Композиции рекомбинантного cdv и ее применение



Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение
Композиции рекомбинантного cdv и ее применение

 


Владельцы патента RU 2567337:

МЕРИАЛ ЛИМИТЕД (US)

Представленная группа изобретений касается композиции для борьбы с, профилактики, защиты или вызова иммунного ответа у животных против инфекции вирусом чумы плотоядных (CDV), экспрессионного вектора и способа вакцинации животных. Охарактеризованная вакцина содержит вектор, представляющий собой вирусный вектор. Указанный экспрессионный вектор содержит первый полинуклеотид, кодирующий полипептид CDV HA, и второй полинуклеотид, кодирующий полипептид GM-CSF псовых (caGM-CSF). Представленный способ включает введение композиции или вектора животному. Изобретения позволяют оптимизировать иммунологическое действие caGM-CSF при сохранении эффективности и безопасности CDV-вакцин в полевых условиях. 3 н. и 15 з.п. ф-лы, 19 ил., 2 табл., 7 пр.

 

Перекрестная ссылка на родственные заявки

Данная заявка притязает на преимущество предварительной заявки на патент США, №61/308620, поданной 26 февраля 2010.

Область техники, к которой относится изобретение

Настоящее изобретение относится к композициям для борьбы с вирусом чумы плотоядных и другими вирусными инфекциями собачьих у животных. Конкретно настоящее изобретение относится к векторам, которые содержат и экспрессируют in vivo или in vitro CDV НА, которые вызывают иммунную реакцию у животных против вируса чумы плотоядных, включая композиции, содержащие указанные векторы, способы вакцинации против вируса чумы плотоядных и наборы для применения с такими способами и композициями. Настоящее изобретение также относится к векторам, которые содержат и экспрессируют in vivo или in vitro CDV НА и GM-CSF, которые вызывают иммунную реакцию у животных против вируса чумы плотоядных и других вирусов собачьих, и к композициям, содержащим указанные векторы.

Предпосылки создания изобретения

Чума плотоядных (CD) является высоко инфекционным лихорадочным заболеванием собак и других плотоядных (Fenner et al., 1987, Veterinary Virology, Academic Press, Inc., pp.485-503). Показатель смертности высокий, колеблющийся от 30 до 80 процентов. Выжившие собаки часто имеют необратимое повреждение центральной нервной системы (Fenner et al., 1987). Установленная этиология CD представляет собой заражение членом семейства парамиксовирусов рода Morbillivirus, известного как вирус CD (CDV). Вообще парамиксовирусы являются оболочечными вирусами, содержащими геном одноцепочечной РНК в 18-20 т.п.о. отрицательной полярности. Геном кодирует 5-7 структурных белков, включая гибридный (F) гликопротеин и гликопротеин или гемагглютинин-нейроамидазу (NH) или гемагглютинин (НА). Мембранный гликопротеин гемагглютинин (НА) ответственен за гемагглютинацию и присоединение вируса к клетке-хозяину, и гибридный гликопротеин (F) вызывает слияние мембран между вирусом и инфицированной клеткой или между инфицированной и соседней неинфицированной клетками (Graves et al., 1978, Virology, 86:254-263). В случае CDV обнаружено, что в оболочке вируса и на поверхности инфицированных клеток присутствуют гликопротеины как F, так и НА. По заключению из анализов с другими членами Morbillivirus оказывается, что гликопротеины CDV F и НА важны для заражения CDV и его иммунобиологии (Diallo А., 1990, Vet. Micro., 23:155-163). Разработаны вакцины с рекомбинантным CDV на основе поксвирусов для защиты и лечения собак (US 5756102). В заявке на патент США USSN 09/587964 раскрываются вакцины на основе плазмиды ДНК, экспрессирующие антигены CDV.

Гранулоцитарно-макрофагиальный колониестимулирующий фактор (GM-CSF) впервые обнаружен в 1977 (Burgess et al., 1977, J. Biol. Chem., 252:1998-2003). GM-CSF играет несколько физиологических ролей. В частности, GM-CSF стимулирует продуцирование, развитие и образование колоний гранулоцитов, макрофагов, эозинофилов и мегакариоцитов (Dy М., в «Les Cytokines», Cavailon, 1995, ed. Masson, Paris, France, 43-56). В частности, GM-CSF индуцирует макрофагиальную цитотоксичность, стимулирует антителозависимую цитотоксическую активность (ADCC) и рекрутинг лейкоцитов на уровне зон воспаления.

Размеры нуклеотидных последовательностей, кодирующих известные GM-CSF различных видов, изменяются от 381 до 432 нуклеотидов. Нуклеотидные последовательности человека и мыши имеют степень гомологии 69%. На уровне аминокислотной последовательности степень гомологии составляет 54% (Cantrell et al., 1985, Proc. Natl. Acad. Sci. USA, 82:6250-6254). Идентифицирован GM-CSF лошади, который имеет размер 144 аминокислоты (US 7250161). В US 5702919 и US 5606024 идентифицированы два GM-CSF собачьих, которые имеют 127 аминокислот и 174 аминокислоты, соответственно.

Введение гетерологичного GM-CSF не дает возможности получить оптимальный полезный эффект, в частности, стимуляцию активности кроветворных клеток и существенное возрастание иммунной реакции.

Таким образом, существует общая потребность в улучшении эффективности и безопасности CDV-вакцин и в более эффективной защите в полевых условиях.

Изобретение предлагает решение для оптимизации иммунологического действия caGM-CSF при сохранении в то же время высокой безопасности для вакцинированных собак.

Сущность изобретения

Предметом данного изобретения могут быть любой один или все рекомбинантные векторы или вирусы, а также способы получения таких векторов и композиции и/или вакцины, а также способы лечения и профилактики заражения CDV и другим вирусом собачьих.

Изобретение относится к рекомбинантному вектору, такому как рекомбинантный вирус, который содержит и экспрессирует по меньшей мере одну молекулу экзогенной нуклеиновой кислоты и по меньшей мере одна молекула экзогенной нуклеиновой кислоты может включать молекулу нуклеиновой кислоты, кодирующей представляющий интерес иммуноген или эпитоп из CDV, такой как CDV НА.

Изобретение относится к рекомбинантному вектору, такому как рекомбинантный поксвирус, который содержит первый полинуклеотид, кодирующий полипептид CDV НА и/или его вариант или фрагмент, и второй полинуклеотид, кодирующий полипептид GM-CSF собачьих и/или его вариант или фрагмент.

Изобретение также относится к композициям или вакцинам, содержащим такой экспрессирующий вектор или продукт(ы) экспрессии такого экспрессирующего вектора.

Изобретение также относится к способам индукции иммунологической (или иммуногенной) или защитной реакции против CDV и другого вируса собачьих, а также к способам предупреждения или лечения от CDV и другого вируса собачьих или болезненного(ых) состояния(ий), вызванного(ых) CDV и другим вирусом собачьих, включающим введение экспрессирующего вектора или продукта экспрессии экспрессирующего вектора или композиции, содержащей экспрессирующий вектор, или композиции, содержащей продукт экспрессии экспрессирующего вектора.

Изобретение также относится к продуктам экспрессии из вируса, а также антителам, генерированным из продуктов экспрессии, или их экспрессии in vivo, и использованию таких продуктов и антител, например, в применениях при диагностике.

Такие и другие воплощения раскрываются или становятся очевидными из последующего подробного описания и охватываются им.

Краткое описание чертежей

Последующее подробное описание, данное как примеры конкретных описанных воплощений, не предназначенных для ограничения изобретения, можно лучше всего понять в сочетании с прилагаемыми чертежами.

Фигура 1 представляет таблицу, идентифицирующую SEQ ID NO, приписанные нуклеотидным и белковым последовательностям.

Фигура 2 представляет выравнивание последовательностей между SEQ ID NO:2 и SEQ ID NO:5.

Фигура 3 отображает плазмидные карты pCXL1557.1 и pJSY2218.1.

