Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе



Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе
Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе
Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе
Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе
Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе
Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе
Способ обнаружения днк возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости, олигонуклеотидный микрочип, набор праймеров и набор олигонуклеотидных зондов, используемые в способе

 


Владельцы патента RU 2562866:

Федеральное государственное бюджетное учреждение науки Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук (ИМБ РАН) (RU)

Изобретение относится к биотехнологии, а именно к способу обнаружения ДНК возбудителя туберкулеза - микобактерий туберкулезного комплекса с одновременным установлением генотипа возбудителя и определением генетических детерминант устойчивости к широкому спектру противотуберкулезных препаратов, включая рифампицин, изониазид, фторхинолоны, канамицин, капреомицин, амикацин, этамбутол, в клиническом образце на дифференцирующем олигонуклеотидном микрочипе. Метод основан на мультиплексной ПЦР с одновременным флуоресцентным маркированием ПЦР-продуктов с последующей гибридизацией полученных продуктов на олигонуклеотидном микрочипе, содержащем набор специфичных дискриминирующих олигонуклеотидов. Изобретение также касается олигонуклеотидного микрочипа, набора праймеров и набора олигонуклеотидных зондов, используемых при осуществлении способа. Изобретение позволяет проводить анализ ДНК, выделенной непосредственно из клинического образца, выявлять генотипы возбудителя туберкулеза, ассоциированные с повышенной вирулентностью и трансмиссивностью, обеспечивать персонифицированный выбор эффективных противотуберкулезных препаратов для каждого конкретного пациента, проводить эпидемиологическое генотипирование. 4 н. и 5 з.п. ф-лы, 7 ил., 3 табл., 8 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к молекулярной биологии, микробиологии и медицине и обеспечивает способ обнаружения ДНК возбудителя туберкулеза - микобактерий туберкулезного комплекса (Mycobacterium tuberculosis, M. bovis, M. bovis BCG, M. africanum, M. microti, Mycobacterium canettii, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium mungi) с одновременным установлением генотипа возбудителя и определением генетических детерминант устойчивости к широкому спектру противотуберкулезных препаратов, включая рифампицин, изониазид, фторхинолоны, канамицин, амикацин, капреомицин, этамбутол, в клиническом образце на дифференцирующем олигонуклеотидном микрочипе.

Уровень техники

Распространение устойчивых к противотуберкулезным препаратам штаммов M. tuberculosis представляет серьезную мировую проблему. Сегодня по классификации ВОЗ выделяют возбудителей туберкулеза с множественной лекарственной устойчивостью (МЛУ (MDR) ТБ), с широкой лекарственной устойчивостью (ШЛУ (XDR) ТБ) и возбудителей с тотальной (полной) устойчивостью к противотуберкулезным препаратам (суперустойчивый ТБ). МЛУ ТБ вызывается микобактериями, устойчивыми, по крайней мере, к двум наиболее эффективным препаратам первого ряда - изониазиду и рифампицину. ШЛУ ТБ - это форма туберкулеза, устойчивого к изониазиду и рифампицину, а также к любому фторхинолону, и, как минимум, к одному из трех инъекционных противотуберкулезных препаратов второй линии терапии (амикацин, канамицин или капреомицин). Лекарственно-устойчивые формы ТБ не отвечают на стандартную шестимесячную терапию противотуберкулезными средствами первой линии и лечатся в течение двух и более лет лекарствами второй линии, которые более токсичны и дороги. В то же время, курс лечения лекарственно-чувствительного туберкулеза обходится приблизительно в 200 USD, МЛУ ТБ - 5 000 USD, а лечение ШЛУ ТБ еще более дорого и, главное, занимает более продолжительное время.

В России, согласно данным официальной статистики, в 2009 г. МЛУ ТБ среди впервые выявленных больных был зарегистрирован в 15,4%, тогда как общая распространённость МЛУ-штаммов среди всех больных ТБ в 2009 г. составила 33,5%. Данные по ШЛУ ТБ и суперустойчивого ТБ в России не опубликованы, поскольку они не включены в отчетные формы («Туберкулез в Российской федерации 2009 г» Аналитический обзор статистических показателей по туберкулезу, используемых в Российской Федерации). По данным ВОЗ, в нашей стране ШЛУ штаммы составляют около 30 % всех МЛУ штаммов M. tuberculosis. В мире число случаев ШЛУ ТБ оценивается как 25 000 в год, и почти все они приводят к смертельному исходу (World Health Organization, 2010. Global tuberculosis control: a short update to the 2009 report).

Распространению лекарственно-устойчивого ТБ способствует длительность бактериологического тестирования выделенных от пациентов возбудителей ТБ. Даже с использованием автоматического анализатора BACTEC процедура оценки профиля чувствительности конкретного изолята к препаратам первого ряда занимает более месяца, при этом в большинстве бактериологических лабораторий тестирование на чувствительность к препаратам второй линии терапии (фторхинолоны, амикацин, канамицин, капреомицин, этамбутол и др.) вообще не проводится.

В этой связи необходимы методы быстрого и надежного определения устойчивости клинических штаммов туберкулеза, то есть причисления штаммов туберкулеза к классам устойчивости: лекарственно-чувствительный, МЛУ или ШЛУ. Результаты анализа будут непосредственно использоваться в клинической практике для своевременной коррекции противотуберкулезной терапии. Наиболее перспективными методами являются молекулярные технологии анализа генома возбудителя туберкулеза, позволяющие идентифицировать генетические детерминанты множественной и широкой лекарственной устойчивости.

Еще одной важной клинически значимой задачей является генотипирование возбудителя туберкулеза. Нарастающее количество секвенированных геномов в последние годы M. tuberculosis и последующее сравнение их in silico выявило достаточный уровень генетического разнообразия для филогенетически надежных построений, по крайней мере, на уровне генетических семейств. Анализ однонуклетидного полиморфизма геномов микобактерий туберкулезного комплекса позволил выявить пять основных линий - Beijing («пекинская» линия), CAS (Central Asian - «центрально-азиатская» линия), EuroAmerican («Евро-Американская» линия), EAI (East African-Indian - «восточная Африкано-Индийская» линия), M. bovis (Baker L, Brown T, Maiden MC, Drobniewski F. 2004. Silent nucleotide polymorphisms and a phylogeny for Mycobacterium tuberculosis. Emerging Infectious Diseases 10:1568-1577). К настоящему моменту на территории РФ и стран бывшего СССР отмечено повсеместное превалирование Beijing и Евро-Американской линий, последняя, в свою очередь, разделяется на три основных генотипа Ural, LAM и Haarlem (Casali N, Nikolayevskyy V, Balabanova Y, Ignatyeva O, Kontsevaya I, Harris SR, Bentley SD, Parkhill J, Nejentsev S, Hoffner SE, Horstmann RD, Brown T, Drobniewski F. Microevolution of extensively drug-resistant tuberculosis in Russia. Genome Research. 2012. 22(4):735-45).

Следует отметить, что в РФ генотип Beijing является самым распространённым и встречается в среднем у 50% пациентов (Igor Mokrousov. Insights into the origin, emergence, and current spread of a successful Russian clone of Mycobacterium tuberculosis. Clinical microbiology reviews 2013; 26(2):342-60). В настоящее время установление генотипа Beijing является клинически значимой задачей, поскольку его штаммы демонстрируют важные патогенные свойства, например повышенную вирулентность в организме мышей, вакцинированных БЦЖ (Lopez B, Aguilar D, Orozco H, Burger M, Espitia C, Ritacco V, et al. A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis geneotypes. Clin Exp Immunol. 2003;133:30-7), ассоциацию с множественной и широкой лекарственной устойчивостью (Mokrousov I, Narvskaya O, Vyazovaya A, Otten T, Jiao WW, Gomes LL, Suffys PN, Shen AD, Vishnevsky B. Russian "successful" clone B0/W148 of Mycobacterium tuberculosis Beijing genotype: a multiplex PCR assay for rapid detection and global screening. Journal of Clinical Microbiology 2012 Nov 50(11):3757-9), способность быстро размножаться в человеческих макрофагах и высокую трансмиссивность (Tran N Buu, Dick van Soolingen, Mai N T Huyen, Nguyen T N Lan, Hoang T Quy, Edine W Tiemersma, Kristin Kremer, Martien W Borgdorff, Frank G J Cobelens. Increased transmission of Mycobacterium tuberculosis Beijing genotype strains associated with resistance to streptomycin: a population-based study. PLoS One 2012 13; 7(8):e42323). Текущая эпидемия туберкулеза в России в значительной степени связана с активным распространением мультирезистентных штаммов генотипа Beijing и его варианта B0/W148 в популяции, иммунизированной БЦЖ (Casali, N., Nikolayevskyy, V., Balabanova, Y., Harris, S.R., Ignatyeva, O., Kontsevaya, I., Corander, J., Bryant, J., Parkhill, J., Nejentsev, S., Horstmann, R.D., Brown, T. & Drobniewski, F. Evolution and transmission of drug-resistant tuberculosis in a Russian population. Nature Genetics 2014 46, 279-86). Таким образом, наблюдаемое сейчас широкое распространение штаммов Beijing представляет серьезную угрозу успешной реализации национальных программ борьбы с туберкулезом.

Для двух других семейств возбудителя туберкулеза LAM и Ural, также широко представленных на территории РФ, в настоящее время ассоциаций с высокой вирулентностью и лекарственной устойчивостью не обнаружено. Это обусловлено отсутствием молекулярных диагностических инструментов, обеспечивающих одновременное определение генетических детерминант лекарственной устойчивости и генотипирование возбудителя туберкулеза.

В настоящее время для идентификации лекарственно-устойчивых штаммов микобактерий туберкулезного комплекса и их генотипирования применяются следующие молекулярные методы:

I. ПЦР с детекцией в режиме реального времени для идентификации мутаций, ответственных за лекарственную устойчивость. (Real-time PCR)

Заявка на патент WO/2011/140237 «Process for detection of multidrug resistant tuberculosis using real-time PCR and high resolution melt analysis»

Ramirez MV, Cowart KC, Campbell PJ, Morlock GP, Sikes D, Winchell JM, Posey JE. Rapid detection of multidrug-resistant Mycobacterium tuberculosis by use of real-time PCR and high-resolution melt analysis. Journal of clinical microbiology 2010 Nov; 48(11):4003-9

Chen X, Kong F, Wang Q, Li C, Zhang J, Gilbert GL. Rapid detection of isoniazid, rifampin, and ofloxacin resistance in Mycobacterium tuberculosis clinical isolates using high-resolution melting analysis. Journal of clinical microbiology 2011 Oct; 49(10):3450-7.

Yadav R, Sethi S, Mewara A, Dhatwalia SK, Gupta D, Sharma M. Rapid detection of rifampicin, isoniazid and streptomycin resistance in Mycobacterium tuberculosis clinical isolates by high-resolution melting curve analysis. Journal of Applied Microbiology 2012 Oct; 113(4):856-62.

Владимирский М.А., Аляпкина Ю.С., Варламов Д.А., Алексеев Я.И., Шипина Л.К., Шульгина М.В., Домотенко Л.В., Быкадорова К.Р., Гащенко Н.Н., Ендоурова Л.Б., Иванова О.В., Ильина Е.А., Левкова О.А., Маркова Т.В., Наземцева В.П., Павлова Е.П., Полозов А.И., Шишкина Н.В. Применение метода ПЦР в реальном времени для определения и контроля за распространением лекарственно-устойчивых штаммов микобактерий туберкулеза. Туберкулез и болезни легких. 2008. 85(4) 38-44

II. Автоматизированная процедура, совмещающая обработку клинического образца и выделение ДНК с последующей амплификацией с детекцией в режиме реального времени в отдельном картридже, изолированном от окружающей среды (например, коммерческая диагностическая тест-система Xpert® MTB/RIF компании Cepheid, США, и аналоги). (cartridge-based, automated diagnostic test that can identify Mycobacterium tuberculosis (MTB) and resistance to rifampicin (RIF))

Helb, D., M. Jones, E. Story, C. Boehme, E. Wallace, K. Ho, J. Kop, M.R. Owens, R. Rodgers, P. Banada, H. Safi, R. Blakemore, N.T. Lan, E.C. Jones-Lopez, M. Levi, M. Burday, I. Ayakaka, R.D. Mugerwa, B. McMillan, E. Winn-Deen, L. Christel, P. Dailey, M.D. Perkins, D.H. Persing, and D. Alland. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. Journal of clinical microbiology 2010 48, 229-37

Список публикаций доступен на веб-сайте ВОЗ по следующей ссылке:

Published evidence and commentary on the Xpert MTB/RIF assay

Рекомендации ВОЗ по применению тест-системы Xpert® MTB/RIF приведены в следующих статьях:

Rapid implementation of the Xpert MTB/RIF diagnostic test (WHO/HTM/TB/2011.2)

Policy statement: Xpert MTB/RIF system (WHO/HTM/TB/2011.4)

Castan, P., de Pablo, A., Fernandez-Romero, N., Rubio, J.M., Cobb, B.D., Mingorance, J. & Toro, C. Point-of-care system for detection of Mycobacterium tuberculosis and rifampin resistance in sputum samples. Journal of clinical microbiology 2014 52, 502-7

III. Гибридизационные технологии на основе зондов, иммобилизованных на нитроцеллюлозных полосках («стрипах») (Line probe assay)

III.I Коммерческий набор INNO-LiPA Rif.TB компании Innogenetics (Бельгия)

Tortoli E, Marcelli F. Use of the INNO LiPA Rif.TB for detection of Mycobacterium tuberculosis DNA directly in clinical specimens and for simultaneous determination of rifampin susceptibility. European Journal of Clinical Microbiology and Infectious Diseases 2007 Jan; 26(1):51-5.

Skenders GK, Holtz TH, Riekstina V, Leimane V. Implementation of the INNO-LiPA Rif. TB® line-probe assay in rapid detection of multidrug-resistant tuberculosis in Latvia. International Journal of Tubercle and Lung Diseases 2011 Nov; 15(11):1546-52

III.II Коммерческие наборы GenoType® MTBDRplus и GenoType® MTBDRsl компании Hain Lifescience (Германия)

В основе наборов лежит заявка на патент WO/2003/039703 «Method in the form of a dry rapid test for detecting nucleic acids» компании Hain Lifescience.

Hillemann D, Rüsch-Gerdes S, Richter E. Evaluation of the GenoType MTBDRplus assay for rifampin and isoniazid susceptibility testing of Mycobacterium tuberculosis strains and clinical specimens. Journal of clinical microbiology 2007 Aug; 45(8):2635-40.

Nikolayevskyy V, Balabanova Y, Simak T, Malomanova N, Fedorin I, Drobniewski F. Performance of the Genotype MTBDRPlus assay in the diagnosis of tuberculosis and drug resistance in Samara, Russian Federation. BMC Clinical Pathology. 2009 Mar 10; 9:2.

Miotto P, Cabibbe AM, Mantegani P, Borroni E, Fattorini L, Tortoli E, Migliori GB, Cirillo DM. GenoType MTBDRsl performance on clinical samples with diverse genetic background. European Respiratory Journal. 2012 Sep; 40(3):690-8

Barnard M, Warren R, Van Pittius NG, van Helden P, Bosman M, Streicher E, Coetzee G, O'Brien R. GenoType MTBDRsl Line Probe Assay Shortens Time to Diagnosis of XDR-TB in a High-throughput Diagnostic Laboratory. American Journal of Respiratory and Critical Care Medicine. 2012 Oct 18

III.III Коммерческие наборы AID TB resistance line probe assay компании Autoimmun Diagnostika GmbH (AID) (Германия).

B. Molina-Moya, A. Lacoma, C. Prat, J. Diaz, A. Dudnyk, L. Haba, J. Maldonado, S. Samper, J. Ruiz-Manzano, V. Ausina, J. Dominguez. AID TB resistance line probe assay for rapid detection of resistant Mycobacterium tuberculosis in clinical samples. Journal of Infection 2014. In press. DOI: http://dx.doi.org/10.1016/j.jinf.2014.09.011

Ritter C, Lucke K, Sirgel FA, Warren RW, van Helden PD, Böttger EC, Bloemberg GV. Evaluation of the AID TB resistance line probe assay for rapid detection of genetic alterations associated with drug resistance in Mycobacterium tuberculosis strains. Journal of clinical microbiology 2014 Mar;52(3):940-6

IV. Гибридизационные технологии на основе олигонуклеотидных микрочипов (DNA microarrays (biochips)).

IV.I Гидрогелевые олигонуклеотидные микрочипы (биочипы) низкой плотности. Коммерческие наборы «ТБ-Биочип-1» и «ТБ-БИОЧИП-2», разработанные в Институте молекулярной биологии им. В.А. Энгельгардта РАН, для идентификации штаммов возбудителя туберкулеза и определения его чувствительности к рифампицину/изониазиду и фторхинолонам.

