Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода



Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода
Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода
Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода
Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода
Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода
Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода

 


Владельцы патента RU 2561677:

Федеральное государственное бюджетное учреждение "Научный центр акушерства, гинекологии и перинатологии имени академика В.И. Кулакова" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки. Способ включает исследование экспрессии эзрина и процесса метилирования генов в эндометрии. При повышенной экспрессии эзрина в цитоплазме клеток от 4 до 6 баллов и снижении процесса метилирования генов под воздействием О6-метилгуанил-ДНК метилтрансферазы (MGMT) до уровня не более 2 баллов определяют возможность злокачественного течения патологического процесса и возникновения эндометриоидной аденокарциномы. Использование изобретения позволяет повысить эффективность дифференциальной диагностики и прогнозирования рака эндометрия у пациенток перименопаузального периода. 4 ил., 1 пр.

 

Список сокращений:

ПГЭ - простая гиперплазия эндометрия

КГЭ - комплексная гиперплазия эндометрия без атипии

КАГЭ - комплексная атипическая гиперплазия эндометрия с атипией

ЭИН - эндометриальная интраэпителиальная неоплазия

ЭАК - эндометриоидная аденокарцинома

MGMT- O6-метилгуанин-ДНК метилтрансфераза

Изобретение относится к медицине, а именно к гинекологии и патологической анатомии, предназначено для дифференциальной диагностики различных форм ГЭ, ЭИН и эндометриоидной адеденокарциномы у пациенток перименопаузального периода.

Изучение патогенеза различных форм гиперплазии эндометрия (ГЭ), ЭИН и ЭАК у женщин перименопаузального периода является одной из актуальных задач, что обусловлено высокой частотой рецидивирования процесса и возможностью малигнизации, которая происходит в 29% случаев [1].

По данным литературы в 40% и более случаев выявлен рак эндометрия в базальных слоях эндометрия при дооперационном диагнозе атипической гиперплазии эндометрия по результатам исследования соскобов эндометрия [2]. В настоящее время установлено, что в ходе канцерогенеза развиваются не только генетические, но и эпигенетические нарушения, важнейшими из которых является метилирование генов [3]. Метилирование ДНК - это процесс энзиматического присоединения метальной группы к основаниям в составе ДНК. Аномальное метилирование генов-супрессоров опухолевого роста зачастую обнаруживается в предраковых состояниях эндометрия [3]. Высокая частота метилирования генов-супрессоров при гиперплазии эндометрия с атипией и при раке эндометрия может служить маркером ранних стадий неопластического процесса не только в эндометрии, но и в других тканях [4, 5]. Другим приоритетным направлением диагностики и таргетной терапии гиперпластических и предраковых процессов эндометрия является эффективный мониторинг показателей межклеточных контактов. Онкомаркер эзрин - белок, принадлежащий к семейству трансмембранных гликопротеинов, ответственных за межклеточные связи между эпителиальными клетками, эпителиальными и стромальными клетками.

Эзрин относится к новым независимым прогностическим маркерам в развитии ЭАК [6].

Задача изобретения - повысить эффективность дифференциальной диагностики и прогнозирования развития рака эндометрия при различных формах ГЭ и ЭИН на основании иммуногистохимического исследования процесса метилирования и экспрессии эзрина в эндометрии.

Поставленная задача решается путем иммуногистохимического изучения процессов метилирования и экспрессии эзрина в эндометрии на разных стадиях опухолевой прогрессии, что позволит обосновать дифференцированный подход к выбору тактики лечения больных с различными формами ГЭ и ЭИН у женщин перименопаузального периода. Практически способ осуществляется следующим образом:

Морфологические исследования выполняли на операционном материале: 9 удаленных маток (экстирпация матки с придатками) и 26 соскобах эндометрия. Материал фиксировался в 10% забуференном формалине, заливался в парафин. Серийные срезы толщиной 4 мкн окрашивались гематоксилином и эозином, а также использовались для иммуногистохимических реакций.

Иммуногистохимическое исследование

Демаскировка антигенов проводилась в ретривере с цитратным буфером с ph=6,0, при температуре - 120C° в течение 20 минут. Для определения экспресии эзрина применялись кроличьи моноклональные антитела, фирмы Cell. Signaling, в разведении 1:100. Разводили раствором для разведения антител Emerald antibody diluent (фирма Cell MARQUE). Для изучения совокупного уровня метилирования использовались кроличьи моноклональные антитела к MGMT (фирма EPITOMICS) в разведении 1:100. Для определения экспрессии Ki-67 и PTEN применялись моноклональные антитела к антигену Ki-67 (Dako, в разведение 1:100) и PTEN (Dako, в разведение 1:100). Ставились положительные и отрицательные контроли. Результаты реакций оценивались полуколичественным методом с рассчетом баллов по количеству окрашенных клеток одного типа: 2 балла - до 20% положительных клеток, 4 балла - более 20% но менее 40%, 6 баллов - более и равное 40%. Экспрессия Ki-67 подсчитывалась в процентах на 3000 клеток одного типа.