Фигура 4 показывает саузерн-блоттинг vCP2263.

Фигура 5 показывает вестерн-блоттинг vCP2263.

Фигура 6 показывает иммунобляшковый (immunoplaque) анализ vCP2263.

Фигура 7 показывает картину вестерн-блоттинг vCP2391.

Фигура 8 показывает вестерн-блоттинг vCP2392.

Фигура 9 показывает вестерн-блоттинг vCP2391 и vCP2392 для GM-CSF.

Фигура 10 показывает вестерн-блоттинг vCP2392 для белка CDV НА.

Фигура 11 представляет результаты серологии vCP2392 и vCP2263 с использованием гетерологического теста SN.

Фигура 12 представляет результаты серологии vCP2392 и vCP2263 с использованием гомологического теста SN.

Фигуры 13а и 13b представляют выравнивание последовательностей белков CDV НА и процент идентичности последовательностей на уровне аминокислот.

Фигура 14 представляет выравнивание последовательностей кодон-оптимизированной ДНК CDV НА и ДНК CDV НА дикого типа.

Фигуры 15а и 15b представляют выравнивание последовательностей ДНК CDV НА и процент идентичности последовательностей на уровне ДНК.

Фигура 16 представляет результат клеточной иммунной реакции.

Фигура 17 представляет результат ELISA CPV2.

Фигура 18 отображает результаты гомологического теста SN антител SN CDV.

Фигура 19 отображает результаты гетерологического теста SN антител SN CDV.

Подробное описание

Описываются композиции, содержащие экспрессирующий вектор, содержащий полинуклеотид, кодирующий полипептид CDV и его фрагменты и варианты, которые выявляют иммуногенную реакцию у животного. Экспрессирующий вектор, содержащий полинуклеотид, кодирующий полипептид CDV или его фрагменты и варианты, может быть включен в вакцины или фармацевтические композиции и использован для выявления или стимулирования защитной реакции у животного. В одном воплощении полипептид CDV представляет собой полипептид гемагглютинин (НА) CDV или его активный фрагмент или вариант.

Описываются композиции, содержащие экспрессирующий вектор, содержащий полинуклеотид, кодирующий полипептид CDV НА или его активные фрагменты или варианты, и полинуклеотид, кодирующий полипептид GM-CSF или его активные фрагменты или варианты.

Признается, что полипептиды по изобретению могут представлять собой полноразмерные полипептиды или их активные фрагменты или варианты. Обозначения «активные фрагменты» или «активные варианты» предполагают, что фрагменты или варианты сохраняют антигенный характер полипептида. Таким образом, настоящее изобретение охватывает любой полипептид, антиген, эпитоп или иммуноген CDV, который выявляет иммуногенную реакцию у животного. Полипептид, антиген, эпитоп или иммуноген CDV могут представлять собой любой полипептид, антиген, эпитоп или иммуноген CDV, такой как, но без ограничения, белок, пептид или его фрагмент или вариант, который выявляет, индуцирует или стимулирует иммуногенную реакцию у животного.

Конкретным полипептидом CDV, представляющим интерес, является гемагглютинин (НА) CDV. CDV НА относится к типу гемагглютинина, обнаруженного на поверхности CDV. Он является антигенным гликопротеином и ответственен за связывание вируса с клеткой, которая инфицируется. Существуют различные антигены НА, ассоциированные с различными штаммами CDV, которые циркулируют в данной области, любой из которых можно использовать при практическом применении изобретения. Однако существуют различные антигены, такие как гибридный (F) гликопротеин и нуклеопротеин (NP), любой из которых можно использовать при практическом применении изобретения. Также признается, что можно использовать предшественников любых таких антигенов. Антигенные полипептиды по изобретению способны давать защиту против CDV. Иными словами, они способны стимулировать иммунную реакцию у животного.

Термин «антиген» или «иммуноген» обозначает вещество, которое вызывает специфическую иммунную реакцию у животного-реципиента. Антиген может включать весь микроорганизм убитый, аттенюировнный или живой; субъединицу или часть микроорганизма; рекомбинантный вектор, содержащий вставку с иммуногенными свойствами; отрезок или фрагмент ДНК, способной вызывать иммунную реакцию после представления животному-реципиенту; полипептид, эпитоп, гаптен или их любую комбинацию. С другой стороны, иммуноген или антиген может включать токсин или антитоксин.

Термины «белок», «пептид», «полипептид» и «фрагмент полипептида» используются в данном описании как взаимозаменяемые для обозначения полимеров из аминокислотных остатков любой длины. Полимер может быть линейным или разветвленным, он может включать модифицированные аминокислоты или аналоги аминокислот, и он может прерываться химическими группами иными, чем аминокислоты. Термины также охватывают полимер аминокислоты, который модифицирован в природе или путем вмешательства, например, за счет образования дисульфидной связи, гликозилированием, липидированием, ацетилированием, фосфорилированием или любой другой манипуляцией или модификацией, такой как конъюгирование с компонентом-меткой или биоактивным компонентом.

Термин «полипептид или полинуклеотид CDV НА» относится к любому нативному или оптимизированному полипептиду или полинуклеотиду CDV НА и их производным и вариантам.

Термин «полипептид или полинуклеотид GM-CSF» относится к любому нативному или оптимизированному полипептиду или полинуклеотиду GM-CSF и их производным и вариантам.

Термин «иммуногенный или антигенный полипептид», используемый в данном описании, включает полипептиды, которые являются иммунологически активными в том смысле, что однажды введенные реципиенту, способны вызывать иммунную реакцию гуморального и/или клеточного типа, направленную против белка. Предпочтительно белковый фрагмент является таким, что он по существу имеет такую же иммунологическую активность, как целый белок. Таким образом, белковый фрагмент по изобретению включает или по существу состоит или состоит, по меньшей мере, из эпитопа или антигенной детерминанты. «Иммуногенный» белок или полипептид, как используется в данном описании, включает полноразмерную последовательность белка, его аналога или его иммуногенных фрагментов. «Иммуногенный фрагмент» обозначает фрагмент белка, который включает один или несколько эпитопов и, таким образом, выявляет иммунологическую реакцию, описанную выше. Такие фрагменты можно идентифицировать с использованием любого ряда методов картирования эпитопов, хорошо известных в технике. См., например, Epitope Mapping Protocols in Methods in Molecular Biology, Vol.66 (Glenn E. Morris, Ed., 1996). Например, линейные эпитопы можно определить, например, одновременным синтезом большого числа пептидов на твердых носителях, причем пептиды соответствуют частям молекулы белка, и взаимодействием пептидов с антителами в то время как пептиды все еще присоединены к носителям. Такие методы известны в технике и описаны, например, в пат. США №4708871; Geysen et al., 1984; Geysen et al., 1986. Подобным образом конформационные эпитопы легко идентифицируются путем определения пространственной конформации аминокислот, например, с помощью рентгеновской кристалллографии и 2-мерного ядерного магнитного резонанса. См., например, Epitope Mapping Protocols, цит. выше.

Как обсуждалось в данном описании, изобретение охватывает активные фрагменты и варианты антигенного полипептида. Таким образом, термин «иммуногенный или антигенный полипептид» также предполагает делеции, добавления и замены в последовательности до тех пор, пока полипептид функционирует для выработки иммунологической реакции как определено в данном описании.

