Способ прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком молочной железы, получавших курсы химиотерпии по схеме сах


 


Владельцы патента RU 2563180:

Федеральное государственное бюджетное учреждение "Научно-исследовательский институт онкологии" Сибирского отделения Российской академии медицинских наук (ФГБУ "НИИ онкологии" СО РАМН) (RU)

Изобретение относится к области медицины и касается способов прогнозирования достижения ПМР у больных ТНР молочной железы. Проводят иммунногистохимическое исследование ткани опухоли. Для полученных параметров оценивают уровень экспрессии. Рассчитывают значение уравнения регрессии по формуле: Y=(5,38-16,2X1-11,2X2+5,98X3+12,4X4-5,39X5), где X1 - состояние регионарного лимфатического аппарата (0 - отсутствие метастатического поражения лимфатических узлов, 1 - поражение до 4 лимфатических узлов, 2 - поражение 4-9 лимфатических узлов, 3 - поражение 10 и более лимфатических узлов); X2 - уровень экспрессии EGFR1 (1 - менее 10%, 2 - 10% и более); X3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки (1 - менее 20%, 2 - 20% и более); X4 - уровень экспрессии Ki-67 (1 - менее 20%, 2 - 20% и более); X5 - уровень экспрессии VEGFR-2 (1 - менее 70%, 2 - 70% и более). Значение вероятности достижения ПМР - P рассчитывают по формуле: P=eY/(1+eY), где е - математическая константа, равная 2,72, и при P<0,5 прогнозируют низкую, а при P>0,5 высокую вероятность достижения ПМР у больных, получавших схему САХ. Способ прогнозирования позволяет прогнозировать достижение ПМР регрессий у больных ТНР, получивших курсы химиотерапии по схеме САХ. 5 табл., 2 пр.

 

Изобретение относится к области медицины, конкретно к онкологии, и касается способов прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком (ТНР) молочной железы, получающих курсы химиотерапии по схеме САХ.

На сегодняшний день химиотерапия в системном лечении больных трипл-негативным раком активно используется в неоадъювантном режиме, что, прежде всего, позволяет оценить чувствительность опухоли к проводимой терапии за достаточно короткий период. Наиболее важным показателем, учитываемым при этом, является достижение полной морфологической регрессии (ПМР), которая является предикторами благоприятного исхода у данного типа рака молочной железы, имеющего достаточно агрессивное клиническое течение и неблагоприятный прогноз заболевания.

В отсутствие таргетных мишеней в настоящее время активно ведется поиск наиболее эффективных цитостатиков [1, 2], использование которых позволяло бы достигать большее количество ПМР у больных операбельным трипл-негативным раком молочной железы [3, 4]. Наиболее часто используются схемы с включением антрациклинов (FAC, FEC), таксанов (Т-FAC, АС-Т, таксотер в монорежиме) и препаратов платины (в монорежиме, в сочетании с другими цитостатиками) [5, 6].

В последние годы активно изучается эффективность препарата капецитабин (кселода), применяемого в различных схемах химиотерапии для лечения больных операбельными формами ТНР МЖ. Он активируется в ткани опухоли и оказывает селективное цитотоксическое действие под воздействием фермента тимидилатсинтетазы, которая осуществляет превращение капецитабина в активное вещество 5-фторурацил [7, 8].

В изученных литературных источниках не обнаружен способ прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком молочной железы, получавших курсы химиотерапии по схеме САХ.

Новый технический результат - создание способа прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком, получивших курсы химиотерапии по схеме САХ.

Для достижения нового технического результата в способе прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком молочной железы, получающих курсы химиотерапии по схеме САХ, характеризующийся тем, что проводят иммунногистохимическое исследование ткани опухоли биопсийного материала у больных с отрицательным рецепторным фенотипом и определяют такие молекулярные параметры, как маркер клеточной пролиферации Ki-67, эпидермальный фактор роста EGFR1, рецепторы к эндотелиальному фактору роста и экспрессию фермента тимидилатфосфорилазы в цитоплазме опухолевой клетки, для всех параметров оценивают уровень экспрессии: к низкому уровню Ki-67 относят показатели менее 20%, к высокому - 20% и более, к низкому уровню EGFR1 относят показатели менее 10%, высокому - 10% и выше, к низкому уровню VEGFR-2 относят показатели менее 70%, к высокому - 70% и более, к низкому уровню тимидилатфосфорилазы относят показатели менее 20%, к высокому- 20% и более, рассчитывают значение уравнения регрессии Y по формуле

Y=5,38-16,2X1-11,2Х2+5,98Х3+12,4X4-5,39Х5,

где Y - значение уравнения регрессии;

5.38 - значение коэффициента регрессии свободного члена;

X1 - состояние регионарного лимфатического аппарата, равное 0, - при отсутствии метастатического поражения лимфатических узлов, 1 - при поражении до 4 лимфатических узлов, 2 - при поражении 4-9 лимфатических узлов, 3 - при поражении 10 и более лимфатических узлов,

16,2 - значение коэффициента регрессии этого признака;

Х2 - уровень экспрессии EGFR1 в биопсийном материале опухолевой ткани, равный 1, - при уроне менее 10%, 2 - при уровне 10% и более,

11,2 - значение коэффициента регрессии этого признака.