Мирзабеков А.Д., Михайлович В.М., Соболев А.Ю. Грядунов Д.А., Лапа С.А., Заседателев А.С. Способ одновременного обнаружения микобактерий туберкулезного комплекса и идентификации мутаций в днк микобактерий, приводящих к устойчивости микроорганизмов к рифампицину и изониазиду, на биологических микрочипах, набор праймеров, биочип и набор олигонуклеотидных зондов, используемые в способе. Патент РФ 2376387. Опубликовано 20.12.2009. Приоритет от 26.12.2005

Gryadunov D., V. Mikhailovich, S. Lapa, N. Roudinskii, M. Donnikov, S. Pan'kov, O. Markova, A. Kuz'min, L. Chernousova, O. Skotnikova, A. Moroz, A. Zasedatelev and A. Mirzabekov. Evaluation of hybridisation on oligonucleotide microarrays for analysis of drug-resistant Mycobacterium tuberculosis. Clinical microbiology and infection 2005. Vol 11: p. 531-539.

О.В. Антонова, Д.А. Грядунов, С.А. Лапа, А.В. Кузьмин, Е.Е. Ларионова, Т.Г. Смирнова, Е.Ю. Носова, О.И. Скотникова, Л.Н. Черноусова, А.М. Мороз, А.С. Заседателев, В.М. Михайлович. Выявление мутаций в геноме Mycobacterium tuberculosis, приводящих к устойчивости к фторхинолонам, методом гибридизации на биологических микрочипах. Бюллетень экспериментальной биологии и медицины 2008. №1. стр. 115-120

Zimenkov DV, Antonova OV, Kuz Min AV, Isaeva YD, Krylova LY, Popov SA, Zasedatelev AS, Mikhailovich VM, Gryadunov DA. Detection of second-line drug resistance in mycobacterium tuberculosis using oligonucleotide microarrays. BMC Infectious Diseases. 2013 May 24; 13(1):240.

Зименков Д.В., Кулагина Е.В., Антонова О.В., Суржиков С.А., Беспятых Ю.А., Шитиков Е.А., Ильина Е.Н., Михайлович В.М., Заседателев А.С., Грядунов Д.А. Анализ генетических детерминант множественной и широкой лекарственной устойчивости возбудителя туберкулеза с использованием олигонуклеотидного микрочипа. 2014. Молекулярная биология. т. 48(2), стр. 251-264

IV.II Иные олигонуклеотидные микрочипы низкой плотности.

Huang WL, Hsu ZJ, Chang TC, Jou R. Rapid and accurate detection of rifampin and isoniazid-resistant Mycobacterium tuberculosis using an oligonucleotide array. Clinical microbiology and infection 2014 Sep; 20(9):O542-9

Linger, Y., Kukhtin, A., Golova, J., Perov, A., Lambarqui, A., Bryant, L., Rudy, G.B., Dionne, K., Fisher, S.L., Parrish, N. & Chandler, D.P. (2014). Simplified microarray system for simultaneously detecting rifampin, isoniazid, ethambutol, and streptomycin resistance markers in Mycobacterium tuberculosis. Journal of clinical microbiology 52, 2100-7

Zhang Z, Li L, Luo F, Cheng P, Wu F, Wu Z, Hou T, Zhong M, Xu J. Rapid and accurate detection of RMP- and INH- resistant Mycobacterium tuberculosis in spinal tuberculosis specimens by CapitalBioTM DNA microarray: A prospective validation study. BMC Infectious Diseases 2012 Nov 14; 12(1):303.

Yao C, Zhu T, Li Y, Zhang L, Zhang B, Huang J, Fu W. Detection of rpoB, katG and inhA gene mutations in Mycobacterium tuberculosis clinical isolates from Chongqing as determined by microarray. Clinical microbiology and infection 2010 Nov; 16(11):1639-43.

Volokhov DV, Chizhikov VE, Denkin S, Zhang Y. Molecular detection of drug-resistant Mycobacterium tuberculosis with a scanning-frame oligonucleotide microarray. Methods in Molecular Biology 2009; 465:395-417.

IV.III Олигонуклеотидные микрочипы высокой плотности

Sougakoff W, Rodrigue M, Truffot-Pernot C, Renard M, Durin N, Szpytma M, Vachon R, Troesch A, Jarlier V. Use of a high-density DNA probe array for detecting mutations involved in rifampicin resistance in Mycobacterium tuberculosis. Clinical microbiology and infection 2004 Apr; 10(4):289-94.

V. Масс-спектрометрические методы (Matrix-assisted laser desorption ionization-time of flight (mass spectrometry))

Афанасьев М.В., Икрянникова Л.Н., Ильина Е.Н., Смирнова Т.Г., Ларионова Е.Е., Кузьмин А.В., Черноусова Л.Н., Камаев Е.Ю., Скорняков С.Н., Киншт В.Н., Чередниченко А.Г., Говорун В.М. Применение реакции мини-секвенирования с последующим MALDI-TOF масс-спектрометрическим анализом для оценки устойчивости к рифампицину и изониазиду штаммов Mycobacterium tuberculosis. Туберкулез и болезни легких. 2007. 84(7):27-42

Афанасьев М.В., Боровская А.Д., Ильина Е.Н., Смирнова Т.Г., Ларионова Е.Е., Кузьмин А.В., Андреевская С.Н., Черноусова Л.Н., Говорун В.М. Выявление мутаций в кодоне 306 embB гена для молекулярно-генетической характеристики клинических штаммов Mycobacterium tuberculosis. Туберкулез и болезни легких 2009. 86(5):48-53

Afanas′ev MV, Ikryannikova LN, Il′ina EN, Kuz′min AV, Larionova EE, Smirnova TG, Chernousova LN, Govorun VM. Molecular typing of Mycobacterium tuberculosis circulated in Moscow, Russian Federation. European Journal of Clinical Microbiology and Infectious Diseases 2011 Feb; 30(2):181-91.

Ikryannikova LN, Afanas′ev MV, Akopian TA, Il′ina EN, Kuz'min AV, Larionova EE, Smirnova TG, Chernousova LN, Govorun VM. Mass-spectrometry based minisequencing method for the rapid detection of drug resistance in Mycobacterium tuberculosis. Journal of Microbiology Methods 2007 Sep; 70(3):395-405.

VI.яАнализ конформационного полиморфизма и гетеродуплексный анализ с применением капиллярного электрофореза (conformation polymorphism analysis and heteroduplex mobility analysis using temperature gradient capillary electrophoresis)

Krothapalli S, May MK, Hestekin CN. Capillary electrophoresis-single strand conformation polymorphism for the detection of multiple mutations leading to tuberculosis drug resistance. Journal of Microbiology Methods 2012 Oct; 91(1):147-54.

Shi R, Otomo K, Yamada H, Tatsumi T, Sugawara I. Temperature-mediated heteroduplex analysis for the detection of drug-resistant gene mutations in clinical isolates of Mycobacterium tuberculosis by denaturing HPLC, SURVEYOR nuclease. Microbes and Infection 2006 Jan; 8(1):128-35.

VII. Конъюгаты нанолигандов со специфическими ДНК-зондами (nanoprobes for detection of SNPs associated with antibiotic resistance).

Veigas B, Machado D, Perdigão J, Portugal I, Couto I, Viveiros M, Baptista PV. Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis. Nanotechnology 2010 Oct 15; 21(41):415101.

VIII. Секвенирование последовательностей генов M. tuberculosis, в которых возможны мутации, ответственные за лекарственную устойчивость. (DNA sequencing, Next-generation sequencing)

Daum LT, Rodriguez JD, Worthy SA, Ismail NA, Omar SV, Dreyer AW, Fourie PB, Hoosen AA, Chambers JP, Fischer GW. Next-Generation Ion Torrent Sequencing of Drug Resistance Mutations in Mycobacterium tuberculosis Strains. Journal of clinical microbiology 2012 Dec; 50(12):3831-7.

Liu CH, Li HM, Lu N, Wang Q, Hu YL, Yang X, Hu YF, Woo PC, Gao GF, Zhu B. Genomic sequence based scanning for drug resistance-associated mutations and evolutionary analysis of multidrug-resistant and extensively drug-resistant Mycobacterium tuberculosis. Journal of Infection 2012 Nov; 65(5):412-22.

Si J, Wang Z, Wang Z, Li H. Sequencing-based detection of drug-resistant Mycobacterium tuberculosis in patients with spinal tuberculosis. Archives of Orthopaedic and Trauma Surgery 2012 Jul; 132(7):941-5.

Feuerriegel S, Oberhauser B, George AG, Dafae F, Richter E, Rüsch-Gerdes S, Niemann S. Sequence analysis for detection of first-line drug resistance in Mycobacterium tuberculosis strains from a high-incidence setting. BMC Microbiology. 2012 May 30; 12:90.

Feuerriegel S, Cox HS, Zarkua N, Karimovich HA, Braker K, Rüsch-Gerdes S, Niemann S. Sequence analyses of just four genes to detect extensively drug-resistant Mycobacterium tuberculosis strains in multidrug-resistant tuberculosis patients undergoing treatment. Antimicrobial Agents and Chemotherapy 2009 Aug; 53(8):3353-6

IX. Мультиплексная лиганд-зависимая амплификация на микросферах. (Multiplex Ligation-dependent Probe Amplification (MLPA) on a Bead Based Array)

Sengstake S, Bablishvili N, Schuitema A, Bzekalava N, Abadia E, de Beer J, Tadumadze N, Akhalaia M, Tuin K, Tukvadze N, Aspindzelashvili R, Bachiyska E, Panaiotov S, Sola C, van Soolingen D, Klatser P, Anthony R, Bergval I. Optimizing multiplex SNP-based data analysis for genotyping of Mycobacterium tuberculosis isolates. BMC Genomics. 2014 Jul 7; 15:572

Gomgnimbou MK, Hernández-Neuta I, Panaiotov S, Bachiyska E, Palomino JC, Martin A, del Portillo P, Refregier G, Sola C. Tuberculosis-spoligo-rifampin-isoniazid typing: an all-in-one assay technique for surveillance and control of multidrug-resistant tuberculosis on Luminex devices. Journal of Clinical Microbiology 2013 Nov; 51(11):3527-34

Bergval, I., Sengstake, S., Brankova, N., Levterova, V., Abadia, E., Tadumaze, N., Bablishvili, N., Akhalaia, M., Tuin, K., Schuitema, A., Panaiotov, S., Bachiyska, E., Kantardjiev, T., de Zwaan, R., Schurch, A., van Soolingen, D., van 't Hoog, A., Cobelens, F., Aspindzelashvili, R., Sola, C., Klatser, P. & Anthony, R. Combined species identification, genotyping, and drug resistance detection of Mycobacterium tuberculosis cultures by MLPA on a bead-based array. PLoS One 2012 7, e43240.

Методы, основанные на ПЦР с детекцией в режиме реального времени (ПЦР-РВ) (I), наиболее эффективны для идентификации, в т.ч. количественной, микобактерий туберкулезного комплекса в клинических образцах. Однако, данные подходы ограниченно применимы для одновременной идентификации большого (>100) количества однонуклеотидных полиморфизмов в геноме, что требуется при анализе детерминант лекарственной устойчивости и генотипирования возбудителя туберкулеза. Для анализа каждой мутации требуется индивидуальная пробирка (лунка планшета), соответственно, при одновременном определении ~100 мутаций в одном образце ДНК, как требуется при анализе ДНК пациента на ШЛУ ТБ, потребуется соответствующее количество пробирок (лунок), без учета положительного контроля. Принимая во внимание время проведения ПЦР-РВ - не менее 1,5 часов, общее время, затрачиваемое на каждый образец с учетом выделения ДНК (не менее 1 часа) составит не менее 3 часов. Следующий образец ДНК будет также проанализирован за 1,5 часа, и т.д., таким образом, за рабочую смену (8 часов) при наличии только одного высокопроизводительного ДНК-амплификатора, использующего 384-луночный планшет, количество проанализированных образцов не превысит 5. Реальные потребности диспансеров оцениваются на уровне 30-ти пациентов в день. Именно по этой причине методики, основанные на ПЦР-РВ, выявляют ограниченный набор мутаций и неприменимы для одновременного выявления всего спектра мутаций в геноме микобактерий туберкулезного комплекса, приводящих к множественной и широкой лекарственной устойчивости, не говоря уже об одновременном генотипировании.

Рекомендованная ВОЗ автоматизированная система на основе сменных картриджей Xpert® MTB/RIF (II) компании Cepheid выявляет 10 наиболее распространенных мутаций в гене rpoB, ответственных за устойчивость к рифампицину, и не может быть применена для определения ШЛУ ТБ и установления клинически важных генотипов M. tuberculosis.

Коммерческий набор INNO-LiPA Rif.TB (III.I), базовым элементом которого является нитроцеллюлозная полоска («стрип») с иммобилизованными специфичными олигонуклеотидами, выявляет только мутации в гене rpoB, ответственные за устойчивость к рифампицину.

Наборы GenoType® MTBDRplus и GenoType® MTBDRsl (Hain lifescience, Германия) (III.II), также использующие стрипы с иммобилизованными зондами, выявляют соответственно 10 генетических детерминант устойчивости к рифампицину и изониазиду и 11 генетических детерминант устойчивости к фторхинолонам, канамицину, амикацину и этамбутолу. При этом для анализа одного образца на предмет выявления МЛУ и ШЛУ требуется не менее 2 раздельных тестов (по одному - системами GenoType® MTBDRplus и GenoType® MTBDRsl). Описанные технологии не позволяют устанавливать генотип возбудителя туберкулеза одновременно с анализом генетических детерминант лекарственной чувствительности.

Набор AID TB resistance line probe assay (III.III) выявляет генетические детерминанты МЛУ и ШЛУ-туберкулеза, однако, не позволяет проводить одновременное генотипирование возбудителя.

Наборы «ТБ-Биочип-1» и «ТБ-БИОЧИП-2» (IV.I), основанные на гидрогелевых олигонуклеотидных микрочипах низкой плотности, выявляют, соответственно, 48 генетических детерминант устойчивости к рифампицину/изониазиду и 9 генетических детерминант устойчивости к фторхинолонам. При этом для анализа одного образца требуется не менее 2 раздельных тестов (по одному - системами «ТБ-Биочип-1» и «ТБ-БИОЧИП-2»). Даже суммарный анализ каждого образца с использованием тест-систем «ТБ-Биочип-1» и «ТБ-БИОЧИП-2» не позволит выявить штаммы ТБ с широкой лекарственной устойчивостью. Более того, при анализе каждого образца ДНК требуются две последовательные стадии мультиплексной ПЦР с обязательным электрофоретическим контролем ПЦР-продуктов после каждой стадии, что приводит к усложнению процедуры и увеличению времени анализа.

Альтернативные методы, основанные на ДНК-микрочипах низкой плотности (IV.II), выявляют отдельные мутации, ответственные за устойчивость к рифампицину, изониазиду фторхинолонам, канамицину, амикацину, этамбутолу, стрептомицину, пиразинамиду, но не обеспечивают комплексного анализа генома возбудителя туберкулеза, включающего идентификацию детерминант устойчивости и генотипирование.

Микрочипы высокой плотности (IV.III) разработаны только для анализа мутаций в гене rpoB, более того, судя по последним тенденциям в области разработки молекулярно-генетических тестов, данная технология не нашла потребителей в клинической лабораторной диагностике туберкулеза.

Масс-спектрометрические методы (V), aнализ конформационного полиморфизма и гетеродуплексный анализ с применением капиллярного электрофореза (VI) и гибридизационные подходы с использованием нанолигандов (VII) обеспечивают идентификацию ограниченного набора мутаций в геноме M. tuberculosis, ассоциированных с лекарственной устойчивостью, но не позволяют проводить одновременное генотипирование.

Несмотря на быстрое развитие технологий секвенирования нового поколения (VIII), включая таргетное и полногеномное /метагеномное секвенирование, транскриптомное профилирование и др., эти методы остаются дорогостоящими и пока не применимы для массового параллельного анализа и/или скрининга клинического материала в условиях потоковых тестов (десятков и сотен образцов в день) клинико-диагностической лаборатории (Lohmann, K. & Klein, C. Next Generation Sequencing and the Future of Genetic Diagnosis. Neurotherapeutics 2014. DOI: 10.1007/s13311-014-0288-8).

Наконец, описанный метод мультиплексной лиганд-зависимой амплификации на микросферах (IX), несмотря на возможность одновременного генотипирования и идентификации детерминант устойчивости к широкому спектру препаратов, требует многостадийной процедуры подготовки образца (лигирование, амплификация, две последовательных очистки продуктов реакций) и сложной интерпретации результатов, что делает данный подход трудоемким и рекомендованным только для лабораторий, обладающих персоналом высокой квалификации.

Таким образом, в данной области существует острая потребность в разработке способа обнаружения ДНК возбудителя туберкулеза, с одновременным установлением клинически значимых генотипов и идентификацией мутаций, ассоциированных с множественной и широкой лекарственной устойчивостью, который бы выгодно отличался от известных из уровня техники решений простотой проведения анализа, высокими специфичностью и информативностью в отношении количества определяемых детерминант устойчивости, а также невысокой стоимостью.