Термин «консервативная вариация» обозначает замену аминокислотного остатка другим биологически схожим остатком или такую замену нуклеотида в нуклеотидной последовательности, что кодированный аминокислотный остаток не изменяется или представляет собой биологически схожий остаток. С учетом этого особенно предпочтительные замены, как правило, будут консервативными по природе, т.е., такими заменами, которые имеют место в пределах семейства аминокислот. Например, аминокислоты вообще делятся на четыре семейства: (1) кислотные - аспартат и глутамат; (2) основные - лизин, аргинин, гистидин; (3) неполярные - аланин, валин, лейцин, изолейцин, пролин, фенилаланин, метионин, триптофан; и (4) незаряженные полярные - глицин, аспарагин, глутамин, цистин, серии, треонин, тирозин. Фенилаланин, триптофан и тирозин иногда классифицируют как ароматические аминокислоты. Примеры консервативных вариаций включают замену одного гидрофобного остатка, такого как изолейцин, валин, лейцин или метионин, на другой гидрофобный остаток, или замену одного полярного остатка на другой полярный остаток, например, замену аргинина на лизин, глутаминовой кислоты на аспарагиновую кислоту или глутамина на аспарагин, и т.п.; или подобную консервативную замену аминокислоты на структурно родственную аминокислоту, которая не будет оказывать существенного влияния на биологическую активность. Белки, имеющие, по существу, такую же аминокислотную последовательность как эталонная молекула, но имеющие минорные аминокислотные замены, которые, по существу, не влияют на иммуногенность белка, поэтому входят в определение эталонного полипептида. Все полипептиды, полученные такими модификациями, включаются в данное изобретение. Термин «консервативная вариация» также включает использование замещенной аминокислоты вместо незамещенной исходной аминокислоты при условии, что антитела, вырабатываемые к замещенному полипептиду, также вступают в иммунную реакцию с незамещенным полипептидом.

Термин «эпитоп» относится к участку антигена или гаптена, с которым реагируют специфические В-клетки и/или Т-клетки. Термин также используется как взаимозаменяемый с термином «антигенная детерминанта» или «участок антигенной детерминанты». Антитела, которые узнают один и тот же эпитоп, могут быть идентифицированы в простом иммуноанализе, показывающем способность антитела блокировать связывание другого антитела с антигеном-мишенью.

«Иммунологическая реакция» на композицию или вакцину представляет собой развитие у реципиента клеточной и/или антителоопосредованной иммунной реакции на композицию или вакцину, представляющую интерес.Обычно «иммунологическая реакция» включает, но не ограничивается, один или несколько следующих эффектов: выработка антител, В-клеток, хелперных Т-клеток и/или цитотоксических Т-клеток, направленных специфически на антиген или антигены, включенные в композицию или вакцину, представляющую интерес. Предпочтительно реципиент будет показывать или лечебную или защитную иммунологическую реакцию, так что будет усиливаться сопротивление новой инфекции и/или будет уменьшаться клиническая тяжесть заболевания. Такая защита будет демонстрироваться или ослаблением или отсутствием симптомов, обычно отображаемых инфицированным хозяином, более коротким временем излечения и/или пониженным вирусным титром у инфицированного хозяина.

Под «животным» подразумеваются млекопитающие, птицы и т.п. Животное или хозяин (реципиент) в данном описании включает млекопитающих и человека. Животное может быть выбрано из группы, включающей лошадей (например, лошадь), собачьих (например, собаку, волка, лису, койота, шакала), кошачьих (например, льва, тигра, домашних кошек, диких кошек, других крупных кошек и других кошачьих, включая гепардов и рысей), овец (например, овцу), коров (например, крупный рогатый скот), свиней (например, свинью), птичьих (например, курицу, утку, гуся, индейку, перепела, мелких птиц, сокола, ворону, страуса, эму и казуара), приматов (например, лемура, долгопята, мартышку, гиббона, обезьяну), хорьков, тюленей и рыб. Термин «животное» также включает отдельное животное на всех стадиях развития, включая эмбриональную и плодную стадии.

Если не поясняется иное, все технические и научные термины, используемые в данном описании, имеют те же значения, какие обычно понимаются специалистами в области техники, к которой принадлежит данное описание. Термины в единственном числе включают соответствующие множественные формы, если контекст не указывает прямо на иное. Подобным образом, предполагается, что слово «или» включает «и», если контекст не указывает прямо на иное.

Как замечание, в данном описании и, особенно, в формуле изобретения и/или разделах такие термины, как «содержит», «содержащийся», «содержащий» и т.п. могут иметь значение, приписываемое им патентным законом США; например, они могут означать «включает», «включенный», «включающий» и т.п.; и что термины, такие как «состоящий по существу из» и «состоит по существу из» имеют значение, приписываемое им патентным законом США; например, они допускают элементы, не перечисленные открыто, но исключают элементы, которые найдены на известном уровне техники или которые затрагивают основной или новый признак изобретения.

Композиции

Настоящее изобретение относится к вакцине против CDV или композиции, которые могут включать рекомбинантный или экспрессирующий вектор, содержащий полинуклеотид, кодирующий полипептид, антиген, эпитоп или иммуноген CDV и фармацевтически или ветеринарно приемлемый носитель, эксципиент, адъювант или среду. Полипептид, антиген, эпитоп или иммуноген CDV могут представлять собой любой полипептид, антиген, эпитоп или иммуноген CDV, такой как, но без ограничения, белок, пептид или его фрагмент, который выявляет, индуцирует или стимулирует реакцию у животного.

Настоящее изобретение относится к вакцине против CDV или композиции, которые могут включать рекомбинантный или экспрессирующий вектор, содержащий полинуклеотид, кодирующий полипептид CDV НА, и фармацевтически или ветеринарно приемлемый носитель, эксципиент, адъювант или среду. В одном воплощении экспрессирующий вектор может дополнительно включать полинуклеотид, кодирующий полипептид GM-CSF.

В другом воплощении фармацевтически или ветеринарно приемлемый носитель, эксципиент, адъювант или среда может представлять собой эмульсию «вода в масле». В еще одном воплощении эмульсия «вода в масле» может представлять собой тройную эмульсию вода/масло/вода (W/O/W). В еще одном воплощении фармацевтически или ветеринарно приемлемый носитель, эксципиент, адъювант или среда может представлять собой эмульсию «масло в воде».

В одном воплощении полипептид CDV, его антиген или фрагмент или вариант может представлять собой полипептид CDV НА или его фрагмент или вариант. В аспекте такого воплощения полипептид CDV НА или его фрагмент или вариант представляет собой рекомбинантный полипептид, продуцируемый геном CDV НА. В другом аспекте такого воплощения ген CDV НА имеет по меньшей мере 70% идентичность с последовательностью, представленной в SEQ ID NO:1, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 или 49. В другом аспекте такого воплощения полипептид CDV НА или его фрагмент или вариант имеет по меньшей мере 80% идентичность с последовательностью, представленной в SEQ ID NO:2, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34.

В другом воплощении полипептид GM-CSF или его фрагмент или вариант представляет собой рекомбинантный полипептид, продуцируемый геном GM-CSF. В другом аспекте такого воплощения ген GM-CSF имеет по меньшей мере 70% идентичность с последовательностью, представленной в SEQ ID NO:3. В другом аспекте такого воплощения полипептид GM-CSF или его фрагмент или вариант имеет по меньшей мере 80% идентичность с последовательностью, представленной в SEQ ID NO:4.

Синтетические антигены также включены в определение, например, полиэпитопы, фланкирующие эпитопы и другие рекомбинантно или синтетически полученные антигены. См., например, Bergmann et al., 1993; Bergmann et al., 1996; Suhrbier, 1997; Gardner et al., 1998. Иммуногенные фрагменты для целей настоящего изобретения обычно будут включать по меньшей мере примерно 3 аминокислоты, по меньшей мере примерно 5 аминокислот, по меньшей мере примерно 10-15 аминокислот или примерно 15-25 аминокислот или больше аминокислот молекулы. Не существует критического верхнего предела длины фрагмента, который может включать почти всю длину белковой последовательности или даже гибридный белок, включающий по меньшей мере один эпитоп белка.

