом до гомогенного состояния). Пробирки помещают на ротатор и инкубируют при 10-20 об/мин при комнатной температуре в течение 10 мин. После этого пробирки центрифугируют в течение 20 сек при 10 тыс.об/мин. Аккуратно, не задевая осадок, максимально полно удаляют надосадочную жидкость с помощью водоструйного насоса или автоматической пипетки с одноразовыми наконечниками.

В каждую пробирку к осадку автоматической пипеткой с одноразовыми наконечниками добавляют по 750 мкл первого промывочного буфера, ресуспендируют осадок перемешиванием на вортексе в течение 30 сек. Затем центрифугируют в течение 20 сек при 10 тыс.об/мин. Не задевая осадок, удаляют надосадочную жидкость с помощью водоструйного насоса или автоматической пипетки с одноразовыми наконечниками.

В каждую пробирку к осадку автоматической пипеткой с одноразовыми наконечниками добавляют по 750 мкл второй промывочный буфер, ресуспендируют осадок перемешиванием на вортексе в течение 30 сек. Затем центрифугируют в течение 20 сек при 10 тыс.об/мин. Не задевая осадок, удаляют надосадочную жидкость с помощью водоструйного насоса или автоматической пипетки с одноразовыми наконечниками. Повторяют данную операцию дважды.

Подсушивают осадки в термостате при 55°C в течение 5 минут. К осадкам автоматической пипеткой добавляют по 50-100 мкл буфера для элюции, перемешивают на вортексе и инкубируют при 55°C в течение 10 минут. Для более эффективной элюции ДНК встряхивают пробирку каждые 2 минуты. Пробирки центрифугируют в течение 2 мин при 10 тыс.об/мин. Аккуратно, не задевая осадок, переносят надосадочные жидкости в чистые промаркированные микропробирки. Хранят выделенные ДНК при температуре минус 20°C в течение года. Допустимо хранение при комнатной температуре (от 18 до 25°C) не более 24 ч, при температуре от 4 до 8°C - не более 7 дней. Полученную ДНК используют для проведения этапа ПЦР.

Пример 2. Мультипраймерная полимеразная цепная реакция.

Для каждого исследуемого образца проводят две независимых ПЦР-реакции. Первую с первым набором олигонуклеотидных праймеров, вторую со вторым набором олигонуклеотидных праймеров. Для этого приготовляют две ПЦР-смеси. Примеры приготовления первой и второй ПЦР-смесей для одной или десяти реакций приведены в таблице 2 и 3.

Таблица 2
Состав первой ПЦР-смеси
«ПЦР-смесь 1»
Наименование компонентов смеси объем на 1 реакцию объем на 10 реакций
Буфер 11 мкл ПО мкл
Первый набор олигонуклеотидных праймеров 5 мкл 50 мкл
Taq ДНК-полимераза 1 мкл 10 мкл
Урацил гликозилаза 1 мкл 10 мкл
Таблица 3
Состав второй ПЦР-смеси
«ПЦР-смесь 2»
Наименование компонентов смеси объем на 1 реакцию объем на 10 реакций
Буфер 11 мкл 110 мкл
Второй набор олигонуклеотидных
праймеров
5 мкл 50 мкл
Taq ДНК-полимераза 1 мкл 10 мкл
Урацил гликозилаза 1 мкл 10 мкл

Перед началом этапа ПЦР маркируют микропробирки по номерам образцов и номерам «ПЦР-смесей», микропробирки для положительных и отрицательных контролей ПЦР. Вносят в микропробирки по 2 капли масла для ПЦР (~20-25 мкл), а затем по 15 мкл соответствующей «ПЦР-смеси».

Дополнительно в пробирки, маркированные знаком «+1» и «+2», вносят по 4 мкл положительного контрольного образца. Положительный контрольный образец - смесь рекомбинантных плазмид, полученных на основе pUC18 и содержащих последовательность маркерных генов, входящих в группу Sus scrofa domesticus, Bos taurus taurus, Gallus gallus, Ovis aries, Meleagris gallopavo Jidus musculus domesticus, Rattus rattus, Canis lupus familiaris, Homo sapiens, Felis catus в концентрации 5 пг/мкл (или 1,5×106) молекул ДНК в 1 мкл. В пробирки для исследуемых проб вносят пипеткой отдельными наконечниками по 4 мкл ДНК исследуемого образца. В пробирки, маркированные знаком «-1» и «-2», вносят по 4 мкл отрицательного контрольного образца (добавляется последним). Отрицательный элемент контроля ПЦР выполнен на основе рекомбинантной плазмиды, выполненной на основе pUC18 и содержащей искусственную последовательность. Далее центрифугируют микропробирки 10 сек при 10 тыс.об/мин. для осаждения капель жидкости, при этом ПЦР-масло должно полностью покрыть ПЦР-смесь.

