Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia sibirica subsp. sibirica bj-90



Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia sibirica subsp. sibirica bj-90
Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia sibirica subsp. sibirica bj-90
Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia sibirica subsp. sibirica bj-90

 


Владельцы патента RU 2560581:

Федеральное бюджетное учреждение науки "Омский научно-исследовательский институт природно-очаговых инфекций" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia sibirca subsp. sibirica. Описано применение штамма R. sibirica subsp. sibirica "Приморье-32/84" генотипа BJ-90, депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под номером 160, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia sibirica subsp. sibirica BJ-90. Штамм изолирован на территории РФ из имаго иксодовых клещей D. silvarum, собранных в Приморском крае в 1984 году. Штамм патогенен для морских свинкок, успешно культивируется на клеточной культуре Vero E6. Охарактеризованное решение может быть использовано для идентификации риккетсий группы клещевой пятнистой лихорадки на основании генотипических и фенотипических признаков и получения диагностических препаратов. 3 пр.

 

Изобретение относится к области биотехнологии и представляет собой оригинальный штамм риккетсий группы клещевой пятнистой лихорадки «Приморье-32/84». Штамм «Приморье-32/84» является представителем генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica, впервые изолированным на территории РФ. На основании изучения фенотипических и генотипических признаков штамм отнесен к порядку Rickettsiales семейству Rickettsiaceae роду Rickettsia виду Rickettsia sibirica subsp. sibirica генотипу BJ-90.

R.sibirica включает два подвида: R.sibirica subsp. sibirica, возбудитель сибирского клещевого тифа (СКТ) и R.sibirica subsp.mongolotimonae, - этиологический агент «ассоциированного с лимфангитом риккетсиоза» ("lymphangitis-associated rickettsiosis" или LAR). Первый из этих подвидов был впервые изолирован в России, а позднее обнаружен в северном Китае (Yu X., Y. Jin, M. Fan, G. Xu, Q. Liu, and D. Raoult. 1993. Genotypic and antigenic identification of two new strains of spotted fever group rickettsiae isolated from China. J. Clin. Microbiol. 31: 83-88). R. sibirica subsp. mongolotimonae была впервые изолирована во Внутренней Монголии, а затем выявлена в южной Европе и Африке (Fournier Р.Е., F.Gouriet, P. Brouqui, F. Lucht and D. Raoult. 2005. Lymphangitis-associated rickettsiosis, a new rickettsiosis caused by Rickettsia sibirica mongolotimonae: seven new cases and review of the literature. Clin. Infect. Dis. 40: 1435-1444, 12). В 1991 году был впервые описан риккетсиальный штамм с неизвестной патогенностью - Rickettsia sp. strain BJ-90, изолированный из клещей Dermacentor sinicus, собранных в окрестностях Beijing, Китай в 1990 году (Yu X.J., Fan M.Y., Bi D.Z. 1991. Isolation and primary identification of spotted fever group rickettsiae BJ-90 strain. Chin. J. Microbiol. Immunol. 1:31). Филогенетически Rickettsia sp. strain BJ-90 близка к Rickettsia sibirica subsp.sibirica и R.sibirica subsp. mongolotimonae, образуя с ними единый кластер, однако более тесно связана с Rickettsia sibirica subsp.sibirica и признана генетическим вариантом этого вида риккетсий (Zhang J.Z., Fan M.Y., Yu X.J., Raoult D. Phylogenetic analysis of the Chinese Rickettia isolate BJ-90. Emerg. Infect. Dis. 2000, 6: 432-433). В Китае штаммы генотипа BJ-90 были выделены только из одного вида клещей - D.sinicus и в одной местности на протяжении нескольких лет (Zhang J.Z., Jin J.L., Fu Х.Р., Raoult D. and Fournier, P.E. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. 2006. J. Clin. Microbiol. 40: 2465-2467).

Заболеваемость риккетсиозом, вызываемым генотипом BJ-90 вида Rickettsia sibirica subsp. sibirica, в настоящее время в России не регистрируется, поскольку диагностические препараты для верификации данного риккетсиоза в РФ не выпускаются. Диагноз риккетсиоза, ассоцированного с генотипом BJ-90 вида Rickettsia sibirica subsp. sibirica, может быть поставлен только при лабораторном обследовании с использованием тест-систем на основе производственных штаммов генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica.

