Растения с измененным уровнем растительного крахмала



Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала
Растения с измененным уровнем растительного крахмала

 


Владельцы патента RU 2565828:

АГРИВИДА, ИНК. (US)

Изобретение относится к области биохимии, в частности к трансгенному растению, включающему конструкцию РНКи, которое имеет повышенный уровень растительного крахмала по сравнению с растением дикого вида, а также к способу его сельскохозяйственной переработки. Также раскрыт способ повышения уровня растительного крахмала в растении с использованием конструкции РНКи, где экспрессия РНКи-конструкции в растении изменяет активность, по меньшей мере, одного фермента, связанного с метаболизмом крахмала в растении. Изобретение также относится к вектору для создания трансгенного растения, имеющего повышенный уровень растительного крахмала по сравнению с растением дикого вида, способу получения трансгенного растения, имеющего повышенный уровень растительного крахмала с его использованием, а также к способу получения корма для животных переработкой вышеуказанного растения. Изобретение позволяет эффективно получать растение с повышенным уровнем растительного крахмала. 7 н. и 53 з.п. ф-лы, 14 ил., 1 табл., 9 пр.

 

Перекрестная ссылка на родственные заявки

Это заявка заявляет приоритет предварительной патентной заявки Соединенных Штатов № 61/358720 от 25 июня 2010 года, которая включена в данный документ ссылкой в полном объеме.

ПОДТВЕРЖДЕНИЕ ГОСУДАРСТВЕННОЙ ПОДДЕРЖКИ

Данное изобретение было осуществлено, по меньшей мере частично, при государственной поддержке с номером государственного заказа 2009-10001-05118, полученным от Национального Института Питания и Сельского Хозяйства, Департамента сельского хозяйства США. Государство обладает определенными правами на изобретение.

ОБЛАСТЬ ТЕХНИКИ

Данное описание относится к растениям с измененным уровнем растительного крахмала.

УРОВЕНЬ ТЕХНИКИ

Глюкоза представляет собой предпочтительное молекулярное сырье, однако ее доступность и стоимость недавно стали лимитирующими факторами при спросе на дешевое сырье в виде биотоплива и сбалансированного животного корма. Спрос на кукурузу и сахарный тростник значительно увеличил стоимость этого продукта. Крахмал представляет собой превосходный источник глюкозы благодаря его простой молекулярной структуре (α-1-4, и α-1-6 глюкозные связи) и относительной легкости, с которой эти связи доступны и гидролизуются с помощью недорогих и высокоэффективных ферментов (например, α-амилазы и глюкоамилазы). Гидролиз растительных тканей типа зерна с высоким содержанием крахмала обеспечивает получение относительно чистой глюкозы, т.е. эффективно трансформируемой в мясные или химические конечные продукты.

Сахароза, растворимый консервирующий углевод, также представляет собой сырьевую молекулу, получаемую из растений, которая легко применяется с использованием ферментирующих организмов. Системы возделывания и процесса получения сельскохозяйственных культур, в которых применяется сырье в виде сахарозы, такое как сахарная свекла и сорго сахарное, ограничены узким интервалом сбора урожая, хранением и стабильностью. Сорго сахарное должно обрабатываться аналогично сахарному тростнику в период сбора его урожая для ограничения микробной ферментации сахарозы благодаря высокому содержанию влажности в собранном материале (брак). Сроки проведения кампании уменьшают общую капитальную эффективность, ориентированную на технологическое оборудование.

Лигноцеллюлозные субстраты менее предпочтительное сырье из-за трудностей процесса получения. Лигноцеллюлозная биомасса содержит смесь гексоз и пентоз, и их сопротивляемость гидролизу (кристалличность и перекрестные сшивки с лигнином) делает гидролиз и экономичную деградацию трудной в применяемых сахарах. При получении биотоплива были разработаны дорогостоящие предварительные обработки для помощи в завершении гидролиза лигноцеллюлозных материалов. Полное применение полученных в результате смесей сахаров для топливной и химической продукции также требует, чтобы специализированные ферментирующие организмы трансформировали полученные в результате сахара в конечные продукты, такие как этанол, бутанол, янтарная кислота и другие химические вещества.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В одном аспекте изобретение относится к трансгенному растению, включающему РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью нуклеиновой кислоты. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера и расположенный между ними, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером.

В одном аспекте изобретение относится к трансгенному растению, полученному из энергетической культуры, пищевой культуры или из фуражной культуры растения, включающего РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности по длине выделенной нуклеиновой кислоты с частью гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером. При экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена.

В одном аспекте изобретение относится к способу сельскохозяйственного процесса получения или приготовления животного корма. Способ включает предоставление трансгенного растения. Трансгенное растение включает РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью нуклеиновой кислоты. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера и расположенный между ними, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером. Способ также включает процесс получения трансгенного растения, где первая и вторая последовательности драйвера экспрессируются в трансгенном растении. Экспрессия первой и второй последовательностей драйвера может осуществляться перед стадией процесса получения. В одном аспекте изобретение относится к продукту, получаемому способом сельскохозяйственного процесса получения или приготовления животного корма.

В одном аспекте изобретение относится к способу сельскохозяйственного процесса получения или приготовления животного корма. Способ включает предоставление трансгенного растения, полученного из энергетической культуры, пищевой культуры или фуражной культуры растения. Трансгенное растение включает РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности по длине выделенной нуклеиновой кислоты с частью гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером. При экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена. Способ также включает процесс получения трансгенного растения, где первая и вторая последовательности драйвера экспрессируются в трансгенном растении. Экспрессия первой и второй последовательностей драйвера может осуществляться перед стадией процесса получения. В одном аспекте изобретение относится к продукту, получаемому способом сельскохозяйственного процесса получения или приготовления животного корма.

В одном аспекте изобретение относится к способу изменения уровня растительного крахмала в растении. Способ включает экспрессию выделенной нуклеиновой кислоты в растении. Экспрессия выделенной нуклеиновой кислоты в растении изменяет активность по меньшей мере одного фермента, связанного с метаболизмом крахмала в растении.

В одном аспекте изобретение относится к способу изменения уровня растительного крахмала в растении. Способ включает экспрессию выделенной нуклеиновой кислоты в растении. Экспрессия выделенной нуклеиновой кислоты в растении изменяет активность по меньшей мере одного фермента, связанного с метаболизмом крахмала в растении. Растение является трансгенным растением. Трансгенное растение включает РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью нуклеиновой кислоты. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера и расположенный между ними, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером.

В одном аспекте изобретение относится к способу изменения уровня растительного крахмала в растении. Способ включает экспрессию выделенной нуклеиновой кислоты в растении. Экспрессия выделенной нуклеиновой кислоты в растении изменяет активность по меньшей мере одного фермента, связанного с метаболизмом крахмала в растении. Растение представляет собой трансгенное растение, полученное из энергетической культуры, пищевой культуры или фуражной культуры растения. Трансгенное растение включает РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности по длине выделенной нуклеиновой кислоты с частью гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером. При экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена.

В одном аспекте изобретение относится к выделенной нуклеиновой кислоте, включающей последовательность, имеющую по меньшей мере 90% идентичности с любой из SEQ ID NO: 7-8,11-18, 21-23, 32-33, 37, 38 и 39-47.

В одном аспекте изобретение относится к вектору, включающему РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности по длине выделенной нуклеиновой кислоты с частью гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера и расположенный между ними, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером.

В одном аспекте изобретение относится к способу получения трансгенного растения. Способ включает трансформацию растения вектором. Вектор включает РНКи-конструкцию. РНКи-конструкция включает первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности по длине выделенной нуклеиновой кислоты с частью гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала, и вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой. РНКи-конструкция также включает спейсер, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера и расположенный между ними, и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером.

В одном аспекте изобретение относится к вектору, содержащему выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичности с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 13 и SEQ ID NO: 14.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Следующее подробное описание предпочтительного варианта осуществления настоящего изобретения будет лучше понятно при его чтении вместе с прилагаемыми чертежами. Для целей иллюстрации изобретения представлены чертежи вариантов осуществления, которые в настоящее время являются предпочтительными. Однако понятно, что изобретение не ограничено точными представленными порядком и средствами. На чертежах:

Фиг. 1A-G иллюстрирует стратегии экспрессии интерферирующих РНК в трансгенных растениях.

Фиг. 2 иллюстрирует промежуточный РНКи-вектор, pAL409.

Фиг. 3 иллюстрирует РНКи-кассеты, с направленным воздействием на рисовые гены GWD, DSP и ISA3.

Фиг. 4 иллюстрирует сравнение последовательности между частью GWD2 [SEQ ID NO: 9], полученной из глюкан-вода-дикиназного гена, и частью гена GWD из томата (Solanum lycopersicon) [SEQ ID NO: 10].

Фиг. 5 иллюстрирует pAL409j SbGWDko2.

Фиг. 6 иллюстрирует детектирование гомологов ISA3 посредством анализа по Саузерну.

Фиг. 7 иллюстрирует выравнивание выборки из генов GWD риса (OsGWD)[SEQ ID NO: 24 и 28], сорго (SbGWD)[SEQ ID NO: 25 и 29], маиса (ZmGWD)[SEQ ID NO: 26 и 30], и томата (SlGWD)[SEQ ID NO: 27 и 31]. Также иллюстрируются праймеры dgGWup2 [SEQ ID NO: 32] и dgGWdown2 [SEQ ID NO: 33].

Фиг. 8 иллюстрирует сравнение относительной длины и расположения интронов внутри корового сегмента гомологии генов GWD из риса, сорго, Arabidopsis и из проса.

Фиг. 9 иллюстрирует изображение точечной матрицы выравниваний BLASTn между геномными последовательностями проса и сорго для глюкан-вода-дикиназных генов. Горизонтальная ось, последовательность проса; вертикальная ось, последовательность риса. Диагональные сегменты представляют участки, где две последовательности высоко гомологичны.

Фиг. 10 иллюстрирует уровень мРНК GWD среди растений, несущих или pAG2100, или pAG2101, и у контрольных растений дикого типа (WT).

Фиг. 11 иллюстрирует уровень мРНК DSP среди растений, несущих pAG2102, и у WT-контролей.

Фиг. 12 иллюстрирует уровень мРНК ISA3 среди растений, несущих pAG2103, и у WT-контролей.

Фиг. 13 иллюстрирует повышенный уровень крахмала среди выбранных линий риса и проса, которые несут РНКи-конструкции.

Фиг. 14 иллюстрирует содержание крахмала в трансгенных рисовых линиях, собранных приблизительно через 19 недель после посадки.

ПОДРОБНОЕ ОПИСАНИЕ ПРЕДПОЧТИТЕЛЬНЫХ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ

В следующем описании используется терминология только для удобства и которая не является ограничением.

При использовании в данном документе термины "выделенная нуклеиновая кислота", "выделенный полинуклеотид", "выделенный олигонуклеотид", "выделенная ДНК" или "выделенная РНК" обозначают нуклеиновую кислоту, полинуклеотид, олигонуклеотид, ДНК или РНК отдельно от организма, из которого они произошли, или от природного генома, локализации или молекул, с которыми они обычно ассоциированы, или представляют собой нуклеиновую кислоту, полученную синтетическими методами.

При использовании в данном документе термины "выделенный белок", "выделенный полипептид", "выделенный олигопептид" или "выделенный пептид" обозначают белок, полипептид, олигопептид или пептид отдельно от организма, из которого он произошел, или отдельно от природной локализации или от молекул, с которыми он обычно ассоциирован.

При использовании в данном документе термин "вариант" обозначает молекулу, которая сохраняет биологическую активность, такую же или по существу такую же, как у исходной последовательности. Вариант может быть из того же или из другого вида или может быть синтетической последовательностью на основе природной молекулы или молекулы-предшественника.

Нуклеиновые кислоты, нуклеотидные последовательности, белки или аминокислотные последовательности, обозначенные в данном документе, могут быть выделенными, очищенными, синтезированными химически или получены с помощью технологии рекомбинантной ДНК. Все эти методы хорошо известны из уровня техники.

При использовании в данном документе термин "функционально связанный" обозначает ассоциацию двух или более биомолекул в конфигурации относительно друг друга, так что может осуществляться нормальная функция биомолекулы. Относительно нуклеотидных последовательностей термин "функционально связанный" обозначает ассоциацию двух или более последовательностей нуклеиновых кислот в конфигурации относительно друг друга, так что может осуществляться нормальная функция последовательностей. Например, нуклеотидная последовательность, кодирующая последовательность-предшественник или секреторный лидер, функционально связана с нуклеотидной последовательностью полипептида, если он экспрессируется в виде белка-предшественника, который участвует в секреции полипептида; промотор или энхансер функционально связан с кодирующей последовательностью, если он влияет на транскрипцию кодирующей последовательности; и сайт связывания рибосомы с нуклеиновой кислотой функционально связан с кодирующей последовательностью, если он располагается так, чтобы облегчить связывание рибосомы с нуклеиновой кислотой.