Результаты исследования

Основные гистологические признаки простой ГЭ без атипии [Рис. 1, а] сводятся к увеличению числа желез и изменению их формы, незначительному увеличению соотношения стромального и железистого компонентов при отсутствии цитологической атипии и низкой экспрессии Ki67 как в паренхиме, так и в строме, а также сохраненная экспрессия PTEN. При КГЭ [Рис. 1, б] характерна более выраженная пролиферация и тесное расположение желез, имеющих сложную архитектонику с почкообразными и папиллярными разрастаниями, а также увеличение железисто-стромального соотношения и экспрессии Ki67 в паренхиме и сохраненная экспрессия PTEN. При этой форме ГЭ отмечаются эпителиальная стратификация и отсутствие клеточной атипии. КАГЭ [Рис. 1, в] характеризуется цитологической атипией, а именно отсутствием полярности, увеличением и стратификацией ядер, изменением их формы, увеличением ядерно-цитоплазматического соотношения, нерегулярными комплексами хроматина, повышенной экспрессией Ki67 и незначительным уменьшением экспрессии PTEN в отдельных эпителиальных клетках. ЭИН [Рис. 1, в, г, д] выявляется в виде очага 2-3 мм в диаметре со скученными железами, малым содержанием стромы (<50%), атипией эпителиальных клеток, относительно высоким Ki67 и потерей экспрессии PTEN [7]. ЭАК [Рис. 1, е] характеризуется выраженной атипией клеток и ядер эпителиальных элементов в пределах предшествующих структур без нарушения целостности базальной мембраны. Отличительными особенностями ЭАК служат отсутствие инвазии стромы опухолевыми клетками, сохранность предшествующих структур эндометрия и базальных желез, наличие воспалительной инфильтрации опухолево-измененного эпителиального пласта при отсутствии ее в окружающем эндометрии [7].

Иммуногистохимическое исследование О6-метилгуанин-ДНК метилтрансферазы (MGMT) (кодирует белок, отвечающий за восстановление ДНК после различных повреждений с помощью метилирования азотистых оснований)

При определении профиля процесса метилирования иммуногистохимическим методом MGMT выявлен в виде гранул коричневого цвета в ядрах и в цитоплазме эпителиальных клеток, а также в клетках стромы при КАГЭ и ЭИН [Рис. 2, Рис. 3, а]. В контрольной группе (нормальный эндометрий в фазе пролиферации) продукт реакции выявлен в отдельных эпителиальных клетках в следовых количествах, 0 баллов [Рис. 2, а]. В случаях простой ГЭ гранулы коричневого цвета выявлялись в отдельных эпителиальных клетках, отмечался низкий уровень фермента, который колебался в пределах 2-4 баллов и в среднем составил 2,67±1,56 [Рис. 2, б]. При КГЭ без атипии продукт реакции выявлялся в группах эпителиальных клеток и локализовался в ядрах и цитоплазме. Получены умеренные и высокие цифры метилирования от 2 до 6 баллов, в среднем - 3,56±1,94 [Рис. 2, в]. При КАГЭ и ЭИН продукт реакции выявлялся в ядрах и цитоплазме во всех эпителиальных и стромальных клетках [Рис. 2, г, д], получены умеренные и высокие цифры метилирования от 4 до 6 баллов, в среднем - 4,80±1,79. В клетках ЭАК продукт реакции выявлен в отдельных клетках в следовых количествах, отмечалось резко слабое метилирование или отсутствие, цифры метилирования не превышали 2 баллов и в среднем составили 1,0±1,5 [Рис. 2, е].

Следовательно, нами установлено, что метилирование генов под действием MGMT возрастает при ПГЭ и КГЭ и достигает своего апогея на стадии КАГЭ и ЭИН, снижаясь при ЭАК.

Иммуногистохимическое исследование эзрина

При иммуногистохимическом исследовании эзрин выявлялся в железистом и покровном эпителии неизмененного эндометрия в апикальной части клеток. Однако при развитии патологических процессов наблюдалось появление эзрина и в цитоплазме клеток. Соотношения апикальной и цитоплазматической локализации эзрина варьировало при разных видах патологии эндометрия [Рис. 3б, 3в]. В нормальном эндометрии эзрин выявлялся в апикальной части эпителиальных клеток эндометрия, определялась высокая экспрессия, составляя от 4 до 6 баллов, среднее значение составило 4,33±1,87 [Рис. 4, а]. В ПГЭ преобладала апикальная экспрессия эзрина от 4 до 6 баллов, среднее значение - 4,33±1,87, однако появлялись единичные клетки с продуктами реакции в цитоплазме, экспрессия эзрина колебалась от 0 до 2 баллов и в среднем составила 1,20±1,10 [Рис. 4, б]. При КГЭ без атипии преобладала цитоплазматическая экспрессия эзрина, колеблющаяся от 3 до 5 баллов, среднее значение - 3,5±1,94 [Рис. 4, в], единичные клетки с продуктами реакции сохранились апикально, экспрессия эзрина от 2 до 2 баллов, среднее значение - 1,78±1,20; В случаях КАГЭ и ЭИН преобладала высокая экспрессия эзрина цитоплазматически, от 4 до 6 баллов и среднее значение 4,33±1,8; апикально продукт реакции выявлялся в единичных клетках от 0 до 2 баллов, в среднем экспрессия эзрина составила 1,20±1,10 [Рис. 4, г, Рис. 4, д]. Эзрин в раковых клетках ЭАК экспрессировал преимущественно цитоплазматически, колебался от 5 до 6 баллов, среднее значение - 5,5±0,4 [Рис. 4, е], а в апикальной части клеток ЭАК эзрин не экспрессировал, лишь в одном очаге была обнаружена слабая экспрессия маркера, которая составила от 0 до 1, среднее значение - 0,50±1,0.

Таким образом, особенности экспрессии эзрина связаны с тем, что по мере прогрессии заболевания от ПГЭ до ЭАК происходит потеря его апикальной специфической локализации, отражающей функциональную активность и, напротив, свободное накопление эзрина наблюдается в цитоплазме клеток. Изменение локализации эзрина вероятно связано с нарушением межклеточных контактов, максимальное проявление которого происходит в ЭАК. Резюмируя полученные данные исследования, следует отметить, что по мере прогрессии ГЭ до КАГЭ и ЭИН теряются межклеточные контакты и нарастает метилирование. Максимальное значение метилирования обнаруживается до развития инвазивного рака эндометрия, что вероятно согласуется с данными о значении в канцерогенезе метилирования преимущественно генов супрессоров рака [5]. Снижение метилирования в ЭАК может отражать процессы автономного роста злокачественной опухоли. Нами было установлено, что при ПГЭ, в ЭИН и КАГЭ эзрин может локализоваться как в апикальных клетках, так и в цитоплазматических клетках. Апикальная локализация связана с участием эзрина в формировании межэпителиальных контактов [9]. Именно апикальная локализация эзрина теряется в процессе канцерогенеза. Цитоплазматическая локализация не несет функциональную нагрузку.