Х3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки в биопсийном материале, равный 1, - при уровне менее 20%, 2 - при уровне 20% и более,

5,98 - значение коэффициента регрессии этого признака.

Х4- уровень экспрессии Ki-67 в биопсийном материале опухолевой ткани, равный 1, - при уровне экспрессии менее 20%, 2 - при уровне 20% и более,

12,4 - значение коэффициента регрессии этого признака;

Х5 - уровень экспрессии VEGFR-2 в биопсийном материале опухолевой ткани, равный 1 - при уровне экспрессии менее 70%, 2 - при уровне экпрессии 70% и более,

5.39 - значение коэффициента регрессии этого признака;

значение вероятности достижения полных морфологических регрессий Р рассчитывают по формуле

Р=eY/(l+eY),

где е - математическая константа, равная 2,72,

и при Р<0,5 прогнозируют низкую, а при Р>0,5 - высокую вероятность достижения ПМР у больных, получавших схему САХ.

Способ осуществляется следующим образом

У больных трипл-негативным раком молочной железы, получающих курсы химиотерапии по схеме САХ, оценивается состояние лимфатического аппарата. С помощью иммунногистохимического исследования ткани опухоли биопсийного материала у больных с отрицательным рецепторным фенотипом определяют такие молекулярные параметры, как маркер клеточной пролиферации Ki-67, эпидермальный фактор роста EGFR1, рецепторы к эндотелиальному фактору роста и экспрессию фермента тимидилатфосфорилазы в цитоплазме опухолевой клетки. Для всех параметров оценивают уровень экспрессии: для Ki-67 к низкому уровню относят показатели менее 20%, к высокому - 20% и более, для EGFR к низкому - менее 10%, высокому - 10% и выше, для VEGFR-2 к низкому - менее 70%, высокий - 70% и более, для тимидилатфосфорилазы к низкому - менее 20%, высокому - 20% и более. Рассчитывают значение уравнения регрессии Y по формуле

Y=5,38-16,2X1-11,2Х2+5,98Х3+12,4X4-5,39Х5,

где Y - значение уравнения регрессии;

5.38 - значение коэффициента регрессии свободного члена;

X1 - состояние регионарного лимфатического аппарата, равное 0, - при отсутствии метастатического поражения лимфатических узлов, 1 - при поражении до 4 лимфатических узлов, 2 - при поражении 4-9 лимфатических узлов, 3 - при поражении 10 и более лимфатических узлов,

16,2 - значение коэффициента регрессии этого признака;

Х2 - уровень экспрессии EGFR1 в биопсийном материале опухолевой ткани, равный 1, -при уроне менее 10%, 2 - при уровне 10% и более,

11,2 - значение коэффициента регрессии этого признака.

Х3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки в биопсийном материале, равный 1, - при уровне менее 20%, 2 - при уровне 20% и более,

5,98 - значение коэффициента регрессии этого признака.

X4 - уровень экспрессии Ki-67 в биопсийном материале опухолевой ткани, равный 1, - при уровне экспрессии менее 20%, 2 - при уровне 20% и более,

12,4 - значение коэффициента регрессии этого признака;

Х5 - уровень экспрессии VEGFR-2 в биопсийном материале опухолевой ткани, равный 1, - при уровне экспрессии менее 70%, 2 - при уровне экпрессии 70% и более,

5.39 - значение коэффициента регрессии этого признака;

значение вероятности достижения полных морфологических регрессий Р рассчитывают по формуле

Р=eY/(l+eY),

где е - математическая константа, равная 2,72, и при Р<0,5 прогнозируют низкую, а при Р>0,5 - высокую вероятность достижения ПМР у больных, получавших схему САХ.

Сущность предлагаемого способа иллюстрируется следующими примерами.

Пример 1. Больная Л., 39 лет с трипл-негативным раком молочной железы IIA стадия (T2N0M0) без вовлечения в процесс лимфатических узлов (0) получила 4 курса НАХТ по схеме САХ (2). При ретроспективном анализе результатов иммуногистохимического исследования опухоль характеризовалась высоким уровнем экспрессии EGFR1 (2) и Ki-67 (2) и низкими показателями VEGFR-2 (1) и ТФ (1).

Значение уравнения регрессии оценивали по формуле

Y=(5,38-16,2X1-11,2X2+5,98X3+12,4X4-5,39X5)=5,38-16,2×0-11,2×2+5,98×2+12,4×1+5,39×1=0,24.

Значение вероятности достижения ПМР определяли по формуле Р=eY/(1+eY)=2,720,24/(1+2,720,24)=0,99.

Вероятность достижения ПМР была высокая и составила 99%. Это соответствовало данным, которые были получены после проведения НАХТ, эффективность составила 100% (полная морфологическая регрессия).