Соответственно, минимальная структура полинуклеотда, экспрессирующего эпитоп, является такой, что она включает или состоит по существу или состоит из нуклеотидов, кодирующих эпитоп или антигенную детерминанту полипептида CDV. Полинуклеотид, кодирующий фрагмент полипептида CDV, может включать или состоять по существу или состоять из минимум 15 нуклеотидов, примерно 30-45 нуклеотидов, примерно 45-75 нуклеотидов, или по меньшей мере 75, 87 или 150 последовательных или смежных нуклеотидов последовательности, кодирующей полпептид. Процедуры определения эпитопов, такие как получение библиотек перекрывающихся пептидов (Hemmer et al., 1998), Pepscan (Geysen et al., 1984; Geysen et al., 1985; Van der Zee R. et al., 1989; Geysen, 1990; Multipin.RTM. Peptide Synthesis Kits de Chiron) и алгоритмы (De Groot et al., 1999; PCT/US2004/022605), можно использовать при осуществлении изобретения.

Термины «нуклеиновая кислота» и «полинуклеотид» относятся к РНК или ДНК, которая является линейной или разветвленной, одно- или двухцепочечной или их гибридом. Термины также охватывают гибриды РНК/ДНК. Неограничительными примерами полнуклеотидов являются ген или фрагмент гена, экзоны, интроны, мРНК, тРНК, рРНК, рибозимы, кДНК, рекомбинантные полинуклеотиды, разветвленные полинуклеотиды, плазмиды, векторы, изолированная ДНК любой последовательности, изолированная РНК любой последовательности, нуклеотидные зонды и праймеры. Полинуклеотид может включать модифицированные нуклеотиды, такие как метилированные нуклеотиды, и аналоги нуклеотидов, урацил, другие сахара и соединяющие группы, такие как флуорорибоза и тиолат, и нуклеотидные ответвления. Последовательность нуклеотидов может быть дополнительно модифицирована после полимеризации, например, конъюгацией с компонентом-меткой. Другими типами модификаций, включенных в такое определение, являются кэпы, замена одного или нескольких встречающихся в природе нуклеотидов аналогом и введение средств для присоединения полинуклеотида к белкам, ионам металлов, компонентам-меткам, другим полинуклеотидам или твердому носителю. Полинуклеотиды можно получить химическим синтезом или получить из микроорганизмов.

Термин «ген» широко используется как относящийся к любому сегменту полинуклеотида, связанного с биологической функцией. Так, гены включают интроны и экзоны, как в геномной последовательности или только кодирующие последовательности, как в кДНК, и/или регуляторные последовательности, требуемые для их экспрессии. Например, «ген» также относится к фрагменту нуклеиновой кислоты, который экспрессирует мРНК или функциональную РНК или кодирует специфический белок, и который включает регуляторные последовательности.

Изобретение также относится к комплементарной цепи к полинуклеотиду, кодирующему антиген, эпитоп или иммуноген CDV, или полинуклеотиду, кодирующему антиген, эпитоп или иммуноген GM-CSF. Комплементарная цепь может быть полимерной и любой длины и может содержать дезоксирибонуклеотиды, рибонуклеотиды и аналоги в любой комбинации.

Определение «изолированный» биологический компонент (такой как нуклеиновая кислота или белок или органелла) относится к компоненту, который по существу отделен или очищен от других биологических компонентов в клетке организма, в которой компонент встречается в природе, например, других хромосомной и внехромосомной ДНК и РНК, белков и органелл. Нуклеиновые кислоты и белки, которые «изолированы», включают нуклеиновые кислоты и белки, выделенные в чистом виде стандартными методами очистки. Термин также включает нуклеиновые кислоты и белки, полученные рекомбинантной технологией, а также химическим синтезом.

Термин «очищенный», используемый в данном описании, не требует абсолютной чистоты; скорее предполагается, что он является условным термином. Так, например, препарат частично очищенного полипептида представляет собой препарат, в котором полипептида больше, чем в его природном окружении. Иными словами, полипептид отделен от клеточных компонентов. Под «по существу чистым» подразумевается, что удалено по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 95% или, по меньшей мере 98% или больше клеточных компонентов или материалов. Подобным образом, полипептид может быть частично очищенным. Под «частично очищенным» подразумевается, что удалено менее 60% клеточных компонентов или материала. То же применимо к полинуклеотидам. Полинуклелотиды, раскрываемые в данном описании, могут быть очищены любым из способов, известных в технике.

Кроме того, предполагается, что в объем настоящего изобретения входят гомологи полипептидов CDV НА и гомологи полипептидов GM-CSF. Используемый в данном описании термин «гомологи» включает ортологи, аналоги и паралоги. Термин «аналоги» относится к двум полинуклеотидам или полипептидам, которые имеют одну и ту же или схожие функции, но которые развивались раздельно в неродственных организмах. Термин «ортологи» относится к двум полинуклеотидам или полипептидам от различных видов, но которые развивались из общего предкового гена вследствие видообразования. Обычно ортологи кодируют полипептиды, имеющие одну и ту же или схожие функции. Термин «паралоги» относится к двум полинуклеотидам или полипептидам, которые связаны дупликацией в пределах генома. Паралоги обычно имеют различные функции, но такие функции могут быть родственными. Например, аналоги, ортологи и паралоги полипептида CDV дикого типа могут отличаться от полипептида CDV дикого типа посттрансляционными модификациями, различиями в аминокислотных последовательностях или тем и другим. В частности, гомологи по изобретению обычно будут показывать по меньшей мере 80-85%, 85-90%, 90-95% или 95%, 96%, 97%, 98%, 99% идентичность последовательностей со всем или частью полипептида CDV дикого типа или нуклеотидных последовательностей и будут проявлять схожие функции.

В одном воплощении настоящее изобретение относится к экспрессирующему вектору, содержащему один или несколько полинуклеотидов, кодирующих один или несколько полипептидов, имеющих по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, 96%, 97%, 98% или 99% идентичность последовательностей с полипептидом, имеющим последовательность, представленную в SEQ ID NO:2, 4, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34. В другом воплощении настоящее изобретение относится к фрагментам и вариантам полипептидов CDV или GM-CSF, идентифицированных выше (SEQ ID NO:2, 4, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34), которые могут быть легко получены специалистом в данной области техники с использованием хорошо известных методов молекулярной биологии. Варианты представляют собой гомологичные полипептиды, имеющие аминокислотные последовательности с по меньшей мере 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% идентичностью с последовательностями, представленными в SEQ ID NO:2, 4, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34.

Варианты включают аллельные варианты. Термин «аллельный вариант» относится к полинуклеотиду или полипептиду, содержащему полиморфизмы, которые ведут к изменениям в аминокислотных последовательностях белка, и которые существуют в природной популяции (например, видах или разновидности вируса). Такие природные аллельные вариации могут типично приводить к 1-5% варианте в полинуклеотиде или полипептиде. Аллельные варианты могут быть идентифицированы секвенированием нуклеотидной последовательности, представляющей интерес, в ряде различных видов, которое можно легко осуществить путем использования гибридизирующих зондов для идентификации одного и того же генетического локуса генов в таких видах. Предполагается, что любые и все такие вариации нуклеиновых кислот и получающиеся аминокислотные полиморфизмы или вариации, которые являются результатом природной аллельной вариации, и которые не изменяют функциональной активности гена, представляющего интерес, входят в объем изобретения.

Используемый в данном описании термин «производное», или «вариант», относится к полипептиду или нуклеиновой кислоте, кодирующей полипептид, которые имеют одну или несколько консервативных вариаций аминокислот или других минорных модификаций, таких что (1) соответствующий полипептид имеет, по существу, эквивалентную функцию при сравнении с полипептидом дикого типа, или (2) антитело, возникшее против полипептида, является иммунореактивным в отношении полипептида дикого типа. Такие варианты или производные включают полипептиды, имеющие минорные модификации полипептида CDV или первичных аминокислотных последовательностей GM-CSF, которые могут привести к пептидам, которые имеют, по существу, эквивалентную активность при сравнении с немодифицированным аналогичным полипептидом. Такие модификации могут быть преднамеренными, например с помощью сайт-направленного мутагенеза, или могут быть спонтанными. Термин «вариант» также предполагает делеции, добавления и замены в последовательности до тех пор, пока полипептид функционирует, продуцируя иммунологическую реакцию, как определено в данном описании.