Напротив, она может свидетельствовать о нарушении транспорта эзрина в зону межэпителиальных контактов или за счет дефектов транспортных систем, или самого эзрина. Наши данные в целом совпадают с данными литературы [9, 10], однако ни в одной из работ не анализировались особенности локализации эзрина.

Клинический пример

1) Пациентка Н., 48 лет, обратилась в онкологический центр г. Астаны в 2012 году с жалобами на кровянистые выделения из половых путей в течение трех недель. Клинический диагноз: Дисфункциональное маточное кровотечение в перименопаузальном периоде. Гиперплазия эндометрия. Заболевания у ближайших родственников: у бабушки - сахарный диабет. Соматические заболевания: болезнь Боткина в детстве, хронический бронхит, артериальная гипертензия 1 степени, риск 1, ожирение 2 степени, диффузно-кистозная мастопатия. Гинекологические заболевания: хронический аднексит. Гинекологические операции: искусственный аборт (4 раза).

Менструации с 11 лет, установились сразу, регулярные, по 4 дня, через 28 дней, умеренные, безболезненные. Последние менструации точно не помнит, так как в течение 5 мес отмечала нарушение менструального цикла. Репродуктивная функция: общее количество беременностей - 6, из них родов - 2, аборт - 4. Половая жизнь с 19 лет. Гинекологический осмотр: наружные половые органы развиты правильно. Оволосение по женскому типу. Шейка матки цилиндрической формы, чистая. Тело матки не увеличено, плотное, подвижное, безболезненное при пальпации. Придатки матки с обеих сторон не увеличены, безболезненны при пальпации. Своды глубокие, безболезненные при пальпации. Выделения - кровянистые, умеренные.

Данные УЗИ органов малого таза (от 24.12.2012): тело матки размерами 3,8*4,0*3,8 см. Придатки матки без патологии. М-ЭХО - 13 см. 24.12.12 Операция: Раздельное диагностическое выскабливание эндоцервикса и слизистой полости матки.

Результаты патоморфологического исследования №4167/38760-38761 - атипическая железистая гиперплазия эндометрия.

Через 4 дня после выявленной атипической гиперплазии эндометрия произведено оперативное лечение в объеме: экстирпация матки с обоими придатками, дренирование брюшной полости.

Гистологическое заключение №354/2644-2665: высокодифференцированная эндометриоидная аденокарцинома, локализуется в пределах базального слоя эндометрия, не врастает в миометрий.

Иммуногистохимическое исследование экспрессии эзрина и MGMT в соскобе и в операционном материале: При определении профиля процесса метилирования методом исследования MGM выявлено, что продукт реакции определялся в отдельных клетках в следовых количествах, отмечалось резко слабое метилирование, не превышающее 2 баллов вплоть до отсутствия в отдельных комплексах атипичных клеток [см. Рис. 2, е]. Эзрин в раковых клетках ЭАК экспрессировал преимущественно цитоплазматически и составил 5 баллов [см. Рис. 4, е], а в апикальной части клеток ЭАК эзрин не экспрессировался. Следовательно, уже по значительному снижению метилирование генов под действием MGMT и цитоплазматической экспрессии эзрина при отсутствии апикальной можно было заподозрить о прогрессировании КАГ в карциному у данной пациентки.

2) Пациентка М., 51 года, обратилась в городскую больницу №1 г. Астана в 2011 году с жалобами на кровянистые выделения из половых путей в течение 15 дней. Клинический диагноз: Рецедивирующее маточное кровотечение в перименопаузальном периоде. Гиперплазия эндометрия. Заболевания у ближайших родственников: рак яичника у бабушки.

Соматические заболевания: артериальная гипертензия 2 степени, риск 1, ожирение 1 степени, остеохондроз позвоночника. Гинекологические заболевания: эрозия шейки матки (диатермокоагуляция в 1996 г), миома матки с 2005 г. Гинекологические операции: в 2010 г. - гистероскопия, раздельное диагностическое выскабливание эндоцервикса и слизистой полости матки. Результаты патоморфологического исследования: железисто-кистозная гиперплазия эндометрия. Менструации с 13 лет, установились сразу, регулярные, по 5-6 дней, через 30 дней, умеренные, безболезненные. Последние менструации - 6 мес назад. Репродуктивная функция: общее количество беременностей - 3 (родов - 3). Половая жизнь с 20 лет. Гинекологический осмотр: наружные половые органы развиты правильно. Оволосение по женскому типу. Шейка матки цилиндрической формы, чистая. Тело матки увеличено до 5 недель, плотное, подвижное, безболезненное при пальпации. Придатки матки с обеих сторон не увеличены, безболезненны при пальпации. Своды глубокие, безболезненные при пальпации. Выделения - кровянистые, умеренные. Данные УЗИ органов малого таза (от 12.01.2011): тело матки размерами 4,5*5,0*4,8 см. По передней стенке субсерозно определяется узел, д - 1,5×2 см. Придатки матки без патологии. М-ЭХО - 13 см. 12.01.11 Операция: Гистероскопия, раздельное диагностическое выскабливание эндоцервикса и слизистой полости матки. Результаты патоморфологического исследования №315 - комплексная гиперплазия эндометрия с атипией. Через 1 неделю после выявленной атипической гиперплазии эндометрия произведено оперативное лечение в объеме: экстирпация матки с обоими придатками, дренирование брюшной полости. Гистологическое заключение №354/2644-2665: высокодифференцированная эндометриоидная аденокарцинома, локализуется в пределах базального эндометрия, не врастает в миометрий. Иммуногистохимическое исследование экспрессии эзрина и MGMT в соскобе и в операционном материале. При определении профиля процесса метилирования методом исследования MGM выявлено, что продукт реакции определялся в отдельных клетках в следовых количествах, отмечалось резко слабое метилирование, не превышающее 2 балла [см. Рис. 2, е]. Эзрин в раковых клетках ЭАК экспрессировал преимущественно цитоплазматически и составил 6 баллов [см. Рис. 4, е], а в апикальной части клеток ЭАК эзрин не экспрессировал.