Подготовленные для проведения реакции пробирки переносят в ДНК-амплификатор, и запускают программу амплификации в соответствии с режимами, приведенными в таблице 3-1.

Таблица 3-1
Параметры шагов амплификации
Шаг программы Температура, °С Время инкубации Количество циклов
1 37 20 мин 1
2 94 10 мин 1
3 94 20 сек
4 61 20 сек 30
5 72 20 сек
6 72 5 мин 1

При необходимости после этой стадии пробу можно хранить при минус 20°C в течение 3-х месяцев.

Пример 3. Электрофорез продуктов ПЦР в ПААГ.

После окончания программы амплификации добавляют к каждой пробе 5 мкл 5х буфера для нанесения на гель, перемешивают на вортексе в течение 15 сек и осаждают капли со стенок пробирки центрифугированием при 10 тыс.об/мин. в течение 10 сек. Наносят 3 мкл каждой пробы в отдельную лунку ПААГ, подготовленного, как описано выше. На каждый гель должно быть нанесено 3 мкл пробы положительного контроля ПЦР, а также 3 мкл маркеров длин фрагментов ДНК.

Проводят электрофорез ДНК образцов в 0,5×ТБЭ-буфере при напряжении электрического поля 100 В. При достижении лидирующего красителя (бромфеноловый синий) нижней границы геля остановливают электрофорез. Проводят фотодокументирование результатов электрофореза и последующее сканирование и запись данных на электронный носитель.

Пример 4. Учет результатов.

Интерпретацию результатов проводят на основании сопоставления подвижности в геле ПЦР-фрагментов проб и положительного контроля ПЦР (размеры ПЦР-фрагментов приведены в таблицах 4 и 5).

Таблица 4
Перечень праймеров для проведения ПЦР-1:
Организм Праймеры Длина ПЦР-фрагмента, п.н.
Bos taurus taurus (домашний бык) SEQ ID NO: 1-up, SEQ ID NO: 2-lo 233
Sus scrofa domesticus (свинья домашняя) SEQ ID NO: 3-up, SEQ ID NO: 4-lo, 300
Ovis aries (домашняя овца) SEQ ID NO: 5-up, SEQ ID NO: 6-lo,, 150
Gallus gallus (домашняя курица) SEQ ID NO: 7-up, SEQ ID NO: 8-lo, 200
Meleagris gallopavo (обыкновенная индейка) SEQ ID NO: 9-up, SEQ ID NO: 10-lo, 133
Внутренний контроль SEQ ID NO: 20-up, SEQ ID NO: 21-lo, 80
Таблица 5
Перечень праймеров для проведения ПЦР-2:
Организм Праймеры Длина ПЦР-фрагмента, п.н.
Canis lupus familiaris (собака домашняя) SEQ ID NO: 11-up, SEQ ID NO: 12-lo, 185
Felis catus (домашняя кошка) SEQ ID NO: 13-up, SEQ ID NO: 14-lo, 133
Rattus rattus (norvegicus) (крыса черная (серая)) SEQ ID NO: 15-up, SEQ ID NO: 16-lo, 260
Homo sapiens (человек разумный) SEQ ID NO: 17-up, SEQ ID NO: 18-lo, 150
Mus musculus domesticus (мышь домовая) SEQ ID NO: 19-up, SEQ ID NO: 16-l0, 295
Внутренний контроль SEQ ID NO: 20-up, SEQ ID NO:21-lo, 80

Учет результатов анализа следует начинать с результатов амплификации положительных и отрицательных контролей (см. таблицу 6). Положительные контроли ПЦР содержат ПЦР-фрагменты всех анализируемых последовательностей и внутреннего контроля, отрицательные контроли выделения ДНК и ПЦР должны содержать фрагмент внутреннего контроля. При отсутствии внутреннего контроля анализ считается недействительным. Если в пробах отрицательных контролей кроме внутреннего контроля содержатся ПЦР-фрагменты, соответствующие каким-либо анализируемым последовательностям, это свидетельствует о контаминации растворов для пробоподготовки и/или ПЦР. В этом случае анализ считается недействительным. Третий комплект дополнительно содержит графический планшет со схемой электофоретического разделения продуктов ПЦР в 6% ПААГ.