Раскрытие изобретения

В результате проведенных обширных научных исследований, анализа баз данных нуклеотидных последовательностей NCBI http://www.ncbi.nlm.nih.gov/genome/genomes/166?subset=, Welcome Trust Sanger institute http://www.sanger.ac.uk/resources/downloads/bacteria/mycobacterium.html, TBDReaMDB (www.tbdreamdb.com), авторы настоящего изобретения обнаружили, что задача разработки способа обнаружения ДНК возбудителя туберкулеза, с одновременным установлением генотипа и идентификацией мутаций, ассоциированных с множественной и широкой лекарственной устойчивостью, может быть успешно решена путем использования олигонуклеотидных микрочипов (биочипов), содержащих олигонуклеотидные зонды, последовательности которых специфичны к фрагменту инсерционного элемента IS6110, характерного для возбудителя туберкулеза, однонуклеотидным полиморфизмам, устанавливающим принадлежность к генотипам Beijing, Haarlem, LAM, Ural, а также к мутантным вариантам генов rpoB, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, являющихся маркерами лекарственной устойчивости M. tuberculosis.

Заявляемый в настоящем изобретении способ выгодно отличается от известных из уровня техники методов возможностью идентификации возбудителя непосредственно в клиническом материале с одновременным установлением генотипов Beijing, Beijing B0/W148, Haarlem, LAM, Ural и определением 120 мутаций, определяющих устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу. Метод не требует дорогостоящего оборудования и высококвалифицированного персонала. Данные, полученные с помощью заявленного способа, могут быть использованы для персонифицированного выбора эффективных противотуберкулезных препаратов, выявления клинически значимых особо опасных форм возбудителя (например, семейства Beijing) и эпидемиологического генотипирования.

В своем первом аспекте данное изобретение обеспечивает способ обнаружения ДНК возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу. Способ основан на мультиплексной ПЦР с получением флуоресцентно-меченых фрагментов микобактериального генома с последующей гибридизацией этих фрагментов на олигонуклеотидном микрочипе, содержащем набор дифференцирующих олигонуклеотидов.

Способ предусматривает следующие стадии:

а) мультиплексную амплификацию генов rpoB, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, мобильного элемента IS6110, фрагментов микобактериального генома, содержащих генотип-специфичные однонуклеотидные полиморфизмы Rv0557, Rv0129c, Rv1811, Rv2629, Rv0118c, с одновременным флуоресцентным маркированием при использовании геномной ДНК микобактерий туберкулезного комплекса в качестве матрицы и набора праймеров, последовательности которых представлены SEQ ID NO: 1-36, с получением флуоресцентно-меченых фрагментов микобактериального генома.

б) обеспечение олигонуклеотидного микрочипа для идентификации ДНК микобактерии туберкулезного комплекса с одновременным установлением генотипов Beijing, Beijing B0, LAM, Haarlem, Ural и определением мутаций, ответственных за устойчивость возбудителя туберкулеза к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу, представляющий собой подложку, содержащую множество дискретных элементов, в каждом из которых иммобилизован уникальный олигонуклеотидный зонд, имеющий последовательность, комплементарную последовательности одноцепочечного фрагмента, полученного на стадии (а), и выбранную из группы, включающей: а) соответствующие последовательности фрагмента мобильного элемента IS6110; б) соответствующие последовательности фрагмента, включающего полиморфизм Rv0557, характерный для Евро-Американской линии; в) соответствующие последовательности фрагмента, включающего полиморфизм Rv0557, характерный для генотипа Haarlem, при установленной принадлежности к Евро-Американской линии; г) соответствующие последовательности фрагмента, включающего полиморфизм Rv0129c, характерный для генотипа LAM, при установленной принадлежности к Евро-Американской линии; д) соответствующие последовательности фрагмента, включающего полиморфизм Rv1811, характерный для генотипа Ural, при установленной принадлежности к Евро-Американской линии; е) соответствующие последовательности фрагмента, включающего полиморфизм Rv2629, характерный для семейства Beijing, при отсутствии принадлежности к Евро-Американской линии; ж) соответствующие последовательности фрагмента, включающего полиморфизм Rv0118c в гене oxcA, характерный для генотипа Beijing B0/W148 при установленном семействе Beijing; з) соответствующие последовательности фрагмента гена rpoB дикого типа; и) соответствующие последовательности фрагмента мутантного варианта гена rpoB, приводящего к устойчивости микроорганизмов к рифампицину; й) соответствующие последовательности фрагмента гена katG дикого типа; к) соответствующие последовательности фрагмента мутантного варианта гена katG, приводящего к устойчивости микроорганизмов к изониазиду; л) соответствующие последовательности фрагмента гена inhA дикого типа; м) соответствующие последовательности фрагмента мутантного варианта гена inhA, приводящего к устойчивости микроорганизмов к изониазиду; н) соответствующие последовательности фрагмента гена ahpC дикого типа; о) соответствующие последовательности фрагмента мутантного варианта гена ahpC, приводящего к устойчивости микроорганизмов к изониазиду; п) соответствующие последовательности фрагмента гена gyrA дикого типа; р) соответствующие последовательности фрагмента мутантного варианта гена gyrA, приводящего к устойчивости микроорганизмов к фторхинолонам; с) соответствующие последовательности фрагмента гена gyrB дикого типа; т) соответствующие последовательности фрагмента мутантного варианта гена gyrB, приводящего к устойчивости микроорганизмов к фторхинолонам; у) соответствующие последовательности фрагмента гена eis дикого типа; ф) соответствующие последовательности фрагмента мутантного варианта гена eis, приводящего к устойчивости микроорганизмов к канамицину, амикацину и капреомицину; х) соответствующие последовательности фрагмента гена rrs дикого типа; ц) соответствующие последовательности фрагмента мутантного варианта гена rrs, приводящего к устойчивости микроорганизмов к канамицину, амикацину и капреомицину; ч) соответствующие последовательности фрагмента гена embB дикого типа; ш) соответствующие последовательности фрагмента мутантного варианта гена embB, приводящего к устойчивости микроорганизмов к этамбутолу; при этом последовательности иммобилизованных олигонуклеотидных зондов представлены SEQ ID NO: 37-229;

(в) - гибридизацию амплифицированных флуоресцентно-меченых продуктов, полученных на стадии (а), на олигонуклеотидном микрочипе с образованием дуплексов с иммобилизованными зондами в условиях, обеспечивающих разрешение в один нуклеотид между образующимися в результате гибридизации совершенными и несовершенными дуплексами;

(г) - регистрацию результатов гибридизации на олигонуклеотидном микрочипе, проведенной на стадии (в) с использованием портативного анализатора флуоресценции и программного обеспечения, что позволяет использовать программную обработку интенсивностей сигналов с последующей интерпретацией результатов, которую проводят в два этапа: на первом этапе анализируют сигналы в ячейке микрочипа, содержащей олигонуклеотидный зонд, специфичный к фрагменту мобильного элемента IS6110, характерного для микобактерий туберкулезного комплекса, с целью обнаружения ДНК возбудителя туберкулеза; при наличии сигнала в данной ячейке, т.е. в случае обнаружения микобактериальной ДНК, на втором этапе одновременно анализируют элементы микрочипа, содержащие генотип-специфичные олигонуклеотидные зонды, исследующие полиморфизмы Rv0557, Rv0129c, Rv1811, Rv2629, Rv0118c, и элементы, в которых иммобилизованы олигонуклеотидные зонды для выявления мутаций в генах rpoB, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, тем самым устанавливая генотип возбудителя туберкулеза и определяя генетические детерминанты устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу.

В одном из своих воплощений способ характеризуется тем, что амплификацию фрагментов микобактериального генома проводят, используя ДНК, выделенную из материала клинического образца (мокроту, экссудат, бронхоальвеолярный лаваж, кровь) или предварительно выращенной культуры микроорганизма.

В следующем воплощении способ характеризуется тем, что на стадии (а) в для флуоресцентного маркирования получаемых ПЦР-фрагментов используют флуоресцентно меченый дезоксиуридинтрифосфат.

В еще одном из воплощений способ характеризуется тем, что на стадии (г) на втором этапе интерпретации результатов при анализе элементов микрочипа, содержащих генотип-специфичные олигонуклеотидные зонды, в случае установления дикого типа по полиморфизму Rv0557_321 штамм относят к Евро-Американской линии, с дальнейшей идентификацией генотипа Haarlem (по полиморфизму Rv0557_455), либо генотипа LAM (по полиморфизму Rv0129c), либо Ural (по полиморфизму Rv1811); при выявлении другого варианта полиморфизма Rv0557_321 штамм относят к иной, не Евро-Американской линии, с дальнейшей идентификацией семейства Beijing (по полиморфизму Rv2629), и определением генотипа B0/W148 для семейства Beijing (по полиморфизму Rv0118).

В еще одном из своих воплощений способ характеризуется на стадии (г) на втором этапе интерпретации результатов анализируют группы элементов, содержащих олигонуклеотидные зонды, специфичные к одному из генов rpob, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, tmbB; при этом каждая из групп включает элемент, содержащий зонд дикого типа, и элементы, содержащие зонды, соответствующие мутантным вариантам генов. Если максимальный сигнал в группе зарегистрирован в элементе, содержащем зонд дикого типа, то считают, что по данной аминокислотной/нуклеотидной позиции данного гена изучаемый образец ДНК возбудителя туберкулеза мутаций не имеет. Если максимальный сигнал в группе зарегистрирован в элементе, содержащем зонд, последовательность которого специфична для мутантного варианта одного из генов, то считают, что по данной аминокислотной/нуклеотидной позиции данного гена изучаемый образец ДНК возбудителя туберкулеза имеет аминокислотную/нуклеотидную замену, являющейся генетической детерминантой устойчивости.

Наконец, в еще одном своем воплощении способ дополнительно может включать подтверждение клинического диагноза «туберкулез», персонализированный выбор эффективных химиопрепаратов первого и второго ряда, установление клинически значимых генотипов и эпидемиологическое генотипирование на основе проведенной интерпретации результатов.

Краткий перечень фигур

Для более ясного понимания сущности заявленного изобретения, а также для демонстрации его характерных черт и преимуществ далее приводится подробное описание изобретения со ссылками на фигуры чертежей, на которых:

Фиг. 1. представляет схему размещения дискриминирующих олигонуклеотидов на биочипе.

Фиг. 2. Флуоресцентная картина гибридизации биочипа и результаты интерпретации при анализе ДНК лабораторного штамма M. tuberculosis H37Rv, чувствительного к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину/капреомицину, этамбутолу.

Фиг. 3. Флуоресцентная картина гибридизации биочипа и результаты интерпретации при анализе ДНК, выделенной из клинического образца, содержащего штамм M. tuberculosis генотипа Ural, обладающий устойчивостью к изониазиду.

Фиг. 4. Флуоресцентная картина гибридизации биочипа и результаты интерпретации при анализе ДНК, выделенной из клинического образца, содержащего штамм M. tuberculosis генотипа Beijing B0/W148, обладающего устойчивостью к рифампицину, изониазиду, этамбутолу.

Фиг. 5. Флуоресцентная картина гибридизации биочипа и результаты интерпретации при анализе ДНК, выделенной из клинического образца, содержащего штамм M. tuberculosis генотипа Beijing, обладающего устойчивостью к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину/капреомицину, этамбутолу.

Фиг. 6. Флуоресцентная картина гибридизации биочипа и результаты интерпретации при анализе ДНК, выделенной из клинического образца, содержащего штамм M. tuberculosis генотипа LAM, обладающего устойчивостью к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину/капреомицину, этамбутолу.

Фиг. 7. Флуоресцентная картина гибридизации биочипа и результаты интерпретации при анализе ДНК, выделенной из клинического образца, не содержащего микобактерий туберкулезного комплекса.

Осуществление изобретения

Задача настоящего изобретения состоит в создании способа обнаружения ДНК возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант множественной и широкой лекарственной устойчивости с помощью олигонуклеотидного микрочипа.

В заявленном способе предложено использование мультиплексной амплификации и флуоресцентного маркирования фрагментов микобактериального генома с получением флуоресцентно-меченых ПЦР-продуктов, при этом в качестве матрицы может быть использована геномная ДНК, выделенная из клинического образца, такого как, например, мокрота, промывные воды бронхов; бронхоальвеолярные смывы, материал, получаемый при бронхоскопии, транстрахеальной и внутрилегочной биопсии; аспират из бронхов; ларингеальные мазки; экссудаты; мазки из торакальных ран, а также культуры клеток микобактерий, полученные с жидкой и твердой сред. Заявленный способ также предусматривает использование оригинального олигонуклеотидного микрочипа с иммобилизованными специфическими олигонуклеотидными зондами, процедуры гибридизации, регистрации и интерпретации результатов, а также наборы праймеров и олигонуклеотидных зондов, используемые для осуществления способа.

Принципиальная схема анализа микобактериальной ДНК с целью идентификации микобактерий туберкулезного комплекса, установления генотипа возбудителя и определения генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу.

Клинический образец подвергают деконтаминации и лизису клеток с целью обеспечения доступа к геномной ДНК. Одним из пригодных способов является разжижение в щелочных условиях в присутствии N-ацетил-L-цистеина и кипячение с детергентом для обеспечения доступа к ДНК и деконтаминации образца (Kent, P. T., and G. P. Kubica. Public health mycobacteriology. A guide for level III laboratory. 1985 Centers for Disease Control and Prevention, Atlanta, GA). Для этих целей также могут быть использованы иные способы, известные специалистам в данной области, такие как разрушение клеток с помощью ультразвука (Padilla E, Gonzalez V, Manterola JM, et al. Evaluation of two different cell lysis methods for releasing mycobacterial nucleic acids in the INNO-LiPA mycobacteria test. Diagn Microbiol Infect Dis. 2003 May; 46(1):19-23), лизис при помощи гуанидина тиоцианата - саркозина (Chakravorty S, Tyagi JS. Novel use of guanidinium isothiocyanate in the isolation of Mycobacterium tuberculosis DNA from clinical material. FEMS Microbiology Letters 2001 Nov 27; 205(1):113-7.) и т.д. Очистка геномной ДНК после проведения лизиса может быть проведена с использованием автоматических роботизированных станций, например Freedom EVO® Clinical (Tecan Group Ltd., Германия), или коммерческих наборов, таких, например, как «ПРОБА-НК» (ООО «НПО «ДНК-Технология», Регистрационное удостоверение Росздравнадзора № ФСР 2008/02938), «Реагент в пробирках для выделения ДНК из биопроб с целью последующего анализа методом полимеразной цепной реакции (ДНК-ЭКСПРЕСС)» (ООО «НПФ «Литех», Регистрационное удостоверение Росздравнадзора ФСР 2007/00362), Комплект реагентов для выделения РНК/ДНК из клинического материала «РИБО-преп» по ТУ 9398-071-01897593-2008 (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Регистрационное удостоверение Росздравнадзора ФСР 2008/03147).

Полученный препарат микобактериальной геномной ДНК используют в качестве матрицы в мультиплексной ПЦР. В ходе амплификации происходит наработка фрагментов генов rpoB, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, мобильного элемента IS6110, фрагментов микобактериального генома, содержащих генотип-специфичные однонуклеотидные полиморфизмы Rv0557, Rv0129c, Rv1811, Rv2629, Rv0118c.

Праймеры для проведения мультиплексной ПЦР выбирают таким образом, чтобы они фланкировали регион гена или регуляторной области, где находятся наиболее часто встречающиеся мутации, приводящие к устойчивости микроорганизма к химиопрепаратам, либо генотип-специфичные однонуклеотидные полиморфизмы.. Используя специализированное программное обеспечение, например Oligo v. 6.3 (Molecular Biology Insights Inc., США) или Fast PCR (http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm) или другие коммерчески доступные программы, или программы, свободно доступные в сети Internet, рассчитывают температуры плавления праймеров и, варьируя их длину, добиваются того, чтобы разброс температур отжига праймеров внутри набора не превышал 3-4°C. При подборе праймеров избегают таких последовательностей, которые способны формировать вторичные структуры типа шпильки с высокими температурами плавления. При выборе праймеров для мультиплексной ПЦР избегают таких последовательностей, которые образуют между собой дуплексы, состоящие более чем из трех-пяти нуклеотидов. Каждый выбранный праймер должен обладать уникальной специфичностью в отношении анализируемого участка последовательности нуклеиновых кислот генома микобактерий туберкулезного комплекса. Специфичность праймеров проверяется с помощью программного обеспечения, использующего поиск в базах нуклеотидных последовательностей по алгоритму BLAST (например, www.ncbi.nlm.nih.gov/BLAST).

Для обеспечения эффективной амплификации с одновременным введением флуоресцентной метки во все вышеперечисленные сегменты микобактериального генома в едином реакционном объеме используют праймеры следующей конструкции. Последовательность каждого добавляемого в реакционную смесь праймера состоит из двух частей - 3′-специфичной, т.е. комплементарной последовательности фрагмента генома M. tuberculosis, и 5′-универсальной (адаптерной), различавшейся для прямых и обратных праймеров. Помимо таких праймеров, содержащих и специфические, и адаптерные последовательности, в реакционную смесь добавляют два праймера, последовательности которых комплементарны последовательностям адаптерной части составных праймеров (SEQ ID NO: 1, 2, Таблица 1). Данные адаптерные праймеры присутствуют в реакционной смеси в различных концентрациях, с целью наработки преимущественно одноцепочечных фрагментов, последовательности которых комплементарны последовательностям олигонуклеотидов, иммобилизованных на биочипе.