3) Пациентка С., 47 лет, обратилась в БСМП г. Астаны в 2012 году с жалобами на кровянистые выделения из половых путей в течение 2-х недель. Клинический диагноз: Дисфункциональное маточное кровотечение в перименопаузальном периоде. Гиперплазия эндометрия. Соматические заболевания: хронический гастрит. Гинекологические заболевания: хронический сальпингоофорит. Гинекологические операции: отрицает. Менструации с 12 лет, установились сразу, регулярные, по 3-4 дня, через 28 дней, умеренные, безболезненные. Последние менструации - в течение 3-х месяцев нарушение менструального цикла, дату последней менструации точно не помнит. Репродуктивная функция: общее количество беременностей - 4, из них родов - 2, аборт - 2. Половая жизнь с 21 года. Гинекологический осмотр: наружные половые органы развиты правильно. Оволосение по женскому типу. Шейка матки цилиндрической формы, чистая.

Тело матки не увеличено, плотное, подвижное, безболезненное при пальпации. Придатки матки с обеих сторон не увеличены, безболезненны при пальпации. Своды глубокие, безболезненные при пальпации. Выделения - кровянистые, умеренные. Данные УЗИ органов малого таза (от 25.04.2012): тело матки размерами 3,8*4,0*3,8 см. Придатки матки без патологии. М-ЭХО - 13,5 см. 25.04.12 Операция: Гистероскопия. Раздельное диагностическое выскабливание эндоцервикса и слизистой полости матки. Результаты патоморфологического исследования №5510-4 - атипическая железистая гиперплазия эндометрия. Через 1 неделю после выявленной атипической гиперплазии эндометрия произведено оперативное лечение в объеме: экстирпация матки с обоими придатками, дренирование брюшной полости.

Гистологическое заключение №119-1: Комплексная гиперплазия с атипией эндометрия.

Иммуногистохимическое исследование экспрессии эзрина и MGMT в соскобе и в операционном материале: При КАГЭ MGMT выявлялся в ядрах и цитоплазме во всех эпителиальных и стромальных клетках [см. Рис. 2, г], получены высокие цифры метилирования, которые составили 6 баллов. Экспрессия эзрина преобладала цитоплазматически и составила 4 балла; апикально продукт реакции выявлялся в единичных клетках 2 балла [Рис. 4, г].

4) Пациентка Р., 46 лет, обратилась в АО «Республиканский научный центр неотложной медицинской помощи» г. Астаны в 2011 году с жалобами на кровянистые выделения из половых путей в течение 3-х недель. Клинический диагноз: Дисфункциональное маточное кровотечение в перименопаузальном периоде. Гиперплазия эндометрия. Заболевания у ближайших родственников: рак желудка у дедушки. Соматические заболевания: артериальная гипертензия 2 степень, риск 2. Гинекологические заболевания: хронический эндометрит. Гинекологические операции: отрицает. Менструации с 14 лет, установились сразу, регулярные, по 5-6 дней, через 27 дней, умеренные, безболезненные. Последние менструации - в течение 2-х месяцев нарушение менструального цикла. Репродуктивная функция: общее количество беременностей - 0, из них родов - 0, аборт - 0. Половая жизнь с 22 лет. Гинекологический осмотр: наружные половые органы развиты правильно. Оволосение по женскому типу. Шейка матки цилиндрической формы, чистая. Тело матки не увеличено, плотное, подвижное, безболезненное при пальпации. Придатки матки с обеих сторон не увеличены, безболезненны при пальпации. Своды глубокие, безболезненные при пальпации. Выделения - кровянистые, умеренные. Данные УЗИ органов малого таза (от 25.04.2012): тело матки размерами 3,9*4,0*3,8 см. Придатки матки без патологии. М-ЭХО - 14 см. 25.04.12 Операция: Гистероскопия. Раздельное диагностическое выскабливание эндоцервикса и слизистой полости матки. Результаты патоморфологического исследования №5341-60 - диффузная атипическая гиперплазия эндометрия. Через 1 неделю после выявленной атипической гиперплазии эндометрия произведено оперативное лечение в объеме экстирпации матки с обоими придатками, дренирование брюшной полости.

Гистологическое заключение №115-6: комплексная гиперплазия с атипией эндометрия.

Иммуногистохимическое исследование экспрессии эзрина и MGMT в соскобе и в операционном материале: При КАГЭ MGMT выявлялся в ядрах и цитоплазме во всех эпителиальных и стромальных клетках [см. Рис. 2, д], получены высокие цифры метилирования - 6 баллов. Экспрессия эзрина преобладала цитоплазматически и составила 4 балла; апикально продукт реакции выявлялся в единичных клетках и составил 2 балла [Рис. 4, д].

Источники информации

1. Holinke C.F., Ferenczy A., et al. Estradiol-induced hyperplasia in en dome-trial biopsies from women on hormone replacement therapy. /Am.. Surg. Pathol. 2002. 26: 1269-1275.

2. Kurosawa H. Kiyoshi I. Hitoshi N. et all Hysteroscopic inspection and total curettage are insufficient for discrimination endometrial cancer from atypical endometrial hyperplasia / Tonocu J. Exp. Med, 2012 г., 228, 365-370 c.).

Trimble C.L., Kauderer J., Zaino R. et al. / Gynecologic Oncology Group study. Cancer 2006; 106:4, 812-819).