Штаммы Rickettsia генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica, имеющиеся в коллекции Омского НИИ природно-очаговых инфекций - это первые штаммы данного генотипа риккетсий, выделенные из клещей Dermacentor silvarum за пределами Китая. Штамм генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84" выделен из имаго иксодовых клещей D.silvarum, собранных в Дальнереченском районе Приморского края в 1984 году, т.е. на 6 лет раньше изоляции первых китайских штаммов этой риккетсии.

Штамм «Приморье-32/84» культивируется в культуре клеток Vero, куриных эмбрионах, морских свинках.

По результатам изучения и сравнения нуклеотидных последовательностей фрагментов генов gltA и ompA имеет 100% гомологии с типовым штамом генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica.

Штамм генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84" хранится во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под инвентарным номером 160 от 4 марта 2013 г. Задача изобретения - оригинальный штамм генотипа BJ-90 вида Rickettsia sibirica subsp.sibirica "Приморье-32/84", который может быть использован для разработки и изготовления диагностических препаратов (наборов реагентов).

Технический результат - использование штамма генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84", в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого генотипом BJ-90 вида Rickettsia sibirica subsp. sibirica. Заявляемый штамм обладает способностью активно размножаться в различных биологических системах (морские свинки, развивающиеся куриные эмбрионы, культура клеток Vero) и накапливать производственную биомассу в процессе культивирования, что позволяет использовать его для серийного (коммерческого) выпуска диагностических препаратов (наборов реагентов). Использование штамма генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84", в качестве продуцента диагностических препаратов позволяет оптимизировать лабораторную диагностику риккетсиозов и мониторинг сочетанных природных очагов риккетсиозов группы клещевой пятнистой лихорадки (КПЛ) в России.

Выделенный штамм генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84" характеризуется следующими признаками:

Морфологические признаки. Типичны для риккетсий, но чаще других встречаются палочковидные формы (тип b по классификации П.Ф. Здродовского). Грамотрицательны.

Кулътуральные свойства. Успешно пассируется в культуре клеток Vero-Е6, с максимальным накоплением риккетсий до 25-30 и более экземпляров в поле зрения. При культивировании на 5-6 дневных куриных эмбрионах, начиная со второго пассажа дает накопление 50 и более риккетсий в поле зрения.

Пассажная характеристика. Штамм выделен в 1984 г. в биопробе на морских свинках-самцах и после восьми пассажей на морских свинках переведен на куриные эмбрионы. Культура штамма генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84" лиофильно высушена на 5-м пассаже на куриных эмбрионах.

Антигенные свойства. Антигенные детерминанты генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica выявляются методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы КПЛ.

Иммуногенные свойства. В реакции связывания комплемента (РСК) с антигеном R.sibirica и сыворотками морских свинок, зараженных штаммом генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica "Приморье-32/84, отмечается сероконверсия в титрах 1:40-1:80. При исследовании методом ИФА сывороток крови лихорадящих больных, имевших в анамнезе присасывание клещей, с антигеном генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica, приготовленным из штамма "Приморье-32/84", антитела класса IgM к данному виду риккетсий выявлены в 16,0±3,2%, антитела класса IgG - в 9,9±2,6%. Отмечается отсутствие перекрестных реакций при исследовании сывороток крови больных клещевым риккетсиозом на наличие антител классов IgM и IgG в ИФА с антигенами R.sibirica subsp. sibirica и R.sibirica subsp. sibirica генотипа BJ-90, что позволяет оценивать данный штамм как кандидат для разработки диагностических препаратов.

Вирулентные свойства. При внутрибрюшинном заражении морских свинок штамм вызывает 2-3 дневную лихорадочную реакцию с выраженным периорхитом. При вскрытии у животных наблюдается характерная для клещевого риккетсиоза патологоанатомическая картина.