Расчетные температуры плавления специфичных и адаптерных последовательностей выбирают равными 70°C и 55°C, соответственно, а профиль амплификации включает две стадии по 30 циклов каждая, с температурами отжига 64°C на первой, и 50°C на второй стадии.

Таким образом, в ходе ПЦР в едином реакционном объеме на первой стадии за счет гибридизации и элонгации составных праймеров при использовании геномной ДНК в качестве матрицы происходит наработка двуцепочечных ПЦР-продуктов, содержащих на концах последовательности, специфичные к адаптерным праймерам, а затем, в ходе второй стадии, полученные ПЦР-продукты служат матрицей для наработки одноцепочечных фрагментов при использовании адаптерных праймеров с меньшей температурой отжига.

Флуоресцентное маркирование исследуемых фрагментов микобактериального генома проводят, добавляя в ПЦР-смесь флуоресцентный субстрат - конъюгат дезоксиуридинтрифосфата и красителя индодикарбоцианинового ряда, с длиной волны возбуждения, равной (640±5) нм и длиной волны флуоресценции, равной (665±5) нм (WO 2008127139. Indicyanine dyes and the derivatives thereof for analysing biological micromolecules). В ходе ПЦР данный субстрат встраивается Taq-ДНК-полимеразой в растущую цепь ДНК, обеспечивая на выходе флуоресцентно-меченые ПЦР-продукты, анализируемые далее посредством гибридизации на биочипе (Alexandrova LA, Jasko MV, Belobritskaya EE, Chudinov AV, Mityaeva ON, Nasedkina TV, Zasedatelev AS, Kukhanova MK. New triphosphate conjugates bearing reporter groups: labeling of DNA fragments for microarray analysis. Bioconjugate Chemistry 2007 18(3):886-93).

При выборе дискриминирующих олигонуклеотидов для иммобилизации на биочипе с учетом размера и сложности анализируемой последовательности и, в частности, наличия повторов и протяженных гомополимерных последовательностей определяют длину дискриминирующих олигонуклеотидов, обеспечивающую их специфичность в отношении анализируемой последовательности. Для каждой позиции, для которой известны мутации либо однонуклеотидный полиморфизм, подбирают набор специфичных дискриминирующих олигонуклеотидов, способный выявлять известные варианты замен. Используя программное обеспечение, например Oligo v. 6.3 (Molecular Biology Insights Inc., США), рассчитывают температуры плавления олигонуклеотидов и, варьируя их длину, добиваются того, чтобы разброс температур плавления олигонуклеотидов составлял не более 2-3°C. Избегают таких олигонуклеотидов, которые способны формировать вторичные структуры типа шпильки с высокими температурами плавления. Положение определяемых вариабельных нуклеотидов и других нуклеотидных перестроек выбирают по возможности не далее 1-4 нуклеотида от середины соответствующего дискриминирующего олигонуклеотида.

Дискриминирующие олигонуклеотиды иммобилизуют в гелевых элементах, которые наносятся на подложку формата предметного стекла в виде капель диаметром от 50 до 100 мкм с периодом 50-100 мкм, без использования специальных приспособлений, например, кварцевых масок. В качестве материала подложки используют полимеры (полипропилен, полиэтилен, полибутилентерефталат, полиметакрилат, поликарбонат, полистирол), либо стекло. Под действием ультрафиолетового излучения происходит совместная полимеризация олигонуклеотидов с основными компонентами геля. В результате этой реакции иммобилизуемые молекулы ковалентно присоединяются к мономерам растущей полимерной цепи и равномерно распределяются во всем объеме каждой гелевой ячейки (Rubina AY, Pankov SV, Dementieva EI et al. Hydrogel drop microchips with immobilized DNA: properties and methods for large-scale production. Analytical Biochemistry 2004; 325:92-106).

ПЦР-продукты, полученные на стадии ПЦР, гибридизуют на дифференцирующем биочипе с иммобилизованными олигонуклеотидами, комплементарными последовательностям изучаемых на предмет наличия мутаций генов, фрагмента инсерционного элемента IS6110, фрагментов, содержащих генотип-специфичный однонуклеотидный полиморфизм. Гибридизацию проводят в растворе, содержащем буферный компонент для поддержания рН, соль для создания ионной силы и хаотропный (дестабилизирующий водородные связи) агент, в герметичной гибридизационной камере при температуре, зависящей от температуры плавления иммобилизованных на микрочипе дискриминирующих олигонуклеотидов. В качестве дестабилизирующего водородные связи агента могут быть использованы, например, гуанидин тиоцианат, мочевина или формамид. Выбор оптимальной температуры гибридизации проводят с учетом удобства практического применения системы. Дискриминирующие олигонуклеотиды, заявленные в настоящем изобретении, имеют температуру плавления в интервале от 42 до 44°C, что позволяет проводить гибридизацию при 37°C с использованием хаотропного агента. Температура 37°C удобна тем, что большинство клинических лабораторий оснащены термостатами, поддерживающими эту температуру.

Анализируемые фрагменты ДНК образуют совершенные гибридизационные дуплексы только с соответствующими (полностью комплементарными) олигонуклеотидами. Со всеми остальными олигонуклеотидами изучаемые фрагменты ДНК дают несовершенный дуплекс. Дискриминацию совершенных и несовершенных дуплексов выполняют путем сравнения интенсивностей флуоресценции ячеек, в которых образовались дуплексы. Интенсивность сигнала в ячейке, в которой образовался совершенный гибридизационный дуплекс (Iсов) выше, чем в таковой, где образовался несовершенный дуплекс (Iнесов). Проведение гибридизации при оптимальных условиях (температура, подобранная концентрация хаотропного агента и ионная сила гибридизационного буфера) позволяет добиться соотношения Iсов/ Iнесов ≥ 2 между двумя ячейками, содержащими зонды, принадлежащие одной группе, и различающиеся на один нуклеотид.

Используя схему расположения олигонуклеотидов на биочипе (Фиг. 1), определяют наличие ДНК возбудителя туберкулеза на основании наличия сигнала в ячейке, содержащей зонд IS, специфичный к фрагменту IS6110, характерному только для микобактерий туберкулезного комплекса. Интерпретация результата в данной группе основана на соотношении сигнала IIS в ячейке IS со средним сигналом I<0> в ячейках сравнения ′0′, не содержащие иммобилизованных олигонуклеотидов. Если данной группы выполняется соотношение IIS/ I<0> ≥ 4, то считают, что в анализируемом образце обнаружена ДНК, принадлежащая микобактериям туберкулезного комплекса.

Установление генотипа возбудителя основано на сравнении сигналов в группах ячеек, содержащих олигонуклеотиды, последовательности которых комплементарны фрагментам, содержащим генотип-специфические однонуклеотидные полиморфизмы Rv0557, Rv0129c, Rv1811, Rv2629, Rv0118c. Для идентификации полиморфизма Rv0557 предназначены ячейки t321, 321c, 455, 455c; Rv0129 - g309, 309a; Rv1811 - g12, 12a; Rv2629 - a191, 191c; Rv0118c - g757, 757t (Фиг. 1). Интенсивности сигналов внутри данных групп ячеек сравнивают и в случае, если максимальный сигнал в одной из ячеек превосходит сигналы в других более чем в 2 раза, т.е. выполняется соотношение Iсов/ Iнесов ≥ 2 между ячейками, принадлежащими одной группе, делают следующие заключения:

- в случае установления дикого типа по полиморфизму Rv0557_321 штамм относят к Евро-Американской линии, с дальнейшей идентификацией генотипа Haarlem (по полиморфизму Rv0557_455G>C), либо генотипа LAM (по полиморфизму Rv0129c_309G>A), либо Ural (по полиморфизму Rv1811_12G>A);

- при выявлении замены T>C полиморфизма Rv0557_321 штамм относят к иной, не Евро-Американской линии, и при наличии полиморфизма Rv2629_191A>C определяют семейство Beijing.

- в случае выявления семейства Beijing, анализируют ячейки g757, 757t. При выявлении замены Rv0118c G>T в гене oxcA устанавливают генотип B0/W148 для семейства Beijing.

В каждой из групп ячеек, содержащих олигонуклеотиды, специфичные к одному из генов rpob, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, присутствует ячейка, содержащая зонд дикого типа (обведена толстой линией на Фиг. 1) и ячейки, содержащие зонды на возможные мутации. Для каждой группы ячеек регистрируют максимальный сигнал, превосходящий остальные более чем в 2 раза (проверяется соотношение Iсов/Iнесов ≥ 2). Если максимальный сигнал зарегистрирован в ячейке, соответствующей ДНК без мутаций (т.е. принадлежащей микроорганизму, чувствительному к лекарственному препарату), то считают, что по данной аминокислотной/нуклеотидной позиции (группе ячеек) изучаемый образец мутаций не имеет. Если максимальный сигнал зарегистрирован в ячейке, соответствующей ДНК с мутацией (мутациями) (т.е. принадлежащей микроорганизму, устойчивому к лекарственному препарату), то считают, что по данной аминокислотной/нуклеотидной позиции (группе ячеек) изучаемый образец имеет аминокислотную/нуклеотидную замену, приводящую к возникновению резистентности. Изучаемый образец ДНК признается принадлежащим к чувствительному штамму микобактерий, если по каждой вариабельной аминокислотной/нуклеотидной позиции (группе ячеек) образец охарактеризован как чувствительный. Изучаемый образец ДНК признается принадлежащим к устойчивому штамму микобактерий, если как минимум по одной вариабельной аминокислотной / нуклеотидной позиции (группе ячеек) образец охарактеризован как имеющий мутацию, приводящую к возникновению резистентности. Для таких образцов дополнительно выясняют тип препарата, к которому обнаружена устойчивость, установив группу, по которой образец отнесен к резистентному типу.

Данный алгоритм может быть реализован в программном обеспечении, позволяющем проводить автоматическую регистрацию и интерпретацию результатов, посредством захвата флуоресцентной картины гибридизации, вычисления сигнала в каждой ячейке, сравнения сигналов внутри групп и выдачи отчета о наличии в анализируемом образце ДНК возбудителя туберкулеза, его генотипе и отсутствии/наличии детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу.

Полученные результаты могут быть использованы для подтверждения клинического диагноза «туберкулез» (при наличии соответствующей клинической картины и присутствию в образце ДНК микобактерий туберкулезного комплекса), для персонализированного назначения спектра эффективных химиопрепаратов, для которых было показано отсутствие генетических детерминант устойчивости, для выявления клинически значимых генотипов возбудителя, например Beijing и Beijing B0, характеризующихся повышенной вирулентностью и трансмиссивностью, и, наконец, для эпидемиологического генотипирования, включающего определение наиболее распространенных на территории РФ генотипов Haarlem, LAM, Ural, Beijing, Beijing B0.

Далее изобретение будет проиллюстрировано примерами, которые предназначены для обеспечения лучшего понимания сущности заявленного изобретения, но не должны рассматриваться как ограничивающие данное изобретение.

Примеры

Пример 1. Обработка клинического образца и выделение ДНК. Проведение мультиплексной ПЦР и гибридизации на олигонуклеотидном микрочипе. Регистрация и интепретация результатов гибридизации.

Обработка клинического образца и выделение ДНК.

1. Клинический образец (мокрота, экссудат, смыв, бронхоальвеолярный лаваж, кровь и т.д.) смешивали в соотношении 1:1 по объему со свежеприготовленным 0,5% раствором N-ацетил-L-цистеина (NALC) в 2% NaOH. Образец тщательно перемешивали на вортексе и выдерживали при комнатной температуре в течение 20 мин. К образцу добавляли фосфатный буфер рН 6,8 в соотношении 1:5 по объему и центрифугировали в течение 30 мин при 3000 об/мин. При использовании спинномозговой жидкости проводили предварительное центрифугирование в течение 10 мин при 10000 об/мин. При анализе крови предварительно выделяли лимфоцитарную фракцию по общепринятой методике с использованием фиколла. Дальнейшая обработка образцов проводилась одинаково.

2. Осадок клеток суспендировали в 1,5 мл ТЕ буфера (10 мМ Трис-HCl, 1 мМ ЭДТА), рН 8,0 и осаждали при 3000 об/мин в течение 30 мин. Отмывку повторяли еще раз.

3. К полученному осадку добавляли 30 мкл ТЕ буфера, рН 8,0, содержавшего 1% (об./об.) Тритон Х-100 и выдерживали в сухом термостате при 95°C в течение 30 мин.

4. Образец центрифугировали при 10000 об/мин в течение 10 мин.

5. Дальнейшую очистку ДНК проводили с использованием набора «ПРОБА-НК» (ООО «НПО «ДНК-Технология») согласно инструкции производителя. Полученный раствор ДНК в объеме 50 мкл пригоден для проведения мультиплексной ПЦР.

Проведение мультиплексной ПЦР.

Для каждого анализируемого образца готовили 2 стерильные пробирки вместимостью 0,2 мл для проведения ПЦР, маркируя их «N1» и «N2», где N - номер анализируемого образца.

Состав ПЦР-смеси в пробирке N1

- 1Х ПЦР-буфер для HS Taq ДНК полимеразы (ЗАО «Евроген», Россия»);

- 200 мкM каждого dATP, dCTP, dGTP, dUTP (Евроген);

- 1 мкм флуоресцентного субстрата IMD515-dUTP (ООО «БИОЧИП-ИМБ», Россия)

- Смесь праймеров ПР-1. Последовательности праймеров и их концентрации в смеси ПР-1 представлены в Таблице 1.

- 5 ед. HS Taq ДНК полимеразы (ЗАО «Евроген», Россия»);

Состав ПЦР-смеси в пробирке N2

- 1Х ПЦР-буфер для HS Taq ДНК полимеразы (ЗАО «Евроген», Россия»);

- 200 мкM каждого dATP, dCTP, dGTP, dUTP (Евроген);

- 1 мкм флуоресцентного субстрата IMD515-dUTP (ООО «БИОЧИП-ИМБ», Россия)

- Смесь праймеров ПР-2. Последовательности праймеров и их концентрации в смеси ПР-2 представлены в Таблице 1.

- 5 ед. HS Taq ДНК полимеразы (ЗАО «Евроген», Россия»);

В 30 мкл ПЦР-смесей N1 и N2 вносили 3 мкл раствора ДНК, полученного в п.5 процедуры обработки клинического образца и выделения ДНК.

Таблица 1
Перечень последовательностей и концентраций праймеров, используемых в реакционных смесях стадии мультиплексной ПЦР заявляемого способа
Seq ID No Название праймера Последовательность 5'-3' Ген / мишень Реакционная смесь Концентрация в реакционной смеси, мкмоль
1 lm_fa CTCTGCGAGCATAATG адаптер ПР-1, ПР-2 100
2 lm_ra GGCTGTACGCTGTC адаптер ПР-1, ПР-2 2000
3 rpoB..F CTCTGCGAGCATAATGAGTGAGACGGGTGCACGTCGCGGACCT rpoB ПР-1 50
4 rpoB..R GGCTGTACGCTGTCCGTGGAGGCGATCACACCGCAGACGTTG rpoB ПР-1 50
5 ahpC..F CTCTGCGAGCATAATGATGGTGTGATATATCACCTTTGCCTGACAGC ahpC ПР-1 50
6 ahpC..R GGCTGTACGCTGTCTGACTCTCCTCATCATCAAAGCGGACA ahpC ПР-1 50
7 katG..F CTCTGCGAGCATAATGTGGAAGAGCTCGTATGGCACCGGAACC katG ПР-1 40
8 katG..R GGCTGTACGCTGTCGCTCTCCGTCAGCTCCCACTCGTAGCC katG ПР-1 40
9 inhA..F CTCTGCGAGCATAATGCCGGAAATCGCAGCCACGTTACGC inhA ПР-1 30
10 inhA..R GGCTGTACGCTGTCGGTAACCAGGACTGAACGGGATACGAA inhA ПР-1 30
11 IS6110..F CTCTGCGAGCATAATGAGGATGGGGTCATGTCAGGTGGTTCATCGA IS6110 ПР-1 30
12 IS6110..R GGCTGTACGCTGTCGCGAAGAAAGCCGACGCGGTCTTTAAAATC IS6110 ПР-1 30
13 embB (296) F CTCTGCGAGCATAATGCCCTGACCGACGCCGTGGTGATATTCG embB ПР-1 30
14 embB (328) R GGCTGTACGCTGTCCGCCAGCAGGTTGTAATACCAGCCGAAGG embB ПР-1 30
15 embB (354) F CTCTGCGAGCATAATGCGACGCCAGTCTGTGGATGCGCCTG embB ПР-2 50
16 embB (406) R GGCTGTACGCTGTCGGACCGCTCGATCAGCACATAGGTGACCA embB ПР-2 50
17 embB (497) F CTCTGCGAGCATAATGCCGTCATCCTGACCGTGGTGTTCGCC embB ПР-2 50
18 embB (497) R GGCTGTACGCTGTCCGCGAACCCTGGTGGCTTCCAACAC embB ПР-2 50
19 gyrA..F CTCTGCGAGCATAATGGGAGGTGCGCGACGGGCTCAAGC gyrA ПР-1 100
20 gyrA..R GGCTGTACGCTGTCCCAGCGGGTAGCGCAGCGACCA gyrA ПР-1 100
21 gyrB..F CTCTGCGAGCATAATGCAAGGCTGTGTCCTCGGCGCAAGCC gyrB ПР-1 50
22 gyrB..R GGCTGTACGCTGTCCGGTGCCCAGCGCCGTGATGAT gyrB ПР-1 50
23 rrs..F CTCTGCGAGCATAATGTCTCAGTTCGGATCGGGGTCTGCAACTCG rrs ПР-1 100
24 rrs..R GGCTGTACGCTGTCCCAGTTGGGGCGTTTTCGTGGTGCTCC rrs ПР-1 100
25 eis..F CTCTGCGAGCATAATGGCGAAATTCGTCGCTGATTCTCGCAGTGGC eis ПР-1 50
26 eis..R GGCTGTACGCTGTCCCCGGCCAGTCGTCCTCGGTCG eis ПР-1 50
27 Rv0129..F CTCTGCGAGCATAATGGCGGTCTACCTGCTCGACGGTCTGCG Rv0129c ПР-2 50
28 Rv0129..R GGCTGTACGCTGTCGCCGCCCACGGGCATGATCACC Rv0129c ПР-2 50
29 Rv0557..F CTCTGCGAGCATAATGCCGGATGTCGTGCATCTGGCGTCGC Rv0557 ПР-2 50
30 Rv0557..R GGCTGTACGCTGTCGGACGGCGCCAGAGTGCGGTCAG Rv0557 ПР-2 50
31 Rv1811..F CTCTGCGAGCATAATGGCTGCCGTGGCCGTCTTGCGATCG Rv1811 ПР-2 50
32 Rv1811..R GGCTGTACGCTGTCGCAACCCACTCCGACGGCCAGCC Rv1811 ПР-2 50
33 Rv2629..F CTCTGCGAGCATAATGGCCGCGACGCGAAGCAGGAGCTC Rv2629 ПР-2 50
34 Rv2629..R GGCTGTACGCTGTCAGATGCTCGTTGACCAGTACTTGCTCGCC Rv2629 ПР-2 50
35 oxcA..F CTCTGCGAGCATAATGGCCGGCACCGGAGGCGATTGATCG oxcA/Rv0118c ПР-2 50
36 oxcA..R GGCTGTACGCTGTCGCGGGTGTGAGTCGGGCAGCAGC oxcA/Rv0118c ПР-2 50