3. Власов P.С, Карпов Д.В., Залетаев Д.В., Коган Е.А, Демура Т.А., Макарова И.И., Гуриев Т.Д., Идрисова Э.А., Богуш О.С., Бадгоева О.Х., Сидорова И.С., Унанян А.Л. / Метилирование генов-супрессоров опухолевого роста при патологических процессах эндометрия // IV международный конгресс по репродуктивной медицине, 2010 «Проблемы репродукции» (Специальный выпуск). - С. 285-286.

4. Ikeda S1, Imura J2, Suzuki К1 / Protein expression, mRNA expression and gene amplification of DNA methyltransferase 1 in endometrial tumor tissues / Mol Clin Oncol. 2013 May; 1(3):423-429.

5. Patra S.K., Bettuzzi S. / Epigenetic DNA-methylation regulation of coding for lipid raft-associated components: A role for raft proteins in cell transformation and cancer progression (review). / Oncol Reports 2007; 17: 1279-1290.

6. Slater M, Cooper M, Murphy CR. / Appl Immunohistochem Mol Morphol. / 2007 Jun; 15(2):170-4.

7. Mutter C.L. Endometrial intraepithelial neoplasia (EIN): Will it bring order to chaos? The Endometrial Collaborative Group. Gynecol. Oncol. 2000. 76:287-290].

8. Yutaka S., Okada Т., Anno K. et al. Aneuploidy Predicts Outcome in Patients with Endometrial Carcinoma and Is Related to Lack of CDH13 Hypermethylation // Clinical Cancer Research. 2008; 14; 3354.

9. Tan O, Ornek T, Fadiel A, Carrick KS, Arici A, Doody K, Carr BR / Expression and activation of the membrane-cytoskeleton protein ezrin during the normal endometrial / Naftolin F/G/Steril. 2012 Jan; 97(1):192-194.

10. Otanik. Sakomoto H. Rutherford T et all/| cancer let/ 2002u/ may 8; 179(1):79-86.

Подписи к рисункам

Рис. 1 - Морфология гиперплазии эндометрия и ЭИН

а) Простая гиперплазия эндометрия (ПГЭ) × 400 мкн

б) Комплексная гиперплазия эндометрия без атипии (КГЭ) × 400 мкн

в) Комплексная гиперплазия эндометрия с атипией (КАГЭ) × 400 мкн

г) Эндометриальная интраэпителиальная неоплазия (ЭИН) × 100 мкн

д) ЭИН Ki67 в эпителиальных клетках × 400 мкн

е) ЭИН, потеря белка PTEN × 400 мкн

а, б, в, г - окраска гематоксилин-эозином

д, е - имуннопероксидазная реакция с ДАБ

Рис. 2 - Экспрессия MGMT при различных формах гиперплазии эндометрия, ЭИН, эндометриоидной аденокарциноме по данным имунногистохимического исследования (имуннопероксидазная реакция с ДАБ).

а) Пролиферативный эндометрий в поздней стадии × 400 мкн

б) Простая гиперплазия эндометрия × 400 мкн

в) Комплексная гиперплазия эндометрия без атипии × 400 мкн

г) Комплексная гиперплазия эндометрия с атипией × 400 мкн

д) ЭИН × 400 мкн

е) Эндометриоидная высокодифференцированная аденокарцинома × 400 мкн

Рис. 3 - Экспрессия MGMT и эзрина в эпителиальных клетках при различных формах гиперплазии эндометрия, ЭИН и эндометриоидной аденокарциноме.

а) Экспрессия MGMT

б) Апикальная локализацияя эзрина

в) Цитоплазматическая локализация эзрина

Рис. 4 - Экспрессия эзрина при различных формах гиперплазии эндометрия, ЭИН и эндометриоидной аденокарциноме (имуннопероксидазная реакция с ДАБ).

а) Пролиферативный эндометрий в поздней стадии × 600 мкн

б) Простая гиперплазия эндометрия × 400 мкн

в) Комплексная гиперплазия эндометрия × 600 мкн

г) Комплексная атипическая гиперплазия эндометрия × 600 мкн

д) ЭИН × 600 мкн

е) Эндометриоидная высокодифференцированная аденокарцинома × 600 мкн.

Способ дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки у пациенток перименопаузального периода, основанный на иммуногистохимическом исследовании экспрессии эзрина и процесса метилирования генов в эндометрии, отличающийся тем, что при повышенной экспрессии эзрина в цитоплазме клеток от 4 до 6 баллов и снижении процесса метилирования генов под воздействием О6-метилгуанил-ДНК метилтрансферазы (MGMT) до уровня не более 2 баллов определяют возможность злокачественного течения патологического процесса и возникновения эндометриоидной аденокарциномы.



 

Похожие патенты:
Изобретение относится к медицине и предназначено для диагностики обострения язвенного колита. Проводят исследование иммунного статуса в сыворотке крови, определяют уровень циркулирующих иммунных комплексов и при повышении циркулирующих иммунных комплексов C1q до 60,8 ед./мл и выше уровня циркулирующих иммунных комплексов C3d до 39,0 ед./мл и выше и С-реактивного белка до 10,2 мг/л и выше диагностируют обострение язвенного колита.
Изобретение относится к медицине, а именно к акушерству и пульмонологии. Изобретение позволяет прогнозировать анемический синдром во втором триместре гестации при обострении хронического обструктивного бронхита у женщин с гриппом A(H3N2) в первом триместре беременности.

Изобретение относится к области медицины, а именно к неврологии, и может быть использовано для диагностики тяжести дисциркуляторной энцефалопатии у мужчин. Определяют уровень липопротеинов высокой плотности, коэффициенты коморбидности Cirs и Kaplan-Feistein.

Изобретение относится к онкологии и касается способов прогнозирования достижения полных морфологических регрессий (ПМР) у больных операбельным трипл-негативным раком молочной железы.

Изобретение относится к медицине, а именно к трансплантологии, и может быть использовано для мониторинга состояния пациента после трансплантации органа. Для этого, после трансплантации производят мониторинг редокс потенциала (РП) плазмы крови пациента.

