Способ диагностики шизофрении



Способ диагностики шизофрении
Способ диагностики шизофрении

 


Владельцы патента RU 2563124:

Федеральное государственное бюджетное учреждение "Федеральный медицинский исследовательский центр психиатрии и наркологии имени В.П. Сербского" Министерства здравоохранения Российской Федерации (ФГБУ "ФМИЦПН им. В.П. Сербского" Минздрава России) (RU)

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при ранней диагностике шизофрении. Способ включает генетический анализ Vall58Met полиморфизма гена катехол-О-метил-трансферазы, при этом у носителей гаплотипа Met/Met проводят избирательную оценку предстимульного торможения и базового латентного периода акустической стартл-реакции. При снижении предстимульного торможения и возрастании базового латентного периода акустической стартл-реакции диагностируют шизофрению. 2 табл., 1 пр.

 

Изобретение относится к медицине, а именно к психиатрии, и может быть применено для повышения уровня объективности ранней диагностики шизофрении.

Повышение эффективности диагностических методов для раннего выявления шизофрении, оценки риска развития и течения заболевания является одной из актуальных проблем современной психиатрии. В последние десятилетия были разработаны различные методы диагностики нервно-психических заболеваний, основанные на оценке иммунологических и нейрохимических показателей крови (RU 2289137, RU 2120637, RU 2216741), специфического паттерна экспрессии генов (RU 2302002), особенностях кровоснабжения различных структур головного мозга (RU 2326596).

Однако указанные методики характеризуются достаточно высокой стоимостью и предполагают наличие значительного времени для проведения анализов.

Учитывая существенную роль наследственных механизмов в патогенезе заболевания, плодотворной представляется оценка генетического полиморфизма. Однако накопленные к настоящему времени данные указывают, что шизофрения является полигенным заболеванием, при этом каждый из генов-кандидатов обладает относительно небольшим размером эффекта. Таким образом, для повышения точности диагноза необходимо увеличивать число определяемых мутаций, что повышает стоимость анализа и одновременно снижает статистическую значимость полученных результатов.

Существует способ прогнозирования риска развития параноидной шизофрении, основанный на оценке полиморфизмов генов рецепторов тирозинкиназ, а также мембранного белка нейрексина (RU 2506595) (всего пяти разных генетических полиморфизмов). Отношение шансов в этом способе находится в пределах от 2 до 3.

Одним из возможных путей повышения эффективности является включение в способ диагностики как генетических, так и нейрофизиологических методов. В связи с этим, актуальным является поиск информативных стандартизированных нейрофизиологических тестов.

Существует способ для скрининга шизофрении, основанный на оценке изменений физиологических показателей (кардиоритма, кожно-гальванической реакции, миограммы) на фоне информационной нагрузки, вызывающей острую эмоциональную реакцию (RU 2222256).

Недостатком этого способа является существенная роль субъективного компонента в оценке испытуемым предъявляемой информации.

В настоящей заявке предлагается применять более объективные психофизиологические показатели, полученные при помощи стандартных тестов. Выбранные показатели относятся к потенциальным нейрофизиологическим эндофенотипам шизофрении.

Основу предлагаемого способа составляет комплексное исследование нейрофизиологических показателей и генетического полиморфизма. Предлагаемый способ включает оценку предстимульного торможения и базового латентного периода акустической стартл-реакции, а также полиморфизма rs4680 гена катехол-О-метилтрансферазы. Данный способ не предполагает обязательного инвазивного вмешательства, экономичен и отличается высоким уровнем точности.

Концепция эндофенотипов предполагает выявление фенотипических признаков, характерных для определенной нозологической единицы, наличие которых у отдельного индивидуума определяется меньшим количеством генов в сравнении с заболеванием в целом. В качестве потенциальных нейрофизиологических эндофенотипов психических заболеваний, в том числе шизофрении, рассматриваются предстимульное торможение акустической стартл-реакции (АСР), а также показатель латентного периода АСР.