Мультиплексную ПЦР проводили на программируемом термостате S1000 (Bio-Rad, CША) согласно температурному режиму, приведенному в Таблице 2.

Таблица 2
Температурно-временной режим стадии ПЦР
Шаг программы Температура Время инкубации Количество циклов
1 +95°С (предварительная денатурация ДНК) 4 мин 1
2 +95°С (денатурация ДНК) 30 с 40
+64°С (отжиг праймеров) 30 с
+72°С (достройка праймеров) 30 с
3 +95°С (денатурация ДНК) 30 с 40
+50°С (отжиг праймеров) 30 с
+72°С (достройка праймеров) 30 с
4 +72°С (завершающая инкубация) 5 мин 1

Проведение гибридизации и отмывки на биочипе.

В пробирку объемом 0,5 мл вносили 7,5 мкл гибридизационного буфера (1,5М гуанидинтиоцианата, 75 мМ буфера HEPES рН 7,5, 7,5 мМ ЭДТА). Вносили 17,5 мкл реакционной смеси из пробирки N1, затем 5 мкл из пробирки с индексом N2 после стадии ПЦР. Полученную смесь перемешивали на вортексе, капли собирали центрифугированием в течение 10 с при 1000 g.

30 мкл полученной гибридизационной смеси вносили в одно из отверстий реакционной камеры биочипа.

Гибридизацию проводили при 37°C в течение 6-12 часов. По окончании гибридизации биочип трижды промывали дистиллированной водой при 37°C, снимали гибридизационную камеру и высушивали биочип в потоке воздуха.

Регистрация и интерпретация результатов гибридизации.

Регистрацию флуоресцентного изображения микрочипа выполняли на универсальном аппаратно-программном комплексе (УАПК) (ООО «БИОЧИП-ИМБ», Россия) для анализа биологических микрочипов с использованием специализированного программного обеспечения ′ImageWare®′ (ООО «БИОЧИП-ИМБ»).

Интерпретацию результатов проводили согласно приведенному выше алгоритму, реализованному в модуле программного обеспечения для анализа флуоресцентных изображений микрочипов ′Imageware®′.

Пример 2. Олигонуклеотидный микрочип для выявления ДНК возбудителя туберкулеза с одновременным установлением генотипа возбудителя и определением генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, амингликозидам, капреомицину, этамбутолу.

Синтез олигонуклеотидов проводили на автоматическом синтезаторе ABI-394 DNA/RNA synthesizer («Applied Biosystems», США) с использованием стандартного фосфорамидитного метода и очищали методом обращенно-фазовой ВЭЖХ (комплекс «Gilson», Франция). Олигонуклеотиды для иммобилизации в элементах микрочипа содержали спейсер со свободной аминогруппой, введенной в процессе синтеза с использованием 5′-Amino-Modifier C6 («Glen Research», США).

Иммобилизацию олигонуклеотидов на подложке биочипа в формате предметного стекла проводили, как было описано ранее (Pan'kov SV, Chechetkin VR, Somova OG, Antonova OV, Moiseeva OV, Prokopenko DV, Yurasov RA, Gryadunov DA, Chudinov AV. Kinetic effects on signal normalization in oligonucleotide microchips with labeled immobilized probes. Journal of Biomolecular Structure and Dynamics. 2009 27(2):235-44).

Схема биочипа представлена на Фиг. 1. содержал 203 гелевых элемента, включая 193 ячейки с иммобилизованными олигонуклеотидами, 7 ячеек пустого геля с индексом '0', выполняющих роль отрицательного контроля и необходимых для вычисления фонового флуоресцентного сигнала и 3 ячейки с индексом «M», содержащие ковалентно связанный флуоресцентный краситель и использующиеся для автоматического вычисления интенсивности флуоресценции ячеек биочипа после гибридизации.

Биочип позволяет идентифицировать ДНК микобактерий туберкулезного комплекса (олигонуклеотид в ячейке IS), устанавливать принадлежность к Евро-Американской линии и определять генотипы Haarlem, LAM, Ural, Beijing, Beijing B0, и выявлять, суммарно, 120 генетических детерминант лекарственной устойчивости, в том числе:

- 28 мутаций в гене rpoB, ответственных за устойчивость к рифампицину;

- 11 мутаций в гене katG, 5 мутаций в гене inhA, 5 мутаций в гене ahpC, приводящих к устойчивости к изониазиду;

- 15 мутаций в гене gyrA, 23 мутации в гене gyrB, ответственных за устойчивость к фторхинолонам;

- 4 мутации в гене rrs, 6 мутаций в гене eis, приводящих к устойчивости к канамицину, амикацину и капреомицину;

- 23 мутации в гене embB, ответственные за устойчивость к этамбутолу.

Ячейки, содержащие олигонуклеотиды для выявления детерминант лекарственной устойчивости, объединены в группы, соответствующие вариабельным аминокислотным остаткам или нуклеотидам в регуляторных областях генов. В каждой из групп присутствует элемент, содержащий олигонуклеотид, способный формировать совершенный гибридизационный дуплекс с ДНК, не имеющей мутаций (т.е. с ДНК дикого типа (WT)), в позициях, соответствующих следующим аминокислотным остаткам или нуклеотидам в регуляторных областях генов (такие ячейки обведены толстой линией на Фиг.1). Остальные ячейки в группе содержат зонды, специфичные к различным мутациям, приводящим к замене аминокислоты или нуклеотида. Такие зонды формируют несовершенные гибридизационные дуплексы с ДНК дикого типа.

Перечень последовательностей олигонуклеотидов, иммобилизованных на биочипе, приведен в Таблице 3.