Таблица 6
Результаты постановки контролей
Контроль Контролируемый этап анализа Специфическая полоса на электрофореграмме, соответствующая внутреннему контролю, 80 п.н. Специфические полосы на электрофореграме, соответствующие длинам фрагментов, анализируемых в ПЦР-1 (5 полос) Специфические полосы на электрофореграмме, соответствующие длинам фрагментов, анализируемых в ПЦР-2 (5 полос)
Отрицательный контроль выделения Выделение ДНК Есть Нет Нет
Положительный контроль ПЦР-1 Есть Есть Нет
Отрицательный контроль ПЦР-1 Есть Нет Нет
Положительный контроль ПЦР-2 Есть Нет Есть
Отрицательный контроль ПЦР-2 Есть Нет Нет

Далее учитывают результаты амплификации ДНК исследуемых образцов с ПЦР смесью-1 и ПЦР-смесью-2 (см. таблицу 7).

Таблица 7
Интерпретация результатов анализа
Результат анализа Специфическая полоса на электрофореграмме, соответствующая внутреннему контролю, п.н. Специфическая полоса на электрофореграмме, соответствующая длине анализируемого фрагмента, п.н.
ПЦР-1 ПЦР-2
Обнаружена ДНК Sus 80 300
Обнаружена ДНК Bos 80 233
Обнаружена ДНК Gallus 80 200
Обнаружена ДНК Ovis 80 150
Обнаружена ДНК Meleagris 80 133
Обнаружена ДНК Mus 80 295
Обнаружена ДНК Rattus 80 260
Обнаружена ДНК Canis 80 185
Обнаружена ДНК Homo 80 150
Обнаружена ДНК Felis 80 133
Недействительный нет Есть/нет Есть/нет

Каждая проба должна содержать фрагмент внутреннего контроля. При отсутствии внутреннего контроля в пробе анализ считается недействительным.

Предлагаемое изобретение, включающее новый набор из 11 пар праймеров, позволяет расширить типы исследуемых ДНК и проводить одновременную диагностику 10 различных типов митохондриальных ДНК, что позволяет повысить надежность и эффективность проверки кормов на наличие белковых добавок.

Высокие чувствительность и специфичность диагностического теста обусловлены тем, что для идентификации митохондриальных ДНК объединены преимущества двух наиболее чувствительных и специфичных способов анализа генома: полимеразной цепной реакции (ПЦР), которая увеличивает концентрацию искомых последовательностей ДНК в миллион и более раз, и гель-электрофореза, который дает результаты, достаточные для достоверной и количественной детекции.

Диагностический тест упакован в контейнере, в котором, кроме первого, второго и третьего комплекта дополнительно введены наклейки с названием торговой марки и штрихкодом, в котором указан номер серии и дата выпуска диагностического теста.

Промышленная применимость

Диагностический тест обеспечивает выявление 102-103 копий митохондриальной ДНК каждого животного, а именно Bos taurus taurus, Sus scrofa domesticus, Ovis aries, Gallus gallus, Meleagris gallopavo, Canis lupus familiaris, Felis catus, Mus musculus domesticus, Rattus rattus и Homo sapiens в 1 мл пробы.

Литература

1. Reaney Scott et al. DETECTION ASSAY FOR MEAT AND BONE MEAL IN FEED. US Patent Application №20090170107 (July 2, 2009).

2. Sinha Sudhir K. et al. Assay for species sources. US Patent №7,582,452 (September 1, 2009).

3. Rothschild Max F. et al Genetic markers for improved meat characteristics in animals. US Patent Application №20040261138 (December 23, 2004).

4. Kusama Toyoko et al. Oligonucleotide sequences that identify species of animal. US Patent Application №20050233334 (October 20, 2005).

5. Cullor James et al. Detection of ruminant DNA via PCR. US Patent Application №20050260618 (November 24, 2005).

6. PAVEL KRCMAR AND EVA RENCOVA Identification of Species-Specific DNA in Feedstuffs J. Agric. FoodChem. 51, 7655-7658 (2003).