АСР - генерализованная реакция организма на внезапный звуковой сигнал высокой интенсивности. У человека стартл-реакцию оценивают по величине мигательной составляющей - потенциалу круговой мышцы глаз. Феномен предстимульного торможения АСР (ПСТ) заключается в снижении амплитуды ответа на основной стимул в случае, если ему предшествует с небольшим (менее 500 мс) интервалом опережения (ИО) сигнал меньшей интенсивности, который сам не вызывает СР. ПСТ является показателем фильтрации сенсомоторной информации, в обеспечение которого вовлечены гиппокамп, префронтальная кора, базальные ганглии. Показано (Dawson et al., 1993. Сторожева и др., 2011 Braff, 1993), что ПСТ нарушено у больных шизофренией вне зависимости от стадии болезни. Кроме того, у больных шизофренией обнаружено существенное возрастание латентного периода АСР на одиночный стимул (базового латентного периода - ЛП) в сравнении с нормой. Как ПСТ, так и ЛП демонстрируют высокий уровень наследуемости (Hasenkamp et al., 2010). Следует отметить, что нарушение ПСТ (как и любой эндофенотип) наблюдается только у части больных шизофренией. В то же время, среди психически здоровых лиц тоже можно выделить популяцию с низким уровнем ПСТ. Есть основания полагать, что генетические механизмы снижения ПСТ у больных шизофренией и психически здоровых лиц различаются между собой. Это обстоятельство позволяет предложить избирательное использование ПСТ и ЛП у носителей определенных генотипов в качестве биомаркеров риска развития шизофрении.

В качестве одного из генов-кандидатов, связанных с риском развития шизофрении, рассматривают ген катехол-О-метилтрансферазы (КОМТ)-фермента, принимающего участие в метаболизме катехоламинов. Замена валина на метионин в положении 158 гена СОМТ (полиморфизм Vall58Met или rs4680) приводит к понижению активности фермента в 3-4 раза.

Показано, что у психически здоровых лиц с различными вариантами Vall58Met полиморфизма СОМТ ассоциируются те или иные особенности выполнения когнитивных и психофизиологических тестов (Mcintosh et al., 2007). В частности, здоровые носители Val/Val гомозиготы демонстрируют сниженный уровень ПСТ в сравнении с носителями Met/Met гомозиготы (Roussos et al., 2008, Quednow et al., 2009).

У больных шизофренией таких закономерностей выявлено не было (Montag et al., 2008, Liu et al., 2013). Указанное различие может быть использовано для создания алгоритма комплексного диагностического инструментария, включающего целенаправленную оценку нейрофизиологических эндофенотипов у носителей определенного генетического полиморфизма.

Заявленный способ основан на оценке 2-х нейрофизиологических показателей - ПСТ и ЛП у носителей Met/Met варианта полиморфизма Vall58Met (rs4680) гена катехол-О-метилтрансферазы.

Заявленный способ диагностики шизофрении включает

- получение образцов для генетического анализа (слюна, буккальный соскоб, кровь),

- определение Vall58Met полиморфизма (rs4680) гена катехол-О-метилтрансферазы,

- проведение оценки предстимульного торможения и латентного периода акустической стартл-реакции у носителей Met/Met полиморфизма rs4680,

- применение метода бинарной логистической регрессии для определения вероятности попадания исследуемого в группу риска в плане развития шизофрении на основе предварительно созданной базы данных.

В качестве предикторов используются ПСТ при интервале опережения предстимула, равном 60 мс, и базовый латентный период реакции с правого глаза. Точность диагноза с использованием заявленного способа - более 85%.

Пример применения способа для выявления лиц с диагнозом «шизофрения».

Методика проведения исследований

Участники и протокол тестирования

Исследована выборка из 76 человек при помощи слепого метода. Диагноз шизофрения (F20 по МКБ-10) был поставлен экспертами ГНЦ ССП им. В.П. Сербского и не сообщался до окончания тестирования и анализа результатов.

Все испытуемые были праворукими мужчинами в возрасте от 22 до 58 лет.