Единственное число при использовании в формуле изобретения и в соответствующих разделах описания определяется как включающее один или более из упомянутых признаков до тех пор, пока конкретно не установлено другое. Терминология включает слова, специально упомянутые выше, их производные и слова похожие по значению. Фраза "по меньшей мере" с последующим перечислением из двух или более признаков, таких как "A, B или C", обозначает любой индивидуальный признак из A, B или C, а также любую их комбинацию.

Список последовательностей, озаглавленный "Список_Последовательностей", с размером файла примерно 219033 байт настоящим включен в данный документ ссылкой в полном объеме.

В одном варианте осуществления предлагается способ изменения количества крахмала, который накапливается в растительных тканях растений с помощью ингибирования активности ферментов, которые обычно отвечают за мобилизацию растительного крахмала (в данном документе обозначается как "Зеленый Крахмал" или "растительный крахмал") в течение циклов день/ночь. Предлагаются выделенные нуклеиновые кислоты для изменения количества крахмала, который накапливается в растительных тканях растений, путем ингибирования активности ферментов, которые обычно отвечают за мобилизацию Зеленого Крахмала. Предлагаются трансгенные растения, которые включают нуклеиновые кислоты для изменения количества крахмала, который накапливается в растительных тканях растений, путем ингибирования активности ферментов, которые обычно отвечают за мобилизацию Зеленого Крахмала. Любое растение может предлагаться в виде трансгенного растения. В одном варианте осуществления в виде трансгенного растения предлагаются рис, просо, сорго или другие энергетические или фуражные культуры.

В одном варианте осуществления предлагаются применения для животного корма, включающие повышенный уровень крахмала в растительных тканях. В вариантах осуществления в данном документе могут предлагаться легкоферментируемые сахара, доступные в процессе ферментации. Производство биотоплива может быть увеличено путем получения легкоферментируемых сахаров. Способы получения легкоферментируемых сахаров и способы увеличения производства биотоплива предлагаются в варианте осуществления в данном документе.

Культуры с повышенным уровнем растительного крахмала обладают разнообразными применениями и использованиями. В одном варианте осуществления предлагается биомасса из растений, которые накапливают повышенный уровень растительного крахмала относительно растений дикого типа. Эти растения могут обладать повышенной эффективностью в виде сырья для процесса ферментации или при применении для животного корма. Например, в типичном целлюлозном процессе полисахариды, такие как целлюлоза и гемицеллюлоза, которые присутствуют в биомассе, гидролизуются до простых сахаров, которые могут затем ферментироваться до этанола, бутанола, изобутанола, жирных кислот или до других углеводов с помощью микроорганизмов. Из-за сопротивляемости биомассы для высвобождения простых сахаров из полимеров, таких как целлюлоза и гемицеллюлоза, часто требуется использование агрессивных условий предварительной обработки и гидролиза с помощью относительно дорогих смесей ферментов. Напротив, любой крахмал, который присутствует в биомассе, представляет собой дополнительный источник простых сахаров (а именно, глюкозы), которые могут очень легко высвобождаться и гораздо менее дорогим способом с помощью или обработки разведенной кислотой, или с помощью гидролиза амилазами, которые в настоящее время доступны и гораздо менее дорогие, чем ферменты, требующиеся для гидролиза целлюлозы и гемицеллюлозы. В результате, любое увеличение количества крахмала, присутствующего в биомассе, будет одновременно увеличивать количество ферментируемого сахара, который может быть извлечен (и, таким образом, количество этанола, бутанола и т.д., которые могут получиться), при этом с несоразмерно маленьким увеличением стоимости процесса (т.е. при добавлении недорогих амилазы или кислотной обработки). Аналогично, биомасса, которая содержит повышенный уровень крахмала, может иметь более высокую значимость в фуражных применениях, где растительный материал служит кормом скоту. Кроме того, избыток крахмала, присутствующего в данном материале, легче переваривается большинством животных, чем целлюлозный материал, обеспечивая при этом больше энергии на единицу биомассы, чем биомасса при обычном уровне крахмала. Варианты осуществления включают применение трансгенного растения, представленного в данном документе, для любого из этих методов.

Способы данного документа, включающие те, что представлены в предыдущем параграфе, могут включать модификацию растений для создания трансгенных растений, выращивание трансгенных растений, сбор растений и либо процесс их получения для применения в качестве животного корма, как другие фуражные культуры, либо их сушку и обработку для применения в процессах ферментации, аналогично типу обработки, который используется в целлюлозных процессах, но с добавлением обработки, такой как кислотный или амилазный гидролиз для гидролиза крахмала до компонентов в виде сахаров. Любая одна стадия, ряд стадий или все стадии, представленные в данном параграфе, могут предлагаться в данном способе.

Были идентифицированы гены для направленного изменения Зеленого Крахмала. Любой фермент, белок или нуклеиновая кислота, вовлеченные в метаболизм крахмала, могут быть мишенями для изменения уровня Зеленого Крахмала. В одном варианте осуществления изменения достигают с помощью подавления экспрессии генов, связанных с Зеленым Крахмалом. В одном варианте осуществления изменение представляет собой увеличение количества Зеленого Крахмала. Конкретные ферменты, которые могут быть мишенями, включают, в частности, белок глюкан-вода-дикиназу (также известную как GWD, R1, sex1); фосфоглюкан-вода-дикиназу (также известную как PWD); протеинфосфатазу с двойной специфичностью (также известную как DSP, sex4); ß-амилазу (BAM), изоамилазу (также известную как ISA3), предельную декстриназу (также известную как LDA); фермент диспропорции; и другие деветвящие ферменты. GWD фосфорилирует крахмал, который затем восприимчив к ферментам деградации крахмала. PWD фосфорилирует крахмал и может зависеть от предыдущего действия GWD благодаря эпистазу. DSP представляет собой регуляторный фермент и может активировать ферменты деградации крахмала. DSP также может фосфорилировать крахмал. Кроме того, предполагается, что DSP обладает эндоамилазной активностью, которая может быть синергична с ß-амилазной и изомеразной мобилизацией крахмала. BAM (но не α-амилаза) и ISA3 вовлечены в мобилизацию растительного крахмала. BAM-активность зависит от GWD, и ISA3-активность зависит от BAM.

В одном варианте осуществления мишени подавляются, и подавление может достигаться посредством РНКи-подавления генной экспрессии. РНКи-конструкции предлагаются для подавления экспрессии белков-мишеней. Белки-мишени могут быть ферментами. Фермент-мишень может быть выбран из фермента, вовлеченного в мобилизацию Зеленого Крахмала. Предлагаются РНКи-конструкции, подавляющие по меньшей мере один из GWD, PWD, DSP, BAM, изоамилазы, LDA, фермента диспропорции и других деветвящих ферментов.

Был разработан ряд стратегий для экспрессии РНКи в трансгенных растениях. См., например, публикацию Horiguchi G., RNA silencing in plants: a shortcut to functional analysis (2004) Differentiation 72(2-3): 65-73, которая включена в данный документ ссылкой в полном объеме. См.также Smith NA, Singh SP, Wang MB, Stoutjesdijk PA, Green AG, Waterhouse PM, Total silencing by intron-spliced hairpin RNAs (2000) Nature 407:319-20; Stoutjesdijk PA, Singh SP, Liu Q, Hurlstone CJ, Waterhouse PA, Green AG hpRNA-mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing (2002) Plant Physiol. 129(4): 1723-31, которые включены в данный документ ссылкой в полном объеме. При ссылке на ЧЕРТЕЖИ. 1A-G иллюстрируются типичные стратегии для РНКи. Варианты осуществления в данном документе включают РНКи-конструкции, способы и трансгенные растения, полученные с помощью РНКи-стратегии. Промоторы 101, 102, 103, 104, 105, 106, 107 и 108 могут давать возможность транскрипции нуклеиновой кислоты в конструкциях. Стратегия, представленная на фиг. 1E включает XVE-респонсивный промотор 109, и стратегия на фиг. 1D включает промоторные фрагменты 110 и 111. Терминаторы 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130 и 131 также проиллюстрированы в виде транскрибируемых терминаторных последовательностей 122a и 123a. Спейсеры 132, 133 и 134 иллюстрируются для стратегий на фиг. 1A, 1С и 1D, и транскрибированные спейсеры 132a и 132b иллюстрируются для фиг. 1A и 1С. Интроны 140, 141 и 142 и транскрибируемый интрон 140a иллюстрируются на фиг.1B, 1E и 1F. Представлены кДНК-фрагменты 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 и 161, а также транскрибируемая кДНК 150a, 151a, 152a, 153a, 154a и двухцепочечная РНК-цепь 154a'. На фиг. 1E и 1F иллюстрируются loxP-сайты 170, 171 и 172. Варианты осуществления включают способы, применяющие РНК драйвера, разделенную с помощью интронного спейсера, как проиллюстрировано на фиг. 1B, и РНКи-конструкции, векторы, промежуточные векторы, трансформирующие векторы, праймеры и трансгенные растения для осуществления РНКи-стратегии, изображенной на фиг. 1B. Но варианты осуществления в данном документе не ограничиваются стратегией, проиллюстрированной на фиг. 1B.

В одном варианте осуществления предлагаются выделенные нуклеиновые кислоты, имеющие последовательность, представленную в любой из нуклеиновых кислот, перечисленных в данном документе, или комплементарные им. В одном варианте осуществления предлагаются выделенные нуклеиновые кислоты, имеющие последовательность, которая гибридизуется с нуклеиновой кислотой, имеющей последовательность любой из нуклеиновых кислот, перечисленных в данном документе, или комплементарной им. В одном варианте осуществления условия гибридизации представляют собой условия низкой жесткости. В одном варианте осуществления условия гибридизации представляют собой условия умеренной жесткости. В одном варианте осуществления условия гибридизации представляют собой условия высокой жесткости. Примеры протоколов гибридизации и методы оптимизации протоколов гибридизации описаны в следующих книгах: Molecular Cloning, T. Maniatis, E.F. Fritsch, and J. Sambrook, Cold Spring Harbor Laboratory, 1982; и Current Protocols in Molecular Biology, F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhl, Volume 1, John Wiley & Sons, 2000, которые включены в данный документ ссылкой в полном объеме. В качестве примера, но не ограничения, приведены процедуры для условий гибридизации средней жесткости: фильтры, содержащие ДНК, предварительно обрабатывают в течение 2-4 ч при 68°C в растворе, содержащем 6X SSC (Amresco, Inc., Solon, OH), 0,5% SDS (Amersco, Inc., Solon, ОН), 5X раствор Денхардта (Amersco, Inc., Solon, OH), и 100 мкг/мл денатурированной ДНК спермы лосося (Invitrogen Life Technologies, Inc., Carlsbad, CA). Приблизительно 0,2 мл раствора для предварительной обработки используют на один квадратный сантиметр используемой мембраны. Гибридизацию проводят в том же растворе со следующими модификациями: могут использоваться 0,01 M EDTA (Amersco, Inc., Solon, OH), 100 мкг/мл ДНК спермы лосося, и 5-20×106 имп/мин 32P-меченные или флуоресцентно меченные зонды. Фильтры инкубируют в гибридизационной смеси в течение 16-20 ч при 68°C и затем отмывают в течение 15 минут при комнатной температуре (25°C±5) в растворе, содержащем 2X SSC и 0,1% SDS, при мягком перемешивании. Раствор для отмывки заменяют на раствор, содержащий 0,1X SSC и 0,5% SDS, и инкубируют дополнительные 2 ч при 68°C при мягком перемешивании. Фильтры сушат и экспонируют для проявления изображения на анализаторе изображений или с помощью радиоавтографии. Если необходимо, фильтры промывают в третий раз и повторно экспонируют для проявления изображения. В качестве примера, но не ограничения, условия низкой жесткости обозначают условия гибридизации, при которых применяют низкую температуру для гибридизации, например, температуру от 37°C до 60°C. В качестве примера, но не ограничения, условия высокой жесткости представляют условия гибридизации, приведенные выше, но модифицированные применением высоких температур, например, температуры гибридизации около 68°C.

В одном варианте осуществления предлагаются выделенные нуклеиновые кислоты, имеющие последовательность, которая имеет по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности по длине с непрерывным участком нуклеиновой кислоты, имеющей любую из последовательностей, представленных в данном документе, или комплементарной им. Непрерывный участок может представлять собой цельную длину последовательности, представленной в данном документе, или комплементарной ей. Идентичность может быть измерена с помощью алгоритма Смита-Ватермана (Smith TF, Waterman MS (1981), "Identification of Common Molecular Subsequences," Journal of Molecular Biology 147: 195-197, который включен в данный документ ссылкой в полном объеме).