7. Bellagamba F. et al. Application of Quantitative Real-Time PCR in the Detection of Prion-Protein Gene Species-Specific DNA Sequences in Animal Meals and Feedstuffs Journal of Food Protection. Volume 69, Number 4, pp.891-896 (6) (April 2006).

8. Комарова И.Н. Количественная оценка содержания компонентов животного происхождения в составе мясного сырья и готовой продукции с использованием метода конкурентной ПЦР. Материалы Третьего Московского международного конгресса "Биотехнология: состояние и перспективы развития", г. Москва (14-18 марта 2005).

9. Наборы реагентов для выявления и идентификации тканей животного происхождения. Техническое описание фирмы ООО "Компания Биоком" (2009) .

10. ГОСТ Р 52723-2007 Продукты пищевые и корма. Экспресс-метод определения сырьевого состава (молекулярный) (28.05.2007).

Набор олигонуклеотидных праймеров для идентификации ДНК животных, входящих в группу: свинья, бык, курица, овца, индейка, мышь, крыса, собака, кошка, и ДНК человека в сухих или консервированных кормах для животных и в сырых или подвергшихся кулинарной обработке мясных продуктах, где набор содержит первую и вторую композиции праймеров для идентификации митохондриальной ДНК, которые обеспечивают возможность одновременного проведения в одинаковых температурных режимах двух мультипраймерных реакций амплификации методом ПЦР с повышенной специфичностью к выявляемым митохондриальным ДНК, при этом для проведения мультипраймерных реакций ПЦР используют соответственно первую и вторую композиции праймеров, где в первую композицию входят праймеры, входящие в группу SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, а во вторую композицию входят праймеры, входящие в группу SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21.



 

Похожие патенты:

Предлагаемая группа изобретений относится к области биотехнологии, а именно к способу диагностики йерсиниоза лососевых рыб и набору для его осуществления. Данная группа изобретений может быть использована для выявления возбудителя йерсиниоза лососевых - Yersinia ruckeri - в пробах для диагностики болезней рыб в ветеринарии.

Изобретение относится к области биохимии, в частности к одновременной идентификации токсигенных штаммов геновариантов Vibrio cholerae О1 серогруппы биовара Эль Тор и их дифференциации по эпидемическому потенциалу.

Изобретение относится к области биотехнологии. Система состоит из следующих элементов: а) модуля подготовки образца, выполненного с возможностью захвата аналита из биологического образца в немикрожидкостном объеме на захватывающей частице, реагирующей на магнитное поле, и направления связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, через первый микрожидкостный канал; б) реакционного модуля, включающего реакционную камеру, имеющую жидкостное сообщение с первым микрожидкостным каналом, и выполненного с возможностью иммобилизации связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, и проведения реакции амплификации множества STR-маркеров аналита.

Настоящее изобретение предоставляет способ предсказания ответа трижды негативного рака молочной железы на терапию противоопухолевым средством. Способ включает: (a) лизирование опухолевых клеток, взятых от трижды негативной опухоли молочной железы, для получения клеточного экстракта; (b) определение уровня экспрессии VEGFR2 в клеточном экстракте; и (c) сравнение уровня экспрессии VEGFR2 в клеточном экстракте, полученном на стадии (b), с эталонным уровнем экспрессии VEGFR2.
Изобретение относится к области медицины и предназначено для детекции гриба Microsporum canis. Осуществляют выделение тотальной нативной ДНК из образца кожи и волос, проводят полимеразную цепную реакцию и амплификацию фрагмента гена 5.8S рРНК Microsporum canis с использованием специфических праймеров.

Изобретение относится к области биохимии. Предложен способ выделения коротких РНК из биологических жидкостей.

Представленное изобретение относится к области биотехнологии и касается способа обнаружения провируса лейкоза крупного рогатого скота. Охарактеризованный способ включает выявление фрагмента LTR (Long Terminal Repeat) - последовательности провируса лейкоза.

Изобретение относится к биохимии. Описан способ обнаружения присутствия или отсутствия нескольких серотипов вируса папилломы человека (ВПЧ) в биологическом образце с помощью многоканальной системы анализа, где указанная система анализа обнаруживает большее количество серотипов, чем существует каналов обнаружения.