Изобретение относится к области медицины. Изобретение представляет способ прогнозирования неразвивающейся беременности путем выявления факторов риска в сыворотке крови с помощью иммуноферментного анализа и дальнейшей обработки полученных результатов методом бинарной логистической регрессии.

Группа изобретений относится к ветеринарии и может быть использована для диагностики лейкоза крупного рогатого скота (КРС). Средство для диагностики лейкоза КРС содержит водорастворимую белковую фракцию клеточной линии почки эмбриона свиньи, контаминированной онкорнавирусами С и D и полученной при культивировании в анаэробных условиях, имеющую молекулярную массу от 75 до 82 кД в количестве 0,49-0,52 масс.% и характеризующуюся наличием пиков при длине волны 214 нм в ультрафиолетовой области спектра, и дополнительно содержит фосфатно-солевой буферный раствор.

Изобретение относится к медицине и описывает способ оценки хирургического риска у больных с атеросклеротической окклюзией бедренно-подколенно-берцового сегмента в стадии критической ишемии, включающий балльную оценку сопутствующих заболеваний сердечно-сосудистой системы, где каждому фактору риска присваивают определенное количество баллов, присвоение баллов происходит следующим образом: возраст более 70 лет - 1 балл, острое нарушение мозгового кровообращения или транзиторная ишемическая атака в анамнезе - 2 балла, постинфарктный кардиосклероз - 1 балл, фракция выброса левого желудочка от 46% до 50% - 2 балла, фракция выброса левого желудочка от 41% до 45% - 4 балла, фракция выброса левого желудочка 40% и менее - 6 баллов, ишемическая болезнь сердца: хроническая коронарная недостаточность I функциональный класс - 1 балл, ишемическая болезнь сердца: хроническая коронарная недостаточность II функциональный класс - 2 балла, ишемическая болезнь сердца: хроническая коронарная недостаточность III функциональный класс - 7 баллов, пароксизмальная форма фибрилляции-трепетания предсердий, эктопический ритм, частые (>5 в минуту) наджелудочковые экстрасистолы - 3 балла, постоянная форма фибрилляции-трепетания предсердий - 2 балла, желудочковые экстрасистолы >30 в час - 1 балл, баллы складывают, оценивают уровень хирургического риска данного больного, при сумме баллов 8 и более присваивают высокий хирургический риск, рекомендуют выполнение эндоваскулярной интервениции, при сумме баллов от 0 до 3 присваивают низкий хирургический риск, рекомендуют шунтирующую операцию, в случае суммы баллов от 4 до 7 присваивают средний хирургический риск, возможно использование обоих методов артериальной реконструкции.

Настоящее изобретение относится к отбору проб жидкости, которая находится в эластичном закрытом контейнере, например, в контейнере для сбора мочи или крови. Устройство для отбора жидкости, находящейся в эластичном контейнере (13, 14), содержит первую секцию (20), имеющую базовую поверхность (21), и элемент (22) для перфорирования пленки, выступающий от базовой поверхности (21).

Изобретение относится к области микробиологии, а именно к набору для детекции спор, происходящих из микобактерий в образце. Набор содержит антитело, которое специфически связывает относящийся к спорам пептид из микобактерий, где относящийся к спорам пептид из микобактерий выбран из группы, состоящей из CotA, CotD, CotT, SpoVK, CotSA, YrbC, SpoVE, Soj, SpoIIIE и SEQ ID NO: 2, 4, 6, 8, 10, 12, 16, 18, 20, 22, 24 и 26, где указанное антитело получают иммунизацией человека или организма, не являющегося человеком, указанным относящимся к спорам пептидом.
Изобретение относится к медицине, а именно к микологии и дерматовенерологии, и может быть использовано для диагностики микроспории. Способ включает выделение тотальной нативной ДНК из кожи и волос, специфическую амплификацию фрагмента гена 5.8S рРНК Trichophyton verrucosum с использованием праймеров следующей структуры: 5′ CCACGATAGGGATCAGCGTT 3′, 5′ GAAAGTTTTAACTGATTTTGCTTG 3′. Затем при электрофоретическом обнаружении продукта амплификации размером 231 п.н. определяют наличие возбудителя. Использование изобретения позволяет установить факт инфицированности человека Trichophyton verrucosum при различных клинических формах заболевания, в том числе стертых и атипичных. 2 пр.
Изобретение относится к медицине, а именно к способу прогнозирования рецептивности эндометрия в циклах экстракорпорального оплодотворения (ЭКО). Сущность способа состоит в том, что определяют оптическую плотность экспрессии лейкемия ингибирующего фактора (LIF) в поверхностном и железистом эпителии эндометрия в период окна имплантации в цикле, предшествующем проведению экстракорпорального оплодотворения, и дополнительно определяют содержание сосудистого эндотелиального фактора роста (VEGF) в цервикальной слизи в день трансвагинальной пункции фолликулов, систолодиастолическое отношение (S/D) и индекс резистентности (IR) спиральных артерий в день введения триггера овуляции, а затем рассчитывают значение регрессионной функции (Z) по формуле. При значении Z>0 прогнозируют, что эндометрий рецептивен, а при Z<0 - эндометрий не рецептивен. Использование заявленного способа позволяет прогнозировать рецептивность эндометрия и наступление беременности в результате цикла ЭКО с высокой степенью точности. 2 пр.

Изобретение относится к медицине и может быть использовано для диагностики опухолей головного мозга (ОГМ). Для этого путем электронной феноменологической спектроскопии измеряют оптическую плотность плазмы крови человека в видимой и ультрафиолетовой области спектра. При этом предварительно осуществляют измерение оптической плотности плазмы крови у группы доноров с диагностированной ОГМ и группы доноров, не имеющих такого диагноза. Рассчитывают интегральную силу осцилляторов в видимой (ИСО vis) и ультрафиолетовой (ИСО uv) областях спектра для каждого донора. Проводят построение графика зависимости ИСО vis от ИСО uv для обеих групп доноров и фиксацию результирующих прямых этих зависимостей на обоих графиках. Диагностику осуществляют путем измерения расстояния показателя конкретного больного на графике зависимости ИСО vis от ИСО uv до результирующих прямых доноров с диагнозом ОГМ (d1) и доноров, не имеющих такого диагноза (d2), и при d1<d2 делают вывод о вероятности наличия ОГМ. Изобретение позволяет осуществить первичную диагностику ОГМ у пациентов. 1 з.п. ф-лы, 2 ил., 3 пр.