Пример 2. Больная С., 50 лет с трипл-негативным раком молочной железы IIB стадия (T2N1M0) с вовлечением в опухолевый процесс 1 лимфатического узла (1) получила 4 курса НАХТ по схеме САХ. При ретроспективном анализе результатов иммуногистохимического исследования опухоль характеризовалась высокими показателями EGFR1 (2), Ki-67 (2), VEGFR-2 (2) и ТФ (2).

Значение уравнения регрессии оценивали по формуле

Y=(5,38-16,2X1-11,2X2+5,98X3+12,4X4-5,39X5)=5,38-16,2×1-11,2×2+5,98×2+12,4×2+5,39×2=0,00.

Значение вероятности достижения ПМР определяли по формуле Р=eY/(1+eY)=2,720,00/(1+2,720,00)=0,00.

Вероятность достижения ПМР была низкая и составила 0%. Это соответствовало данным, которые были получены после проведения НАХТ, эффективность НАХТ - прогрессирование опухолевого процесса.

Способ основан на анализе данных клинических наблюдений.

В исследование было включено 43 больных операбельным трипл-негативным раком молочной железы (T2-3N0-2M0), получивших по 2-4 курса НАХТ по схеме САХ (циклофосфан 100 мг/м2, внутримышечно в течение 14 дней, адриамицин 30 мг/м2 внутривенно в 1-й и 8-й дни, капецитабин 1000 мг/м2 2 раза в день, per os, в течение 14 дней, через 21 день) на базе отделения общей онкологии ФГБУ НИИ Онкологии СО РАМН в период с 2007 по 2013 гг. Средний возраст пациенток составил 50±7,4 лет.

После курсов НАХТ следовал хирургический этап в объеме секторальной резекции, аксиллярной лимфаденэктомии или радикальной мастэктомии. Всем больным в адъювантном режиме проводилось по 2-4 курса химиотерапии по схеме FAC, лучевая терапия назначалась по показаниям.

Морфологическое и иммуногистохимическое исследование биопсийного материала опухоли осуществлялось по стандартной методике.

Для выявления тройного отрицательного фенотипа (РЭ, РП-, Her-2/neu-) использовались антитела фирмы «Dako» к рецепторам эстрогена (клон 1D5, RTU, мышиные), к рецепторам прогестерона (клон PgR636, RTU, мышиные), к онкопротеину с - erbB - 2 (HER2/neu статус) (рабочее разведение 1:500, кроличьи).

Всем больным определялся уровень маркера клеточной пролиферации Ki67 (клон MIB-1, RTU, мышиные) (к низкому уровню относились показатели менее 20%, к высокому - 20% и более). Также оценивалась экспрессия эпидермального фактора роста EGFR1 (клон SP9, рабочее разведение 1:600, кроличьи, фирмы Diagnostic BioSystems), рецептора к эндотелиальному фактору роста-2 VEGFR-2 и фермента тимидилатсинтетазы в цитоплазме опухолевой клетки. Экспрессия оценивалась в процентном содержании положительно окрашенных клеток в 10 полях зрения на 1000 клеток при увеличении ×400.

К низкому уровню Ki-67 относились показатели менее 20%, к высокому - 20% и более. К низкому уровню экспрессии EGFR1 относились показатели менее 10%, к высокому - 10% и более. К низкому уровню экспрессии VEGFR-2 относились показатели менее 70%, к высокому - 70% и более. К низкому уровню экспрессии тимидилатсинтетазы - показатели менее 20%, к высокому - 20% и более.

Непосредственная эффективность НАХТ оценивалась по шкале RECIST на основании данных клинического осмотра, УЗИ молочных желез и маммографии. Статистическая обработка результатов выполнялась с помощью пакета программ «Statistica 7.0 for Windows».

Для прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком молочной железы, получающих курсы химиотерапии по схеме САХ, использовался метод логистической регрессии. Была определена формула

Y=(5,38-16,2X1-11,2X2+5,98X3+12,4X4-5,39X5),

Где Y - значение уравнения регрессии;

(5,38) - значение коэффициента регрессии свободного члена;

X1 - состояние регионарного лимфатического аппарата (0 - отсутствие метастатического поражения лимфатических узлов, 1 - поражение до 4 лимфатических узлов, 2 - поражение 4-9 лимфатических узлов, 3 - поражение 10 и более лимфатических узлов), (16,2) - значение коэффициента регрессии этого признака.

X2 - уровень экспрессии EGFR1 в биопсийном материале опухолевой ткани (1 - менее 10%, 2 - 10% и более), (11,2) - значение коэффициента регрессии этого признака.

X3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки в биопсийном материале (1 - менее 20%, 2 - 20% и более), (5,98) - значение коэффициента регрессии этого признака.

X4 - уровень экспрессии Ki-67 в биопсийном материале опухолевой ткани (1 - менее 20%, 2 - 20% и более), (12,4) - значение коэффициента регрессии этого признака.