Изобретения относятся к области ДНК-генеалогии и касаются способа определения гаплогрупп Y-хромосомы человека, тест-системы и олигонулкотидных праймеров. Охарактеризованный способ осуществляют в два этапа.

Изобретение относится к области медицины и предназначено для определения риска развития рака тела матки у женщин с гиперпластическими процессами эндометрия. Осуществляют выделение ДНК из периферической венозной крови, проводят генотипирование гена APOE, выявляют полиморфные аллели APOE*2, APOE*3, APOE*4 и при наличии генотипов, содержащих аллели APOE*2 прогнозируют высокий риск рака эндометрия.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине. Предложен олигодезоксирибонуклеотидный ингибитор ДНК-метилтрансферазы 1 человека (Dnmt1), характеризующийся тем, что он имеет самокомплементарную структуру, которая образует двуцепочечную шпильку, имеет неспаренную СА пару в сайте узнавания фермента ДНК-метилтрансферазы 1 человека и содержит в своем составе 5-метилцитозин (5mC) и тиофосфаты вместо фосфатов.

Изобретение относится к биотехнологии. Предложен способ печати биологических лигандов, представляющих собой олигосахариды, и/или полисахариды, и/или пептиды, и/или гликопептиды, и/или биотин.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.
Изобретение относится к области биохимии и молекулярной биологии, а именно к способу очистки синтетических олигодезоксирибонуклеотидов. Основной задачей настоящего изобретения является разработка эффективного способа очистки олигодезоксирибонуклеотидов с высоким выходом и высокой степенью очистки от производных кремниевой кислоты, пригодного для крупномасштабного синтеза.

Изобретение относится к области биотехнологии, а именно к реагенту для предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР), способу предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР-амплификация) и наборам, которые включают данный реагент.

Изобретение относится к области биотехнологии, а именно к способу и набору для определения наличия или отсутствия мутации в гене PIK3CA. .

Изобретение относится к области биохимии и молекулярной биологии и может быть использовано для детекции нуклеиновых кислот, диагностики и/или лечения заболеваний.

Изобретение относится к области биотехнологии, в частности к полипептиду и его гомодимеру, которые обладают агонистической активностью в отношении рецептора гормона роста, молекуле нуклеиновой кислоты, их кодирующей, вектору, который включает данную нуклеиновую кислоту, клетке для экспрессии данного полипептида, фармацевтической композиции и способу с применением вышеуказанных полипептидов для лечения дефицита гормона роста.

Изобретение относится к области биотехнологии, а именно к способу оценки эффективности терапии рака мочевого пузыря человека методом ПЦР в режиме реального времени и набору для его осуществления.

Изобретение относится к области биотехнологии, конкретно к получению белковых каркасов, связывающихся с IgG, и может быть использовано в диагностике или лечении. Получают белковый каркас на основе консенсусной последовательности десятого повтора фибронектина типа III (FN3) человека, содержащий последовательность аминокислот SEQ ID NO: 16. На основе полученного белкового каркаса создают библиотеку белковых каркасов путем внесения разнообразия в копии указанного полипептида посредством мутирования по меньшей мере одной петлевой области остатков 22-28 и 75-81 SEQ ID NO: 16. Изобретение позволяет получить белковый каркас с высокой термостабильностью и сниженным риском аутоиммунного ответа при введении в организм. 2 н.п. ф-лы, 8 ил., 3 табл., 3 пр.

Изобретение относится к области биотехнологии и представляет собой набор олигонуклеотидных праймеров для идентификации ДНК животных, входящих в группу: свинья, бык, курица, овца, индейка, мышь, крыса, собака, кошка, и ДНК человека в сухих или консервированных кормах для животных и в сырых или подвергшихся кулинарной обработке мясных продуктах. Набор содержит первую и вторую композиции праймеров для идентификации митохондриальной ДНК, которые обеспечивают возможность одновременного проведения в одинаковых температурных режимах двух мультипраймерных реакций амплификации методом ПЦР с повышенной специфичностью к выявляемым митохондриальным ДНК. Для проведения мультипраймерных реакций ПЦР используют соответственно первую и вторую композиции праймеров, где в первую композицию входят праймеры, входящие в группу SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, а во вторую композицию входят праймеры, входящие в группу SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21. 4 ил., 8 табл., 4 пр.

Наверх