Иммуногенный фрагмент полипептида CDV или полипептида GM-CSF включает по меньшей мере 8, 10, 13, 14, 15 или 20 последовательных аминокислот, по меньшей мере 21 аминокислоту, по меньшей мере 23 аминокислоты, по меньшей мере 25 аминокислот или по меньшей мере 30 аминокислот полипептида CDV НА, имеющего последовательность, представленную в SEQ ID NO:2, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34 или ее вариантах, или полипептида GM-CSF, имеющего последовательность, представленную в SEQ ID NO:4 или ее вариантах.

В другом аспекте настоящее изобретение относится к экспрессирующему вектору, содержащему полинуклеотид, кодирующий полипептид CDV НА, такой как полинуклеотид, кодирующий полипептид, имеющий последовательность, представленную в SEQ ID NO:2, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34. В еще одном аспекте настоящее изобретение относится к экспрессирующему вектору, содержащему полинуклеотид, кодирующий полипептид, имеющий по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, 96%, 97%, 98% или 99% идентичность последовательностей с полипептидом, имеющим последовательность, представленную в SEQ ID NO:2, 5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 или 34, или консервативный вариант, аллельный вариант, гомолог или иммуногенный фрагмент, содержащий по меньшей мере восемь или по меньшей мере десять последовательных аминокислот одного из таких полипептидов, или комбинацию таких полипептидов.

В еще одном аспекте настоящее изобретение относится к экспрессирующему вектору, содержащему полинуклеотид, кодирующий полипептид GM-CSF, такой как полинуклеотид, кодирующий полипептид, имеющий последовательность, представленную в SEQ ID NO:4. В еще одном аспекте настоящее изобретение относится к экспрессирующему вектору, содержащему полинуклеотид, кодирующий полипептид, имеющий по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, 96%, 97%, 98% или 99% идентичность последовательностей с полипептидом, имеющим последовательность, представленную в SEQ ID NO:4, или консервативный вариант, аллельный вариант, гомолог или иммуногенный фрагмент, содержащий по меньшей мере восемь или по меньшей мере десять последовательных аминокислот одного из таких полипептидов, или комбинацию таких полипептидов.

В одном воплощении полинуклеотид по настоящему изобретению включает полинуклеотид, имеющий нуклеотидную последовательность, представленную в SEQ ID NO:1, 3, 6, 7, 8, 9, 14, 19, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 или 49,или его вариант. В другом воплощении полинуклеотид по настоящему изобретению включает полинуклеотид, имеющий по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, 96%, 97%, 98% или 99% идентичность последовательностей с одним из полинуклеотидов, имеющим последовательность, представленную в SEQ ID NO:1, 3, 6, 7, 8, 9, 14, 19, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 или 49, или его вариант.

Полинуклеотиды из описания включают последовательности, которые являются вырожденными как результат вырожденности генетического кода, например, в которых использовались оптимизированные кодоны для специфического хозяина. Используемое в данном описании определение «оптимизированный» относится к полинуклеотиду, который создан генной инженерией для усиления его экспрессии в данном виде. Для того, чтобы предоставить оптимизированные полинуклеотиды, кодирующие полипептиды CDV НА или полипептиды GM-CSF, последовательность ДНК гена CDV НА или гена GM-CSF можно модифицировать для 1) включения ко донов, предпочитаемых генами с высокой экспрессией в определенном виде; 2) включения доли А+Т или G+C в композиции пар оснований, которая по существу обнаружена в указанном виде; 3) образования инициирующей последовательности указанного вида; или 4) устранения последовательностей, которые вызывают дестабилизацию, несоответствующее полиаденелирование, деградацию и терминацию РНК, или которые образуют вторичные структурные «шпильки» или сайты сплайсинга. Повышенной экспрессии белка CDV НА или белка GM-CSF в указанном виде можно достичь путем использования частоты распределения использования кодонов в эукариотах и прокариотах или в определенном виде. Термин «частота использования предпочтительного кодона» относится к предпочтению, обнаруживаемому определенной клеткой-хозяином в использовании нуклеотидных кодонов для определения данной аминокислоты. Существует 20 природных аминокислот, большинство из которых определяется более чем одним кодоном. Следовательно, все вырожденные нуклеотидные последовательности включаются в описание до тех пор, пока аминокислотная последовательность полипептида CDV НА или полипептида GM-CSF, кодированная нуклеотидной последовательностью, является функционально неизменной.

Идентичность последовательностей между аминокислотными последовательностями может быть установлена с помощью NCBI (National Center for Biotechnology Information) попарный blast и матрицу blosum62, с использованием стандартных параметров (см., например, алгоритм BLAST или BLASTX, доступные на сервере «National Center for Biotechnology Information» (NCBI, Bethesda, Md., USA), a также в Altschul et al).

«Идентичность» в отношении последовательностей может относиться к числу позиций с идентичными нуклеотидами или аминокислотами, деленному на число нуклеотидов или аминокислот в более короткой из двух последовательностей, при этом выравнивание двух последовательностей может быть определено в соответствии, например, с алгоритмом Wibur and Lipman (Wibur and Lipman), с использованием размера окна в 20 нуклеотидов, длины слова в 4 нуклеотида и штрафа за брешь 4, и анализ с помощью компьютера и интерпретацию данных о последовательностях, включая выравнивание, можно удобно выполнить с использованием коммерчески доступных программ (например, Intelligenetics™ Suite, Intelligenetics Inc., CA). Когда о последовательностях РНК говорят, что они схожи или имеют степень идентичности последовательностей или гомологии с последовательностями ДНК, тимидин (Т) в последовательности ДНК рассматривается как эквивалентный урацилу (U) в последовательности РНК. Таким образом, последовательности РНК входят в объем изобретения и могут быть получены из последовательностей ДНК, причем тимидин (Т) в последовательности ДНК рассматривается как эквивалентный урацилу (U) в последовательностях РНК.

Идентичность последовательностей или подобие последовательностей двух аминокислотных последовательностей или идентичность последовательностей между двумя нуклеотидными последовательностями можно определить с использованием пакета программ Vector NTI (Invitrogen, 1600 Faraday Ave., Carlsbad, CA).

Следующие документы предоставляют алгоритмы для сравнения относительной идентичности или гомологии последовательностей и, кроме того или с другой стороны, в отношении указанного выше, указания в приведенных ссылках можно использовать для определения гомологии или идентичности в процентах:

Needleman SB и Wunsch CD; Smith TF и Waterman MS; Smith TF, Waterman MS и Sadler JR; Feng DF и Dolittle RF; Higgins DG и Sharp PM; Thompson JD, Higgins DG и Gibson TJ; и Devereux J, Haeberlie P и Smithies О. И без чрезмерного экспериментирования специалист в данной области техники может консультироваться со многими другими программами или ссылками для определения процентна гомологии.

Реакции гибридизации можно осуществить в условиях различной жесткости. Условия, которые повышают жесткость реакции гибридизации, хорошо известны. См., например, «Molecular Cloning: A Laboratory Manual», second edition (Sambrook et al., 1989).

Изобретение охватывает полинуклеотид CDV или полинуклеотид GM-CSF или оба полинуклеотида, содержащиеся в молекуле-векторе или экспрессирующем векторе и функционально соединенные с промоторным элементом и, необязательно, с энхансером.