В одном варианте осуществления предлагаются выделенные нуклеиновые кислоты, полинуклеотиды или олигонуклеотиды, имеющие часть последовательности, представленной в любой из нуклеиновых кислот, перечисленных в данном документе, или комплементарные им. Эти выделенные нуклеиновые кислоты, полинуклеотиды или олигонуклеотиды не ограничены, но могут иметь длину в интервале от 10 нуклеотидов до полной длины, 10-600, 10-500, 10-400,10-300, 10-200, 10-100, 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10-35, 10-30, 10-25, 10-20, 10-15 или 20-30 нуклеотидов или 10,15, 20 или 25 нуклеотидов. Выделенная нуклеиновая кислота, полинуклеотид или олигонуклеотид, имеющие длину внутри одного из вышеуказанных интервалов, могут иметь специфическую длину внутри приведенного выше интервала, включая конечные точки. Заданная длина нуклеотидов может начинаться в любом уникальном положении внутри эталонной последовательности (т.е. любая из нуклеиновых кислот, представленных в данном документе), где достаточно нуклеотидов после уникального положения, чтобы обеспечить заданную длину. В одном варианте осуществления гибридизационный зонд или праймер комплементарен нуклеиновой кислоте той же длины, что и у зонда или праймера, на 85-100%, 90-100%, 91-100%, 92-100%, 93-100%, 94-100%, 95-100%, 96-100%, 97-100%, 98-100%, 99-100% или 100%, и имеет последовательность, выбранную из длины нуклеотидов, соответствующей длине зонда или праймера в той части последовательности, что представлена в любой из нуклеиновых кислот, перечисленных в данном документе. В одном варианте осуществления гибридизационный зонд или праймер гибридизуется по длине с нуклеиновой кислотой соответствующей длины, имеющей последовательность, представленную в любой из нуклеиновых кислот, представленных в данном документе. В одном варианте осуществления условия гибридизации представляют собой условия низкой жесткости. В одном варианте осуществления условия гибридизации представляют собой условия умеренной жесткости. В одном варианте осуществления условия гибридизации представляют собой условия высокой жесткости.

Любая из выделенных нуклеиновых кислот, представленных в данном документе, может предлагаться в виде набора реагентов. Набор реагентов может использоваться для получения РНКи-конструкции, получения трансгенных растений, для тестирования растения на присутствие интересующего гена, тестирования растения на присутствие РНКи-конструкции, как описано в данном документе, или для любого другого способа или цели, описанных в данном документе. Набор реагентов может включать один или более векторов, представленных в данном документе, или один или более зонд или праймер, представленные в данном документе.

В одном варианте осуществления предлагается трансгенное растение. Трансгенное растение может быть получено из любого растения. Трансгенное растение может быть получено из энергетической культуры растений, из фуражной культуры или из пищевой культуры растений. Энергетическая культура растений может быть в частности кукурузой, просо, тополем или мискантом. Фуражная культура растений может представлять собой, в частности, сорго. Пищевая культура растений может представлять собой, в частности, кукурузу или томат. Трансгенное растение может включать РНКи-конструкцию. Растение может представлять собой рис, просо, сорго, кукурузу или томат.

РНКи-конструкция может быть сконструирована для осуществления любой РНКи-стратегии, включая, в частности, проиллюстрированные на фиг. 1A-G. РНКи-конструкция может включать первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую последовательность, соответствующую части гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала. Первая последовательность драйвера может включать первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности по длине выделенной нуклеиновой кислоты с частью гена в трансгенном растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала. Длина первой нуклеиновой кислоты может быть любой подходящей длины для обеспечения РНКи-воздействия. РНКи-конструкция может включать вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой последовательностью нуклеиновой кислоты. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой последовательностью нуклеиновой кислоты при in situ условиях в трансгенном растении. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой последовательностью нуклеиновой кислоты при условиях низкой жесткости. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой последовательностью нуклеиновой кислоты при условиях умеренной жесткости. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой последовательностью нуклеиновой кислоты при условиях высокой жесткости. Вторая последовательность нуклеиновой кислоты может представлять собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты. РНКи-конструкция может включать спейсер, функционально связанный с первой последовательностью драйвера и второй последовательностью драйвера, и расположенный между ними. Функционально связанный спейсер может обеспечивать связь между первой и второй выделенными нуклеиновыми кислотами, так что РНК-последовательности, транскрибируемые с первой и второй выделенных нуклеиновых кислот, могут гибридизоваться друг с другом. Функционально связанный спейсер может представлять собой интрон. Интрон может сплайсировать первую и вторую последовательности драйвера. Первая последовательность драйвера может располагаться в 5'-области по отношению к спейсеру и прилегает к нему. Спейсер может располагаться в 5'-области по отношению ко второй последовательности драйвера и прилегает к ней. Первая последовательность драйвера может располагаться в 5'-области по отношению к спейсеру и прилегает к нему, и спейсер может располагаться в 5'-области по отношению ко второй последовательности драйвера и прилегает к ней. РНКи-конструкция также может включать промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и спейсером. Функционально связанный промотор может давать возможность транскрипции первой последовательности драйвера, спейсера и второй последовательности драйвера. Функционально связанный промотор может представлять собой любой тип промотора. Функционально связанный промотор может представлять собой индуцируемый промотор. Функционально связанный промотор может представлять собой конститутивный промотор. Транскрипция первой последовательности драйвера, спейсера и второй последовательности драйвера может означать экспрессию последовательности драйвера и спейсера. При экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом. Загибридизовавшиеся РНК-транскрипты первой и второй последовательностей драйвера могут быть способны ингибировать экспрессию гена. Трансгенное растение может включать более одного типа РНКи-конструкций. Каждый отличный тип РНКи-конструкции может быть направлен на ингибирование экспрессии различных генов, экспрессирующих различные белки-мишени.

РНКи-конструкция может включать первую последовательность драйвера. Первая последовательность драйвера может включать последовательность первой нуклеиновой кислоты, которая имеет любую подходящую последовательность для воздействия РНКи на ген, кодирующий белок-мишень. Первая последовательность драйвера может включать первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45. Идентичность может быть измерена по длине первой выделенной нуклеиновой кислоты. Длина первой выделенной нуклеиновой кислоты может быть равной длине эталонной последовательности. РНКи-конструкция может включать первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45 или из комплементарных им последовательностей, при условиях низкой жесткости. РНКи-конструкция может включать первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45 или из комплементарных им последовательностей, при условиях умеренной жесткости. РНКи-конструкция может включать первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45 или из комплементарных им последовательностей, при условиях высокой жесткости. РНКи-конструкция может включать вторую последовательность драйвера, имеющую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой нуклеиновой кислотой при in situ условиях в трансгенном растении. РНКи-конструкция может включать вторую последовательность драйвера, имеющую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой нуклеиновой кислотой при условиях низкой жесткости. РНКи-конструкция может включать вторую последовательность драйвера, имеющую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой нуклеиновой кислотой при условиях умеренной жесткости. РНКи-конструкция может включать вторую последовательность драйвера, имеющую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой нуклеиновой кислотой при условиях высокой жесткости. РНКи-конструкция может включать вторую последовательность драйвера, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с последовательностью, комплементарной эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45. Идентичность может быть измерена по длине последовательности, комплементарной эталонной последовательности. Длина второй нуклеиновой кислоты может быть равной длине последовательности, комплементарной эталонной последовательности.

Спейсером может быть любая последовательность. Спейсером может быть интрон. Интрон может быть любым интроном. Интроном может быть OsUbiintron. Последовательность OsUbiintron может быть обнаружена при ссылке на фиг. 2, которая иллюстрирует pAL409 вместе с OsUbiintron между положениями 4519-566. Последовательность pAL409 представлена ниже и в SEQ ID NO: 13. Нумерация нуклеотидов в SEQ ID NO: 13 может варьироваться как на фиг. 2, но при этом сравнение отмеченных последовательностей (например, сайты рестрикции) между фиг. 2 и SEQ ID NO: 13 дает возможность идентификации любой специфичной последовательности, характерной для pAL409. Интрон может иметь последовательность, которая имеет по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с OsUbiintron. Интрон может иметь последовательность, которая гибридизуется с OsUbiintron или с последовательностью, комплементарной ему, при условиях низкой жесткости. Интрон может иметь последовательность, которая гибридизуется с OsUbiintron или с последовательностью, комплементарной ему, при условиях умеренной жесткости. Интрон может иметь последовательность, которая гибридизуется с OsUbiintron или с последовательностью, комплементарной ему, при условиях высокой жесткости.

Промотором может быть любой промотор. Промотор может представлять собой индуцируемый промотор. Примеры индуцируемых промоторов включают, в частности, промотор, индуцируемый спиртом, промотор, индуцируемый тетрациклином, промотор, индуцируемый стероидами, или промотор, индуцируемый гормонами. Промотор может представлять собой конститутивный промотор. Промотор может быть функционально связанным с первой последовательностью драйвера, второй последовательностью драйвера и спейсером. Промотор может представлять собой промотор P-OsUbi. Последовательность промотора P-OsUbi может быть обнаружена при ссылке на фиг. 2, которая иллюстрирует pAL409 вместе с промотором P-OsUbi между положениями 3574-4507. Последовательность pAL409 представлена ниже и в SEQ ID NO: 13. Нумерация нуклеотидов в SEQ ID NO: 13 может варьироваться как на фиг. 2, но при этом сравнение отмеченных последовательностей (например, сайты рестрикции) между фиг. 2 и SEQ ID NO: 13 дает возможность идентификации любой специфичной последовательности, характерной для pAL409. Промотор может включать последовательность, которая имеет по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с промотором P-OsUbi. Промотор может включать последовательность, которая гибридизуется с промотором P-OsUbi или с последовательностью, комплементарной ему, при условиях низкой жесткости. Промотор может включать последовательность, которая гибридизуется с промотором P-OsUbi или с последовательностью, комплементарной ему, при условиях умеренной жесткости. Промотор может включать последовательность, которая гибридизуется с промотором P-OsUbi или с последовательностью, комплементарной ему, при условиях высокой жесткости.

Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, которая имеет любую подходящую последовательность для воздействия РНКи на ген, кодирующий белок-мишень. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую последовательность, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37 или из комплементарных им последовательностей, при условиях низкой жесткости. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую последовательность, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37 или из комплементарных им последовательностей, при условиях умеренной жесткости. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую последовательность, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37 или из комплементарных им последовательностей, при условиях высокой жесткости. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, которая имеет любую подходящую последовательность для воздействия РНКи на ген, кодирующий белок-мишень. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях in situ в трансгенном растении. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях низкой жесткости. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях умеренной жесткости. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях высокой жесткости.

Белок-мишень может представлять собой любой белок, вовлеченный в регуляцию Зеленого Крахмала. Например, белок-мишень может представлять собой один из белка глюкан-вода-дикиназы, фосфоглюкан-вода-дикиназы, протеинфосфатазы с двойной специфичностью, ß-амилазы, изоамилазы, предельной декстриназы, фермента диспропорции или деветвящего фермента. Ген, кодирующий белок-мишень, может иметь последовательность, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43. Ген, кодирующий белок-мишень, может иметь последовательность, которая гибридизуется с эталонной последовательностью, выбранной из группы состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43 или из комплементарных им последовательностей, при условиях низкой жесткости. Ген, кодирующий белок-мишень, может иметь последовательность, которая гибридизуется с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43 или из комплементарных им последовательностей, при условиях умеренной жесткости. Ген, кодирующий белок-мишень, может иметь последовательность, которая гибридизуется с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43 или из комплементарных им последовательностей, при условиях высокой жесткости.

Трансгенное растение может быть создано с помощью любого метода трансформации. Например, может использоваться биолистическая трансформация. Трансформация может осуществляться с использованием любого подходящего вектора, включающего или состоящего из одного или более РНКи-конструкций, представленных в данном документе. Может использоваться трансформация, опосредованная Agrobacterium. Трансформация, опосредованная Agrobacterium, может использовать любой подходящий трансформирующий вектор, несущий один или более РНКи-конструкций, представленных в данном документе. Трансформация, опосредованная Agrobacterium, может осуществляться с использованием вектора, имеющего последовательность, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

Любое трансгенное растение, представленное в данном документе, может быть предложено в способе сельскохозяйственного процесса получения или в применениях для животного корма. Трансгенное растение может включать любую одну или несколько РНКи-конструкций, описанных в данном документе. Стадия получения трансгенного растения может включать его получение из другой части, которую оно производит. Стадия получения может включать создание трансгенного растения. Способ сельскохозяйственной переработки или применения для животного корма могут включать переработку трансгенного растения. Последовательности драйвера в РНКи-конструкции в трансгенном растении могут экспрессироваться в любой стадии способа. Последовательности драйвера в РНКи-конструкции в трансгенном растении могут экспрессироваться перед стадией обработки растения. Последовательности драйвера в РНКи-конструкции в трансгенном растении могут экспрессироваться во время стадии обработки растения. Экспрессия может быть индуцируемой. Сельскохозяйственный процесс получения может включать применение созданного сырья с повышенным уровнем крахмала. Сырье может включать любое трансгенное растение, представленное в данном документе, индивидуально или в комбинации с другими компонентами. Другой компонент может включать другой растительный материал. Сельскохозяйственная обработка представляет собой манипуляцию или превращение любого сельскохозяйственного сырья для конкретного продукта или применения. Сельскохозяйственный процесс получения включает, в частности, по меньшей мере одну из операций в виде сбора урожая, прессования, мелкого дробления, перемалывания, рубки, дробления, раздавливания, гранулирования, экстракции компонента из сырья, очистки компонента или части сырья, экстракции или очистки крахмала, гидролиза полисахаридов до олигосахаридов или моносахаридов, силосования, ферментации, химического превращения или химического катализа сырья.