Генотипические характеристики. Определена нуклеотидная последовательность гена цитрат синтазы (gltA) длиной 1234 пар оснований штамма "Приморье-32/84", которая имела 100% гомологии с последовательностью гена цитрат синтазы типового штамма R.sibirica subsp. sibirica генотип BJ-90, депонированной в GenBank под номером AF178035:

Последовательность нуклеотидов гена белка наружной мембраны риккетсий (OmpA) длиной 590 пар оснований имеет 100% гомологии с депонентом GenBank под номером AF179365 Rickettsia sibirica subsp. sibirica генотип BJ-90. OmpA (ompA) gene:

На основании морфологических, антигенных и генетических признаков изолированный штамм относят к роду Rickettsia виду Rickettsia sibirica subsp. sibirica генотипу BJ-90.

Изобретение иллюстрируется следующими примерами.

Пример 1. Идентификация на основании генотипических признаков. Экстракция ДНК.

Экстракцию риккетсиальной ДНК из пробы культур клеток осуществляют, применяя QIAamp Tissue Kit (QIAGEN, Hilden, Germany) и протеиназу К в концентрации 2,0 мг/мл (Boehringer Mannheim, Mannheim, Germany) в соответствии с протоколом QIAamp Tissue Kit. Полимеразная цепная реакция (ПЦР) и секвенс-реакция.

Полимеразную цепную реакцию (ПЦР) и секвенс-реакцию выполняют, применяя праймеры, специфичные для Rickettsiae, используют две пары праймеров, амплифицирующие gltA ген, кодирующий цитрат синтетазу: CS1d (5-ATGACTAATGGCAATAATAA-3) и CS535r (5-GAATATTTATAAGACAT-TGC-3), CS409d (5-CCTATGGCTATTATGCTTGC-3) и RP1258n (5-ATTGCAAAAAGTACAGTGAACA-3), а также праймеры 190.70 (ATG GCGAATATTTCTCCAAAA), 190.180 (GCAGCGATAATGCTGAGTA) и 190.701 (GTTCCGTTAATGGCAGCATCT), амплифицирующие ompA ген, кодирующий белок наружной мембраны (Roux V. et al., 1997; Fournier P-E. et al., 1998).

ПЦР выполняют в термоциклере Peltier модель PTC-200 (Mj Research, Inc, Watertown, MA). Реакционная смесь для каждой пробы содержит 10 pmol каждого праймера, 0,5 единиц полимеразы (Elongase, GibcoBRL), 20 mM каждого дезоксинуклеозидтрифосфата, 1,8 mM MgCl2 и 7,5 мкл ДНК от каждой пробы, финальный объем составляет 25 мкл. Амплификацию выполняют по следующей программе: 3 мин инициальной денатурации при 94°С, в последующих 44 циклах 30 с денатурации при 94°С, 30 с отжиг праймеров при температуре 55°С, 90 с элонгации при 68°С и 7 мин финальная элонгация при температуре 68°С. Каждая постановка ПЦР включает отрицательный контроль (дистиллированная вода) и положительный контроль (ДНК R.montanensis).

Пурификацию ПЦР-продукта проводят, применяя QIAquick PCR Purification Kit (Germany) в соответствии с протоколом.

Секвенс-реакцию с ПЦР-продуктами выполняют, применяя d-Rhodamine Terminator Cycle Sequencing Ready Reaction kit (Applied Biosistems, Warrington, UK). Секвенирование выполняют на ABI 3100 PRISM (Applied Biosystems) в автоматическом секвенаторе. Анализ полученных нуклеотидных последовательностей для сравнения степени гомологии с последовательностями Банка данных GenBank проводят с помощью программы BLAST в режиме прямого доступа.

Пример 2. Идентификация на основании фенотипических (культуральных и антигенных) свойств. Культивирование риккетсий.

Культивирование риккетсий проводят на культуре клеток Vero Е6. Культуру выращивают по стандартной методике Соловьева, Бектемирова 1972 г., в качестве ростовой среды используют Игла MEM с двойным набором аминокислот с добавлением 5% эмбриональной сыворотки. Оптимальная посевная доза 100-150 тыс. клеток на 1 мл. На следующие сутки после образования монослоя клеточную культуру используют для заражения.

Заражение культур клеток.