Определение полиморфизма rs4680

Выделение ДНК из образцов слюны или лейкоцитов периферической крови проводили при помощи набора «ДНК-экспресс» и «ДНК-экспресс-кровь» фирмы «Литех» (Москва, Россия). Определение полиморфизма rs4680 проводили методом полимеразной цепной реакции в реальном времени с использованием детектирующего амплификатора «ДТ-322» («ДНК-Технология», Россия) и наборов, изготовленных фирмой «Литех», по протоколу производителя.

Предстимульное торможение АСР (ПСТ)

Процедура исследования

При исследовании ПСТ за основу был принят протокол, рекомендованный Международным Консорциумом по изучению генетики шизофрении. Для вызова АСР использовали широкополосные звуковые импульсы, подаваемые со звуковой карты компьютера через наушники бинаурально. Параметры основного стимула - 40 мс, 110 дБ, параметры предстимула - 20 мс, 85 дБ. Интервал между основными стимулами изменялся в пределах 15-22 с. В ходе эксперимента испытуемый сидел в удобном кресле с открытыми глазами. Исследование состояло из четырех серий. В 1-й и 4-й сериях подавалось по 5 одиночных основных стимулов.

Во 2-й и 3-й сериях подавались стимулы 4-х типов (по 8 стимулов каждого типа):

- основной одиночный стимул,

- основной стимул, в сочетании с предстимулом при ИО=60 мс,

- основной стимул в сочетании с предстимулом при ИО=120 мс,

- основной стимул в сочетании с предстимулом при ИО=2500 мс.

Регистрировали электромиограмму (ЭМГ) круговой мышцы глаза с помощью 4-канального «Нейромиографа-01-МБН» («МБН», Россия). Частота квантования составляла 1000 Гц; фильтр верхних частот - 0.5 Гц, а фильтр нижних частот - 200 Гц. Для получения интегрированной ЭМГ записи подвергались цифровой высокочастотной фильтрации с частотой среза 10 Гц (для удаления низкочастотного тренда), выпрямлению и сглаживанию фильтром скользящего среднего. Затем определяли автоматически амплитуду и латентность АСР [6].

Базовые параметры АСР оценивали как средние величины амплитуды и латентного периода (ЛП) реакций в 1-й серии. Показатель угашения АСР рассчитывали по формуле

Н=[(ml-m4)/ml]×l00%, где ml и m4 - средние значение амплитуды АСР в 1-й серии и 4-й сериях соответственно.

Величину ПСТ оценивали по формуле:

ПСТ=[(А0-Апр)/А0]×100%, где А0 - средняя амплитуда АСР в пробах, не включающих предстимул, Апр - средняя амплитуда АСР в пробах, включающих предстимул.

Результаты исследования

При анализе полученных данных у больных шизофренией выявлен значимый дефицит предстимульного торможения АСР суммарно по двум сериям при регистрации с левого глаза, который составил 19,6% по сравнению с контрольной группой (р<0,05). Возрастание латентного периода при регистрации с правого глаза у больных составило 15,2% относительно уровня нормы (р<0,001).

Данные, полученные у носителей различных генотипов СОМТ из группы нормы и больных шизофренией, представлены в табл. 1.

Как видно из таблицы, статистически значимые межгрупповые различия по обоим показателям наблюдаются только у носителей Met/Met генотипа. При этом величина снижения ПСТ относительно нормы составляет 36,4%, а возрастание латентного периода - 35%, т.е. существенно больше, чем при сравнении групп в целом.

Применение бинарной логистической регрессии показало, что избирательное использование в качестве предикторов шизофрении исследованных нейрофизиологических показателей у носителей Met/Met варианта полиморфизма rs4680 обеспечивает высокий уровень чувствительности и специфичности способа (табл. 2).

Список литературы

1. Braff D.L. Information processing and attention dysfunctions in schizophrenia. Schizophr. Bull. 1993. 19 (2): 233-259.

2. Dawson M., Hazlett E.A., Filion, D.L. Attention and schizophrenia: impaired modulation of the startle reflex. J. Abnorm. Psychol. 1993. 102: 633-641.

3. Hasenkamp W, Epstein MP, Green A, Wilcox L, Boshoven W, Lewison B, Duncan E (2010). Heritability of acoustic startle magnitude, prepulse inhibition, and startle latency in schizophrenia and control families. Psychiatry Research 178(2), 236-243.