Настоящее изобретение также охватывает вакцину для собачьих или композицию, которая может содержать вышеуказанный рекомбинантный вектор, содержащий полинуклеотид, кодирующий полипептид или антиген CDV НА, и полинуклеотид, кодирующий полипептид или антиген GM-CSF, фармацевтически или ветеринарно приемлемый носитель, эксципиент, адъювант или среду, и кроме того, один или несколько антигенов от собачьих. Настоящее изобретение также относится к вакцине для собачьих или композиции, которая может содержать вышеуказанный рекомбинантный вектор, содержащий полинуклеотид, кодирующий полипептид GM-CSF, фармацевтически или ветеринарно приемлемый носитель, эксципиент, адъювант или среду, и кроме того, один или несколько антигенов от собачьих. Антиген может представлять собой антиген собачьих, выбранный из группы, состоящей из вируса бешенства, парвовируса собачьих, коронавируса собачьих, вируса гриппа собачьих, чумы плотоядных, инфекционного гепатита собачьих, вируса герпеса собачьих, псевдобешенства, парвовируса I-типа собачьих (canine minute virus), Leptospira, Neospora caninum, Borrelia burgdorferi, Ehrlichia canis, Rickettsia rickettsii, Bordetella bronchiseptica, Blastomyces dermatitidis, Histoplasma capsulatum, Coccidioides_immitis, Cryptococcus neoformans, Microsporum canis, Sporothrix schenckii, Aspergillus_fumigatus и Р. insidiosum. Антиген может включать весь микроорганизм, убитый, аттенюированный или живой; субъединицу или часть микроорганизма; рекомбинантный вектор, содержащий вставку с иммуногенными свойствами»; отрезок или фрагмент ДНК, способный индуцировать иммунную реакцию после представления животному-хозяину; полипептид, эпитоп, гаптен или их любую комбинацию.

Термин «вектор» относится к рекомбинантной ДНК или РНК, плазмиде или вирусу, которые содержат гетерологичный полинуклеотид, доставляемый в клетку-мишень или in vitro или in vivo. Гетерологичный полинуклеотид может включать представляющую интерес последовательность для целей профилактики или лечения и может, необязательно, находиться в форме экспрессирующей кассеты. Используемый в данной заявке вектор не нуждается в способности к репликации в основной клетке-мишени или организме субъекта. Термин включает клонирующие векторы и вирусные векторы.

Термин «рекомбинантный» обозначает полинуклеотид полусинтетического или синтетического происхождения, который или не встречается в природе или связан с другим полинуклеотидом в порядке, не обнаруженном в природе.

«Гетерологичный» означает образованный от организма, генетически отличного от другого организма, с которым его сравнивают.Например, полинуклеотид может быть помещен методами генной инженерии в плазмиду или вектор, образованный от другого источника, и представляет собой гетерологичный полинуклеотид. Промотор, выделенный из нативной кодирующей последовательности и функционально соединенный с кодирующей последовательностью иной, чем нативная кодирующая последовательность, является гетерологичным промотором.

Полинуклеотиды по изобретению могут включать дополнительные последовательности, такие как дополнительные кодирующие последовательности в пределах одной и той же единицы транскрипции, регулирующие элементы, такие как промоторы, рибосомсвязывающие сайты, 5' UTR, 3'UTR, терминаторы транскрипции, сайты полиаденелирования, дополнительные единицы транскрипции под контролем того же или другого промотора, последовательности, которые допускают клонирование, экспрессию, гомологичную рекомбинацию и трансформацию клетки-хозяина, и любую такую конструкцию, которая может быть желательна для обеспечения воплощений данного изобретения.

Элементы для экспрессии полипептида, антигена, эпитопа или иммуногена CDV НА или полипептида GM-CSF присутствуют в векторе по изобретению. В минимальном случае это включает инициирующий кодон (ATG), стоп-кодон и промотор, и необязательно также последовательность полиаденелирования для некоторых векторов, таких как плазмида, и некоторых вирусных векторов, например, вирусных векторов иных, чем поксвирусы. Когда полинуклеотид кодирует фрагмент полипептида, например, полипептида CDV НА, в векторе ATG размещается в 5' от рамки считывания а стоп-кодон размещается в 3'. Могут присутствовать другие элементы для регулирования экспрессии, такие как энхансерные последовательности, стабилизирующие последовательности, такие как интрон, и сигнальные последовательности, допускающие секрецию белка.

Настоящее изобретение также относится к композициям или вакцинам, содержащим векторы. Композиция или вакцина может включать один или несколько векторов, например, экспрессирующие векторы, такие как in vivo экспрессирующие векторы, содержащие и экспрессирующие один или несколько полипептидов, антигенов, эпитопов или иммуногенов CDV НА или GM-CSF. В одном воплощении вектор содержит и экспрессирует полинуклеотид, кодирующий и/или экспрессирующий антиген, эпитоп или иммуноген CDV НА, в фармацевтически или ветеринарно приемлемом носителе, эксципиенте, адъюванте или среде. Таким образом, согласно воплощению изобретения другой вектор или векторы в препарате содержат, состоят по существу или состоят из полинуклеотида, который кодирует, и в соответствующих условиях вектор экспрессирует один или несколько других белков полипептида, антигена, эпитопа или иммуногена CDV НА (например, гемагглютинин, нейраминидазу, нуклеопротеин) или их фрагменты.

Согласно другому воплощению, вектор или векторы в композиции или вакцине содержат или по существу состоят или состоят из полинуклеотида(ов), кодирующего(их) один или несколько белков или фрагментов полипептида, антигена, эпитопа или иммуногена CDV НА, или полипептида, антигена, эпитопа или иммуногена GM-CSF, или их комбинацию. В другом воплощении композиция или вакцина включает один, два или больше векторов, содержащих полинуклеотиды, кодирующие и экспрессирующие, преимущественно in vivo, полипептид CDV НА или его антиген, слитый белок или эпитоп. Изобретение также относится к смесям векторов, которые содержат полинуклеотиды, кодирующие и экспрессирующие различные полипептиды GM-CSF, антигены, эпитопы, слитый белок или иммуногены, например, полипептид CDV НА, антиген, эпитоп или иммуноген из различных видов, таких как, но без ограничения, люди, свиньи, коровы или крупный рогатый скот, собаки, кошки и птицы.

В настоящем изобретении рекомбинантный вирусный вектор используется для экспрессии последовательности, кодирующей CDV, или ее фрагментов, кодирующих полипептид CDV или его фрагмент или вариант. Конкретно вирусный вектор может экспрессировать последовательность CDV, конкретнее, гена CDV НА или его фрагмента, который кодирует антигенный полипептид. Рассматриваемый в данном описании вирусный вектор включает, но без ограничения, поксвирус [например, вирус осповакцины или аттенюированный вирус осповакцины, авипоксвирус или аттенюированный авипоксвирус (например, оспы канареек, оспы домашней птицы, оспы голубей, оспы голубиных, оспы перепелиных, ALVAC, TROVAC; см., например, US 5505941, US 54948070), вирус оспы енотовых, вирус оспы свиней и т.д.], аденовирус (например, аденовирус человека, аденовирус собачьих), вирус герпеса (например, вирус герпеса собачьих, вирус герпеса кошачьих, бычий вирус герпеса, вирус герпеса свиней), бакуловирус, ретровирус и т.д.. В другом воплощении авипоксвирусный экспрессирующий вектор может представлять собой вирусный вектор оспы канареек, такой как ALVAC. В еще одном воплощении авипоксвирусный экспрессирующий вектор может представлять собой вирусный вектор оспы домашней птицы, такой как TROVAC. Полипептид, антиген, эпитоп или иммуноген CDV может представлять собой CDV НА. Например, поксвирусные векторы, содержащие CDV НА, могут представлять собой векторы такие, как описанные в US 5756102. Экспрессируемые полипептид или антиген CDV НА по изобретению встраивают под контролем специфического поксвирусного промотора, например, осповакцинного промотора в 7,5 кД (Cochran et al., 1985), осповакцинного промотора I3L (Riviere et al., 1992), осповакцинного промотора НА (Shida, 1986), осповакцинного промотора ATI (Funahashi et al., 1988), осповакцинного промотора Н6 (Taylor et al., 1988b; Guo et al., 1989; Perkus et al., 1989), среди прочего.