Один вариант осуществления включает способ изменения уровня растительного крахмала в растении. Способ может включать экспрессию выделенной нуклеиновой кислоты в растении. Экспрессия выделенной нуклеиновой кислоты в растении может изменять активность по меньшей мере одного фермента, связанного с метаболизмом крахмала в растении. Растение может быть любым трансгенным растением, представленным в данном документе. Трансгенное растение может включать любую одну или несколько РНКи-конструкций, описанных в данном документе.

В одном варианте осуществления предлагается выделенная нуклеиновая кислота, включающая, по существу состоящая из или состоящая из последовательности, имеющей по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с любой из SEQ ID NO: 7-8, 11-18, 21-23, 32-33, 37, 38 и 39-47. В одном варианте осуществления предлагается выделенная нуклеиновая кислота, включающая, по существу состоящая из или состоящая из последовательности, которая гибридизуется с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7-8, 11-18, 21-23, 32-33, 37, 38 и 39-47 или из комплементарных им последовательностей, при условиях низкой жесткости. В одном варианте осуществления предлагается выделенная нуклеиновая кислота, включающая, по существу состоящая из или состоящая из последовательности, которая гибридизуется с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7-8, 11-18, 21-23, 32-33, 37, 38 и 39-47 или из комплементарных им последовательностей, при условиях умеренной жесткости. В одном варианте осуществления предлагается выделенная нуклеиновая кислота, включающая, по существу состоящая из или состоящая из последовательности, которая гибридизуется с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7-8, 11-18, 21-23, 32-33, 37, 38 и 39-47 или из комплементарных им последовательностей, при условиях высокой жесткости.

Один вариант осуществления включает вектор, содержащий любые РНКи-конструкции, представленные в данном документе. Вектор может быть промежуточным вектором. Вектор может быть трансформирующим вектором. РНКи-конструкция в векторе может содержать первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности по длине первой выделенной нуклеиновой кислоты с частью гена в растении, кодирующего белок-мишень, вовлеченный в мобилизацию растительного крахмала. РНКи-конструкция в векторе также может включать вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой выделенной нуклеиновой кислотой при условиях in situ в растении, в которое может быть трансформирован вектор. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой выделенной нуклеиновой кислотой при условиях низкой жесткости. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой выделенной нуклеиновой кислотой при условиях умеренной жесткости. Вторая выделенная нуклеиновая кислота может быть способна гибридизоваться с первой выделенной нуклеиновой кислотой при условиях высокой жесткости. РНКи-конструкция в векторе также может включать спейсер, функционально связанный с первой последовательностью драйвера и второй последовательностью драйвера. Спейсер может располагаться между первой последовательностью драйвера и второй последовательностью драйвера. РНКи-конструкция в векторе также может включать промотор, функционально связанный с первой последовательностью драйвера, со второй последовательностью драйвера и со спейсером.

Вектор, представленный в данном документе, может быть сконструирован для экспрессии в организме-хозяине гена, на который направлено действие РНКи-конструкции. При экспрессии РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, могут быть способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена в организме-хозяине.

Вектор, представленный в данном документе, может включать первую последовательность драйвера, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44, и SEQ ID NO: 37. Вектор, представленный в данном документе, может включать первую выделенную нуклеиновую кислоту, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45 или из комплементарных им последовательностей, при условиях низкой жесткости. Вектор, представленный в данном документе, может включать первую выделенную нуклеиновую кислоту, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45 или из комплементарных им последовательностей, при условиях умеренной жесткости. Вектор, представленный в данном документе, может включать первую выделенную нуклеиновую кислоту, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 44 и SEQ ID NO: 45 или из комплементарных им последовательностей, при условиях высокой жесткости. Как представлено выше, вторая выделенная нуклеиновая кислота в любом векторе, описанном в данном разделе, может быть сконструирована так, чтобы она была способна гибридизоваться с первой выделенной нуклеиновой кислотой. Гибридизация первой и второй выделенных нуклеиновых кислот может осуществляться в условиях in situ, имеющих место в растении, в которое может быть трансформирован вектор. Гибридизация первой и второй выделенных нуклеиновых кислот может осуществляться при условиях низкой жесткости. Гибридизация первой и второй выделенных нуклеиновых кислот может осуществляться при условиях умеренной жесткости. Гибридизация первой и второй выделенных нуклеиновых кислот может осуществляться при условиях высокой жесткости. Вторая выделенная нуклеиновая кислота может представлять собой инвертированную комплементарную последовательность первой выделенной последовательности нуклеиновой кислоты.

Спейсер в векторе, представленном в данном документе, может представлять собой любую последовательность. Спейсером может быть интрон. Интрон может быть любым интроном. Интроном может быть OsUbiintron. Последовательность OsUbiintron может быть обнаружена при ссылке на фиг. 2, которая иллюстрирует pAL409 вместе с OsUbiintron между положениями 4519-566. Последовательность pAL409 представлена ниже и в SEQ ID NO: 13. Нумерация нуклеотидов в SEQ ID NO: 13 может варьироваться относительно того, как отмечено на фиг. 2, но при этом сравнение отмеченных последовательностей (например, сайты рестрикции) между фиг. 2 и SEQ ID NO: 13 дает возможность идентификации любой специфичной последовательности, характерной для pAL409. Интрон может иметь последовательность, которая имеет по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с OsUbiintron. Интрон может иметь последовательность, которая гибридизуется с OsUbiintron или с последовательностью, комплементарной ему, при условиях низкой жесткости. Интрон может иметь последовательность, которая гибридизуется с OsUbiintron или с последовательностью, комплементарной ему, при условиях умеренной жесткости. Интрон может иметь последовательность, которая гибридизуется с OsUbiintron или с последовательностью, комплементарной ему, при условиях высокой жесткости.

Промотор в векторе может представлять собой любой промотор. Промотор может представлять собой индуцируемый промотор. Промотор может представлять собой конститутивный промотор. Промотор может быть функционально связанным с первой последовательностью драйвера, второй последовательностью драйвера и спейсером. Промотор может представлять собой промотор P-OsUbi. Последовательность промотора P-OsUbi может быть обнаружена при ссылке на фиг. 2, которая иллюстрирует pAL409 вместе с промотором P-OsUbi между положениями 3574-4507. Последовательность pAL409 представлена ниже и в SEQ ID NO: 13. Нумерация нуклеотидов в SEQ ID NO: 13 может варьироваться относительно того, как отмечено на фиг. 2, но при этом сравнение отмеченных последовательностей (например, сайты рестрикции) между фиг. 2 и SEQ ID NO: 13 дает возможность идентификации любой специфичной последовательности, характерной для pAL409. Промотор может включать последовательность, которая имеет по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с промотором P-OsUbi. Промотор может включать последовательность, которая гибридизуется с промотором P-OsUbi или с последовательностью, комплементарной ему, при условиях низкой жесткости. Промотор может включать последовательность, которая гибридизуется с промотором P-OsUbi или с последовательностью, комплементарной ему, при условиях умеренной жесткости. Промотор может включать последовательность, которая гибридизуется с промотором P-OsUbi или с последовательностью, комплементарной ему, при условиях высокой жесткости.

Первая последовательность драйвера в векторе, представленном в данном документе, может представлять собой выделенную нуклеиновую кислоту, которая имеет любую подходящую последовательность для воздействия РНКи на ген, кодирующий белок-мишень. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую последовательность, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37 или из комплементарных им последовательностей, при условиях низкой жесткости. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую последовательность, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37 или из комплементарных им последовательностей, при условиях умеренной жесткости. Первая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, имеющую последовательность, способную гибридизоваться с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из последовательности, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 21, SEQ ID NO: 22 и SEQ ID NO: 37 или из комплементарных им последовательностей, при условиях высокой жесткости. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, которая имеет любую подходящую последовательность для воздействия РНКи на ген, кодирующий белок-мишень. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях in situ в трансгенном растении. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях низкой жесткости. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях умеренной жесткости. Вторая последовательность драйвера может представлять собой выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью драйвера при условиях высокой жесткости.

Белок-мишень, на который направлено воздействие РНКи-конструкции в векторе, представленном в данном документе, может представлять собой любой белок, вовлеченный в регуляцию Зеленого Крахмала. Например, белок-мишень может представлять собой один из белка глюкан-вода-дикиназы, фосфоглюкан-вода-дикиназы, протеинфосфатазы с двойной специфичностью, ß-амилазы, изоамилазы, предельной декстриназы, фермента диспропорции или деветвящего фермента. Ген, кодирующий белок-мишень, может иметь последовательность, имеющую по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43. Ген, кодирующий белок-мишень, может иметь последовательность, которая гибридизуется с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43 или из комплементарных им последовательностей, при условиях низкой жесткости. Ген, кодирующий белок-мишень, может иметь последовательность, которая гибридизуется с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43 или из комплементарных им последовательностей, при условиях умеренной жесткости. Ген, кодирующий белок-мишень, может иметь последовательность, которая гибридизуется с нуклеиновой кислотой, включающей, по существу состоящей из или состоящей из эталонной последовательности, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43 или из комплементарных им последовательностей, при условиях высокой жесткости.

Вектор, представленный в данном документе, включает первую последовательность драйвера в 5'-области по отношению к спейсеру и прилегает к нему. Вектор, представленный в данном документе, может включать спейсер в 5'-области по отношению ко второй последовательности драйвера и прилегает к ней. Вектор, представленный в данном документе, может включать первую последовательность драйвера, расположенную в 5'-области по отношению к спейсеру и прилегает к нему, и спейсер, расположенный в 5'-области по отношению ко второй последовательности драйвера и прилегает к ней.

Вектор, представленный в данном документе, может содержать последовательность, включающую, по существу состоящую из или состоящую из последовательности, имеющей по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

Вектор, представленный в данном документе, может содержать последовательность, включающую, по существу состоящую из или состоящую из последовательности, имеющей по меньшей мере 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 13 и SEQ ID NO: 14.

В одном варианте осуществления предлагается способ получения трансгенного растения. Способ включает трансформацию растения с использованием одного или более векторов, представленных в данном документе. Растение может быть растением любого типа. Растение может представлять собой энергетическую культуру растений, пищевую культуру или фуражную культуру растений. Растение может представлять собой рис, просо, сорго, кукурузу или томат.

Дополнительные варианты осуществления включают те, что формируются при чтении любого зависимого пункта формулы изобретения, приведенной ниже, будучи зависимыми от любого одного или более из предыдущих пунктов формулы изобретения, вплоть до и включая их основные независимые пункты формулы изобретения.

Дополнительные варианты осуществления, представленные в данном документе, включают те, что могут быть сформированы путем дополнения любого варианта осуществления одним или более элементами из других, любого одного или более, вариантов осуществления, представленных в данном документе.

Примеры - Следующие частные примеры представлены для иллюстрации конкретных вариантов осуществления. Все варианты осуществления могут быть дополнены одним или более элементами из любого одного или более примеров, приведенных ниже.

Пример 1

Библиотеки со вставкой T-ДНК из различных организмов могут быть исследованы на предмет локализации в этих организмах генов, связанных с регуляцией крахмала. На основе открытия таких генов может быть проведено исследование для обнаружения похожих генов в интересующем растении. Интересующие гены могут использоваться в конструкциях, представленных в данном документе, для того чтобы вызвать изменение в регуляции крахмала.

Для генерирования или идентификации нулевых аллелей среди генов был разработан ряд других методов. Среди них TILLING (Till BJ, Cooper J, Tai TH, Colowit P, Greene EA, Henikoff S, Comai L Discovery of chemically induced mutations in rice by TILLING (2007) BMC Plant Biol. 7:19), и направленное воздействие на ген с помощью Tos17 ретротранспозонов или сконструированных маисовых (Zea mays) Ac и Ds/dSpm транспозонов (Krishnan A, Guiderdoni E, An G, Hsing YI, Han CD, Lee MC, Yu SM, Upadhyaya N, Ramachandran S, Zhang Q, Sundaresan V, Hirochika H, Leung H, Pereira A. 2009. Mutant resources in rice for functional genomics of the grasses. Plant Physiol. 149:165-70 и ссылки этих публикаций), которые включены в данный документ ссылкой в полном объеме. Эти методы могут использоваться для генерирования или идентификации нулевых аллелей среди генов, связанных с регуляцией крахмала.