Таблица 3
Перечень последовательностей олигонуклеотидов, иммобилизованных на биочипе
SEQ ID No Название зонда в соответствии с Фиг.1 Ген / мишень Назначение зонда Последовательность 5'- 3'
37 507 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 507, дикий тип TGGCTGGTGCCGAAGA
38 507 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 507, делеция CTCAGCTGGCTGAAGAA
39 L511 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 511, дикий тип TTGGCTCAGCTGGCTG
40 511P rpoB Зонд для идентификации мутаций в гене rpoB, кодон 511, замена L>P TTGGCTCGGCTGGCT
41 511R rpoB Зонд для идентификации мутаций в гене rpoB, кодон 511, замена L>R TTGGCTCCGCTGGCT
42 S512 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 512, дикий тип AATTGGCTCAGCTGGC
43 512T rpoB Зонд для идентификации мутаций в гене rpoB, кодон 512, замена S>T AATTGGGTCAGCTGG
44 512R rpoB Зонд для идентификации мутаций в гене rpoB, кодон 512, замена S>R AATTGGCGCAGCTG
45 N513 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 513, дикий тип TCCATGAATTGGCTCAGCT
46 513L rpoB Зонд для идентификации мутаций в гене rpoB, кодон 513, замена N>L CATGAATAGGCTCAGCT
47 513K rpoB Зонд для идентификации мутаций в гене rpoB, кодон 513, замена N>K CATGAATTTGCTCAGCT
48 513G rpoB Зонд для идентификации мутаций в гене rpoB, кодон 513, замена N>G CATGAATGGGCTCAGCT
49 D516 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 516, дикий тип TTGTTCTGGTCCATGAAT
50 516Y rpoB Зонд для идентификации мутаций в гене rpoB, кодон 516, замена D>Y TTGTTCTGGTACATGAAT
51 516G rpoB Зонд для идентификации мутаций в гене rpoB, кодон 516, замена D>G TTGTTCTGGCCCATGAAT
52 516V rpoB Зонд для идентификации мутаций в гене rpoB, кодон 516, замена D>V TTGTTCTGGACCATGAAT
53 516E rpoB Зонд для идентификации мутаций в гене rpoB, кодон 516, замена D>E TTGTTCTGCTCCATGAAT
54 516A rpoB Зонд для идентификации мутаций в гене rpoB, кодон 516, замена D>A TTGTTCTGGGCCATGAAT
55 S522 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 522, дикий тип TCAACCCCGACAGCG
56 522L rpoB Зонд для идентификации мутаций в гене rpoB, кодон 522, замена S>L TCAACCCCAACAGCG
57 H526 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, дикий тип GGCGCTTGTGGGTCAAC
58 526Y rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>Y GGCGCTTGTAGGTCAAC
59 526D rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>D GGCGCTTGTCGGTCAAC
60 526N rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>N GGCGCTTGTTGGTCAAC
61 526P rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>P GGCGCTTGGGGGTCAAC
62 526Q rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>Q GGCGCTTTTGGGTCAAC
63 526C rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>C GGCGCTTGCAGGTCAAC
64 526L rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>L GGCGCTTGAGGGTCAAC
65 526R rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>R GGCGCTTGCGGGTCAAC
66 526F rpoB Зонд для идентификации мутаций в гене rpoB, кодон 526, замена H>F GGCGCTTGAAGGTCAAC
67 S531 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 531, дикий тип CCAGCGCCGACAGTCGG
68 531L rpoB Зонд для идентификации мутаций в гене rpoB, кодон 531, замена S>L CCCAGCGCCAACAGTCGG
69 531C rpoB Зонд для идентификации мутаций в гене rpoB, кодон 531, замена S>C CCAGCGCACACAGTCGG
70 531W rpoB Зонд для идентификации мутаций в гене rpoB, кодон 531, замена S>W CCAGCGCCCACAGTCGG
71 531N rpoB Зонд для идентификации мутаций в гене rpoB, кодон 531, замена S>N CCAGCGCCTGCAGTCGG
72 L533 rpoB Зонд для идентификации мутаций в гене rpoB, кодон 533, дикий тип TGCCCCAGCGCCGACAG
73 L533P rpoB Зонд для идентификации мутаций в гене rpoB, кодон 533, замена L>P TGCCCCGGCGCCGACAG
74 S315 katG Зонд для идентификации мутаций в гене katG, кодон 315, дикий тип CGATCACCAGCGGCAT
75 315T(1) katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>T (вариант 1) CGATCACCACCGGCAT
76 315T(2) katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>T (вариант 2) CGATCACCACAGGCATC
77 315N katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>N GATCACCAACGGCATC
78 315I katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>I GATCACCATCGGCATC
79 315R(1) katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>R (вариант 1) GATCACCCGCGGCAT
80 315R(2) katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>R (вариант 2) ATCACCAGAGGCATCG
81 315G katG Зонд для идентификации мутаций в гене katG, кодон 315, замена S>G GATCACCGGCGGCAT
82 W328 katG Зонд для идентификации мутаций в гене katG, кодон 328, дикий тип CGAAATGGGACAACA
83 328G katG Зонд для идентификации мутаций в гене katG, кодон 328, замена W>G CGAAAGGGGACAACA
84 328L katG Зонд для идентификации мутаций в гене katG, кодон 328, замена W>L CGAAATTGGACAACAG
85 328C katG Зонд для идентификации мутаций в гене katG, кодон 328, замена W>C CGAAATGCGACAACA
86 I335 katG Зонд для идентификации мутаций в гене katG, кодон 335, дикий тип TCCTCGAGATCCTGTACG
87 335V katG Зонд для идентификации мутаций в гене katG, кодон 335, замена I>V TCCTCGAGGTCCTGTACG
88 t8 inhA Зонд для идентификации мутаций в гене inhA, позиция - 8, дикий тип GATAGGTTGTCGGGG
89 8a inhA Зонд для идентификации мутаций в гене inhA, позиция - 8, замена T>A GATAGGATGTCGGGG
90 8g inhA Зонд для идентификации мутаций в гене inhA, позиция - 8, замена T>G GATAGGGTGTCGGGG
91 c15 inhA Зонд для идентификации мутаций в гене inhA, позиция - 15, дикий тип CGGCGAGACGATAGG
92 15t inhA Зонд для идентификации мутаций в гене inhA, позиция - 15, замена C>T CGGCGAGATGATAGG
93 16g inhA Зонд для идентификации мутаций в гене inhA, позиция - 16, замена C>G GGCGAGGCGATAGG
94 g24 inhA Зонд для идентификации мутаций в гене inhA, позиция - 24, дикий тип CCGGCCGCGGCG
95 24t inhA Зонд для идентификации мутаций в гене inhA, позиция - 24, замена G>T CCGGCCTCGGCG
96 g6 ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 6, дикий тип GCACGATGGAATGTCGC
97 6a ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 6, замена G>A GCACGATAGAATGTCGCA
98 c10 ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 10, дикий тип TCACGGCACGATGGAA
99 10t ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 10, замена С>T TCACGGCATGATGGAA
100 10a ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 10, замена С>A TCACGGCAAGATGGAA
101 g9 ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 9, дикий тип CACGGCACGATGGAAT
102 9a ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 9, замена G>A CACGGCACAATGGAAT
103 c12 ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 12, дикий тип CTTCACGGCACGATGG
104 12t ahpC Зонд для идентификации мутаций в гене ahpC, позиция - 12, замена C>T ACTTCACGGTACGATGGA
105 IS IS6110 Зонд для идентификации ДНК микобактерий туберкулезного комплекса CCGGAGCTGCGTGAGCG
106 N296 embB Зонд для идентификации мутаций в гене embB, кодон 296, дикий тип GGCGCGAATTCGTCG
107 296H embB Зонд для идентификации мутаций в гене embB, кодон 296, замена N>H GCGCGCATTCGTCG
108 S297 embB Зонд для идентификации мутаций в гене embB, кодон 297, дикий тип CGCGAATTCGTCGGACG
109 297A embB Зонд для идентификации мутаций в гене embB, кодон 297, замена S>A CGCGAATGCGTCGGAC
110 M306 embB Зонд для идентификации мутаций в гене embB, кодон 306, дикий тип CCTGGGCATGGCCCGAG
111 306V embB Зонд для идентификации мутаций в гене embB, кодон 306, замена M>V CCTGGGCGTGGCCCGAG
112 306L embB Зонд для идентификации мутаций в гене embB, кодон 306, замена M>L CCTGGGCCTGGCCCGAG
113 306I1 embB Зонд для идентификации мутаций в гене embB, кодон 306, замена M>I (вариант 1) CCTGGGCATAGCCCGAG
114 306I2 embB Зонд для идентификации мутаций в гене embB, кодон 306, замена M>I (вариант 2) CCTGGGCATCGCCCGAG
115 306I3 embB Зонд для идентификации мутаций в гене embB, кодон 306, замена M>I (вариант 3) CCTGGGCATTGCCCGAG
116 V309 embB Зонд для идентификации мутаций в гене embB, кодон 309, дикий тип GCCCGAGTCGCCG
117 309F embB Зонд для идентификации мутаций в гене embB, кодон 309, замена V>S GCCCGATTCGCCGA
118 A313 embB Зонд для идентификации мутаций в гене embB, кодон 313, дикий тип GACCACGCCGGCTAC
119 313V embB Зонд для идентификации мутаций в гене embB, кодон 313, замена A>V CGACCACGTCGGCTACA
120 Y319 embB Зонд для идентификации мутаций в гене embB, кодон 319, дикий тип ATGTCCAACTATTTCCGCTGG
121 319C embB Зонд для идентификации мутаций в гене embB, кодон 319, замена Y>C ATGTCCAACTGTTTCCGCTG
122 319S embB Зонд для идентификации мутаций в гене embB, кодон 319, замена Y>S ATGTCCAACTCTTTCCGCTG
123 319D embB Зонд для идентификации мутаций в гене embB, кодон 319, замена Y>D ATGTCCAACGATTTCCGCTG
124 D328 embB Зонд для идентификации мутаций в гене embB, кодон 328, дикий тип CCCGGAGGATCCCTTCG
125 328Y embB Зонд для идентификации мутаций в гене embB, кодон 328, замена D>Y CCCGGAGTATCCCTTCGG
126 328G embB Зонд для идентификации мутаций в гене embB, кодон 328, замена D>G CCGGAGGGTCCCTTCG
127 D354 embB Зонд для идентификации мутаций в гене embB, кодон 354, дикий тип CCTACCAGACCTGGCCGCCGG
128 354A embB Зонд для идентификации мутаций в гене embB, кодон 354, замена D>A CCTACCAGCCCTGGCCGCGG
129 E378 embB Зонд для идентификации мутаций в гене embB, кодон 378, дикий тип GCGGTGGAGGCCAGCA
130 378A embB Зонд для идентификации мутаций в гене embB, кодон 378, замена E>A CGGTGGCGGCCAGC
131 G406 embB Зонд для идентификации мутаций в гене embB, кодон 406, дикий тип CCGGAGGGCATCATC
132 406A embB Зонд для идентификации мутаций в гене embB, кодон 406, замена G>A CCGGAGGCCATCATC
133 406D embB Зонд для идентификации мутаций в гене embB, кодон 406, замена G>D CCGGAGGACATCATCG
134 406C embB Зонд для идентификации мутаций в гене embB, кодон 406, замена G>C CCGGAGTGCATCATCG
135 406S embB Зонд для идентификации мутаций в гене embB, кодон 406, замена G>S CCGGAGAGCATCATCG
136 Q497 embB Зонд для идентификации мутаций в гене embB, кодон 457, дикий тип CGCCGACCAGACCCT
137 497R embB Зонд для идентификации мутаций в гене embB, кодон 457, замена Q>R CGCCGACCGGACCCT
138 497K embB Зонд для идентификации мутаций в гене embB, кодон 457, замена Q>K CGCCGACAAGACCCT
139 497P embB Зонд для идентификации мутаций в гене embB, кодон 457, замена Q>P CGCCGACCCGACCCT
140 H70 gyrA Зонд для идентификации мутаций в гене gyrA, кодон 70, дикий тип GACCGCAGCCACGCCAAGTCG
141 70R gyrA Зонд для идентификации мутаций в гене gyrA, кодон 70, замена H>R ACCGCAGCCGCGCCAAGTC
142 A74 gyrA Зонд для идентификации мутаций в гене gyrA, кодон 74, дикий тип CCAAGTCGGCCCGGTCGG
143 74S gyrA Зонд для идентификации мутаций в гене gyrA, кодон 74, замена A>S GCCAAGTCGTCCCGGTCGG
144 T80 gyrA Зонд для идентификации мутаций в гене gyrA, кодон 80, дикий тип TGCCGAGACCATGGGC
145 80A gyrA Зонд для идентификации мутаций в гене gyrA, кодон 80, замена T>A GCCGAGGCCATGGGC
146 G88 gyrA Зонд для идентификации мутаций в гене gyrA, кодон 88, дикий тип CCCGCACGGCGACGCG
147 88A gyrA Зонд для идентификации мутаций в гене gyrA, кодон 88, замена G>A CCCGCACGCCGACGCG
148 88C gyrA Зонд для идентификации мутаций в гене gyrA, кодон 88, замена G>C CCCGCACTGCGACGCG
149 A90 gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 90, 91, дикий тип CGACGCGTCGATCTACGA
150 90V gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 90, 91, замена A>V, дикий тип CGACGTGTCGATCTACGA
151 90G gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 90, 91, замена A>G, дикий тип CGACGGGTCGATCTACGA
152 90* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 90, 91, дикий тип, S>P CGACGCGCCGATCTACG
153 90V* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 90, 91, замены A>V, S>P CGACGTGCCGATCTACGA
154 90G* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 90, 91, замены A>G, S>P CGACGGGCCGATCTACG
155 D94 gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, дикий тип CGATCTACGACAGCCTG
156 94H gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>H CGATCTACCACAGCCTG
157 94A gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>A, дикий тип GATCTACGCCAGCCTG
158 94N gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>N, дикий тип TCGATCTACAACAGCCTG
159 94G gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>G, дикий тип GATCTACGGCAGCCTG
160 94Y gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>Y, дикий тип TCGATCTACTACAGCCTG
161 94V gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>V, дикий тип CGATCTACGTCAGCCTG
162 D94* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, дикий тип, замена S>T TCTACGACACCCTGGT
163 94H* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>H, замена S>T CGATCTACCACACCCTG
164 94A* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>A, замена S>T TCTACGCCACCCTGGT
165 94N* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>N, замена S>T TCGATCTACAACACCCTG
166 94G* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>G, замена S>T GATCTACGGCACCCTG
167 94Y* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>Y, замена S>T CGATCTACTACACCCTG
168 94V* gyrA Зонд для идентификации мутаций в гене gyrA, кодоны 94, 95, замена D>V, замена S>T CGATCTACGTCACCCTG
169 P102 gyrA Зонд для идентификации мутаций в гене gyrA, кодон 102, дикий тип GCCCAGCCCTGGTCGCT
170 102H gyrA Зонд для идентификации мутаций в гене gyrA, кодон 102, замена P>H GGCCCAGCACTGGTCGC
171 R485 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 485, дикий тип GCCGATTGCCGTTCCACG
172 485C gyrB Зонд для идентификации мутаций в гене gyrB, кодон 485, замена R>C GCCGATTGCTGTTCCACG
173 485H gyrB Зонд для идентификации мутаций в гене gyrB, кодон 485, замена R>H CCGATTGCCATTCCACG
174 485L gyrB Зонд для идентификации мутаций в гене gyrB, кодон 485, замена R>L GCCGATTGCCTTTCCACG
175 S486 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 486, дикий тип CGATTGCAGTTCCACGGATCCGC
176 486F gyrB Зонд для идентификации мутаций в гене gyrB, кодон 486, замена S>F CGATTGCAGTTTCACGGATCCGCG
177 D500 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 500, дикий тип GTAGAAGGTGACTCGGCCG
178 500H gyrB Зонд для идентификации мутаций в гене gyrB, кодон 500, замена D>H GTAGAAGGTCACTCGGCCG
179 500N gyrB Зонд для идентификации мутаций в гене gyrB, кодон 500, замена D>N CGTAGAAGGTAACTCGGCCG
180 500A gyrB Зонд для идентификации мутаций в гене gyrB, кодон 500, замена D>A TAGAAGGTGCCTCGGCCG
181 G509 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 509, дикий тип GCAAAAAGCGGTCGCGATTC
182 509C gyrB Зонд для идентификации мутаций в гене gyrB, кодон 509, замена G>C TGCAAAAAGCTGTCGCGATTC
183 509A gyrB Зонд для идентификации мутаций в гене gyrB, кодон 509, замена G>A GCAAAAAGCGCTCGCGATTC
184 I525 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 525, дикий тип CGGCAAGATCATCAATGTGGA
185 525L gyrB Зонд для идентификации мутаций в гене gyrB, кодон 525, замена I>L CGGCAAGATCCTCAATGTGG
186 D533 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 533, дикий тип GCGCATCGACCGGGTG
187 533A gyrB Зонд для идентификации мутаций в гене gyrB, кодон 533, замена D>A CGCATCGCCCGGGTG
188 N538 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 538, дикий тип GTGCTAAAGAACACCGAA
189 538D gyrB Зонд для идентификации мутаций в гене gyrB, кодон 538, замена N>D TGCTAAAGGACACCGAA
190 538Y gyrB Зонд для идентификации мутаций в гене gyrB, кодон 538, замена N>Y GTGCTAAAGTACACCGAAG
191 538K gyrB Зонд для идентификации мутаций в гене gyrB, кодон 538, замена N>K GTGCTAAAGAAAACCGAA
192 538T gyrB Зонд для идентификации мутаций в гене gyrB, кодон 538, замена N>T TGCTAAAGACCACCGAA
193 T539 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 539, дикий тип CTAAAGAACACCGAAGTTC
194 539I gyrB Зонд для идентификации мутаций в гене gyrB, кодон 539, замена T>I CTAAAGAACATCGAAGTTCA
195 539N gyrB Зонд для идентификации мутаций в гене gyrB, кодон 539, замена T>N GCTAAAGAACAACGAAGTT
196 539P gyrB Зонд для идентификации мутаций в гене gyrB, кодон 539, замена T>P CTAAAGAACCCCGAAGTT
197 E540 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 540, дикий тип AACACCGAAGTTCAGGC
198 540D(1) gyrB Зонд для идентификации мутаций в гене gyrB, кодон 540, замена E>D (вариант 1) AACACCGATGTTCAGGC
199 540D(2) gyrB Зонд для идентификации мутаций в гене gyrB, кодон 540, замена E>D (вариант 2) AACACCGACGTTCAGG
200 540V gyrB Зонд для идентификации мутаций в гене gyrB, кодон 540, замена E>V AACACCGTAGTTCAGGC
201 A543 gyrB Зонд для идентификации мутаций в гене gyrB, кодон 543, дикий тип AGTTCAGGCGATCATCA
202 543T gyrB Зонд для идентификации мутаций в гене gyrB, кодон 543, замена A>T AAGTTCAGACGATCATCA
203 543V gyrB Зонд для идентификации мутаций в гене gyrB, кодон 543, замена A>T AGTTCAGGTGATCATCA
204 1401 rrs Зонд для идентификации мутаций в гене rrs, позиция 1401, дикий тип CGCCCGTCACGTCATGAA
205 1401g rrs Зонд для идентификации мутаций в гене rrs, позиция 1401, замена C>G GCCCGTCGCGTCATGAA
206 1402t rrs Зонд для идентификации мутаций в гене rrs, позиция 1401, замена C>T CGCCCGTCATGTCATGAAA
207 1402a rrs Зонд для идентификации мутаций в гене rrs, позиция 1401, замена C>A CGCCCGTCAAGTCATGAAA
208 1484 rrs Зонд для идентификации мутаций в гене rrs, позиция 1484, дикий тип GATTGGGACGAAGTCGTAACA
209 1484t rrs Зонд для идентификации мутаций в гене rrs, позиция 1484, замена G>T GATTGGGACTAAGTCGTAACA
210 -10 rrs Зонд для идентификации мутаций в гене eis, позиция - 10, дикий тип GCATATGCCACAGTCGGATT
211 с-14t eis Зонд для идентификации мутаций в гене eis, позиция - 14, замена C>T GGCATATGCTACAGTCGGATT
212 a-13g eis Зонд для идентификации мутаций в гене eis, позиция - 13, замена A>G GCATATGCCGCAGTCGGATT
213 c-12t eis Зонд для идентификации мутаций в гене eis, позиция - 12, замена C>T GCATATGCCATAGTCGGATTC
214 g-10a eis Зонд для идентификации мутаций в гене eis, позиция - 10, замена G>A CATATGCCACAATCGGATTCTG
215 g-10c eis Зонд для идентификации мутаций в гене eis, позиция - 10, замена G>C ATATGCCACACTCGGATTCT
216 -35 eis Зонд для идентификации мутаций в гене eis, позиция - 35, дикий тип CGTAATATTCACGTGCACGTAGC
217 g-37t eis Зонд для идентификации мутаций в гене eis, позиция - 37, замена G>T TAATATTCACTTGCACGTAGCC
218 309 Rv0129c Зонд для идентификации генотипа LAM CGGCCTTCGAGGAGTACTACC
219 309a Rv0129c Зонд для идентификации генотипа LAM CGGCCTTCGAAGAGTACTACCA
220 321 Rv0557 Зонд для определения принадлежности к Евро-Американской линии TGGCTACGGTGGACTCCAT
221 321c Rv0557 Зонд для определения принадлежности к Евро-Американской линии GGCTACGGCGGACTCC
222 455 Rv0557 Зонд для идентификации генотипа Haarlem CACTTGCATCGCCTGGCT
223 455c Rv0557 Зонд для идентификации генотипа Haarlem CACTTGCATCCCCTGGCT
224 12 Rv1811 Зонд для идентификации генотипа Ural GCAAACGCTGACTGTCGC
225 g12a Rv1811 Зонд для идентификации генотипа Ural GCAAACGCTAACTGTCGCC
226 191 Rv2629 Зонд для идентификации генотипа Beijing GGTGCGGGATTCTCGACC
227 191c Rv2629 Зонд для идентификации генотипа Beijing TGCGGGCTTCTCGACC
228 g757 oxcA/Rv0118c Зонд для идентификации генотипа Beijing B0 ATGTCGATGGCCAAGGGG
229 757t oxcA/Rv0118c Зонд для идентификации генотипа Beijing B0 GATGTCGATGTCCAAGGGG

Пример 3. Анализ лабораторного штамма M. tuberculosis H37Rv, чувствительного к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину/капреомицину, этамбутолу.

Обработку культуры штамма M.tuberculosis H37Rv, выделение ДНК проводили, амплификацию исследуемых фрагментов микобактериального генома и гибридизацию на биочипе проводили согласно описанию в Примере 1.

Результаты гибридизации приведены на Фиг. 2.

Согласно алгоритму обработки результатов гибридизации, значение сигнала в ячейке IS превосходило средний фоновый сигнал более, чем в 4 раза. Следовательно, в данном образце установлено наличие ДНК микобактерий туберкулезного комплекса.

Анализ группы ячеек, с зондами, специфичными к полиморфизму Rv0557, показал наличие дикого типа, что означает, что штамм принадлежит к Евро-Американской линии. Анализ ячеек с зондами, специфичными к полиморфизмам Rv0557_455, Rv0129c, Rv1811, показал наличие дикого типа. Таким образом, для данного штамма установить генотип не удалось, что соответствует истине, поскольку штамм H37Rv является лабораторным и образует отдельную филогенетическую ветвь.

Анализ групп ячеек с зондами, специфичными к детерминантам устойчивости, показал, что в каждой группе совершенный гибридизационный дуплекс зарегистрирован в ячейке, соответствующей дикому типу. Таким образом, ни в одном из исследуемых фрагментов генома M. tuberculosis H37Rv мутации обнаружены не были, что означает чувствительность данного штамма к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу. Данный результат совпадает с микробиологическими данными о лекарственной чувствительности штамма M. tuberculosis H37Rv.

Пример 4. Анализ клинического образца, содержащего штамм M. tuberculosis генотипа Ural, обладающий устойчивостью к изониазиду.

Клинический образец (мокрота), полученный от пациента, с подтвержденным микроскопией наличием кислотоустойчивых бактерий (БК+), был разделен на 2 части, одна из которых после деконтаминации (N-ацетил-L-цистеин и NaOH) и нейтрализации была передана для микробиологических исследований. Идентификацию микобактерий туберкулезного комплекса проводили по результатам биохимических тестов (Kent PT, Kubica GP. Public health mycobacteriology. A guide for level III laboratory. Atlanta, GA: Centers for Disease Control and Prevention, 1985). Тесты на устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутиолу проводили с использованием автоматизированной системы Bactec MGIT 960 (Becton Dickinson, США). Вторую часть образца мокроты анализировали согласно изобретению, как описано в Примерeх 1 и 2.

На Фиг. 3 представлен результат анализа ДНК, выделенной из данного клинического образца, и исследованной согласно изобретению.

Согласно алгоритму обработки результатов гибридизации, значение сигнала в ячейке IS превосходило средний фоновый сигнал более, чем в 4 раза. Следовательно, в данном образце установлено наличие ДНК микобактерий туберкулезного комплекса.

Анализ группы ячеек, с зондами, специфичными к полиморфизму Rv0557, показал наличие дикого типа, что означает, что штамм принадлежит к Евро-Американской линии. Анализ группы ячеек с зондами, специфичными к полиморфизму Rv1811 (обведены пунктирной линией), показал наличие замены Rv1811_12G>A. Таким образом, генотип данного штамма был определен как Ural.

Анализ групп ячеек с зондами, специфичными к детерминантам устойчивости, показал, что в каждой группе ячеек, соответствующих вариабельной аминокислоте 315 в гене katG, совершенный гибридизационный дуплекс зарегистрирован в ячейке, соответствующей мутации Ser 315>Thr (вариант 1). Следовательно ДНК данного штамма содержит такую мутацию и штамм является устойчивым к изониазиду. В других группах ячеек совершенные гибридизационные дуплексы были зарегистрированы только в ячейках, соответствующих дикому типу. Таким образом, ни в одном из исследуемых фрагментов генов rpoB, gyrA, gyrB, eis, rrs, embB данного штамма мутации обнаружены не были, что означает чувствительность данного штамма к рифампицину, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу.