X5 - уровень экспрессии VEGFR-2 в биопсийном материале опухолевой ткани (1 - менее 70%, 2 - 70% и более), (5,39) - значение коэффициента регрессии этого признака.

Значение вероятности достижения полных морфологических регрессий определяется по формуле

Р=eY(1+eY),

где е - математическая константа, равная 2,72.

и при P<0,5 прогнозируют низкую вероятность достижения ПМР, а при P>0,5 - высокую у больных, получавших схему САХ.

Чувствительность - 100%; специфичность - 100%.

При анализе достижения полных морфологических регрессий у больных операбельным трипл-негативным раком в зависимости от параметров, вошедших в прогностическую модель, оказалось, что достижение ПМР наиболее часто отмечалось при отсутствии метастатического поражения регионарных лимфатических узлов (p=0,0000) (табл. 1), высокой экспрессии EGFR1 (p=0,0007) (табл. 2), Ki-67 (p=0,0001) (табл. 3), фермента тимидилатфосфорилазы в цитоплазме опухоли (p=0,017) (табл. 4) и VEGFR-2 (р-0,017) (табл. 5).

Таким образом, предлагаемый способ позволяет с высокой точностью и информативностью прогнозировать достижение ПМР у больных трипл-негативным раком молочной железы при использовании схемы химиотерапии с включением капецитабина, что позволит оптимизировать планирование и подходы к лечению данной категории пациентов.

Источники информации

1. Amos K.D., Adamo В., Anders C.K. «Triple-negative Breast Cancer: An Update on Neoadjuvant Clinical Trials» International Journal of Breast Cancer 2012.

2. Smith I.E. «Neoadjuvant/presurgical treatment» Breast Cancer Research 2008, 10.

3. Reis-Filho J.S., Tutt A.N. «Triple-negative tumors: a critical review» Histopathology 2008, 52, 108-118.

4. Liedtke C., Mazouni С., Hess K.R. et al. «Response to Neoadjuvant therapy and Long-Term survival in patients with Triple-negative breast cancer» Journal of Clinical Oncology 2008, Volume.

5. Hawk N., O`Regan R. «Treatment of Triple-negative breast cancer» Community Oncology 2010; 7: 328-332.

6. Gluz O., Liedtke C., Gottscchalk N., Pusztai L., Nitz U., Harbeck N. Triple-negative breast cancer - current status and future directions. Annals of Oncology 2009; 20: 1913-1927.

7. Lindman H., Kellokumpu-Lehtinen P-L., Huovinen R. Integration of capecitabine into anthracycline- and taxane-based adjuvant therapy for triple-negative early breast cancer: final subgroup analysis of the FinXX study. SABCS 2010. Abstract PD01-02.

8. Steger G.G., Barrios C., O'Shaughnessy J., Martin M., Gnant M. Abstract PD01-03: Review of Capecitabine for the Treatment of Triple-Negative Early Breast Cancer. Cancer Res 2010. 70 (24 Suppl): Abstract nr PD01-03.

Приложение

Таблица 1

Достижение полных морфологических регрессий у больных, получавших НАХТ по схеме САХ в зависимости от состояния регионарных л/у

Таблица 2

Достижение полных морфологических регрессий у больных, получавших НАХТ по схеме САХ в зависимости от уровня EGFR1

Таблица 3

Достижение полных морфологических регрессий у больных, получавших НАХТ по схеме САХ в зависимости от уровня Ki-67

Таблица 4

Достижение полных морфологических регрессий у больных, получавших НАХТ по схеме САХ в зависимости от уровня тимидилатфосфорилазы в цитоплазме опухоли

Таблица 5

Достижение полных морфологических регрессий у больных, получавших НАХТ по схеме САХ в зависимости от уровня тимидилатфосфорилазы в цитоплазме опухоли