Пример 2

Пример промежуточного РНКи-вектора представляет собой pAL409, который проиллюстрирован на фиг. 2. Как представлено на фиг. 2, инвертированные копии сегментов из транскрибируемого участка из гена, на который направлено воздействие, могут вводиться в pAL409 по AvrII сайту 220 (положение 4507) и по BspEI-сайту 210 (положение 4519), и снова по AgeI-сайту 295(положение 566) и по NheI-сайту 290 (положение 620). При транскрипции с рисового убиквитинового промотора 230 (P-OsUbi3), инвертированные копии сегментов (последовательности драйвера) позволяют получать РНК с образованием шпильки, в которой OsUbi3-интрон 200 служит в качестве спейсера между повторяющимися элементами. Сигнал полиаденилирования 280 (NOS 3') служит в качестве терминатора транскрипции. Цельная экспрессирующая кассета (от промотора до терминатора) может быть вырезана из этой плазмиды в виде фрагмента PacI-XmaI с помощью гидролиза по PacI-сайту 240 (положение 3574) и по XmaI-сайту 270 (положение 911). pAL409 также включает ColEI, E. coli последовательность начала репликации 260; и bla 250, маркер устойчивости к ампициллину. Последовательность pAL409 представлена ниже, но нумерация нуклеотидов и их ориентация отличается от изображенной на фиг. 2. Специалист способен сравнить последовательность, приведенную ниже, с векторной картой на фиг. 2, где приведена схема вектора. Промежуточный РНКи-вектор, такой как pAL409, может использоваться для введения тандемных инвертированных копий теоретически любых последовательностей драйвера.

>Последовательность pAL409

В вариантах осуществления, представленных в данном документе, предлагаются промежуточные РНКи-векторы, которые реплицируются с получение большого числа копий в E. coli, обладают низкой сложностью генома и имеют несколько стандартных сайтов рестрикции. pAL409 обладает этими характеристиками. Векторы с такими характеристиками применимы для сборки РНКи-экспрессирующих кассет, которые затем могут быть перенесены в Agrobacterium трансформирующий вектор.

Пример 3

Типичный трансформирующий вектор, pAG2004, проиллюстрирован на фиг. 3. pAG2004 [SEQ ID NO: 14]. pAG2004 включает интрон рисового убиквитина 300 (OsUbi3-интрон), рисовый убиквитиновый промотор 330 (P-OsUbi3), PacI-сайт 340 (положение 155), XmaI-сайт 370 (положение 214), NOS 3', сигнал полиаденилирования 380, и ColE1, E. coli последовательность начала репликации 360. pAG2004 также включает ген фосфоманноза-изомеразы (PMI) 390, RB 391, st AT 392 и aadA 393. pAG2004 или похожие векторы могут переноситься из E. coli в Agrobacterium tumefaciens LBA4404 посредством конъюгационного переноса, в процессе которого плазмида интегрируется в pSB1 (резидентная Ti-плазмида) посредством гомологичной рекомбинации. Совместное культивирование полученного рекомбинантного штамма Agrobacterium вместе с растительными клетками может привести в результате к переносу полученной из pAG2004 ДНК в геном растения. Варианты осуществления, представленные в данном документе, включают трансформирующий вектор, содержащий последовательности драйвера, связанные с мишенями для изменения Зеленого Крахмала. Варианты осуществления, представленные в данном документе, включают трансформирующий вектор, содержащий фрагмент из pAL409, включающий последовательности драйвера, связанные с мишенями для изменения Зеленого Крахмала. Варианты осуществления, представленные в данном документе, включают трансформирующий вектор, содержащий фрагмент PacI-XmaI из pAL409, включающий последовательности драйвера, связанные с мишенями для изменения Зеленого Крахмала, вместо фрагмента PacI-XmaI из pAG2004.

Пример 4

Последовательности из любого гена, связанного с регуляцией крахмала, могут быть представлены в промежуточном РНКи-векторе, трансформирующем векторе или в трансгенном растении, представленном в данном документе. Эти типичные гены для направленного воздействия на РНК интерференцию в рисе представляют собой GWD, DSP и ISA3. В SEQ ID NO: 1-3 приведены последовательности для рисовых генов GWD, DSP и ISA3, соответственно. В SEQ ID NO: 4-6 приведены предсказанные кодирующие последовательности для рисовых генов GWD, DSP и ISA3, соответственно. Последовательности генов GWD, DSP и ISA3 взяты из базы данных RiceGE: регистрационные № 0s06g30310 (GWD); 0s03g01750 (DSP) и 0s09g29404 (ISA3).

Пример 5

На основе кодирующих последовательностей в SEQ ID NO: 3-4 синтезировали искусственную кДНК и обеспечивали источник экспрессии соответствующих генов в гетерологичных системах (например, E. coli или дрожжи), которые, в свою очередь, делают возможным получать антитела для применения в анализе получаемых трансгенных растений.

Плазмидные ДНК, несущие цельные кодирующие последовательности SEQ ID NO: 3-4, использовали в качестве матриц в ПЦР-реакциях для получения последовательностей драйвера, используемых в РНКи-конструкциях. Для гена GWD получали две отдельные последовательности драйвера.

>GWD1 последовательность драйвера(одна копия)

>GWD2 последовательность драйвера (одна копия)

GWD1 получена из участка рядом с 5'-концом кодирующей последовательности GWD. Вторая последовательность драйвера GWD, GWD2, получена из участка вблизи от середины кодирующей последовательности GWD, которая соответствует участку относительно высокой консервативности генов GWD из различных видов. См. фиг. 4, которая иллюстрирует сравнение между GWD2, полученным из рисового гена глюкан-вода-дикиназы, и геном GWD из томата (Solanum lycopersicon). Неожиданно, анализ BLAST [публикация Zhang Z, Schwartz S, Wagner L, and Miller W, A greedy algorithm for aligning DNA sequences (2000) J Comput Biol 2000; 7(1-2):203-14, которая включена в данный документ ссылкой в полном объеме] этих двух последовательностей обнаружил существенную гомологию, несмотря на филогенетическую удаленность, которая разделяет эти два вида (рис - однодольное растение, в то время как томат - двудольное). Это предполагает, что данный участок гена GWD мог бы служить в качестве широко применимой мишени для РНК-интерференции. На фиг. 4 запросная последовательность (Query) (верхняя) представляет собой участок последовательности драйвера GWD2 [SEQ ID NO: 9]; и сравниваемая с ней (Sbjct) (нижняя последовательность) представляет собой кДНК-последовательность GWD томата [SEQ ID NO: 10]. Благодаря гомологии последовательностей на протяжении этого участка возможно, чтобы РНКи-конструкция, направленная против этого участка в рисовом гене, также могла бы применяться для подавления экспрессии гомологичных генов GWD в других видах растений. Варианты осуществления включают способы, векторы и трансгенные растения, включающие последовательности РНКи с направленным воздействием на GWD.

Участки генов DSP и ISA3 из риса также выбрали, чтобы они служили в качестве последовательностей драйвера.

>Последовательность драйвера DSP1

>Последовательность драйвера ISA3

Каждую последовательность драйвера, GWD1, GWD2, DSP1 и ISA3, амплифицировали с помощью ПЦР, так что каждая была фланкирована сайтами распознавания ферментов рестрикции (например, NheI и XmaI). Фрагменты сначала лигировали в pCRBlunt II TOPO (Invitrogen), с подтверждением посредством гидролиза множества ферментов рестрикции и с помощью секвенирования, затем разрезали (с использованием ферментов рестрикции, которые расщепляют введенные фланкированные сайты) и лигировали сначала по сайтам BspEI и AvrII и затем по сайтам NheI и AgeI из pAL409 (фиг. 2), которые располагались в виде двух копий в противоположных ориентациях. Полученные в результате РНКи-кассеты вырезали из производных pAL409 в виде фрагментов PacI-XmaI и лигировали в pAG2004 (фиг. 3), с получением плазмид pAG2100, pAG2102 и pAG2103. На фиг. представлены РНКи-кассеты с направленным воздействием на рисовые гены GWD, DSP и ISA3, где две верхние последовательности получены из гена GWD, средняя из DSP и нижняя из гена ISA3. Каждый из этих элементов драйвера представлен в виде дублированных инвертированных копий, разделенных с помощью интрона OsUbi3 и прилегающих к нему. Слева перечислены названия конструкций, которые собирали в плазмиде pAL409. Справа перечислены названия плазмид, которые были получены, когда РНКи-кассеты вырезали из pAL409 в виде фрагментов PacI-XmaI и вставляли в pAG2004.

Все еще ссылаясь на фиг. 3, pAL409-6WDko1-конструкция включает промотор P-OsUbi 331, последовательность драйвера GWD1 310, OsUBi-интрон 301, инвертированную последовательность драйвера GWD1 311 и NOS 3' последовательность полиаденилирования 381. pAL409-6WDko2-конструкция включает промотор P-OsUbi 332, последовательность драйвера GWD2 312, OsUBi-интрон 302, инвертированную последовательность драйвера GWD2 313 и NOS 3', последовательность полиаденилирования 382. pAL409-DSPko1-конструкция включает промотор P-OsUbi 333, последовательность драйвера DSP1 314, OsUBi-интрон 303, инвертированную последовательность драйвера DSP1 315 и NOS 3', последовательность полиаденилирования 383. pAL409-ISA3kol-конструкция включает промотор P-OsUbi 334, последовательность драйвера ISA3 316, OsUBi-интрон 304, инвертированную последовательность драйвера ISA3 317 и NOS 3', последовательность полиаденилирования 384. С помощью замены фрагмента PacI-XmaI pAG2004 на фрагменты PacI-XmaI конструкций pAL409-6WDko1, pAL409-6WDko2, pAL409-DSPko1 и pAL409-ISA3ko1, получали плазмиды pAG2100 [SEQ ID NO: 15], pAG2101 [SEQ ID NO: 16], pAG2102 [SEQ ID NO: 17] и pAG2103 [SEQ ID NO: 18], соответственно.

Пример 6

Генерирование трансгенных растений

Штаммы E. coli, несущие pAG2100, pAG2101, pAG2102 или pAG2103, использовали для конъюгации с Agrobacterium и для последующей трансформации риса, маиса и проса.

РНКи-конструкция сорго

План геномной последовательности, соответствующей предполагаемому гену GWD из Сорго двухцветного [SEQ ID NO: 19], был получен со странички Сорго двухцветного Объединенного Института Генома (JGI) по адресу (http://genome.jgi- psf.org/Sorbil/Sorbil.home.html). Из этой последовательности идентифицировали участок, приблизительно соответствующий участку гена GWD2 риса [SEQ ID NO: 20]. В сорго кодирующие последовательности в этом участке разрываются одним или более интронами, как идентифицировано с помощью JGI, и интроны приблизительно соответствуют нуклеотидам 140-342, нуклеотидам 507-628 и нуклеотидам 723-795 в SEQ ID NO: 20. Нативный интрон, полученный из генома сорго, применяли в сборке РНКи-кассеты для выключения гена GWD в сорго. Участок гена GWD сорго амплифицировали. Амплифицированный участок включал один полный экзон (на основе прогноза JGI) внутри высоко консервативного срединного участка (описано ранее, см. фиг. 4), соседний интрон, и 10 оснований последующего экзона (для сохранения границ 3' интрон/экзон). Сайт XmaI инкорпорировали в 5'-области первого экзона, а сайты AgeI и NheI инкорпорировали в 3'-области укороченного второго экзона в процессе ПЦР-амплификации продукта. Данный продукт (SbGWDko2a) сначала лигировали в pCRBluntII TOPO (Invitrogen), и его состав подтверждали посредством гидролиза с использованием множества ферментов рестрикции и с помощью секвенирования.

>SbGWDko2a (с фланкирующими сайтами рестрикции)

Второй ПЦР-продукт (SbGWDko2b), соответствующий только первому экзону, упомянутому выше, также амплифицировали с помощью ПЦР с введением фланкирующих сайтов NheI и XmaI на 5'- и 3'-концах (относительно направления транскрипции, и лигировали в pCRBluntII TOPO. Состав данного фрагмента также подтверждали с помощью гидролиза с использованием множества ферментов рестрикции и с помощью секвенирования.

>SbGWDko2b (с фланкирующими сайтами рестрикции)

Затем SbGWDko2b вырезали из pCRBluntII в виде фрагмента NheI-XmaI, и лигировали по сайтам NheI и AgeI плазмиды, несущей SbGWDko2a, располагая SbGWDko2b в 3'-области по отношению к интрону и в противоположной ориентации с SbGWDko2a. В данной ориентации последовательности в sbGWDko2b-участке плазмиды присутствуют в виде инвертированных комплементарных последовательностей внутри участка sbGWDko2a. Ссылаясь на фиг. 5, данную цельную кассету вырезали в виде фрагмента XmaI-NheI и лигировали в pAL409j, с получением плазмиды pAL409j SbGWDko2 [SEQ ID NO: 47]. pAL409j несет РНКи-кассету с направленным воздействием на ген GWD Сорго двухцветного. Последовательность драйвера 510 (sbGWDko2a) показана на фиг. 5 в 5'-области по отношению к интрону 520 (sbGWDi), который показан в 5'-области по отношению к последовательности драйвера 530 (sbGWDko2b). pAL409j отличается от pAL409 только в том, что соединение между промотором OsUbi3 и OsUbi3i-интроном было модифицировано для отражения нативного контекста в геноме риса. Как таковая данная операция может предохранять энхансерные функции OsUbi3i по отношению к промотору OsUbi3. Как представлено на фиг. 5, две инвертированные, гомологичные последовательности драйвера, полученные из экзона внутри гена GWD сорго (GWDex), разделены нативным экзоном сорго гена GWD сорго (SbGWDi). Другие элементы имеют названия как на фиг. 2.