4. Liu X1, Hong X, Chan RC, Kong F, Peng Z, Wan X, Wang C, Cheng L. Association study of polymorphisms in the alpha 7 nicotinic acetylcholine receptor subunit and catechol-o-methyl transferase genes with sensory gating in first-episode schizophrenia. Psychiatry Res. 2013 Oct 30;209(3):431-8. doi: 10.1016/j.psychres. 2013.03.027. Epub 2013 Apr 15.

5. Mcintosh A.M., Baig B.J., Hall J., Job D., Whalley H.C., Lymer G.K., Moorhead TW, Owens DG, Miller P, Porteous D, Lawrie SM, Johnstone EC. Relationship of catechol-O-methyltransferase variants to brain structure and function in a population at high risk of psychosis. Biol Psychiatry. 2007 May 15;61(10):1127-34.

6. Montag C, Hartmann P, Merz M, Burk C, Reuter M. D2 receptor density and prepulse inhibition in humans: negative findings from a molecular genetic approach. Behav Brain Res. 2008 Mar 5;187(2):428-32.

7. Roussos P, Giakoumaki SG, Rogdaki M, Pavlakis S, Frangou S, Bitsios P. Prepulse inhibition of the startle reflex depends on the catechol O-methyltransferase Vall58Met gene polymorphism. Psychol Med. 2008 Nov;38(ll):1651-8.

8. Quednow BB, Schmechtig A, Ettinger U, Petrovsky N, Collier DA, Vollenweider FX, Wagner M, Kumari V. Sensorimotor gating depends on polymorphisms of the serotonin-2A receptor and catechol-O-methyltransferase, but not on neuregulin-1 Arg38Gln genotype: a replication study. Biol Psychiatry. 2009 Sep 15;66(6):614-20.

9. Сторожева З.И., Киренская A.B., Лазарев И.Е., Новотоцкий-Власов В.Ю., Самылкин Д.В, Фастовцов Г.А. Исследования предстимульной модификации акустической стартл-реакции в российской популяции психически здоровых лиц и больных шизофренией. Журнал неврологии и психиатрии им. С.С.Корсакова. 2011. 111 (2): 72-75.

Способ диагностики шизофрении, включающий генетический анализ Vall58Met полиморфизма гена катехол-О-метил-трансферазы, отличающийся тем, что у носителей гаплотипа Met/Met проводят избирательную оценку предстимульного торможения и базового латентного периода акустической стартл-реакции и при снижении предстимульного торможения и возрастании базового латентного периода акустической стартл-реакции диагностируют шизофрению.



 

Похожие патенты:

Изобретение относится к области судебно-медицинской экспертизы, а именно к тестовым наборам, и позволяет произвести тестирование спермы в пятнах на исследуемом образце.

Изобретение относится к медицине и может быть использовано для диагностики опухолей головного мозга (ОГМ). Для этого путем электронной феноменологической спектроскопии измеряют оптическую плотность плазмы крови человека в видимой и ультрафиолетовой области спектра.
Изобретение относится к медицине, а именно к способу прогнозирования рецептивности эндометрия в циклах экстракорпорального оплодотворения (ЭКО). Сущность способа состоит в том, что определяют оптическую плотность экспрессии лейкемия ингибирующего фактора (LIF) в поверхностном и железистом эпителии эндометрия в период окна имплантации в цикле, предшествующем проведению экстракорпорального оплодотворения, и дополнительно определяют содержание сосудистого эндотелиального фактора роста (VEGF) в цервикальной слизи в день трансвагинальной пункции фолликулов, систолодиастолическое отношение (S/D) и индекс резистентности (IR) спиральных артерий в день введения триггера овуляции, а затем рассчитывают значение регрессионной функции (Z) по формуле.
Изобретение относится к медицине, а именно к микологии и дерматовенерологии, и может быть использовано для диагностики микроспории. Способ включает выделение тотальной нативной ДНК из кожи и волос, специфическую амплификацию фрагмента гена 5.8S рРНК Trichophyton verrucosum с использованием праймеров следующей структуры: 5′ CCACGATAGGGATCAGCGTT 3′, 5′ GAAAGTTTTAACTGATTTTGCTTG 3′.