Способ прогнозирования достижения полных морфологических регрессий у больных трипл-негативным раком молочной железы, получающих курсы химиотерапии по схеме САХ, характеризующийся тем, что проводят иммунногистохимическое исследование ткани опухоли биопсийного материала у больных с отрицательным рецепторных фенотипом и определяют такие молекулярные параметры как маркер клеточной пролиферации Ki-67, эпидермальный фактор роста EGFR1, рецепторы к эндотелиальному фактору роста и экспрессию фермента тимидилатфосфорилазы в цитоплазме опухолевой клетки, для всех параметров оценивают уровень экспрессии: к низкому уровню Ki-67 относят показатели менее 20%, к высокому - 20% и более, к низкому уровню EGFR1 относят показатели менее 10%, высокому - 10% и выше, к низкому уровню VEGFR-2 относят показатели менее 70%, к высокому - 70% и более, к низкому уровню тимидилатфосфорилазы относят показатели менее 20%, к высокому - 20% и более, рассчитывают значение уравнения регрессии Y по формуле
Y=5,38-16,2X1-11,2Х2+5,98Х3+12,4X4-5,39Х5,
где Y - значение уравнения регрессии;
5,38 - значение коэффициента регрессии свободного члена;
X1 - состояние регионарного лимфатического аппарата, равное 0, при отсутствии метастатического поражения лимфатических узлов, 1 - при поражении до 4 лимфатических узлов, 2 - при поражении 4-9 лимфатических узлов, 3 - при поражении 10 и более лимфатических узлов,
16,2 - значение коэффициента регрессии этого признака;
Х2 - уровень экспрессии EGFR1 в биопсийном материале опухолевой ткани, равный 1- при уроне менее 10%, 2 - при уровне 10% и более,
11,2 - значение коэффициента регрессии этого признака.
Х3 - уровень экспрессии тимидилатфосфорилазы в цитоплазме опухолевой клетки в биопсийном материале, равный 1 - при уровне менее 20%, 2 - при уровне 20% и более,
5,98 - значение коэффициента регрессии этого признака.
Х4 - уровень экспрессии Ki-67 в биопсийном материале опухолевой ткани, равный 1- при уровне экспрессии менее 20%, 2 - при уровне 20% и более,
12,4 - значение коэффициента регрессии этого признака;
Х5 - уровень экспрессии VEGFR-2 в биопсийном материале опухолевой ткани, равный 1- при уровне экспрессии менее 70%, 2 - при уровне экпрессии 70% и более,
5,39 - значение коэффициента регрессии этого признака;
значение вероятности достижения полных морфологических регрессий Р рассчитывают по формуле
Р=eY/(l+eY),
где е - математическая константа, равная 2,72,
и при Р<0,5 прогнозируют низкую, а при Р>0,5 - высокую вероятность достижения ПМР у больных, получавших схему САХ.



 

Похожие патенты:

Изобретение относится к медицине, биологии, фармации и пищевой технологии применительно к исследованию гомолитических свойств липидов и их участия в свободнорадикальных реакциях окисления, а также - к осуществлению подбора антиоксидантов.

Изобретение относится к области медицины, а именно к акушерству и гинекологии, и может быть использовано для прогнозирования ранней гипогалактии - перед родами у беременных женщин при анализе анамнеза, течения настоящей беременности выявляют факторы риска гипогалактии.
Изобретение относится к медицине, а именно к способу прогнозирования синдрома задержки внутриутробного развития плода в третьем триместре гестации при реактивации хронической цитомегаловирусной инфекции (ЦМВ) у женщин с угрозой невынашивания во втором триместре беременности.

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при ранней диагностике шизофрении. Способ включает генетический анализ Vall58Met полиморфизма гена катехол-О-метил-трансферазы, при этом у носителей гаплотипа Met/Met проводят избирательную оценку предстимульного торможения и базового латентного периода акустической стартл-реакции.

Изобретение относится к области судебно-медицинской экспертизы, а именно к тестовым наборам, и позволяет произвести тестирование спермы в пятнах на исследуемом образце.

Изобретение относится к медицине и может быть использовано для диагностики опухолей головного мозга (ОГМ). Для этого путем электронной феноменологической спектроскопии измеряют оптическую плотность плазмы крови человека в видимой и ультрафиолетовой области спектра.
Изобретение относится к медицине, а именно к способу прогнозирования рецептивности эндометрия в циклах экстракорпорального оплодотворения (ЭКО). Сущность способа состоит в том, что определяют оптическую плотность экспрессии лейкемия ингибирующего фактора (LIF) в поверхностном и железистом эпителии эндометрия в период окна имплантации в цикле, предшествующем проведению экстракорпорального оплодотворения, и дополнительно определяют содержание сосудистого эндотелиального фактора роста (VEGF) в цервикальной слизи в день трансвагинальной пункции фолликулов, систолодиастолическое отношение (S/D) и индекс резистентности (IR) спиральных артерий в день введения триггера овуляции, а затем рассчитывают значение регрессионной функции (Z) по формуле.
Изобретение относится к медицине, а именно к микологии и дерматовенерологии, и может быть использовано для диагностики микроспории. Способ включает выделение тотальной нативной ДНК из кожи и волос, специфическую амплификацию фрагмента гена 5.8S рРНК Trichophyton verrucosum с использованием праймеров следующей структуры: 5′ CCACGATAGGGATCAGCGTT 3′, 5′ GAAAGTTTTAACTGATTTTGCTTG 3′.

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для дифференциальной диагностики высокодифференцированной эндометриоидной аденокарциномы тела матки.
Изобретение относится к медицине и предназначено для диагностики обострения язвенного колита. Проводят исследование иммунного статуса в сыворотке крови, определяют уровень циркулирующих иммунных комплексов и при повышении циркулирующих иммунных комплексов C1q до 60,8 ед./мл и выше уровня циркулирующих иммунных комплексов C3d до 39,0 ед./мл и выше и С-реактивного белка до 10,2 мг/л и выше диагностируют обострение язвенного колита.