Затем вырезали цельную РНКи-кассету из pAL409j SbGWDko2 в виде фрагмента PacI-XmaI и лигировали по сайтам PacI и XmaI pAG2004, с получением трансформирующего Agrobacterium вектора pAG2106 [SEQ ID NO: 23] так, как описано в ссылке на фиг. 3. Штамм E. coli, несущий pAG2106, использовали для конъюгации с Agrobacterium и для последующей трансформации сорго.

Пример 7

Секвенирование генов GWD проса

Гомологи GWD и ISA3 детектировали в геноме проса, и количество гомологов, которые присутствуют для каждого, оценивали с использованием стратегии анализа по Саузерну. Результаты анализа по Саузерну с использованием зонда ISA3 риса представлены на фиг. 6. На фиг. 6 представлено детектирование гомологов ISA3 посредством анализа по Саузерну. Геномную ДНК экстрагировали из риса, сорго, маиса и проса, гидролизовали с помощью HindIII, и разделяли с использованием электрофореза на агарозном геле. ДНК затем переносили на нейлоновую мембрану посредством капиллярного блоттинга и блоты гибридизовали с DIG-меченной ДНК, полученной из клонированного гена ISA3 риса. В то время как зонд гибридизовался только с уникальными фрагментами в рисе и сорго, тот же самый зонд гибридизовался с 3-5 фрагментами в геномах маиса и проса. В качестве контроля использовали плазмидную ДНК, несущую кодирующую последовательность ISA3 риса; и маркер в виде молекулярных массовых стандартов ДНК. Были получены аналогичные результаты, когда в качестве зонда использовали фрагмент GWD2 (не показано). Было определено, что в отличие от риса и сорго, которые содержат единственные копии GWD и ISA3, просо содержит множество гомологов каждого из этих генов.

Участок гена GWD проса идентифицировали и клонировали с использованием метода вырожденной ПЦР. Вырожденная ПЦР применяет олигонуклеотидные праймеры, содержащие один или более неопределенных оснований, которые дают возможность праймерам отжигаться на последовательностях матрицы, для которых доступна только приблизительная информация о последовательности. То есть, в участках существенной консервативности последовательности между генами значительно удаленных видов, специалист может сделать вывод об интервале возможных последовательностей, которые могут присутствовать в соответствующем гене из недостаточно охарактеризованных видов, таких как просо. Затем специалист может сконструировать вырожденные праймеры, которые будут отжигаться на предсказанных последовательностях, давая возможность ПЦР-амплификации и клонирования участка рассматриваемого гена.

Проводя стратегию вырожденной ПЦР, выравнивали участки генов GWD, полученных из риса, сорго, маиса и томата. Сильное выравнивание наблюдалось в участке генов GWD, который описан на фиг. 4. Короткие (~40 нт) участки вблизи концов этих участков гомологии были выбраны для более подробного сравнения последовательностей (фиг. 7). Фиг. 7 иллюстрирует выравнивание выборки из генов GWD риса (OsGWD)[SEQ ID NO: 24 (верхняя) и 28 (нижняя)], сорго (SbGWD) [SEQ ID NO: 25 (верхняя) и 29 (нижняя)], маиса (ZmGWD) [SEQ ID NO: 26 (верхняя) и 30 (нижняя)], и томата (SIGWD) [SEQ ID NO: 27 (верхняя) и 31 (нижняя)]. Нуклеотидные положения, которые консервативны, по меньшей мере в двух из четырех последовательностей отмечены светло-серым. Внизу для каждой группы представлена консенсусная последовательность, для которой были сконструированы вырожденные праймеры (dgGWDup2 и dgGWDdown2 [SEQ ID NO: 32 и 33, соответственно]) для ПЦР-амплификации. Примечательно, что только неполная последовательность доступна для маисового гомолога, с участком неизвестной последовательности, представленной как Ns. Четыре последовательности, выровненные в верхнем сегменте, соответствуют участку кодирующих последовательностей GWD, которые можно обнаружить на участке нуклеотидов 1803-1840 кодирующей последовательности томата (как определено на фиг. 4), в то время как выравнивания в нижнем сегменте соответствуют нуклеотидам 2208-2249 последовательности томата. Нуклеотидные сокращения для вырожденных нуклеотидов представлены ниже: Y, C или T; W, A или T; K, G или T; R, A или G, M, A или C; H, A или C или T; S, G или C; D, A или G или T. На основе данной информации конструировали вырожденные праймеры (dgGWDup2: 5'-TGGAATTYTTGTWTGGATKAGRTTCATGGCTACMAGGCA-3' и dgGWDdown2: 5'-GGYTCWGAATGRATMGSWCGRTCATARCTCAADAGACGCTCT-3'). Геномную ДНК, которая была выделена из сорго, затем использовали в качестве матрицы в реакциях ПЦР с данными праймерами. С помощью вырожденной ПЦР с геномной ДНК сорго в качестве матрицы получали ПЦР-продукт с размером приблизительно 800 п.о. Секвенирование данного ПЦР-продукта обнаружило, что он имеет близкое сродство с последовательностью, которая была предсказана для гена GWD сорго с помощью базы данных JGI (см. выше), которая выявила, что вырожденные праймеры будут достоверно амплифицировать сегмент гена GWD.

Те же праймеры затем использовали в ПЦР-реакциях, в которых использовали геномную ДНК проса (экотип Alamo) в качестве матрицы. Эти реакции продуцировали дискретные ПЦР-продукты размером приблизительно 1100 п.о. Эти продукты лигировали в pCRBluntII TOPO и пять полученных в результате плазмид секвенировали.

На основе этих пяти последовательностей определили, что:

•Каждый клонированный ПЦР-продукт получали из гена с очень существенной гомологией с геном GWD риса.

•Среди пяти секвенированных продуктов было три очевидных класса (высоко гомологичных) последовательностей, предполагающих что клоны были получены из трех различных гомологов GWD внутри генома проса. Это наблюдение согласуется с данными анализа по Саузерну, который предполагает множество генов GWD, располагающихся внутри генома проса.

•Главные отличия в размерах продуктов, которые были получены из вырожденной ПЦР сорго и проса, могут объясняться различиям по длине предполагаемых интронов в каждом из соответствующих генов.

При ссылке на фиг. 8, иллюстрируется сравнение относительной длины и расположения интронов внутри корового сегмента гомологии генов GWD из риса, сорго, Arabidopsis, и из проса. Темные боксы представляют экзоны, а светлые боксы представляют интроны. Последовательности экзонов очень консервативны и легко распознаваемы. В то время как относительные положения каждого из интронов также очень консервативны среди видов, при этом длина и последовательность интронов не так консервативны. Длины интронов и экзонов указаны в п.о. внутри каждого элемента.

Как показано ниже, выравнивание последовательностей из трех полученных из проса продуктов вырожденной ПЦР, представленных ниже, демонстрирует, что относительно немного единичных нуклеотидных изменений и два некоторых вставок/делеций по длине отличают эти три GWD-гомолога в данном участке. Эти три продукта представляют собой PvGWD-2 [SEQ ID NO: 34], PvGWD-5 [SEQ ID NO: 35] и PvGWD-1 [SEQ ID NO: 36].

CLUSTAL 2.0.10 выравнивание множества последовательностей

Последовательности экзонов из гена(ов) GWD проса были выведены на основе вышеописанной информации. Выведенные последовательности использовали для (1) разработки РНКи-конструкции, которая будет направленно воздействовать на данный центральный участок одного или всех из генов GWD проса, и (2) определения большего количества геномных последовательностей для каждого из этих (по меньшей мере для трех) GWD-гомологов в просе.

Для разработки РНКи-конструкции ПЦР использовали для амплификации участков из двух экзонов, охваченных в продуктах вырожденной ПЦР, описанных выше. Эти два продукта затем сшивали с помощью SOEPCR (Horton R.M., Hunt H.D., Ho S.N., Pullen J.К., Pease L.R., Engineering hybrid genes with out the use of restriction enzymes: gene splicing by overlap extension (1989) Gene 77(1):61-8), которая включена в данный документ ссылкой в полном объеме. Сшитые продукты включали непрерывную последовательность, которая, как ожидалось, была более близка одной или более мРНК GWD проса. Сайты NheI и XmaI инкорпорировали в конец сшитого продукта, чтобы была возможность последующего клонирования в pAL409. Последовательность данного продукта (названного "PvGWDko2" наряду с фланкирующими сайтами рестрикции) изображена ниже.

>Последовательность драйвера РНКи PvGWDko2

Одну копию данного элемента лигировали по сайтам AvrII и BspEI pAL409, затем вторую копию лигировали по сайтам NheI и AgeI полученной плазмиды с получением РНКи-кассеты pAL409 PvGWDko2, которая содержала элементы, расположенные в противоположных ориентациях, разделенные интроном OsUbi3, как описано в ссылке на фиг. 3. РНКи-кассету вырезали из данной плазмиды в виде фрагмента PacI-XmaI и лигировали по сайтам PacI и XmaI pAG2004 (фиг. 3). Полученный трансформирующий Agrobacterium вектор назвали pAG2104 [SEQ ID NO: 38]. Штамм E. coli, несущий данную плазмиду, использовали для конъюгации с Agrobacterium и для последующей трансформации проса.

При изучении полных геномных последовательностей каждого из генов GWD в просе может быть возможна идентификация потенциальных уникальных последовательностей (5'- и 3'-нетранслируемых участков), которые фланкируют каждый из этих генов. С использованием данной информации возможно конструирование РНКи-конструкций, которые специфически направленно воздействуют на один из этих генов или на другие.

Для идентификации большего количества последовательностей, ассоциированных с каждым из GWD гомологов, следовали стратегии, которая применяет обратную ПЦР (оПЦР (iPCR)), а также вырожденную ПЦР. Геномную ДНК из проса гидролизовали с использованием либо EcoRI, HindIII, либо Bgl II. Затем их подвергали самолигированию, разводили приблизительно в 100 раз и использовали в качестве матриц для обратных ПЦР-реакций. Последовательности первых праймеров, использованных в оПЦР-реакциях, суммированы в таблице 1.

Таблица 1
Последовательности праймеров, используемых для обратной ПЦР
PvGWDi-1 CCGTGGCTTCACATTATAGTTCTTATTCCA SEQ ID NO: 39
PvGWDi-2 GAGATAAGCAAAGCACAAGATAGGT SEQ ID NO: 40
PvGWDi-3 GCCTGCCCAAGGAGAGACATAACCA SEQ ID NO: 41
PvGWDi-4 GATATAAGTGTTTACTGGGACACCT SEQ ID NO: 42

Обратные ПЦР-реакции либо с праймерами PvGWDi-1 и PvGWDi-2, либо с праймерами PvGWDi-3 и PvGWDi-4 проводили с использованием матриц, гидролизованных с помощью EcoRI или HindIII (и самолигированных). С помощью этих реакций получали небольшое количество чистых продуктов, которые очищали из агарозных гелей и лигировали в pCRBluntII-TOPO. Анализ последовательности полученных в результате плазмид давал возможность расширения известной последовательности генов GWD проса в обоих направлениях, в 5' и в 3' в целом до 3,4 т.п.о. И снова, последовательности из индивидуальных клонов отличались примерно на 1-2%, согласуясь с идеей, что клонированные ПЦР продукты получали из отдельных, но очень схожих GWD-гомологов в геноме проса. Этот опыт повторяли с новыми сконструированными праймерами, включая как обратную ПЦР, так и вырожденную ПЦР для дополнительного расширения известной последовательности. Идентифицировали приблизительно 7 т.п.о. последовательности GWD проса.

Предлагается укрупненная последовательность, представляющая последовательности гена GWD проса, открытые в данном документе. Представленная последовательность не включает все из вариантов, идентифицированных среди гомологов. Таким образом, последовательность может рассматриваться как химера данных гомологов. Данная последовательность охватывает сегмент приблизительно l-2 т.п.о., для которого нет данных о последовательности. Данный сегмент представлен как последовательность Ns. Ссылаясь на фиг. 9 иллюстрируется изображение точечной матрицы выравниваний BLASTn между геномными последовательностями проса и риса для глюкан-вода-дикиназных генов. Горизонтальная ось представляет последовательность проса; и вертикальная ось представляет последовательность риса. Диагональные сегменты представляют участки, где две последовательности высоко гомологичны. Данная схема представляет гомологию последовательности проса, представленной ниже, с соответствующей последовательностью гена GWD риса.

>гомологи GWD проса

Пример 8

Подавление мРНК из генов, вовлеченных в мобилизацию растительного крахмала

Для определения того, оказывают ли РНКи-векторы, описанные выше, эффект на мРНк-мишени в трансгенных растениях, РНК выделяли из нескольких контрольных и трансгенных растений и использовали ПЦР в реальном времени с обратной транскриптазой (ОТ-ПЦР в реальном времени) для измерения представленности мРНК видов (фиг. 10, 11 и 12). Эти результаты подтвердили, что РНКи может использоваться для понижения уровня нативной мРНК в трансгенном рисе.