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки.
Изобретение относится к медицине и предназначено для диагностики обострения язвенного колита. Проводят исследование иммунного статуса в сыворотке крови, определяют уровень циркулирующих иммунных комплексов и при повышении циркулирующих иммунных комплексов C1q до 60,8 ед./мл и выше уровня циркулирующих иммунных комплексов C3d до 39,0 ед./мл и выше и С-реактивного белка до 10,2 мг/л и выше диагностируют обострение язвенного колита.
Изобретение относится к медицине, а именно к акушерству и пульмонологии. Изобретение позволяет прогнозировать анемический синдром во втором триместре гестации при обострении хронического обструктивного бронхита у женщин с гриппом A(H3N2) в первом триместре беременности.

Изобретение относится к области медицины, а именно к неврологии, и может быть использовано для диагностики тяжести дисциркуляторной энцефалопатии у мужчин. Определяют уровень липопротеинов высокой плотности, коэффициенты коморбидности Cirs и Kaplan-Feistein.

Изобретение относится к онкологии и касается способов прогнозирования достижения полных морфологических регрессий (ПМР) у больных операбельным трипл-негативным раком молочной железы.

Изобретение относится к медицине, а именно к трансплантологии, и может быть использовано для мониторинга состояния пациента после трансплантации органа. Для этого, после трансплантации производят мониторинг редокс потенциала (РП) плазмы крови пациента.
Изобретение относится к медицине, а именно к способу прогнозирования синдрома задержки внутриутробного развития плода в третьем триместре гестации при реактивации хронической цитомегаловирусной инфекции (ЦМВ) у женщин с угрозой невынашивания во втором триместре беременности. Сущность способа состоит в том, что во втором триместре гестации при реактивации хронической цитомегаловирусной инфекции у женщин определяют уровень антител IgM к ЦМВ и антител IgG к ЦМВ в парных сыворотках крови, в баллах - А, оценивают степень выраженности угрозы прерывания беременности, в баллах - В, определяют концентрацию фактора некроза опухоли-α (пг/мл) - С. Рассчитывают величину дискриминантной функции D с граничным значением равным +18,61. При D меньше граничного значения дискриминантной функции прогнозируют отсутствие синдрома задержки внутриутробного развития плода, а при D равной или больше граничного значения дискриминантной функции прогнозируют развитие синдрома задержки внутриутробного развития плода. Использование заявленного способа позволяет эффективно спрогнозировать синдром внутриутробного развития плода в третьем триместре гестации при реактивации хронической цитомегаловирусной инфекции (ЦМВ) у женщин с угрозой невынашивания во втором триместре беременности. 2 пр.

Изобретение относится к области медицины, а именно к акушерству и гинекологии, и может быть использовано для прогнозирования ранней гипогалактии - перед родами у беременных женщин при анализе анамнеза, течения настоящей беременности выявляют факторы риска гипогалактии. Проводят сравнительную оценку морфологии кристаллограмм секрета молочных желез, забираемого с началом родовой деятельности, в первые и вторые сутки послеродового периода. При отсутствии изменения морфологии кристаллограмм секрета молочных желез в первые, вторые сутки послеродового периода по сравнению с кристаллограммой, выполненной с началом родовой деятельности, в 100% прогнозируют раннюю гипогалактию. При отсутствии изменения морфологии кристаллограммы секрета молочных желез в первые сутки и изменении морфологии кристаллограммы во вторые сутки послеродового периода по сравнению с кристаллограммой, выполненной с началом родовой деятельности, с вероятностью в 70,3% прогнозируют раннюю гипогалактию, при этом изменение морфологии кристаллограммы в первые сутки послеродового периода по сравнению с кристаллограммой, выполненной с началом родовой деятельности, свидетельствует о физиологическом становлении лактации. Способ неинвазивен, безопасен для матери и ребенка, доступен, повышает точность прогнозирования ранней гипогалактии. 8 ил., 3 пр.