Группа изобретений относится к области экспериментальной биологии и медицины для приготовления тотальных препаратов биологических тканей для оптической проекционной томографии, конфокальной, мультифотонной и светоплоскостной микроскопии и может быть использована для предклинических испытаний фармакологических препаратов и оценки физиологических воздействий на организм, а также для работы с материалом биопсий в диагностических и исследовательских целях. Способ иммуногистохимического окрашивания тотальных препаратов образцов биологической ткани включает фиксацию ткани раствором параформальдегида. Также способ включает постфиксацию, которую сначала проводят 0,5-1%-ным параформальдегидом в течение 48 ч при 4°C, а затем после трехкратной отмывки фосфатным буфером при комнатной температуре, в растворе 20%-ного диметилсульфоксида в 100%-ном метаноле в течение 1-2 ч при комнатной температуре. После этого образец ткани отбеливают в растворе, содержащем 100%-ный метанол:диметилсульфоксид: 30% Н2О2 в соотношении 4:1:1, в течение 2-4 ч на ярком свету при комнатной температуре до полного обесцвечивания. Затем образец отмывают 3 раза по 60 мин в 100%-ном метаноле при комнатной температуре и замораживают не менее чем на 1 час при -70…-80°C, после чего регидратируют последовательно в 50, 25 и 12,5%-ных растворах метанола в фосфатном буфере по 45-60 мин в каждом при комнатной температуре. Затем образцы трижды отмывают от метанола фосфатным буфером, причем два раза отмывают по 1-2 ч при комнатной температуре, а последнюю отмывку проводят в течение ночи при 4°C. Последующую пермеабилизацию образца проводят в фосфатном буфере, содержащем 2%-ный Triton Х-100, 5%-ную нормальную сыворотку, 5%-ный диметилсульфоксид, в течение 2 ч при комнатной температуре. Затем образец отмывают трижды в фосфатном буфере, содержащем 0,2%-ный Triton Х-100, причем два раза отмывают по 30-60 мин при комнатной температуре, а последнюю отмывку проводят в течение ночи при 4°C. После этого проводят инкубацию последовательно в растворах первичных и вторичных антител, приготовленных на буфере, состоящем из 0,05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, 5% диметилсульфоксид и 2,5-5,0% нормальной сыворотки животного-хозяина вторичных антител, при 4°C в течение 2-7 суток, с отмывками после каждой инкубации в буфере, состоящем из 0.05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, сначала 3 раза по 60 мин при комнатной температуре, а затем в течение ночи при 4°C. Окрашенные образцы дегидратируют последовательно в 50, 96%-ных растворах этанола в фосфатном буфере по 45-60 мин в каждом при комнатной температуре. Затем образцы выдерживают сначала в 100%-ном этаноле при комнатной температуре 2-3 раза по 45-60 мин, а после в 2-бутоксиэтаноле при 4°C в течение 12-18 ч. Дегидратированные образцы просветляют при комнатной температуре в смеси бензил бензоата:бензиловый спирт, взятых в соотношении 2:1 в течение 3-4 ч. При этом способ окрашивания, начиная с операции постфиксации, проводят при помешивании со скоростью 650-800 об/мин. Второй вариант способа заключается в том, что инкубацию проводят в растворе флуоресцентно-меченных первичных антител, приготовленных на буфере, состоящем из 0,05 М Tris-HCl с pH 7,5; 0,15 М NaCl; 0,2% Triton Х-100, 5% диметилсульфоксид и 2,5-5.0% нормальной сыворотки, при 4°C в течение 2-7 суток. Достигаемый при этом технический результат заключается в осуществлении окрашивания тотальных препаратов образцов биологических тканей с сохранением их морфологии и обеспечением более широкого охвата выявляемых антигенов, а также в возможности проведения количественного анализа иммуногистохимически выявленных меток за счет высокого соотношения фон-сигнал и снижения аутофлуоресценции. 2 н. и 16 з.п. ф-лы, 2 ил., 2 пр.

Изобретение относится к ветеринарии и может быть использовано для снижения токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов с применением гомеопатических препаратов in vitro. Для этого к лейкоцитарной взвеси в объеме 0,5 мл добавляют 0,15 мл антибактериального препарата энрофлоксацин 5%. Затем полученный раствор помещают в термостат на 3 часа при Т=37±0,5°C, после инкубации вносят по 0,5 мл гомеопатического препарата, разведенного в физиологическом растворе в выбранном разведении С6, С12, С30, С200. После этого пробирки вновь помещают в термостат на 4 часа при Т=37±0,5°C и затем вносят взвесь микроорганизмов референтного штамма Staphylococcus albus №182 по 0,5 мл, содержащего 109 КОЕ в 1 мл физиологического раствора. Далее помещают в термостат на 30 минут при Т=37±0,5°C, после инкубации мазки крови фиксируют в спирт-формалине 1:9, 40% раствор формалина и 96° спирта, в течение 10 минут и окрашивают по Романовскому - Гимзе в течение 30 минут. Использование данного способа позволяет in vitro оценить влияние гомеопатических препаратов на снижение токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов. 4 табл.