Ссылаясь на фиг. 10, 11 и 12, эти фигуры иллюстрируют, что РНКи-вектор подавляет накопление мРНК-мишени в трансгенном рисе. От-ПЦР в реальном времени применяли для измерения представленности мРНК различных видов относительно эталонных генов ("гены домашнего хозяйства", которые обычно конститутивно экспрессируются в рисе). В нескольких из трансгенных линий было обнаружено, что уровень мРНК-мишени существенно ниже уровня, наблюдаемого в контрольных растениях. Фиг. 10, уровень мРНК GWD среди растений, несущих pAG2100 или pAG2101 среди контролей дикого типа (WT); фиг. 11, уровень мРНК DSP среди растений, несущих pAG2102 и у WT-контролей; фиг. 12, уровень мРНК ISA3 среди растений, несущих pAG2103 и у WT-контролей.

Пример 9

Накопление крахмала среди трансгенных растений

Ткани собирали из контрольных растений, а также из риса и проса, которые несут интегрированные копии РНКи-трансгенов, описанных выше. Эти ткани затем сушили и перемалывали до мелкодисперсного порошка. Содержание крахмала в этих тканях определяли с помощью стандартных методов (публикация Smith AM and Zeeman SC, Quantification of starch in plant tissues (2006) Nat. Protocols 1:1342-1345, которая включена в данный документ ссылкой в полном объеме). Ссылаясь на фиг. 13, повышенное содержание крахмала среди выбранных линий риса и проса представлено для тех линий, которые несут РНКи-конструкции. Результаты для Nipponbarre и Alamo (нетрансформированные линии для риса и проса, соответственно) представляют средние значения для нескольких различных растений. Другие результаты представляют 2-3-кратные повторения для одного трансгенного растения. Трансгенные растения идентифицировали согласно направленному воздействию на ген, связанный с мобилизацией крахмала. OsGWD-1 растения несут РНКи-вектор pAG2100; OsGWD-2 растения несут pAG2101; OsDSP растения несут pAG2102; OsISA3 растения несут pAG2103; PvGWD растения несут pAG2104, РНКи-экспрессирующий вектор, который специфически направленно воздействует на транскрипты GWD проса, напоминающие последовательности, описанные выше (см.фиг. 9). Как представлено на фиг. 13, несколько трансгенных линий риса и проса идентифицировали как накапливающие крахмал выше уровня, наблюдаемого в контрольных растениях. В данных примерах крахмал накапливался до уровня настолько высокого, как 6% в трансгенных рисовых линиях, в то время как самое высокое накопление контрольных растений доходило до примерно 3%. В просе самое высокое накопление в линии Alamo составило примерно 2% крахмала, тогда как самое высокое накопление трансгенной линии составило примерно 3,5% крахмала в пересчете на сухую массу.

Ссылаясь на фиг. 14, было обнаружено, что содержание крахмала в нескольких рисовых растениях, которые приблизительно на 5 недель старше, чем другие, изображенные на фиг. 13, составляет в 2-3 раз выше, чем наблюдалось в более молодых растениях. Фиг. 14 иллюстрирует содержание крахмала в трансгенных рисовых линиях, собранных приблизительно через 19 недель после посадки. Номенклатура растений такая, как на фиг.13. Среди них одна линия, экспрессирующая РНКи, которая направленно воздействует на GWD, накапливала крахмал до ~16% в пересчете на сухую массу, в то время как контрольные линии накапливали не более чем ~8% крахмала.

Таким образом, понятно, что данное изобретение не ограничено конкретными раскрытыми вариантами осуществления, но подразумевается, что оно охватывает все модификации, которые находятся в рамках смысла и сущности изобретения, которые определены с помощью прилагаемой формулы изобретения; приведенного выше описания; и/или которые представлены в прилагаемых чертежах.

1. Трансгенное растение, включающее конструкцию РНКи, включающую:
первую последовательность драйвера, состоящую из первой выделенной нуклеиновой кислоты, имеющую по меньшей мере 90% идентичность с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37;
вторую последовательность драйвера, состоящую из второй выделенной нуклеиновой кислоты, способной гибридизоваться с первой последовательностью нуклеиновой кислоты в высокожестких условиях;
спейсер, функционально связанный с первой последовательностью драйвера и второй последовательностью драйвера и располагающийся между ними; и
промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и со спейсером,
где при экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена, и трансгенное растение имеет повышенный уровень растительного крахмала по сравнению с растением дикого вида.

2. Трансгенное растение по п. 1, где спейсер представляет собой интрон, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера.

3. Трансгенное растение по п. 1, где вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

4. Трансгенное растение по п. 1, где первая последовательность драйвера представляет собой выделенную нуклеиновую кислоту, имеющую последовательность со 100% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37, и вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

5. Трансгенное растение по п. 1, где трансгенное растение представляет собой растение, выбранное из группы, состоящей из риса, проса, сорго, кукурузы и томата.

6. Трансгенное растение по п. 1, где первая последовательность драйвера располагается в 5′-области по отношению к спейсеру и прилегает к нему, и спейсер располагается в 5′-области по отношению ко второй последовательности драйвера и прилегает к ней.

7. Трансгенное растение по п. 1, где трансгенное растение является продуктом трансформации растения при помощи Agrobacterium с применением вектора, содержащего РНКи-конструкцию, или является потомством такого трансгенного растения.

8. Трансгенное растение по п. 7, где вектор имеет последовательность, выбранную из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

9. Трансгенное растение, полученное из энергетической культуры, пищевой культуры или из фуражной культуры растения, включающего РНКи-конструкцию, включающую:
первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичность с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37;
вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой в высокожестких условиях;
спейсер, функционально связанный с первой последовательностью драйвера и второй последовательностью драйвера; и
промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и спейсером,
где при экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена, и трансгенное растение имеет повышенный уровень растительного крахмала по сравнению с растением дикого вида.

10. Трансгенное растение по п. 9, где спейсер представляет собой интрон, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера.

11. Трансгенное растение по п. 9, где вторая выделенная нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой нуклеиновой кислоты.

12. Трансгенное растение по п. 9, где первая последовательность драйвера располагается в 5′-области по отношению к спейсеру и прилегает к нему, и спейсер располагается в 5′-области по отношению ко второй последовательности драйвера и прилегает к ней.

13. Трансгенное растение по п. 9, где энергетическая культура, пищевая культура или фуражная культура растения представляет собой растение, выбранное из группы, состоящей из риса, проса, сорго, кукурузы и томата.

14. Трансгенное растение по п. 9, где ген включает последовательность с 90% идентичностью с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43.

15. Трансгенное растение по п. 9, где трансгенное растение представляет собой продукт трансформации растения при помощи Agrobacterium с применением вектора, имеющего последовательность, выбранную из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47, или потомство такого трансгенного растения.

16. Способ сельскохозяйственной переработки, включающий:
предоставление трансгенного растения, причем трансгенное растение включает РНКи-конструкцию, имеющую первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичность с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37; вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью нуклеиновой кислоты в высокожестких условиях; спейсер, функционально связанный и расположенный между первой последовательностью драйвера и второй последовательностью драйвера; и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и спейсером; и
процесс переработки трансгенного растения, где процесс переработки выбран из группы операций, состоящей из сбора урожая, прессования, мелкого дробления, перемалывания, рубки, дробления, раздавливания, гранулирования, силосования, ферментации, использования трансгенного растения в качестве сырья, смешивания сырья с другими компонентами, экстракции компонента из сырья, очистки компонента или части сырья, экстракции или очистки крахмала, гидролиза полисахаридов до олигосахаридов или моносахаридов, химического превращения или химического катализа сырья,
где первая и вторая последовательности драйвера экспрессируются в трансгенном растении, и трансгенное растение имеет повышенный уровень растительного крахмала по сравнению с растением дикого вида.

17. Способ по п. 16, где спейсер представляет собой интрон, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера.

18. Способ по п. 16, где вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

19. Способ по п. 16, где первая последовательность драйвера представляет собой выделенную нуклеиновую кислоту, имеющую последовательность со 100% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37, и где вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

20. Способ по п. 16, где трансгенное растение представляет собой растение, выбранное из группы, состоящей из риса, проса, сорго, кукурузы и томата.

21. Способ по п. 16, где первая последовательность драйвера располагается в 5′-области по отношению к спейсеру и прилегает к нему, и спейсер располагается в 5′-области по отношению ко второй последовательности драйвера и прилегает к ней.

22. Способ по п. 16, где трансгенное растение является продуктом трансформации растения с помощью Agrobacterium с применением вектора, содержащего РНКи-конструкцию, или потомством такого трансгенного растения.

23. Способ по п. 22, где вектор имеет последовательность, выбранную из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

24. Способ по п. 16, где стадия переработки включает по меньшей мере одну стадию, выбранную из группы, состоящей из сушки, подготовки к ферментации, кислотного гидролиза и амилазного гидролиза.

25. Способ повышения уровня растительного крахмала в растении, где растение представляет собой трансгенное растение, включающее РНКи-конструкцию, имеющую первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичность с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37; вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью нуклеиновой кислоты в высокожестких условиях; спейсер, функционально связанный и расположенный между первой последовательностью драйвера и второй последовательностью драйвера; и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и спейсером, и экспрессия РНКи-конструкции в растении изменяет активность по меньшей мере одного фермента, связанного с метаболизмом крахмала в растении, путем ингибирования экспрессии гена, кодирующего фермент и повышающий уровень растительного крахмала в растении.

26. Способ по п. 25, где спейсер представляет собой интрон, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера.

27. Способ по п. 25, где вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

28. Способ по п. 25, где первая последовательность драйвера представляет собой первую выделенную нуклеиновую кислоту, имеющую последовательность со 100% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37, и вторая последовательность драйвера представляет собой вторую выделенную нуклеиновую кислоту, имеющую инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

29. Способ по п. 25, где трансгенное растение представляет собой растение, выбранное из группы, состоящей из риса, проса, сорго, кукурузы и томата.

30. Способ по п. 25, где первая последовательность драйвера располагается в 5′-области по отношению к спейсеру и прилегает к нему, и спейсер располагается в 5′-области по отношению ко второй последовательности драйвера и прилегает к ней.

31. Способ по п. 25, где трансгенное растение является продуктом трансформации растения с помощью Agrobacterium с применением вектора, содержащего РНКи-конструкцию, или потомством такого трансгенного растения.

32. Способ по п. 31, где вектор имеет последовательность, выбранную из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

33. Способ по п. 25, где растение представляет собой трансгенное растение, полученное из энергетической культуры, пищевой культуры или фуражной культуры растения.

34. Способ по п. 25, где ген включает последовательность, имеющую по меньшей мере 90% идентичность с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43.

35. Способ по п. 25, где трансгенное растение является продуктом трансформации растения с помощью Agrobacterium с применением вектора, имеющего последовательность, выбранную из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47, или потомством такого трансгенного растения.

36. Вектор для создания трансгенного растения, имеющего повышенный уровень растительного крахмала по сравнению с растением дикого вида, где вектор включает РНКи-конструкцию, причем РНКи-конструкция включает:
первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичность с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37;
вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой выделенной нуклеиновой кислотой в высокожестких условиях;
спейсер, функционально связанный и расположенный между первой последовательностью драйвера и второй последовательностью драйвера; и
промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и спейсером, где в организме-хозяине, имеющем ген, и при экспрессии первой последовательности драйвера, спейсера и второй последовательности драйвера РНК-последовательность, транскрибируемая с первой выделенной нуклеиновой кислоты, и РНК-последовательность, транскрибируемая со второй выделенной нуклеиновой кислоты, способны гибридизоваться друг с другом и вызывать ингибирование экспрессии гена и повышать уровень растительного крахмала в трансгенном растении.

37. Вектор по п. 36, где спейсер представляет собой интрон, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера.

38. Вектор по п. 36, где вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

39. Вектор по п. 36, где первая последовательность драйвера представляет собой первую выделенную нуклеиновую кислоту, имеющую последовательность со 100% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37, и вторая последовательность драйвера представляет собой вторую выделенную нуклеиновую кислоту, имеющую инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

40. Вектор по п. 36, где первая последовательность драйвера располагается в 5′-области по отношению к спейсеру и прилегает к нему, и спейсер располагается в 5′-области по отношению ко второй последовательности драйвера и прилегает к ней.

41. Вектор по п. 36, имеющий последовательность с по меньшей мере 90% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

42. Вектор по п. 36, где вектор представляет собой промежуточный вектор.

43. Вектор по п. 36, где вектор представляет собой трансформирующий вектор.

44. Вектор по п. 36, имеющий выделенную нуклеиновую кислоту, имеющую по меньшей мере 90% идентичность с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

45. Способ получения трансгенного растения, имеющего повышенный уровень растительного крахмала по сравнению с растением дикого вида, где способ включает трансформацию растения с помощью вектора по любому из пп. 36-44.

46. Способ по п. 45, где растение представляет собой растение, выбранное из группы, состоящей из энергетической культуры, пищевой культуры или фуражной культуры растения.