Клеточную культуру в матрасе заражают 50% суспензией, полученной из высушенной культуры штамма, в дозе 1 мл на матрац. Во все матрацы с зараженными клетками добавляют среду поддержки (Игла MEM с добавлением 1% эмбриональной сыворотки) в объеме 9 мл на матрац (Raoult D., 2000). Матрацы с зараженными клетками культивируют в термостате при температуре 37°С в течение 10-14 суток. Максимальное накопление наблюдается со второго 2 пассажа и составляет 25-30 и более экземпляров в каждом поле зрения, с преимущественной локализацией микроорганизма в цитоплазме клеток. Инфицированность и стерильность культуры клеток определяют в мазках, окрашивая их по Романовскому-Гимза.

Полученные образцы исследуют методом флюоресцирующих антител по стандартной методике, используют иммуноглобулины диагностические для выявления риккетсий группы КПЛ, люминесцирующие сухие (ФГУП «НПО «Микроген» г. Пермь). Изучение морфологических и тинкториальных свойств проводят по методу Здродовского и Голиневич (1972), для подтверждения принадлежности к риккетсиям используют ПЦР с родоспецифическими праймерами.

Пример 3. Приготовление цельнорастворимых антигенов

Для приготовления антигена зараженные культуры клеток подвергают центрифугированию при 6000 оборотах в минуту в течение 20 минут, далее удаляют супернатант, а из полученной взвеси делают мазки, которые окрашивают по Романовскому-Гимза.

После микроскопического контроля во взвесь зараженных клеток добавляют физиологический раствор и 0,5% фенол. После встряхивания в шейкере пробирки с зараженной клеточной взвесью помещают в рефрижератор на 3-4 дня для осаждения посторонних белковых примесей.

После этого клеточную взвесь подвергают многократной эфирной обработке по Craigie (1945 г.). При первой эфирной обработке к материалу добавляют 1,5-2 объема наркозного эфира и после встряхивания оставляют при комнатной температуре до следующего дня в темном месте. Затем водную фазу отделяют и второй раз обрабатывают эфиром (равный объем эфира в отношении водной фазы), встряхивают и оставляют на 2 часа, затем водную фазу вновь отделяют и в третий раз обрабатывают эфиром (1/2 объема эфира по отношению к объему водной фазы) таким же образом.

После третьей обработки при образовании среднего тканевого слоя делают повторную эфирную обработку. После окончания эфирной обработки производят отгонку эфира под небольшим вакуумом. Пробирки с антигеном оставляют в течение суток в холодильнике для испарения эфира. Полученные серии антигенов испытывают в реакции связывания комплемента РСК на антикомплементарность, специфичность, чувствительность и устанавливают титр. Также антигены стандартизуют по уровню аминного азота методом формольного титрования (%) и белка с помощью биуретовой реакции (%). После испытания антигены разливают в ампулы по 1,0 мл и лиофильно высушивают. Высушенный антиген хранят при температуре - 20°C.

Приготовление корпускулярного антигена.

После завершения культивирования культуру зараженных клеток замораживают при - 20°С, а потом оттаивают для разрушения клеток и максимального выхода из них риккетсий. Материал центрифугируют 10 минут при 3000 оборотах в минуту. Супернатант используют для нанесения корпускулярного антигена на стекла и проведения реакции непрямой иммунофлюоресценции для исследования сывороток больных клещевыми инфекциями.

Таким образом, штамм имеет 100% гомологии с типовым штаммом генотипа BJ-90 вида Rickettsia sibirica subsp. sibirica по результатам сравнения нуклеотидных последовательностей гена gltA и гена ompA, активно размножается в культуре клеток Vero и в развивающихся куриных эмбрионах, что позволяет в процессе культивирования накапливать производственную биомассу. С учетом этого, он может быть использован в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого генотипом BJ-90 вида Rickettsia sibirica subsp. sibirica.

Применение штамма Rickettsia sibirica subsp. sibirica "Приморье-32/84" генотипа BJ-90, депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под номером 160, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia sibirica subsp. sibirica BJ-90.



 

Похожие патенты:

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia slovaca. Представлено применение штамма Rickettsia slovaca "Карпунино-19/69", депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им.