Изобретение относится к области медицины, а именно к педиатрии, и описывает способ диагностики муковисцидоза. Способ характеризуется тем, что определяют концентрации Na, В и Pb в пробоподготовленных волосах детей раннего возраста методами атомной эмиссионной спектрометрии с индукционно связанной аргоновой плазмой и/или масс-спектрометрии с индуктивно связанной аргоновой плазмой, при этом у больных муковисцидозом относительно контрольной группы увеличивается содержание Na и В соответственно в 8,5; 3,3 раза и уменьшается содержание Pb в 1,3 раза. Предложенный способ является простым в исполнении, достоверным. Изобретение может использоваться при диагностике муковисцидоза у детей с первых дней жизни. 1 табл.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для ранней диагностики первичной открытоугольной глаукомы. Для этого проводят измерение и оценку внутриглазного давления, исследование полей зрения и слезной жидкости с последующим определением уровня провоспалительных и противоспалительных цитокинов с дополнительным определением их уровня в сыворотке крови. При повышении соотношения в сыворотке крови ИФ-γ/ИЛ-4, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 у пациентов с подозрением на глаукому уровня коэффициентов цитокинов, равных значению 3,66±1,77, 1,9±0,47, 1,20±0,32 соответственно, у пациентов с начальной стадией первичной открытоугольной глаукомы соотношения ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 уровня коэффициентов цитокинов, равных значению 1,85±0,44, 1,48±0,34, 2,85±0,74, 2,42±0,71 соответственно, а также при повышении соотношения в слезной жидкости ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 у пациентов с подозрением на глаукому уровня коэффициентов цитокинов, равных значению 1,11±0,19, 1,06±0,09, 3,81±0,63, 4,04±0,36 соответственно, а у пациентов с начальной стадией первичной открытоугольной глаукомы повышением соотношения ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10 уровня коэффициентов цитокинов, равных значению 1,26±0,22, 0,84±0,08, 3,98±0,61 соответственно, диагностируют первичную открытоугольную глаукому. Способ позволяет упростить раннюю диагностику заболевания при его высокой точности и информативности. 4 ил.
Изобретение относится к медицине, а именно к способу определения адаптационной способности пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для этого методом иммуноферментного анализа определяют количественный уровень биомаркеров в ротовой жидкости пациента до или не ранее чем через 30 мин после приема пищи. В качестве биомаркера выбирают матриксную металлопротеиназу 2 (ММП 2) или матриксную металлопротеиназу 8 (ММП 8). Для группы клинического сравнения ММП 2 принимают уровень 1,89-2,69 нг/мл; при уровне 4,2-6,6 нг/мл диагностируют низкую адаптационную способность, а при 2,9-3,8 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для группы клинического сравнения ММП 8 принимают уровень 21,65-41,85 нг/мл; при уровне 433,0-1011,6 нг/мл диагностируют низкую адаптационную способность, а при 52,8-186,3 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Изобретение позволяет повысить точность экспресс-диагностики адаптационной способности к съемным пластиночным конструкциям ортопедических протезов пациента с новообразованиями челюстно-лицевой области в день обращения пациента. 2 з.п. ф-лы, 6 пр.
Изобретение относится к медицине, а именно к оториноларингологии, и может быть использовано для лечения больных риносинуситом с болевым симптомом. Для этого в сыворотке крови больного до начала лечения определяют уровень субстанции Р. При значении уровня субстанции Р 2000 пг/мл и более в схему общепринятой терапии с первого дня лечения в течение 5 дней включают препараты Преднизолон и Мильгамму. Преднизолон в дозе 30 мг 1 раз в день вводят перорально. Мильгамму вводят внутримышечно в дозе 2 мл 1 раз в день. Способ позволяет повысить эффективность лечения больных риносинуситом за счет расширения функциональных возможностей общепринятой стандартной терапии при сокращении сроков купирования болевого симптома. 2 пр.