Изобретение относится к области судебно-медицинской экспертизы, а именно к тестовым наборам, и позволяет произвести тестирование спермы в пятнах на исследуемом образце. Набор содержит две тестовые полоски из фильтровальной бумаги, одна из которых пропитана раствором, содержащим: цитратный буфер концентрации 50 ммоль/л - 10 мл, α-нафтил фосфат концентрации 10 ммоль/л - 26,5 мг, прочный красный TR концентрации 1,5 ммоль/л - 3,9 мг; а другая полоска пропитана раствором, содержащим: тартрат натрия концентрации 2 ммоль/л - 10 мл, α-нафтил фосфат концентрации 10 ммоль/л - 26,5 мг, прочный красный TR концентрации 1,5 ммоль/л - 3,9 мг; дистиллированную воду для получения водного экстракта исследуемого образца и емкость для проведения тестирования. При этом чувствительность полосок к сперме составляет не менее 0,00625 мг/мл. Изобретение позволяет ускорить и упростить процесс анализа на наличие спермы в исследуемом образце как в лабораторных условиях, так и непосредственно на месте происшествия, а также позволяет сохранять результаты исследования. 2 ил.

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при ранней диагностике шизофрении. Способ включает генетический анализ Vall58Met полиморфизма гена катехол-О-метил-трансферазы, при этом у носителей гаплотипа Met/Met проводят избирательную оценку предстимульного торможения и базового латентного периода акустической стартл-реакции. При снижении предстимульного торможения и возрастании базового латентного периода акустической стартл-реакции диагностируют шизофрению. 2 табл., 1 пр.
Изобретение относится к медицине, а именно к способу прогнозирования синдрома задержки внутриутробного развития плода в третьем триместре гестации при реактивации хронической цитомегаловирусной инфекции (ЦМВ) у женщин с угрозой невынашивания во втором триместре беременности. Сущность способа состоит в том, что во втором триместре гестации при реактивации хронической цитомегаловирусной инфекции у женщин определяют уровень антител IgM к ЦМВ и антител IgG к ЦМВ в парных сыворотках крови, в баллах - А, оценивают степень выраженности угрозы прерывания беременности, в баллах - В, определяют концентрацию фактора некроза опухоли-α (пг/мл) - С. Рассчитывают величину дискриминантной функции D с граничным значением равным +18,61. При D меньше граничного значения дискриминантной функции прогнозируют отсутствие синдрома задержки внутриутробного развития плода, а при D равной или больше граничного значения дискриминантной функции прогнозируют развитие синдрома задержки внутриутробного развития плода. Использование заявленного способа позволяет эффективно спрогнозировать синдром внутриутробного развития плода в третьем триместре гестации при реактивации хронической цитомегаловирусной инфекции (ЦМВ) у женщин с угрозой невынашивания во втором триместре беременности. 2 пр.

Изобретение относится к области медицины, а именно к акушерству и гинекологии, и может быть использовано для прогнозирования ранней гипогалактии - перед родами у беременных женщин при анализе анамнеза, течения настоящей беременности выявляют факторы риска гипогалактии. Проводят сравнительную оценку морфологии кристаллограмм секрета молочных желез, забираемого с началом родовой деятельности, в первые и вторые сутки послеродового периода. При отсутствии изменения морфологии кристаллограмм секрета молочных желез в первые, вторые сутки послеродового периода по сравнению с кристаллограммой, выполненной с началом родовой деятельности, в 100% прогнозируют раннюю гипогалактию. При отсутствии изменения морфологии кристаллограммы секрета молочных желез в первые сутки и изменении морфологии кристаллограммы во вторые сутки послеродового периода по сравнению с кристаллограммой, выполненной с началом родовой деятельности, с вероятностью в 70,3% прогнозируют раннюю гипогалактию, при этом изменение морфологии кристаллограммы в первые сутки послеродового периода по сравнению с кристаллограммой, выполненной с началом родовой деятельности, свидетельствует о физиологическом становлении лактации. Способ неинвазивен, безопасен для матери и ребенка, доступен, повышает точность прогнозирования ранней гипогалактии. 8 ил., 3 пр.

Изобретение относится к медицине, биологии, фармации и пищевой технологии применительно к исследованию гомолитических свойств липидов и их участия в свободнорадикальных реакциях окисления, а также - к осуществлению подбора антиоксидантов. Способ осуществляют путем экстрагирования из навески биоматериала жирорастворимого антиоксиданта в виде гептанового экстракта и водорастворимого антиоксиданта в виде изопропилового экстракта, насыщения пробы модельного субстрата каждого антиоксиданта кислородом с перемешиванием при температуре 60,0±0,2°C и определения объема поглощенного кислорода во времени волюмометрическим методом в термостатированной установке типа Варбурга с построением графика в координатах ΔV/t, последующим определением из кинетических кривых величины периода индукции (τi) и расчетом суммарной антиоксидантной активности компонентов биоматериала в составе модельного субстрата с учетом контрольных проб, не содержащих гептанового и изопропилового экстракта, причем модельный субстрат жирорастворимого антиоксиданта включает в себя: биоматериал, метиловый или этиловый эфир высших ненасыщенных жирных кислот, раствор азо-бис-изобутиронитрила (АИБН) в хлорбензоле в концентрации в пробе (2-60)×10-3 M, полученный образец доводят хлорбензолом до 2 мл, модельный субстрат водорастворимого антиоксиданта включает в себя: биоматериал, метиловый или этиловый эфир ненасыщенных жирных кислот, водный раствор хлорида меди (II) в концентрации в пробе (1-3)×10-3 М, водный раствор цетилтриметиламмония бромида (ЦТМАБ) в концентрации в пробе (1-5)×10-3 М, полученный образец доводят водой до 4 мл, а определение суммарной антиоксидантной активности жирорастворимых и водорастворимых компонентов биоматериала осуществляют из заданной расчетной зависимости. Достигаются повышение точности и ускорение определения. 1 табл., 4 пр.