Представленное изобретение относится к области биотехнологии и касается способа обнаружения провируса лейкоза крупного рогатого скота. Охарактеризованный способ включает выявление фрагмента LTR (Long Terminal Repeat) - последовательности провируса лейкоза.

Группа изобретений относится к области лизиса клеток. Предложен способ избирательного лизиса животных клеток, а также прибор для обнаружения микроорганизмов.

Изобретения относятся к области медицинской микробиологии и касаются способа дифференциации токсигенных генетически измененных штаммов V.cholerae биовара Эль Тор и тест-системы.

Изобретение относится к медицинской микробиологии. Может быть использовано для культивирования и идентификации урогенитальных микоплазм, в частности Mycoplasma hominis.
Группа изобретений относится к биотехнологии. Варианты питательной среды для селективного накопления энтеробактерий содержат панкреатический гидролизат рыбной муки, либо пептон мясной, либо панкреатический гидролизат рыбной муки и пептон мясной (в соотношении 1:1), желчь очищенную модифицированную (ЖОМ), натрий хлористый, глюкозу, калий фосфорнокислый однозамещенный и бриллиантовый зеленый в заданном соотношении.
Изобретение касается набора олигонуклеотидных праймеров и зондов для идентификации и субтипирования ДНК бактерии Pasteurella multocida серотипов А, B, D, E, F методом ПЦР в режиме реального времени.

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами.
Изобретение относится к пищевой микробиологии, в частности к получению питательной среды для определения в кондитерских изделиях, микроорганизмов, вырабатывающих липазы.

Изобретение относится к электрохимическим методам анализа, а именно к иммуноанализу, в частности к определению содержания патогенных микроорганизмов в различных объектах и средах.

Группа изобретений относится к композиции, включающей штаммы Lactobacillus plantarum, и применению штаммов и композиции. Композиция со снижающей холестерин активностью эффективное количество по меньшей мере, одного из штаммов, выбранных из группы штамм Lactobacillus plantarum CECT 7527, штамм Lactobacillus plantarum CECT 7528 и штамм Lactobacillus plantarum CECT 7529.

Изобретение относится к области биотехнологии. Предложено применение соли угольной кислоты в качестве стабилизатора цвета в бактериальной композиции, содержащей бактериальные клетки, относящиеся к роду Bifidobacterium, и аскорбат.

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia slovaca. Представлено применение штамма Rickettsia slovaca "Карпунино-19/69", депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им.

Изобретение относится к области микробиологии. Штамм бактерий Kocuria sp., обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Kocuria sp.

Изобретение относится к области микробиологии. Штамм бактерий Serratia plymuthica ELA-9, обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Serratia plymuthica VKM B-2819D и может быть использован для очистки почв и водоемов, загрязненных нефтью и нефтепродуктами, в широком диапазоне температур от +4 до +30°C.
Изобретение относится к области биотехнологии. Предложен способ получения ксантана.
Изобретение относится к биотехнологии и может быть использовано при производстве препаратов для борьбы с колорадским жуком. Штамм Bacillus thuringiensis 16T100/18 (ВИЗР) обладает высокой инсектицидной активностью в отношении личинок и имаго колорадского жука.

Изобретение относится к области микробиологии. Штамм бактерий Rhodococcus sp.
Изобретение относится к биотехнологии. Штамм споровых бактерий Bacillus megaterium 501 GR, обладающий ростостимулирующим эффектом, депонирован в ГНУ ВНИИСХМ Россельхозакадемии под регистрационным номером RCAM00875 и может быть использован в качестве полифункционального средства для растениеводства, улучшая фосфорное питание растений, а также способствуя биоремедиации загрязненных пестицидами почв.
Изобретение относится к биотехнологии. Описан штамм бактерий Halobacterium salinarum ВКПМ В-11850 - продуцент бактериородопсина.
Изобретение относится к микробиологии и биотехнологии. Предложен штамм бактерий Bacillus stratosphericus ВКПМ В-11677, продуцирующий этанол из лигноцеллюлозной биомассы. Штамм проявляет активный рост на лигноцеллюлозной биомассе и обладает устойчивостью к токсичным составляющим лигноцеллюлозного гидролизата. 2 пр.
Наверх