Изобретение относится к медицине, биологии, фармации и пищевой технологии применительно к исследованию гомолитических свойств липидов и их участия в свободнорадикальных реакциях окисления, а также - к осуществлению подбора антиоксидантов. Способ осуществляют путем экстрагирования из навески биоматериала жирорастворимого антиоксиданта в виде гептанового экстракта и водорастворимого антиоксиданта в виде изопропилового экстракта, насыщения пробы модельного субстрата каждого антиоксиданта кислородом с перемешиванием при температуре 60,0±0,2°C и определения объема поглощенного кислорода во времени волюмометрическим методом в термостатированной установке типа Варбурга с построением графика в координатах ΔV/t, последующим определением из кинетических кривых величины периода индукции (τi) и расчетом суммарной антиоксидантной активности компонентов биоматериала в составе модельного субстрата с учетом контрольных проб, не содержащих гептанового и изопропилового экстракта, причем модельный субстрат жирорастворимого антиоксиданта включает в себя: биоматериал, метиловый или этиловый эфир высших ненасыщенных жирных кислот, раствор азо-бис-изобутиронитрила (АИБН) в хлорбензоле в концентрации в пробе (2-60)×10-3 M, полученный образец доводят хлорбензолом до 2 мл, модельный субстрат водорастворимого антиоксиданта включает в себя: биоматериал, метиловый или этиловый эфир ненасыщенных жирных кислот, водный раствор хлорида меди (II) в концентрации в пробе (1-3)×10-3 М, водный раствор цетилтриметиламмония бромида (ЦТМАБ) в концентрации в пробе (1-5)×10-3 М, полученный образец доводят водой до 4 мл, а определение суммарной антиоксидантной активности жирорастворимых и водорастворимых компонентов биоматериала осуществляют из заданной расчетной зависимости. Достигаются повышение точности и ускорение определения. 1 табл., 4 пр.

Изобретение относится к области медицины и касается способов прогнозирования достижения ПМР у больных ТНР молочной железы. Проводят иммунногистохимическое исследование ткани опухоли. Для полученных параметров оценивают уровень экспрессии. Рассчитывают значение уравнения регрессии по формуле: Y=(5,38-16,2X1-11,2X2+5,98X3+12,4X4-5,39X5), где X1 - состояние регионарного лимфатического аппарата (0 - отсутствие метастатического поражения лимфатических узлов, 1 - поражение до 4 лимфатических узлов, 2 - поражение 4-9 лимфатических узлов, 3 - поражение 10 и более лимфатических узлов); X2 - уровень экспрессии EGFR1 (1 - менее 10%, 2 - 10% и более); X3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки (1 - менее 20%, 2 - 20% и более); X4 - уровень экспрессии Ki-67 (1 - менее 20%, 2 - 20% и более); X5 - уровень экспрессии VEGFR-2 (1 - менее 70%, 2 - 70% и более). Значение вероятности достижения ПМР - P рассчитывают по формуле: P=eY/(1+eY), где е - математическая константа, равная 2,72, и при P<0,5 прогнозируют низкую, а при P>0,5 высокую вероятность достижения ПМР у больных, получавших схему САХ. Способ прогнозирования позволяет прогнозировать достижение ПМР регрессий у больных ТНР, получивших курсы химиотерапии по схеме САХ. 5 табл., 2 пр.