Изобретение относится к области медицины и касается способов прогнозирования достижения ПМР у больных ТНР молочной железы. Проводят иммунногистохимическое исследование ткани опухоли. Для полученных параметров оценивают уровень экспрессии. Рассчитывают значение уравнения регрессии по формуле: Y=(5,38-16,2X1-11,2X2+5,98X3+12,4X4-5,39X5), где X1 - состояние регионарного лимфатического аппарата (0 - отсутствие метастатического поражения лимфатических узлов, 1 - поражение до 4 лимфатических узлов, 2 - поражение 4-9 лимфатических узлов, 3 - поражение 10 и более лимфатических узлов); X2 - уровень экспрессии EGFR1 (1 - менее 10%, 2 - 10% и более); X3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки (1 - менее 20%, 2 - 20% и более); X4 - уровень экспрессии Ki-67 (1 - менее 20%, 2 - 20% и более); X5 - уровень экспрессии VEGFR-2 (1 - менее 70%, 2 - 70% и более). Значение вероятности достижения ПМР - P рассчитывают по формуле: P=eY/(1+eY), где е - математическая константа, равная 2,72, и при P<0,5 прогнозируют низкую, а при P>0,5 высокую вероятность достижения ПМР у больных, получавших схему САХ. Способ прогнозирования позволяет прогнозировать достижение ПМР регрессий у больных ТНР, получивших курсы химиотерапии по схеме САХ. 5 табл., 2 пр.

Группа изобретений относится к области экспериментальной биологии и медицины для приготовления тотальных препаратов биологических тканей для оптической проекционной томографии, конфокальной, мультифотонной и светоплоскостной микроскопии и может быть использована для предклинических испытаний фармакологических препаратов и оценки физиологических воздействий на организм, а также для работы с материалом биопсий в диагностических и исследовательских целях. Способ иммуногистохимического окрашивания тотальных препаратов образцов биологической ткани включает фиксацию ткани раствором параформальдегида. Также способ включает постфиксацию, которую сначала проводят 0,5-1%-ным параформальдегидом в течение 48 ч при 4°C, а затем после трехкратной отмывки фосфатным буфером при комнатной температуре, в растворе 20%-ного диметилсульфоксида в 100%-ном метаноле в течение 1-2 ч при комнатной температуре. После этого образец ткани отбеливают в растворе, содержащем 100%-ный метанол:диметилсульфоксид: 30% Н2О2 в соотношении 4:1:1, в течение 2-4 ч на ярком свету при комнатной температуре до полного обесцвечивания. Затем образец отмывают 3 раза по 60 мин в 100%-ном метаноле при комнатной температуре и замораживают не менее чем на 1 час при -70…-80°C, после чего регидратируют последовательно в 50, 25 и 12,5%-ных растворах метанола в фосфатном буфере по 45-60 мин в каждом при комнатной температуре. Затем образцы трижды отмывают от метанола фосфатным буфером, причем два раза отмывают по 1-2 ч при комнатной температуре, а последнюю отмывку проводят в течение ночи при 4°C. Последующую пермеабилизацию образца проводят в фосфатном буфере, содержащем 2%-ный Triton Х-100, 5%-ную нормальную сыворотку, 5%-ный диметилсульфоксид, в течение 2 ч при комнатной температуре. Затем образец отмывают трижды в фосфатном буфере, содержащем 0,2%-ный Triton Х-100, причем два раза отмывают по 30-60 мин при комнатной температуре, а последнюю отмывку проводят в течение ночи при 4°C. После этого проводят инкубацию последовательно в растворах первичных и вторичных антител, приготовленных на буфере, состоящем из 0,05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, 5% диметилсульфоксид и 2,5-5,0% нормальной сыворотки животного-хозяина вторичных антител, при 4°C в течение 2-7 суток, с отмывками после каждой инкубации в буфере, состоящем из 0.05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, сначала 3 раза по 60 мин при комнатной температуре, а затем в течение ночи при 4°C. Окрашенные образцы дегидратируют последовательно в 50, 96%-ных растворах этанола в фосфатном буфере по 45-60 мин в каждом при комнатной температуре. Затем образцы выдерживают сначала в 100%-ном этаноле при комнатной температуре 2-3 раза по 45-60 мин, а после в 2-бутоксиэтаноле при 4°C в течение 12-18 ч. Дегидратированные образцы просветляют при комнатной температуре в смеси бензил бензоата:бензиловый спирт, взятых в соотношении 2:1 в течение 3-4 ч. При этом способ окрашивания, начиная с операции постфиксации, проводят при помешивании со скоростью 650-800 об/мин. Второй вариант способа заключается в том, что инкубацию проводят в растворе флуоресцентно-меченных первичных антител, приготовленных на буфере, состоящем из 0,05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, 5% диметилсульфоксид и 2,5-5.0% нормальной сыворотки, при 4°C в течение 2-7 суток. Достигаемый при этом технический результат заключается в осуществлении окрашивания тотальных препаратов образцов биологических тканей с сохранением их морфологии и обеспечением более широкого охвата выявляемых антигенов, а также в возможности проведения количественного анализа иммуногистохимически выявленных меток за счет высокого соотношения фон-сигнал и снижения аутофлуоресценции. 2 н. и 16 з.п. ф-лы, 2 ил., 2 пр.
Наверх