Группа изобретений относится к медицине, онкологии и касается формирования плана индивидуальной терапии пациента. Способ включает формирование исходного плана терапии с помощью вероятностной модели осложнения здоровой ткани (NTCP) и вероятностной модели подавления опухоли (TCP) целевой области. Модели NTCP и TCP адаптируют на основании начальных количественных значений набора биомаркеров пациента. После применения исходной терапии формируют исправленный план терапии с помощью моделей NTCP и TCP, адаптированных на основании обновленных после применения терапии количественных значений набора биомаркеров. Начальные и обновленные модели NTCP выражены в виде функции эквивалентной однородной дозы (EUD), модифицированной с использованием скалярной величины. Значения наборов биомаркеров представляют собой определяемые путем исследования значения параметров из группы: уровни Hb, CRP, PSA, TNF-α, ферритина, трансферрина, LDH, IL-6, гепсидина, креатинина, глюкозы, HbA1c, комплексов, связывающихся с концевыми участками ДНК (DNA-EBC), HIF-lα, галектина-1, САР43 и/или NDRG1; длина теломера; тип опухоли; степень опухоли; стадия опухоли; расположение первичной опухоли; степень злокачественности по шкале Глисона; данные анализа уровня коллагена; предшествующее лечение в виде абдоминальной хирургии, гормональной лекарственной терапии, антикоагуляционной лекарственной терапии; наличие диабета; возраст пациента. Используют машиночитаемый носитель информации, содержащий программу, которая управляет процессором для выполнения данного способа, и процессор, сконфигурированный для выполнения стадий способа. Изобретения обеспечивают индивидуальное адаптивное планирование терапии онкологического пациента с оптимизацией вероятности повреждения здоровых тканей и обезвреживания опухоли в соответствии с индивидуальными маркерами для каждого пациента. 3 н. и 5 з.п. ф-лы, 6 ил.
Изобретение относится к медицине, а именно к способу определения адаптационной способности пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для этого методом иммуноферментного анализа определяют количественный уровень биомаркеров в ротовой жидкости пациента до или не ранее чем через 30 мин после приема пищи. В качестве биомаркера выбирают матриксную металлопротеиназу 8 (ММП 8) или матриксную металлопротеиназу 9 (ММП 9). Для группы клинического сравнения ММП 8 принимают уровень 21,65-41,85 нг/мл; при уровне 171,25-524,7 нг/мл диагностируют низкую адаптационную способность, а при 58,7-162,7 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для группы клинического сравнения ММП 9 принимают уровень 134,9-207,7 нг/мл; при уровне 526,5-919,1 нг/мл диагностируют низкую адаптационную способность, а при 236,8-492,3 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Изобретение позволяет повысить точность экспресс-диагностики адаптационной способности к съемным пластиночным конструкциям ортопедических протезов пациента с новообразованиями челюстно-лицевой области в день обращения пациента. 1 н. и 2 з.п. ф-лы, 6 пр.
Изобретение относится к области ветеринарии и предназначено для оценки повышенной чувствительности крупного рогатого скота к лейкозной инфекции. Способ включает выделение нейтрофильных гранулоцитов из венозной крови крупного рогатого скота путем центрифугирования в градиенте плотности фиколл-урографина (плотностью 1,077 г/см3), внесение по 100 мкл клеточной взвеси в две параллельные лунки 96 луночного плоскодонного планшета для иммуноферментного анализа. В одну лунку планшета добавляют 50 мкл забуференного физиологического раствора или физиологического раствора (спонтанный НСТ-тест), а в другую - 50 мкл стимулятора (БЦЖ) в оптимальном разведении в забуференном физиологическом растворе или физиологическом растворе (индуцированный НСТ-тест), затем в обе лунки планшета добавляют по 50 мкл 0,15% раствора нитросинего тетразолия, перемешивают, инкубируют 20 минут при температуре 37°С, центрифугируют при 500 g 10 минут. Затем отделяют надосадок, добавляют 200 мкл абсолютного этилового спирта. Раствор центрифугируют 5 минут при 500 g, отделяют надосадочную жидкость. В клеточный осадок добавляют 200 мкл физиологического раствора. Центрифугируют 5 минут при 500 g. Добавляют в каждую лунку 130 мкл димексида и инкубируют при 60°С 20 минут, добавляют по 70 мкл 2 М раствора КОН, тщательно перемешивают. Результаты реакции фиксируют с помощью иммунохимического анализатора и выражают в условных единицах оптической плотности. После учета реакции определяют коэффициент стимуляции, при этом при определении уровня индуцированной активности в лунку дополнительно вносят 50 мкл левамизола в конечной концентрации 0,5 мкг/мл. Результаты реакции определяют по разнице экстинкций при длине волны 630 и 490 нм. Коэффициент стимуляции (КС) определяется отношением индуцированного уровня клеточной активности к спонтанному уровню. При КС ≤0,95 животное считают с повышенной чувствительностью к лейкозной инфекции крупного рогатого скота. Заявленный способ позволяет быстро и достоверно проводить оценку чувствительности к инфекции ВЛКРС и дает возможность диагностировать развитие инфекционно-воспалительных процессов у больных лейкозом животных. 4 табл., 3 пр.

Изобретение относится к медицине и биологии и может быть использовано для изготовления гистологических образцов биологических тканей с элементами имплантированных металлических и/или полимерных конструкций для изучения с помощью световой микроскопии. Способ заключается в том, что биологический образец последовательно обрабатывают раствором фиксаторов, отмывают, обезвоживают, пропитывают раствором прозрачной смолы для холодной заливки в течение 6-24 часов, погружают в чистую смолу на 12-24 часа и окрашивают красителями на глубину 1-2 мкм. При этом микроскопию последующих слоев выполняют после шлифовки, полировки и повторного окрашивания поверхности образца. Изобретение позволяет проводить послойное исследование образцов без повреждения клеточных компонентов и изменения архитектуры ткани в зоне контакта с инородным телом. 1 ил., 1 пр.
Наверх