Группа изобретений относится к области экспериментальной биологии и медицины для приготовления тотальных препаратов биологических тканей для оптической проекционной томографии, конфокальной, мультифотонной и светоплоскостной микроскопии и может быть использована для предклинических испытаний фармакологических препаратов и оценки физиологических воздействий на организм, а также для работы с материалом биопсий в диагностических и исследовательских целях. Способ иммуногистохимического окрашивания тотальных препаратов образцов биологической ткани включает фиксацию ткани раствором параформальдегида. Также способ включает постфиксацию, которую сначала проводят 0,5-1%-ным параформальдегидом в течение 48 ч при 4°C, а затем после трехкратной отмывки фосфатным буфером при комнатной температуре, в растворе 20%-ного диметилсульфоксида в 100%-ном метаноле в течение 1-2 ч при комнатной температуре. После этого образец ткани отбеливают в растворе, содержащем 100%-ный метанол:диметилсульфоксид: 30% Н2О2 в соотношении 4:1:1, в течение 2-4 ч на ярком свету при комнатной температуре до полного обесцвечивания. Затем образец отмывают 3 раза по 60 мин в 100%-ном метаноле при комнатной температуре и замораживают не менее чем на 1 час при -70…-80°C, после чего регидратируют последовательно в 50, 25 и 12,5%-ных растворах метанола в фосфатном буфере по 45-60 мин в каждом при комнатной температуре. Затем образцы трижды отмывают от метанола фосфатным буфером, причем два раза отмывают по 1-2 ч при комнатной температуре, а последнюю отмывку проводят в течение ночи при 4°C. Последующую пермеабилизацию образца проводят в фосфатном буфере, содержащем 2%-ный Triton Х-100, 5%-ную нормальную сыворотку, 5%-ный диметилсульфоксид, в течение 2 ч при комнатной температуре. Затем образец отмывают трижды в фосфатном буфере, содержащем 0,2%-ный Triton Х-100, причем два раза отмывают по 30-60 мин при комнатной температуре, а последнюю отмывку проводят в течение ночи при 4°C. После этого проводят инкубацию последовательно в растворах первичных и вторичных антител, приготовленных на буфере, состоящем из 0,05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, 5% диметилсульфоксид и 2,5-5,0% нормальной сыворотки животного-хозяина вторичных антител, при 4°C в течение 2-7 суток, с отмывками после каждой инкубации в буфере, состоящем из 0.05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, сначала 3 раза по 60 мин при комнатной температуре, а затем в течение ночи при 4°C. Окрашенные образцы дегидратируют последовательно в 50, 96%-ных растворах этанола в фосфатном буфере по 45-60 мин в каждом при комнатной температуре. Затем образцы выдерживают сначала в 100%-ном этаноле при комнатной температуре 2-3 раза по 45-60 мин, а после в 2-бутоксиэтаноле при 4°C в течение 12-18 ч. Дегидратированные образцы просветляют при комнатной температуре в смеси бензил бензоата:бензиловый спирт, взятых в соотношении 2:1 в течение 3-4 ч. При этом способ окрашивания, начиная с операции постфиксации, проводят при помешивании со скоростью 650-800 об/мин. Второй вариант способа заключается в том, что инкубацию проводят в растворе флуоресцентно-меченных первичных антител, приготовленных на буфере, состоящем из 0,05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, 5% диметилсульфоксид и 2,5-5.0% нормальной сыворотки, при 4°C в течение 2-7 суток. Достигаемый при этом технический результат заключается в осуществлении окрашивания тотальных препаратов образцов биологических тканей с сохранением их морфологии и обеспечением более широкого охвата выявляемых антигенов, а также в возможности проведения количественного анализа иммуногистохимически выявленных меток за счет высокого соотношения фон-сигнал и снижения аутофлуоресценции. 2 н. и 16 з.п. ф-лы, 2 ил., 2 пр.

Изобретение относится к ветеринарии и может быть использовано для снижения токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов с применением гомеопатических препаратов in vitro. Для этого к лейкоцитарной взвеси в объеме 0,5 мл добавляют 0,15 мл антибактериального препарата энрофлоксацин 5%. Затем полученный раствор помещают в термостат на 3 часа при Т=37±0,5°C, после инкубации вносят по 0,5 мл гомеопатического препарата, разведенного в физиологическом растворе в выбранном разведении С6, С12, С30, С200. После этого пробирки вновь помещают в термостат на 4 часа при Т=37±0,5°C и затем вносят взвесь микроорганизмов референтного штамма Staphylococcus albus №182 по 0,5 мл, содержащего 109 КОЕ в 1 мл физиологического раствора. Далее помещают в термостат на 30 минут при Т=37±0,5°C, после инкубации мазки крови фиксируют в спирт-формалине 1:9, 40% раствор формалина и 96° спирта, в течение 10 минут и окрашивают по Романовскому - Гимзе в течение 30 минут. Использование данного способа позволяет in vitro оценить влияние гомеопатических препаратов на снижение токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов. 4 табл.