Согласно еще одному воплощению изобретения экспрессирующий вектор представляет собой плазмидный вектор, в частности, in vivo экспрессирующий вектор. Конкретно, как неограничительный пример, в качестве вектора для вставки полинуклеотидной последовательности можно использовать плазмиду pVR1020 или 1012 (VICAL Inc.; Luke et al., 1997; Hartikka et al., 1996, см., например, патенты США №№5846946 и 6451769). Плазмиду pVR1020 получают из pVR1012, и она содержит человеческую сигнальную последовательность tPA. В одном воплощении человеческая сигнальная последовательность tPA состоит из аминокислот с М(1) до S(23), инвентарный номер GenBank HUMTPA14. В другом характерном неограничительном примере плазмида, используемая в качестве вектора для встраивания полинуклеотидной последовательности, может содержать сигнальную пептидную последовательность IGF1 лошади из аминокислот с М(24) до А(48), инвентарный номер GenBank U28070. Дополнительная информация о ДНК-плазмидах, которую можно принять во внимание или использовать на практике, содержится, например, в патентах США №№6852705, 6818628, 6586412, 6576243, 6558674, 6464984, 6451770, 6376473 и 6221362. Сведения о вакцинах на основе ДНК-плазмид, экспрессирующих антигены CDV, можно найти в заявке на патент США USSN 09/587964.

Термин «плазмида» перекрывает любую единицу транскрипции ДНК, содержащую полинуклеотид по изобретению и элемент, необходимый для ее экспрессии in vivo в клетке или клетках нужного хозяина или мишени; и с учетом этого отмечается, что предполагается, что свернутая в суперспираль или не свернутая в суперспираль кольцевая плазмида, а также линейная форма входят в объем изобретения.

Каждая плазмида включает или содержит по существу, кроме полинуклеотида, кодирующего полипептид, антиген, эпитоп или иммуноген CDV НА, необязательно слитый с последовательностью гетерологичного пептида вариант, аналог или фрагмент, необязательно соединенный с промотором или под контролем промотора или зависимый от промотора. Вообще, выгодно использовать сильный промотор, функциональный в эукариотических клетках. Сильный промотор может представлять собой, но без ограничения, немедленноранний цитомегаловирусный промотор (CMV-IE) из человеческого или мышиного источника или необязательно из другого источника, такого как крыса или морская свинка.

В более общем смысле промотор имеет или вирусное или клеточное происхождение. Сильный вирусный промотор иной, чем CMV-IE, который можно с пользой использовать в практике изобретения, представляет собой ранний/поздний промотор вируса SV40 или LTR промотор вируса саркомы Рауса. Сильный кольцевой промотор, который можно с пользой использовать в практике изобретения, представляет собой промотор гена клеточного скелета, такой как, например, десминный промотор (Kwissa et al., 2000) или актиновый промотор (Miyazaki et al., 1989).

Что касается сигнала полиаденилирования (полиА) для плазмид и вирусных векторов иных, чем поксвирусы, то можно использовать сигнал поли(А) гена бычьего гормона роста (bGH) (см. US 5122458) или сигнал поли(А) гена кроличьего β-глобина или сигнал поли(А) вируса SV40.

Термин «клетка-хозяин» обозначает прокариотическую или эукариотическую клетку, которая изменена генетически или способна к генетическому изменению путем введения экзогенного полинуклеотида, такого как рекомбинантная плазмида или вектор. При обращении к генетически измененным клеткам термин относится как к исходно измененной клетке, так и к ее потомству.

Способы использования и полученное изделие

Настоящее изобретение включает указанные далее воплощения способов. В одном воплощении раскрывается способ вакцинации животного, включающий введение животному композиции, содержащей вектор, содержащий полинуклеотид, кодирующий полипептид CDV НА или его фрагмент или вариант, и фармацевтически или ветеринарно приемлемый носитель, эксципиент, среду или адъювант. В одном аспекте такого воплощения животное представляет собой птицу, лошадь, собаку, кошку, хорька, тюленя или свинью.

В другом воплощении раскрывается способ вакцинации животного, содержащий композицию, содержащую вектор, содержащий полинуклеотид, кодирующий полипептид CDV НА, и полинуклеотид, кодирующий полипептид GM-CSF, и фармацевтически или ветеринарно приемлемый носитель, эксципиент, среду или адъювант, и одну или несколько композиций, содержащих антигены собачьих.

В еще одном воплощении раскрывается способ вакцинации животного, содержащий композицию, содержащую вектор, содержащий полинуклеотид, кодирующий полипептид GM-CSF, и фармацевтически или ветеринарно приемлемый носитель, эксципиент, среду или адъювант, и одну или несколько композиций, содержащих антигены собачьих.

В одном воплощении изобретения может быть использована прайм-бустерная (prime-boost) схема, которая заключается в по меньшей мере одном первичном введении и по меньшей мере в одном бустерном введении с использованием по меньшей мере одного общего полипептида, антигена, эпитопа или иммуногена. Введение может включать одну, две или больше вакцин или композиций, содержащих одни и те же или различные антигены. Типично иммунологическая(ие) композиция(ии) или вакцина(ы), используемая(ые) в первичном введении, отличается(ются) по природе от той(тех), которую(ые) используют в качестве бустера. Однако отмечается, что можно использовать одну и ту же (одни и те же) композицию(ии) как при первичном введении, так и при бустерном введении. Протокол такого введения называется «прайм-бустер» («prime-boost»).

Прайм-бустерная схема включает по меньшей мере одно первичное введение и по меньшей мере одно бустерное введение с использованием по меньшей мере одного общего полипептида и/или его вариантов или фрагментов. Первичное введение может включать одно или несколько введений. Подобным образом, бустерное введение может включать одно или несколько введений. Первичное введение может включать один или несколько антигенов, и бустерное введение может включать один или несколько антигенов.

В одном аспекте протокол прайм-бустер может включать введение композиции, содержащей рекомбинантный вирусный вектор, который содержит и экспрессирует полипептид CDV НА, его антиген и/или их варианты или фрагменты in vivo, с последующим введением рекомбинантного полипептида или антигена CDV НА, или инактивированной вирусной композиции или вакцины, содержащей полипептид или антиген CDV НА, или композиции или вакцины на основе ДНК-плазмиды, экспрессирующей полипептид или антиген CDV НА. Подобным образом, протокол прайм-бустер может включать введение композиции, содержащей рекомбинантный антиген CDV НА, или инактивированной вирусной композиции или вакцины, содержащей полипептид или антиген CDV НА, или композиции или вакцины на основе ДНК-плазмиды, экспрессирующей полипептид или антиген CDV НА, с последующим введением рекомбинантного вирусного вектора, который содержит и экспрессирует полипептид и/или антиген CDV НА и/или их варианты или фрагменты in vivo. Также следует отметить, что как первичные, так и вторичные введения могут включать рекомбинантный вирусный вектор, который содержит и экспрессирует полипептид CDV НА по изобретению. Таким образом, рекомбинантный CDV вирусный вектор по изобретению может быть введен в любом порядке с рекомбинантным антигеном CDV, инактивированной вирусной композицией или вакциной, содержащей антиген CDV, или, с другой стороны, может быть использован один как в первичных, так и во вторичных композициях.

Объем дозы композиций для вида-мишени, которой являются млекопитающие, например, объем дозы композиции для собак, относительно вирусных векторов, например, композиций на основе непоксвирусных векторов, как правило, составляет от примерно 0,1 до примерно 2,0 мл, от примерно 0,1 до примерно 1,0 мл и от примерно 0,5 мл до примерно 1,0 мл.

Эффективность вакцин можно проверить примерно через 2-4 недели после последней иммунизации путем проверочного заражения животных, таких как собака, вирулентным штаммом CDV. Для проверки эффективности вакцины для заражения используют как гомологочные, так и гетерологичные штаммы. Животное может быть заражено перорально, IV инъекцией или IC инокуляцией. В случае каждого различного штамма для проверочного заражения и каждого используемого способа введения вирус имеет достаточно высокий титр для того, чтобы вызывать клинические симптомы у не вакцинированных животных. Объем вируса для заражения составляет примерно 0,5-2,0 мл. Животных можно осматривать в течение 21-42 дней после заражения на клинические признаки, такие как конъюнктивит, ринит, диарея, рвота, депрессия, обезвоживание, гипертермия, пневмония, атаксия, миоклонус, гиперестезия, паралич, парез, припадки, глазные симптомы (такие как кератоконъюнктивит, хориоретинит) и ретробульбарный неврит. На протяжении заражения у животных можно взять образцы крови для клинического анализа крови и серологического исследования (присутствие CDV-специфических антител). Кроме того, можно выполнить PCR с образцами мочи, слез, слюны, фекалий и крови.