47. Способ по п. 45, где растение представляет собой растение, выбранное из группы, состоящей из риса, проса, сорго, кукурузы и томата.

48. Трансгенное растение по п. 14, где ген включает последовательность со 100% идентичностью последовательности, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43.

49. Трансгенное растение по п. 9, где первая выделенная нуклеиновая кислота имеет последовательность со 100% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37, и вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

50. Способ получения корма для животных, включающий: предоставление трансгенного растения, причем трансгенное растение включает РНКи-конструкцию, имеющую первую последовательность драйвера, включающую первую выделенную нуклеиновую кислоту, имеющую последовательность с по меньшей мере 90% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37; вторую последовательность драйвера, включающую вторую выделенную нуклеиновую кислоту, способную гибридизоваться с первой последовательностью нуклеиновой кислоты в высокожестких условиях; спейсер, функционально связанный и расположенный между первой последовательностью драйвера и второй последовательностью драйвера; и промотор, функционально связанный с первой последовательностью драйвера, второй последовательностью драйвера и спейсером; и
получение корма для животных путем переработки трансгенного растения, где переработка выбрана из группы операций, состоящей из сбора урожая, прессования, мелкого дробления, перемалывания, рубки, дробления, раздавливания, гранулирования, силосования, ферментации, использования трансгенного растения в качестве сырья, смешивания сырья с другими компонентами, экстракции компонента из сырья, очистки компонента или части сырья, экстракции или очистки крахмала, гидролиза полисахаридов до олигосахаридов или моносахаридов, химического превращения или химического катализа сырья,
где первая и вторая последовательности драйвера экспрессируются в трансгенном растении, и трансгенное растение имеет повышенный уровень растительного крахмала по сравнению с растением дикого вида.

51. Способ по п. 50, где спейсер представляет собой интрон, функционально связанный с первой последовательностью драйвера и со второй последовательностью драйвера.

52. Способ по п. 50, где вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

53. Способ по п. 50, где первая последовательность драйвера представляет собой выделенную нуклеиновую кислоту, имеющую последовательность со 100% идентичностью с эталонной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12 и SEQ ID NO: 37, и вторая нуклеиновая кислота представляет собой инвертированную комплементарную последовательность первой последовательности нуклеиновой кислоты.

54. Способ по п. 50, где трансгенное растение представляет собой растение, выбранное из группы, состоящей из риса, проса, сорго, кукурузы и томата.

55. Способ по п. 50, где первая последовательность драйвера располагается в 5′-области по отношению к спейсеру и прилегает к нему, и спейсер располагается в 5′-области по отношению ко второй последовательности драйвера и прилегает к ней.

56. Способ по п. 50, где трансгенное растение является продуктом трансформации растения с помощью Agrobacterium с применением вектора, содержащего РНКи-конструкцию, или потомством такого трансгенного растения.

57. Способ по п. 56, где вектор имеет последовательность, выбранную из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.

58. Способ по п. 50, где стадия процесса переработки включает по меньшей мере одну стадию, выбранную из группы, состоящей из сушки, подготовки к ферментации.

59. Способ по п. 33, где ген включает последовательность со 100% идентичностью с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 и SEQ ID NO: 43.

60. Вектор по п. 36, имеющий выделенную нуклеиновую кислоту со 100% идентичностью с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23 и SEQ ID NO: 47.



 

Похожие патенты:

Изобретение относится к генной инженерии. Описан полинуклеотид, обладающий свойствами специфического промотора семян, содержащий контролирующую экспрессию последовательность, которая делает возможной семя-специфическую экспрессию представляющей интерес нуклеиновой кислоты, функционально связанной с ней, в растениях.

Изобретение относится к области биохимии, в частности к способу получения семя-специфичного растительного промотора высокой экспрессии, содержащему функциональное связывание с промотором одной молекулы нуклеиновых кислот, усиливающих экспрессию нуклеиновой кислоты (NEENA), гетерологичной по отношению к указанному промотору, а также к рекомбинантной экспрессионной конструкции, содержащей одну NEENA и, по меньшей мере, один семя-специфичный промотор, гетерологичный по отношению к указанной одной NEENA, и по меньшей мере, одну экспрессируемую молекулу нуклеиновой кислоты.

Изобретение относится к области биохимии, в частности к изолированной молекуле нуклеиновой кислоты, кодирующей полипептид, обладающий дельта-9-элонгазной активностью, а также к очищенному полипептиду, обладающему дельта-9-элонгазной активностью, кодируемому вышеуказанной изолированной молекулой нуклеиновой кислоты.

Изобретение относится к области сельскохозяйственной биотехнологии. Изобретение представляет собой способ получения дигаплоидных растений ячменя из культивируемых микроспор in vitro, включающий: - выращивание растений-доноров при пониженной температуре воздуха 15-20°C, световом режиме: 16 ч день/8 ч ночь, влажности воздуха 60-70%, интенсивности освещения 10000-15000 люкс, с проведением фитосанитарной обработки, при этом выращивание растений-доноров осуществляют до стадии от открытия влагалища флагового листа, когда соцветие находится внутри флагового листа, - стрессовую обработку колосьев при 4°C, в пробирках с бедной средой, содержащей KCl - 1,5 г/л, MgSO4×7H2O - 0,25 г/л, CaCl2×2Н2О - 0,1 г/л, маннитол - 60 г/л, калий-фосфатный буфер - 1 мл/л, pH 7,0, в течение 7 дней для переключения из гаметофитного пути развития микроспоры на спорофитный путь, - выделение микроспор из колосков в стерильных условиях, - культивирование выделенных микроспор на модифицированной среде для индукции эмбриогенеза, включающей 6% мальтозу, 10 завязей на 1,5 мл культуры и регуляторы роста растений в количестве 1 мг/л 2,4-Д, 0,2 мг/л зеатина, причем добавление вышеуказанных компонентов осуществляется перед добавлением микроспор, - регенерацию растений из эмбриоидов путем культивирования на твердой питательной среде Мурашига и Скуга без добавления регуляторов роста растений, - обработку гаплоидных растений ячменя антимитотическим препаратом N-диацетил-N-(β,γ-эпоксипропил) аминоколхицином для удвоения хромосом и получения дигаплоидых растений.

Изобретение относится к области биохимии, в частности к способу введения сиквенс-специфичной нуклеазы (ССН) в растительную клетку. При этом способ включает: обеспечение наличия растительной клетки, имеющей клеточную стенку; покрытие наночастицы золота CCH; приведение растительной клетки, имеющей клеточную стенку, и покрытой наночастицы в контакт друг с другом; и инкубацию клетки, имеющей клеточную стенку, совместно с покрытой наночастицей таким образом, чтобы обеспечить поглощение наночастицы и CCH в растительную клетку, содержащую клеточную стенку.

Изобретение относится к области биохимии, в частности к применению гена, кодирующего белок, который состоит из аминокислотной последовательности, представленной в SEQ ID NO.2, для получения трансгенного риса с длинными, большими и многочисленными зернами и увеличенной урожайностью, увеличенным количеством зерен в метелке и скрученными листьями.

Изобретение относится к области биохимии, в частности к способу борьбы с сорняками поблизости от растения подсолнечника. При этом способ включает нанесение на сорняки и растение подсолнечника эффективного количества любого из гербицидов, выбранных из группы, состоящей из гербицида имидазолинона, гербицида сульфонилмочевины, гербицида триазолопиримидина, гербицида пиримидинилоксибензоата и их смесей.

Изобретение относится к области биотехнологии. Представлены: выделенный из томата полинуклеотид, соответствующий SEQ ID NO:1, представленной в описании, или полинуклеотид, который имеет, по меньшей мере, 70% идентичность с нуклеотидной последовательностью SEQ ID NO:1, или их фрагмент, которые кодируют полипептид с активностью фарнезен-синтазы, соответствующий SEQ ID NO:2, представленной в описании, или имеющий, по меньшей мере, 70% идентичность с аминокислотной последовательностью, соответствующей SEQ ID NO:2, или их фрагмент.

Изобретение относится к области биохимии, в частности к конструкции для экспрессии генов, содержащей: (a) последовательность энхансера экспрессии, полученную из сегмента генома RNA-2 двухкомпонентного РНК-вируса семейства Comoviridae, b) полилинкер для облегчения встраивания гена в систему для экспрессии генов.

Изобретение относится к области биохимии, в частности к способу увеличения биомассы или улучшения пролиферации клеток, развития листа и/или репродуктивного развития растения, содержащему увеличение в растении экспрессии нуклеиновой кислоты, кодирующей Убиквитин-Специфичную Протеазу, а также к растению, части растения и семени растения, биомасса которых увеличена или пролиферация клеток, развитие листа и/или репродуктивное развитие которых улучшены указанным способом.

Изобретение относится к области биохимии, в частности к способу введения нуклеиновой кислоты в растительную клетку, имеющую интактную клеточную стенку. Также раскрыты способ экспрессии гена и способ переноса плазмидной ДНК в растительную клетку.

Изобретение относится к области биохимии, в частности к несортовому растению кукурузы с увеличенным по сравнению с контролем урожаем, включающему набор аллелей из соответствующего набора QTL, каждый из которых вносит вклад в фенотипический признак урожая зерна, причем указанный набор аллелей обоюдно комплементарен набору аллелей, имеющихся в линии Zea mays, выбранной из группы, состоящей из линии NP 1902, депонированной под номером NCIMB 41577, линии NP 1941, депонированной под номером NCIMB 41576, и линии NPNW 0351, депонированной под номером NCIMB 41578, а также к зерну или семени, им продуцируемому.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Изобретение охватывает вакцины против гриппа, в частности вакцины от птичьего гриппа.

Изобретение относится к области биохимии, в частности к способам получения растения с повышенной устойчивостью к засухе и действию солей по сравнению с диким видом растения путем снижения экспрессии/функции белка-фактора транскрипции у растения.

Изобретение относится к области биохимии, в частности к трансгенному растению Brassica juncea, эндогенное содержание жирных кислот семян которого включает от примерно 70% до 78% олеиновой кислоты по массе и от примерно 2% до 3% линоленовой кислоты по массе, где растение содержит fad2 или fad3 аллель, кодирующую мутантный белок дельта-12-десатураз жирных кислот, имеющий аминокислотную последовательность, выбранную из группы, состоящую из SEQ ID NO:5-7, а также к семени вышеуказанного растения и к маслу указанного семени, содержание жирных кислот которого включает от примерно 70,0% до 78% олеиновой кислоты по массе и от примерно 2% до 3% линоленовой кислоты по массе, в остальном имеющее свойства масла семян Brassica juncea.

Изобретение относится к области биохимии, в частности к способу борьбы с сорняками поблизости от растения подсолнечника. При этом способ включает нанесение на сорняки и растение подсолнечника эффективного количества любого из гербицидов, выбранных из группы, состоящей из гербицида имидазолинона, гербицида сульфонилмочевины, гербицида триазолопиримидина, гербицида пиримидинилоксибензоата и их смесей.

Изобретение относится к области биотехнологии и вирусологии. Предложен способ получения вирусоподобных частиц вируса гриппа (ВПЧ) в растении или его части.

Изобретение относится к области биохимии, в частности к конструкции для экспрессии генов, содержащей: (a) последовательность энхансера экспрессии, полученную из сегмента генома RNA-2 двухкомпонентного РНК-вируса семейства Comoviridae, b) полилинкер для облегчения встраивания гена в систему для экспрессии генов.

Изобретение относится к области биохимии, в частности к cконструированному гибридному инсектицидному белку, обладающему активностью против европейского кукурузного мотылька, а также к выделенной молекуле нуклеиновой кислоты, его кодирующей.

Изобретение относится к области биохимии, в частности к способу уничтожения сорняков, предусматривающему стадию нанесения гербицида РРО-ингибиторного типа на культивируемую часть растения, где указанное растение обладает устойчивостью к указанному гербициду и экспрессирует белок со способностью превращать вышеуказанный гербицид в гербицид с более низкой гербицидной активностью.

Изобретение относится к области биохимии, в частности к трансгенному растению кукурузы, которое обладает устойчивостью к насекомым-вредителям европейским кукурузным мотылькам, а также к его семени. Раскрыто множество растений кукурузы на поле, включающее не содержащие Bacillus thuringiensis (не содержащие Bt) растения, которые не экспрессируют трансгенные инсектицидные белки, и множество трансгенных растений, которые обладают устойчивостью к насекомым-вредителям европейским кукурузным мотылькам, а также раскрыта смесь семян кукурузы, включающая семена от не содержащих Bt растений, которые не экспрессируют трансгенные инсектицидные белки, и множество семян, содержащих ДНК, кодирующую инсектицидный белок Cry1Ab, и ДНК, кодирующую инсектицидный белок Cry2Аа. Также раскрыт способ снижения развития устойчивости к белку Cry1Ab или белку Cry2Аа у насекомых европейских кукурузных мотыльков. Изобретение позволяет эффективно бороться с насекомыми-вредителями европейским кукурузным мотыльком. 5 н. и 14 з.п. ф-лы, 1 ил., 4 пр.
Наверх