Изобретение относится к области медицины, а именно к педиатрии, и описывает способ диагностики муковисцидоза. Способ характеризуется тем, что определяют концентрации Na, В и Pb в пробоподготовленных волосах детей раннего возраста методами атомной эмиссионной спектрометрии с индукционно связанной аргоновой плазмой и/или масс-спектрометрии с индуктивно связанной аргоновой плазмой, при этом у больных муковисцидозом относительно контрольной группы увеличивается содержание Na и В соответственно в 8,5; 3,3 раза и уменьшается содержание Pb в 1,3 раза. Предложенный способ является простым в исполнении, достоверным. Изобретение может использоваться при диагностике муковисцидоза у детей с первых дней жизни. 1 табл.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для ранней диагностики первичной открытоугольной глаукомы. Для этого проводят измерение и оценку внутриглазного давления, исследование полей зрения и слезной жидкости с последующим определением уровня провоспалительных и противоспалительных цитокинов с дополнительным определением их уровня в сыворотке крови. При повышении соотношения в сыворотке крови ИФ-γ/ИЛ-4, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 у пациентов с подозрением на глаукому уровня коэффициентов цитокинов, равных значению 3,66±1,77, 1,9±0,47, 1,20±0,32 соответственно, у пациентов с начальной стадией первичной открытоугольной глаукомы соотношения ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 уровня коэффициентов цитокинов, равных значению 1,85±0,44, 1,48±0,34, 2,85±0,74, 2,42±0,71 соответственно, а также при повышении соотношения в слезной жидкости ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 у пациентов с подозрением на глаукому уровня коэффициентов цитокинов, равных значению 1,11±0,19, 1,06±0,09, 3,81±0,63, 4,04±0,36 соответственно, а у пациентов с начальной стадией первичной открытоугольной глаукомы повышением соотношения ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10 уровня коэффициентов цитокинов, равных значению 1,26±0,22, 0,84±0,08, 3,98±0,61 соответственно, диагностируют первичную открытоугольную глаукому. Способ позволяет упростить раннюю диагностику заболевания при его высокой точности и информативности. 4 ил.
Изобретение относится к медицине, а именно к способу определения адаптационной способности пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для этого методом иммуноферментного анализа определяют количественный уровень биомаркеров в ротовой жидкости пациента до или не ранее чем через 30 мин после приема пищи. В качестве биомаркера выбирают матриксную металлопротеиназу 2 (ММП 2) или матриксную металлопротеиназу 8 (ММП 8). Для группы клинического сравнения ММП 2 принимают уровень 1,89-2,69 нг/мл; при уровне 4,2-6,6 нг/мл диагностируют низкую адаптационную способность, а при 2,9-3,8 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для группы клинического сравнения ММП 8 принимают уровень 21,65-41,85 нг/мл; при уровне 433,0-1011,6 нг/мл диагностируют низкую адаптационную способность, а при 52,8-186,3 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Изобретение позволяет повысить точность экспресс-диагностики адаптационной способности к съемным пластиночным конструкциям ортопедических протезов пациента с новообразованиями челюстно-лицевой области в день обращения пациента. 2 з.п. ф-лы, 6 пр.
Изобретение относится к медицине, а именно к оториноларингологии, и может быть использовано для лечения больных риносинуситом с болевым симптомом. Для этого в сыворотке крови больного до начала лечения определяют уровень субстанции Р. При значении уровня субстанции Р 2000 пг/мл и более в схему общепринятой терапии с первого дня лечения в течение 5 дней включают препараты Преднизолон и Мильгамму. Преднизолон в дозе 30 мг 1 раз в день вводят перорально. Мильгамму вводят внутримышечно в дозе 2 мл 1 раз в день. Способ позволяет повысить эффективность лечения больных риносинуситом за счет расширения функциональных возможностей общепринятой стандартной терапии при сокращении сроков купирования болевого симптома. 2 пр.
Наверх