Микробиологическими и бихимическими тестами было подтверждено наличие в мокроте M. tuberculosis. Устойчивость к изониазиду была подтверждена культурально ростом на соответствующей специфической среде с изониазидом, при отсутствии роста на средах с другими препаратами. Таким образом, культуральный способ зафиксировал наличие в клиническом образце штамма M.tuberculosis, монорезистентного по изониазиду, что полностью совпадает с результатами, полученными способом настоящего изобретения.

Пример 5. Анализ клинического образца, содержащего штамм M. tuberculosis генотипа Beijing B0/W148, обладающий устойчивостью к рифампицину, изониазиду, этамбутолу.

Клинический образец (бронхоальвеолярный лаваж), полученный от пациента, с подтвержденным микроскопией наличием кислотоустойчивых бактерий (БК+), был разделен на 2 части, одна из которых после деконтаминации (N-ацетил-L-цистеин и NaOH) и нейтрализации была передана для микробиологических исследований. Идентификацию микобактерий туберкулезного комплекса проводили по результатам биохимических тестов (Kent PT, Kubica GP. Public health mycobacteriology. A guide for level III laboratory. Atlanta, GA: Centers for Disease Control and Prevention, 1985). Тесты на устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутиолу проводили с использованием автоматизированной системы Bactec MGIT 960 (Becton Dickinson, США). Вторую часть образца мокроты анализировали согласно изобретению, как описано в Примерeх 1 и 2.

На Фиг. 4 представлен результат анализа ДНК, выделенной из данного клинического образца, и исследованной согласно изобретению.

Согласно алгоритму обработки результатов гибридизации, значение сигнала в ячейке IS превосходило средний фоновый сигнал более, чем в 4 раза. Следовательно, в данном образце установлено наличие ДНК микобактерий туберкулезного комплекса.

Анализ группы ячеек, с зондами, специфичными к полиморфизму Rv0557 (обведены пунктирной линией), показал наличие полиморфизма Rv0557_321T>C, что означает, что штамм не принадлежит к Евро-Американской линии. Анализ группы ячеек с зондами, специфичными к полиморфизму Rv2629 (обведены пунктирной линией), показал, что данный штамм принадлежит к семейству Beijing. Установленный полиморфизм Rv0118c_G>T в гене oxcA (ячейки обведены пунктирной линией) позволил отнести данный штамм к генотипу Beijing B0/W148.

Анализ групп ячеек с зондами, специфичными к детерминантам устойчивости, позволил выявить мутацию Ser531>Leu в гене rpoB (стрелка 1 на Фиг. 4), приводящую к устойчивости к рифампицину; мутацию Ser315>Thr (вариант 2) в гене katG (стрелка 2), приводящую к устойчивости к изониазиду; мутацию Met 306> Ile (вариант 1) в гене embB (стрелка 3), ассоциированную с устойчивостью к этамбутолу. В других группах ячеек совершенные гибридизационные дуплексы были зарегистрированы только в ячейках, соответствующих дикому типу. Таким образом, ни в одном из исследуемых фрагментов генов gyrA, gyrB, eis, rrs данного штамма мутации обнаружены не были, что означает чувствительность данного штамма к фторхинолонам и канамицину, амикацину/капреомицину.

Микробиологическими и бихимическими тестами было подтверждено наличие в клиническом образце M. tuberculosis. Устойчивость к рифампицину, изониазиду, этамбутолу была подтверждена культурально ростом на специфических средах с соответствующими химиопрепаратами, при отсутствии роста на средах с фторхинолонами, канамицину, амикацинуи и капреомицином. Таким образом, культуральный способ зафиксировал наличие в клиническом образце штамма M. tuberculosis, обладающего множественной лекарственной устойчивостью (к рифампицину и изониазиду) и дополнительно устойчивостью к этамбутолу, что полностью совпадает с результатами, полученными способом настоящего изобретения.

Пример 6. Анализ клинического образца, содержащего штамм M. tuberculosis генотипа Beijing, обладающий устойчивостью к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину/капреомицину и этамбутолу.

Клинический образец (кровь), полученный от пациента, с подтвержденным микроскопией наличием кислотоустойчивых бактерий (БК+), был разделен на 2 части, одна из которых после деконтаминации (N-ацетил-L-цистеин и NaOH) и нейтрализации была передана для микробиологических исследований. Идентификацию микобактерий туберкулезного комплекса проводили по результатам биохимических тестов (Kent PT, Kubica GP. Public health mycobacteriology. A guide for level III laboratory. Atlanta, GA: Centers for Disease Control and Prevention, 1985). Тесты на устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутиолу проводили с использованием автоматизированной системы Bactec MGIT 960 (Becton Dickinson, США). Вторую часть образца мокроты анализировали согласно изобретению, как описано в Примерах 1 и 2.

На Фиг. 5 представлен результат анализа ДНК, выделенной из данного клинического образца, и исследованной согласно изобретению.

Согласно алгоритму обработки результатов гибридизации, значение сигнала в ячейке IS превосходило средний фоновый сигнал более, чем в 4 раза. Следовательно, в данном образце установлено наличие ДНК микобактерий туберкулезного комплекса.

Анализ группы ячеек, с зондами, специфичными к полиморфизму Rv0557 (обведены пунктирной линией), показал наличие полиморфизма Rv0557_321T>C, что означает, что штамм не принадлежит к Евро-Американской линии. Анализ группы ячеек с зондами, специфичными к полиморфизму Rv2629 (обведены пунктирной линией), показал, что данный штамм принадлежит к семейству Beijing.

Анализ групп ячеек с зондами, специфичными к детерминантам устойчивости, позволил выявить мутацию Ser531>Leu в гене rpoB (стрелка 1 на Фиг.5), приводящую к устойчивости к рифампицину; мутацию Asp94>Ala в гене gyrA (стрелка 2), приводящую к устойчивости к фторхинолонам; мутацию Ser315>Arg (вариант 1) в гене katG (стрелка 3), приводящую к устойчивости к изониазиду; нуклеотидную замену g37>t в регуляторной области гена eis (стрелка 4), ассоциированную с устойчивостью к канамицину, амикацину; мутацию Asp 354>Ala в гене embB (стрелка 5), ассоциированную с устойчивостью к этамбутолу. Таким образом, в ДНК данного штамма были обнаружены детерминанты устойчивости по каждому из анализируемых препаратов.

Микробиологическими и бихимическими тестами было подтверждено наличие в крови M. tuberculosis. Устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу была подтверждена культурально ростом на специфических средах с соответствующими химиопрепаратами. Таким образом, культуральный способ зафиксировал наличие в клиническом образце штамма M. tuberculosis, обладающего широкой лекарственной устойчивостью, что полностью совпадает с результатами, полученными способом настоящего изобретения.

Пример 7. Анализ клинического образца, содержащего штамм M. tuberculosis генотипа LAM, обладающего устойчивостью к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину/капреомицину и этамбутолу.

Клинический образец (мокрота), полученный от пациента, с подтвержденным микроскопией наличием кислотоустойчивых бактерий (БК+), был разделен на 2 части, одна из которых после деконтаминации (N-ацетил-L-цистеин и NaOH) и нейтрализации была передана для микробиологических исследований. Идентификацию микобактерий туберкулезного комплекса проводили по результатам биохимических тестов (Kent PT, Kubica GP. Public health mycobacteriology. A guide for level III laboratory. Atlanta, GA: Centers for Disease Control and Prevention, 1985). Тесты на устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутиолу проводили с использованием автоматизированной системы Bactec MGIT 960 (Becton Dickinson, США). Вторую часть образца мокроты анализировали согласно изобретению, как описано в Примерeх 1 и 2.

На Фиг. 6 представлен результат анализа ДНК, выделенной из данного клинического образца, и исследованной согласно изобретению.

Согласно алгоритму обработки результатов гибридизации, значение сигнала в ячейке IS превосходило средний фоновый сигнал более, чем в 4 раза. Следовательно, в данном образце установлено наличие ДНК микобактерий туберкулезного комплекса.

Анализ группы ячеек, с зондами, специфичными к полиморфизму Rv0557, показал наличие дикого типа по полиморфизму Rv0557_321, что означало принадлежность штамма к Евро-Американской линии. Анализ группы ячеек с зондами, специфичными к полиморфизму Rv0129c (обведены пунктирной линией), показал, что данный штамм принадлежит к семейству LAM.

Анализ групп ячеек с зондами, специфичными к детерминантам устойчивости, позволил выявить мутацию Asp515>Val в гене rpoB (стрелка 1 на Фиг.6), приводящую к устойчивости к рифампицину; мутацию Ala90>Val в гене gyrA (стрелка 2), приводящую к устойчивости к фторхинолонам; нуклеотидную замену с15>t в регуляторной области гена inhA (стрелка 3) и мутацию Ser315>Thr (вариант 1) в гене katG (стрелка 4), приводящие к устойчивости к изониазиду; мутацию a1401>g в гене rrs (стрелка 5), приводящую к устойчивости к канамицину, амикацину и капреомицину; мутации Met306>Ile (вариант 1) и Gly406>Asp (стрелки 6 и 7, соответственно) в гене embB, ассоциированные с устойчивостью к этамбутолу. Таким образом, в ДНК данного штамма были обнаружены детерминанты устойчивости по каждому из анализируемых препаратов.

Микробиологическими и бихимическими тестами было подтверждено наличие в мокроте M. tuberculosis. Устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу была подтверждена культурально ростом на специфических средах с соответствующими химиопрепаратами. Таким образом, культуральный способ зафиксировал наличие в клиническом образце штамма M. tuberculosis, обладающего широкой лекарственной устойчивостью, что полностью совпадает с результатами, полученными способом настоящего изобретения.

Пример 8. Анализ клинического образца, не содержащего микобактерий туберкулезного комплекса.

Клинический образец (экссудат), полученный от пациента, с подтвержденным микроскопией наличием кислотоустойчивых бактерий (БК+), был разделен на 2 части, одна из которых после деконтаминации (N-ацетил-L-цистеин и NaOH) и нейтрализации была передана для микробиологических исследований. Идентификацию микобактерий туберкулезного комплекса проводили по результатам биохимических тестов (Kent PT, Kubica GP. Public health mycobacteriology. A guide for level III laboratory. Atlanta, GA: Centers for Disease Control and Prevention, 1985). Тесты на устойчивость к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутиолу проводили с использованием автоматизированной системы Bactec MGIT 960 (Becton Dickinson, США). Вторую часть образца мокроты анализировали согласно изобретению, как описано в Примерeх 1 и 2.

На Фиг. 7 представлен результат анализа ДНК, выделенной из данного клинического образца и исследованной согласно изобретению.

Согласно алгоритму обработки результатов гибридизации значение сигнала в ячейке IS было близко к фоновому значению, т.е. превышало средний сигнал в ячейках пустого геля не более, чем на 20%. Таким образом, было установлено, что исследуемый образец не содержит ДНК микобактерий туберкулезного комплекса, а, следовательно, анализ по установлению генотипа и детерминант устойчивости не проводился.

Микробиологическими и бихимическими тестами было подтверждено наличие в клиническом образце M.avium, не принадлежащем к микобактериям туберкулезного комплекса. Таким образом, результаты, полученные способом настоящего изобретения и референсным методом, полностью совпали.

Таким образом, представленное изобретение позволяет в короткие сроки выявлять ДНК возбудителя туберкулеза - микобактерий туберкулезного комплекса в клинических образцах, устанавливать генотип возбудителя и одновременно идентифицировать генетические детерминанты устойчивости к наиболее эффективным препаратам первого и второго ряда - рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу. Способ данного изобретения выгодно отличается от существующих в настоящее время аналогов наибольшим числом одновременно выявляемых детерминант устойчивости, позволяя установить эффективные для каждого конкретного пациента противотуберкулезные препараты. В отличие от тест-систем на основе гидрогелевых биочипов предыдущего поколения, предложенный вариант одностадийной мультиплексной ПЦР существенно снижает вероятность кросс-контаминации и уменьшает время и трудозатраты при анализе. Выявление клинически значимых генотипов, особенно семейства Beijing, ассоциированных с повышенной вирулентностью и трансмиссивностью, позволит принять меры для предотвращения распространения таких штаммов. Настоящее изобретение позволяет также проводить эпидемиологическое генотипирование, устанавливая генотипы наиболее распространенных на территории РФ семейств.

Хотя предпочтительные воплощения настоящего изобретения и их преимущества были подробно описаны выше, специалист в данной области сможет внести различные изменения, дополнения или, наоборот, что-то опустить, не выходя при этом за рамки данного изобретения, которые определяются прилагаемой ниже формулой изобретения.

1. Способ обнаружения ДНК возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу, включающий:
(а) - мультиплексную амплификацию генов rpoB, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, мобильного элемента IS6110, фрагментов микобактериального генома, содержащих генотип-специфичные однонуклеотидные полиморфизмы Rv0557, Rv0129c, Rv1811, Rv2629, Rv0118c, с одновременным флуоресцентным маркированием при использовании геномной ДНК микобактерий туберкулезного комплекса в качестве матрицы и набора праймеров, последовательности которых представлены SEQ ID NO: 1-36, с получением флуоресцентно-меченых фрагментов микобактериального генома;
(б) - обеспечение олигонуклеотидного микрочипа для идентификации ДНК микобактерий туберкулезного комплекса с одновременным установлением генотипов Beijing, Beijing ВО, LAM, Haarlem, Ural и определением мутаций, ответственных за устойчивость возбудителя туберкулеза к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу, представляющего собой подложку, содержащую множество дискретных элементов, в каждом из которых иммобилизован уникальный олигонуклеотидный зонд, имеющий последовательность, комплементарную последовательности одноцепочечного фрагмента, полученного на стадии (а), и выбранную из группы, включающей: а) соответствующие последовательности фрагмента мобильного элемента IS6110; б) соответствующие последовательности фрагмента, включающего полиморфизм Rv0557, характерный для Евро-Американской линии; в) соответствующие последовательности фрагмента, включающего полиморфизм Rv0557, характерный для генотипа Haarlem, при установленной принадлежности к Евро-Американской линии; г) соответствующие последовательности фрагмента, включающего полиморфизм Rv0129c, характерный для генотипа LAM, при установленной принадлежности к Евро-Американской линии; д) соответствующие последовательности фрагмента, включающего полиморфизм Rv1811, характерный для генотипа Ural, при установленной принадлежности к Евро-Американской линии; е) соответствующие последовательности фрагмента, включающего полиморфизм Rv2629, характерный для семейства Beijing, при отсутствии принадлежности к Евро-Американской линии; ж) соответствующие последовательности фрагмента, включающего полиморфизм Rv0118c в гене охсА, характерный для генотипа Beijing B0/W148 при установленном семействе Beijing; з) соответствующие последовательности фрагмента гена rpoB дикого типа; и) соответствующие последовательности фрагмента мутантного варианта гена rpoB, приводящего к устойчивости микроорганизмов к рифампицину; й) соответствующие последовательности фрагмента гена katG дикого типа; к) соответствующие последовательности фрагмента мутантного варианта гена katG, приводящего к устойчивости микроорганизмов к изониазиду; л) соответствующие последовательности фрагмента гена inhA дикого типа; м) соответствующие последовательности фрагмента мутантного варианта гена inhA, приводящего к устойчивости микроорганизмов к изониазиду; н) соответствующие последовательности фрагмента гена ahpC дикого типа; о) соответствующие последовательности фрагмента мутантного варианта гена ahpC, приводящего к устойчивости микроорганизмов к изониазиду; п) соответствующие последовательности фрагмента гена gyrA дикого типа; р) соответствующие последовательности фрагмента мутантного варианта гена gyrA, приводящего к устойчивости микроорганизмов к фторхинолонам; с) соответствующие последовательности фрагмента гена gyrB дикого типа; т) соответствующие последовательности фрагмента мутантного варианта гена gyrB, приводящего к устойчивости микроорганизмов к фторхинолонам; у) соответствующие последовательности фрагмента гена eis дикого типа; ф) соответствующие последовательности фрагмента мутантного варианта гена eis, приводящего к устойчивости микроорганизмов к канамицину, амикацину и капреомицину; х) соответствующие последовательности фрагмента гена rrs дикого типа; ц) соответствующие последовательности фрагмента мутантного варианта гена rrs, приводящего к устойчивости микроорганизмов к канамицину, амикацину и капреомицину; ч) соответствующие последовательности фрагмента гена embB дикого типа; ш) соответствующие последовательности фрагмента мутантного варианта гена embB, приводящего к устойчивости микроорганизмов к этамбутолу; при этом последовательности иммобилизованных олигонуклеотидных зондов представлены SEQ ID NO: 37-229;
(в) - гибридизацию амплифицированных флуоресцентно-меченых продуктов, полученных на стадии (а), на олигонуклеотидном микрочипе с образованием дуплексов с иммобилизованными зондами в условиях, обеспечивающих разрешение в один нуклеотид между образующимися в результате гибридизации совершенными и несовершенными дуплексами;
(г) - регистрацию результатов гибридизации на олигонуклеотидном микрочипе, проведенной на стадии (в) с использованием портативного анализатора флуоресценции и программного обеспечения, что позволяет использовать программную обработку интенсивностей сигналов с последующей интерпретацией результатов, которую проводят в два этапа: на первом этапе анализируют сигналы в ячейке микрочипа, содержащей олигонуклеотидный зонд, специфичный к фрагменту мобильного элемента IS6110, характерного для микобактерий туберкулезного комплекса, с целью обнаружения ДНК возбудителя туберкулеза; при наличии сигнала в данной ячейке, т.е. в случае обнаружения микобактериальной ДНК, на втором этапе одновременно анализируют элементы микрочипа, содержащие генотип-специфичные олигонуклеотидные зонды, исследующие полиморфизмы Rv0557, Rv0129c, Rvl811, Rv2629, Rv0118c, и элементы, в которых иммобилизованы олигонуклеотидные зонды для выявления мутаций в генах rpoB, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB, тем самым устанавливая генотип возбудителя туберкулеза и определяя генетические детерминанты устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу.

2. Способ по п. 1, в котором амплификацию фрагментов микобактериального генома проводят, используя ДНК, выделенную из материала клинического образца (мокроту, экссудат, бронхоальвеолярный лаваж, кровь) или предварительно выращенной культуры микроорганизмов.

3. Способ по п. 1, характеризующийся тем, что на стадии (а) для флуоресцентного маркирования получаемых ПЦР-фрагментов используют флуоресцентно-меченый дезоксиуридинтрифосфат.

4. Способ по п. 1, характеризующийся тем, что на стадии (г) на втором этапе интерпретации результатов при анализе элементов микрочипа, содержащих генотип-специфичные олигонуклеотидные зонды, в случае установления дикого типа по полиморфизму Rv0557_321 штамм относят к Евро-Американской линии, с дальнейшей идентификацией генотипа Haarlem (по полиморфизму Rv0557_455), либо генотипа LAM (по полиморфизму Rv0129c), либо Ural (по полиморфизму Rv1811); при выявлении другого варианта полиморфизма Rv0557_321 штамм относят к иной, не Евро-Американской линии, с дальнейшей идентификацией семейства Beijing (по полиморфизму Rv2629) и определением генотипа B0/W148 для семейства Beijing (по полиморфизму Rv0118).

5. Способ по п. 1, характеризующийся тем, что на стадии (г) на втором этапе интерпретации результатов анализируют группы элементов, содержащих олигонуклеотидные зонды, специфичные к одному из генов rpob, katG, inhA, ahpC, gyrA, gyrB, rrs, eis, embB; при этом каждая из групп включает элемент, содержащий зонд дикого типа, и элементы, содержащие зонды, соответствующие мутантным вариантам генов. Если максимальный сигнал в группе зарегистрирован в элементе, содержащем зонд дикого типа, то считают, что по данной аминокислотной/нуклеотидной позиции данного гена изучаемый образец ДНК возбудителя туберкулеза мутаций не имеет. Если максимальный сигнал в группе зарегистрирован в элементе, содержащем зонд, последовательность которого специфична для мутантного варианта одного из генов, то считают, что по данной аминокислотной/нуклеотидной позиции данного гена изучаемый образец ДНК возбудителя туберкулеза имеет аминокислотную/нуклеотидную замену, являющуюся генетической детерминантой устойчивости.

6. Способ по п. 1, в котором интерпретированные результаты могут быть применены для подтверждения клинического диагноза «туберкулез», персонализированного выбора эффективных химиопрепаратов первого и второго ряда, установления клинически значимых генотипов и целей эпидемиологического генотипирования.

7. Олигонуклеотидный микрочип, используемый в способе обнаружения ДНК возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу, характеризующийся тем, что он представляет собой подложку с гидрогелевыми элементами, полученными способом химически или фотоиндуцируемой сополимеризации и содержащими иммобилизованные олигонуклеотидные зонды, последовательности которых представлены SEQ ID NO: 37-229.

8. Набор специфичных праймеров для осуществления способа обнаружения ДНК возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу, причем последовательности праймеров представлены SEQ ID NO: 1-36.

9. Набор олигонуклеотидных зондов, используемый для получения олигонуклеотидного микрочипа, используемого в способе обнаружения ДНК возбудителя туберкулеза с одновременным установлением его генотипа и определением генетических детерминант устойчивости к рифампицину, изониазиду, фторхинолонам, канамицину, амикацину, капреомицину, этамбутолу, причем последовательности олигонуклеотидных зондов представлены SEQ ID NO: 37-229.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к способу определения присутствия или отсутствия локуса устойчивости к пыльной головне в растении маиса, а также к способу определения растения маиса, которое проявляет устойчивость к пыльной головне, где способ включает обнаружение в идиоплазме растения маиса, по меньшей мере, одной аллели маркерного локуса, расположенного на хромосомном участке хромосомы 2 маиса, включающем и фланкированном umc1736 и umc2184.

Группа изобретений относится к области медицины и может быть использована для диагностических исследований. Группа изобретений характеризует автоматическую систему количественной амплификации в реальном времени, способ автоматической очистки нуклеиновой кислоты и количественного определения амплификации гена с использованием указанной системы, способ автоматического измерения количества жизнеспособных клеток патогенных бактерий, анализа патогенных бактерий на чувствительность к антибиотикам и автоматического получения антигенной плотности с использованием указанной системы, а также способ очистки связывающей нуклеиновой кислоты-мишени, которой мечен антиген-мишень, содержащийся в биологическом образце, с использованием указанной автоматической системы.
Изобретение относится к области медицины, а именно к способу прогнозирования депрессии тяжелой степени у мужчин с ишемической болезнью сердца (ИБС). Сущность способа состоит в том, что у мужчин с ИБС устанавливают временную и структурную связь между ИБС и признаками депрессии, измеряют уровень личностной тревожности с помощью теста Спилбергера-Ханина.
Изобретение относится к области генетической инженерии, молекулярной биологии и медицины. Предложен набор биомаркеров старения сердца, включающий множество полинуклеотидов, которые дифференциально экспрессируются в ткани сердца у старых субъектов по сравнению с молодыми субъектами, в котором полинуклеотиды выбирают из двух или более генов, вовлеченных в передачу Wnt-сигнала в ткани сердца, где гены представляют собой Dlgh1, Magi3, Akt1, Dab2, Rac1, Ctnnb1, Camk2d, Mapk1, Senp2, Smad3, Mark2, Ccnd1 и Pias4, а также соответствующая композиция и способ скрининга средства или режима на их способность замедлять старение сердца.

Изобретения относятся к области ветеринарной микробиологии и касаются олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D, а также способа с их использованием.

Изобретение относится к биотехнологии, а именно к способу количественного определения нуклеиновых кислот. Способ включает мечение универсального эталонного олигонуклеотида флуоресцентным маркером.

Изобретение относится к области биотехнологии. Раскрываются способы и композиции для определения наличия рака у субъекта и оценки эффективности лечения у него же.

Изобретение относится к молекулярной биологии и касается биочипа для типирования вирусов Lassa (LASV), Junin (JUNV), Machupo (MACV), Guanarito (GTOV) и вирусов Ebola (EBOV) и Marburg (MARV), а также способа типирования указанных вирусов.

Изобретение относится к области биохимии, в частности к способу определения геновариантов штаммов возбудителя чумы методом мультилокусного секвенирования. Заявленный способ предусматривает выделение хромосомной ДНК исследуемого штамма, амплификацию ДНК мишеней в полимеразной цепной реакции с использованием сконструированных праймеров, секвенирование амплифицированных фрагментов.

Изобретение относится к области биохимии, в частности к несортовому растению кукурузы с увеличенным по сравнению с контролем урожаем, включающему набор аллелей из соответствующего набора QTL, каждый из которых вносит вклад в фенотипический признак урожая зерна, причем указанный набор аллелей обоюдно комплементарен набору аллелей, имеющихся в линии Zea mays, выбранной из группы, состоящей из линии NP 1902, депонированной под номером NCIMB 41577, линии NP 1941, депонированной под номером NCIMB 41576, и линии NPNW 0351, депонированной под номером NCIMB 41578, а также к зерну или семени, им продуцируемому.

Изобретение относится к области биоинженерии и касается генетической конструкции, предназначенной для введения в хромосому Yarrowia lipolytica гена RecA из Bacillus subtilis. Представленная конструкция характеризуется последовательностью SEQ ID NO 1. Адресация рекомбинантного белка RecA в митохондрии происходит за счет лидерных последовательностей мРНК гена SOD2, обладающих сродством к внешней поверхности митохондрий и обеспечивающих котрансляционный транспорт RecA внутрь митохондрий. Изобретение позволяет получать рекомбинантные продуценты на основе Y.lipolytica, несущие трансгены в митохондриальном геноме, и предназначено для создания генетической системы модификации митохондриального генома in vivo с целью лечения генетических митохондриальных заболеваний человека. 2 ил.

Изобретение относится к области биохимии, в частности к выделенному антителу, которое специфически связывается с TAT211, или его функциональному фрагменту. Также раскрыты конъюгат, содержащий указанное антитело и который специфически связывает TAT211, нуклеиновая кислота, кодирующая заявленное антитело, и клетка, которая продуцирует заявленное антитело. Раскрыты способ идентификации антитела, способ ингибирования роста клетки, которая экспрессирует полипептид TAT211, способ терапевтического лечения млекопитающего, имеющего раковую опухоль, содержащую клетки, которые экспрессируют полипептид TAT211, способ определения присутствия TAT211 белка в образце и способ диагностики присутствия опухоли у млекопитающего. Изобретение обладает способностью специфически связываться с TAT211, что позволяет эффективно лечить заболевания, ассоциированные с экспрессией полипептида TAT211. 15 н. и 22 з.п. ф-лы, 19 ил., 1 табл., 16 пр.

Изобретение относится к области биотехнологии. Предложены способы диагностики пациентов с рассеянным склерозом (PC). Способы предусматривают идентификацию пациентов с рассеянным склерозом, имеющих повышенный риск развития вторичной аутоиммунной болезни после истощения лимфоцитов, вызванного, например, курсом лечения анти-CD52 антителом. Также предусматриваются способы выбора схемы лечения для пациентов с PC и реагентов, пригодных для использования в вышеописанных способах. Предложенная группа изобретений может быть использована в медицине. 7 н. и 20 з.п. ф-лы, 13 ил., 8 пр.
Изобретение относится к области медицины и предназначено для детекции гриба Trichophyton mentagrophytes. Осуществляют выделение тотальной нативной ДНК из образца кожи и волос, проводят полимеразную цепную реакцию и амплификацию фрагмента гена 5.8S рРНК Trichophyton mentagrophytes с использованием специфических праймеров. При электрофоретическом обнаружении продукта амплификации размером 182 п.н. определяют наличие возбудителя. Изобретение обеспечивает специфическую детекцию Trichophyton mentagrophytes в клиническом материале и может быть использовано для диагностики зооантропонозной трихофитии. 2 пр.

Группа изобретений относится к области биотехнологии. Способ диагностики наличия гломерулонефрита у кошки предусматривает измерение уровня экспрессии одного или нескольких биомаркеров, выбранных из группы, состоящей из люмикана; цепи коллагена альфа 1 (III), варианта 12; декорина; секретируемого родственного frizzled белка 2; ретинол-связывающего белка 5; MMP-2; MMP-7 и MMP-19, в биологическом образце, полученном от кошки. При этом значимое отличие в экспрессии одного или нескольких биомаркеров в образце по сравнению с контрольным значением для экспрессии в образце, полученном от здорового животного, свидетельствует о наличии расстройства почек. В группу изобретений также входит набор для осуществления указанного способа, с возможным использованием для диагностики нуклеотидных последовательностей комплементарных указанным выше генам. Проведение диагностика гломерулонефрита с использованием данной группы изобретений позволяет выявлять и прогнозировать развитие гломерулонефрита на ранних стадиях. 3 н. и 19 з.п. ф-лы, 16 ил., 4 табл., 6 пр.

Изобретение относится к области биотехнологии. Предложен способ тестирования собаки с целью определения вероятности наличия у собаки защиты от накопления меди в печени или к предрасположенности к накоплению меди в печени. Способ предусматривает генотипирование образца ДНК собаки на присутствие или отсутствие в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и (b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с указанным полиморфизмом (a). Также описано применение указанных полиморфизмов для определения вероятности наличия у собаки защиты от накопления меди в печени или к предрасположенности к накоплению меди в печени, а также способы отбора собак для получения потомства и способ предотвращения заболевания, связанного с накоплением меди в печени собак. Предложенная группа изобретений может быть использовано в ветеринарии. 4 н. и 11 з.п. ф-лы, 11 ил., 11 табл., 9 пр.

Изобретение относится к области генетики и молекулярной биологии и касается способа анализа генетического полиморфизма в полиморфных точках генов. Охарактеризованное изобретение включает генотипирование локусов, ответственных за предрасположенность к шизофрении и алкоголизму, с помощью технологии ДНК-биочипов и набора реагентов. Изобретение обеспечивает возможность определения нуклеотидного состава в десяти полиморфных позициях: HTR2A (rs6311, rs6314, rs7997012), BDNF (rs6265), DISC1 (rs3737597), ZNF804A (rs1344706), RELN (rs7341475), COMT (rs165599), SLC18A (rs2270641), PLXNA2 (rs1327175), ADH1B (rs1229984, rs1042026), ALDH2 (rs671), DRD2 (rs1800497, rs1799732), COMT (rs4680), NPY (rs16139), ADH1C (rs1693482), NKR1 (rs6715729) и AUTS2 (rs6943555), что, в свою очередь, позволяет охарактеризовать потенциальную предрасположенность к шизофрении и алкоголизму. Изобретение позволяет упростить анализ генетического полиморфизма для определения предрасположенности к шизофрении и алкоголизму. 2 з.п. ф-лы, 3 ил., 4 табл., 2 пр.

Изобретение относится к области биотехнологии. Предложен способ скрининга на появление, предрасположенность к появлению и/или развитие неоплазмы. Способ предусматривает скрининг в отношении модуляции ДНК или РНК или профиля экспрессии белка одного или нескольких маркеров молекул нуклеиновой кислоты. Изменения ДНК или РНК или профилей экспрессии белков являются показателями появления и/или развития неоплазмы толстой кишки, такой как аденома или аденокарцинома. Изобретение может быть использовано в медицине для диагностики или мониторинга колоректальных неоплазм, таких как колоректальные аденокарциномы. 2 н. и 11 з.п. ф-лы, 3 ил., 8 табл., 6 пр.

Изобретение относится к биотехнологии, а именно к способу захвата и амплификации избранной последовательности и набору для его осуществления. Способ включает получение субстрата, представленного твердофазной подложкой, содержащего первую и вторую популяции связанных с поверхностью олигонуклеотидов, где данные олигонуклеотиды распределены случайным образом относительно друг друга на субстрате. Гибридизируют первый член первой популяции с синтетическим олигонуклеотидом отбора, содержащим участок, который гибридизируется с первым членом, и участок, который содержит геномную последовательность. Удлиняют первый член первой популяции для получения дуплекса, который содержит связанный с подложкой праймер отбора, содержащий последовательность, комплементарную геномной последовательности. Удаляют олигонуклеотид отбора путем денатурации, оставив удлиненный, связанный с подложкой праймер отбора. Гибридизируют связанный с подложкой праймер отбора с фрагментированным геномом, содержащим фрагмент нуклеиновой кислоты, включающий геномную последовательность. Удлиняют связанный с подложкой праймер отбора для получения продукта удлинения, который содержит последовательность, комплементарную фланкирующей последовательности, где фланкирующая последовательность фланкирует геномную последовательность. Амплифицируют геномный продукт на субстрате с помощью мостиковой ПЦР с использованием неудлиненных членов первой и второй популяции связанных с поверхностью олигонуклеотидов, для получения продукта ПЦР. Предложенное изобретение позволяет осуществить обогащение мишени непосредственно на субстрате, используемом для секвенирования. 2 н. и 17 з.п. ф-лы, 18 ил., 4 табл., 1 пр.

Изобретение относится к области биотехнологии и касается способа дифференциации биоваров и геновариантов штаммов Yersinia pestis основного подвида с помощью полимеразной цепной реакции. Способ предусматривает выделение ДНК исследуемого штамма, последовательное проведение ПЦР с праймерами на ДНК мишени «Med24», «glpD», «pCKF» и с праймерами «1.ANT/1.ORI», «2.ANT/2.MED следующего состава: Дифференциацию осуществляют путем сравнения наличия и размеров образуемых амплифицированных фрагментов исследуемого штамма с размерами фрагментов типичных штаммов античного (геноварианты 0.ANT, 1.ANT, 2.ANT), средневекового (геноварианты 2.MED, 2.MED0) и восточного (геновариант 1.ORI) биоваров. Представленное изобретение позволяет быстро и эффективно разделить штаммы возбудителя чумы по их биоварной и внутрибиоварной принадлежности. 1 табл., 3 пр.
Наверх