Композиции, содержащие антигенный полипептид по изобретению, используемые в протоколах прайм-бустер, содержатся в фармацевтически или ветеринарно приемлемой среде, адъюванте, разбавителе или эксципиенте. Протоколы по изобретению защищают животное от CDV и/или предотвращают развитие заболевания у инфицированного животного.

Каждое введение предпочтительно осуществляют через 1-6 недель. Предпочтительный временной интервал составляет 3-5 недель и оптимально 4 недели. Согласно одному воплощению также предусматривается ежегодная активная иммунизация. Животные, например, собаки, на момент первого введения могут быть по меньшей мере 8-недельного возраста.

Специалисту в данной области техники следует представлять, что раскрытие в данном описании приводится с помощью примеров, и настоящее изобретение ими не ограничивается. Из раскрытия в данном описании и знаний в данной области техники специалист может определить число введений, способ введения и дозы, используемые для каждого протокола инъецирования без чрезмерного экспериментирования.

Настоящее изобретение предполагает по меньшей мере одно введение животному эффективного количества терапевтической композиции, полученной согласно изобретению. Животное может быть самцом, самкой, беременной самкой и новорожденным. Указанное введение может осуществляться различными путями, включая, но без ограничения, внутримышечную (IM), интрадермальную (ID) или подкожную (SC) инъекцию, или интраназальным или пероральным введением. Терапевтическую композицию по изобретению также можно вводить с помощью безигольного устройства (как, например, с помощью устройства Pigjet, Dermojet, Biojector, Avijet (Merial, GA, USA), Vetjet или Vitajet (Bioject, Oregon, USA)). Другим подходом к введению плазмидных композиций является использование электропорации (см., например, Tollefsen et al., 2002; Tollefsen et al., 2003; Babiuk et al., 2002; заявка РСТ №. WO99/01158). В другом воплощении терапевтическую композицию доставляют животному с помощью генной пушки или бомбардировки частицами золота. В преимущественном воплощении животное представляет собой собаку, хорька или тюленя.

В одном воплощении изобретение относится к введению терапевтически эффективного количества композиции для доставки и экспрессии антигена или эпитопа CDV в клетке-мишени. Определение терапевтически эффективного количества является обычным экспериментом для специалиста в данной области техники. В одном воплощении композиция включает экспрессирующий вектор, содержащий полинуклеотид, который экспрессирует антиген или эпитоп CDV, и фармцевтически или ветеринарно приемлемый носитель, среду, адъювант или эксципиент. В другом воплощении фармцевтически или ветеринарно приемлемый носитель, среда, адъювант или эксципиент облегчает трансфекцию или инфицирование и/или улучшает сохранение вектора или белка в организме реципиента.

В одном воплощении изобретение относится к введению терапевтически эффективного количества композиции для доставки и экспрессии полипептида, антигена или эпитопа CDV НА в клетке-мишени. Определение терапевтически эффективного количества является обычным экспериментом для специалиста в данной области техники. В одном воплощении композиция включает экспрессирующий вектор, содержащий полинуклеотид, который экспрессирует полипептид, антиген или эпитоп CDV, и фармцевтически или ветеринарно приемлемый носитель, адъювант, среду или эксципиент. В другом воплощении фармцевтически или ветеринарно приемлемый носитель, среда, адъювант или эксципиент облегчает трансфекцию или инфицирование и/или улучшает сохранение вектора или белка в организме реципиента.

Фармцевтически или ветеринарно приемлемые носители или среды или эксципиенты или адъюванты хорошо известны специалистам в данной области техники. Например, фармцевтически или ветеринарно приемлемый носитель или среда или эксципиент или адъювант может представлять собой 0,9% раствор NaCl (например, физиологический раствор) или фосфатный буфер. Другие фармцевтически или ветеринарно приемлемые носитель или среда или эксципиент или адъювант, которые можно использовать для способов данного изобретения, включают, но не ограничиваются указанным, поли-L-глутамат или поливинилпирролидон. Фармцевтически или ветеринарно приемлемый носитель или среда или эксципиент или адъювант может представлять собой любое соединение или комбинацию соединений, облегчающих введение вектора (или белка, экспрессированного из изобретенного вектора in vitro); преимущественно носитель, среда, эксципиент или адъювант могут облегчать трансфекцию и/или улучшать сохранность вектора (или белка). Дозы и объемы доз в данном описании обсуждаются в общем описании и также могут быть определены специалистом в данной области техники на основании описания в сочетании с знаниями в данной области без чрезмерного экспериментирования.

Катионные липиды, содержащие соль четвертичного аммония, которые выгодно, но не исключительно, подходят для плазмид, представляют собой соединения следующей формулы:

,

в которой R1 представляет собой насыщенный или ненасыщенный линейный алифатический радикал с 12-18 атомами углерода, R2 представляет собой другой алифатический радикал, содержащий 2 или 3 атома углерода, и Х представляет собой аминную или гидроксильную группу, например, DMRIE. В другом воплощении катионный липид может быть ассоциирован с нейтральным липидом, например, DOPE.

Среди катионных липидов предпочтение отдается DMRIE (N-(2-гидроксиэтил)-N,N-диметил-2,3-бис(тетрадецилокси)-1-пропанаммоний; WO96/34109), преимущественно ассоциированному с нейтральным липидом, преимущественно DOPE (диолеоилфосфатидилэтаноламин; Behr, 1994), с образованием DMRIE-DOPE.

Когда DOPE присутствует, молярное отношение DMRIE:DOPE преимущественно составляет от примерно 95: примерно 5 до примерно 5: примерно 95, предпочтительнее, примерно 1: примерно 1, например, 1:1.

В другом воплощении фармацевтически или ветеринарно приемлемый носитель, эксципиент, среда или адъювант может представлять собой эмульсию «вода в масле». Примеры подходящих эмульсий «вода в масле» включают эмульсии вакцин «вода в масле» на основе масла, которые устойчивы и жидкие при 4°С, содержащие от 6 до 50 об.% антигенсодержащей водной фазы, предпочтительно, от 12 до 25 об.%, от 50 до 94 об.% масляной фазы, содержащей полностью или частично неметаболизированное масло (например, минеральное масло, такое как парафиновое масло) и/или метаболизированное масло (например, растительное масло или жирную кислоту, сложные эфиры полиолов или спиртов), от 0,2 до 20%, мас./об., поверхностно-активных веществ, предпочтительно, от 3 до 8%, мас./об., причем последние полностью или частично или в смеси представляют собой любые полиглицериды, причем указанные полиглицериды предпочтительно представляют собой полиглицерин(поли)рицинолеаты, или полиоксиэтиленрициновые масла или также гидрированные полиоксиэтиленрициновые масла. Примеры поверхностно-активных веществ, которые можно использовать в эмульсии «вода в масле», включают этоксилированные эфиры сорбитана (например, полиоксиэтилен(2)сорбитанмоноолеат (твин 80®), доступный от AppliChem Inc., Cheshire, СТ) и сложные эфиры сорбитана (например, сорбитанмоноолеат (Спан 80®), доступный от Sigma Aldrich, St. Louis, МО). Кроме того в отношении эмульсии «вода в масле» см. также US 6919084. В некоторых воплощениях антигенсодержащая водная фаза включает солевой раствор, включающий одно или несколько буферирующих веществ. Примером подходящего буферного раствора является забуференный фосфатом физиологический раствор. В одном воплощении эмульсия «вода в масле» может представлять собой тройную эмульсию вода/масло/вода (W/O/W) (US 6358500). Примеры других подходящих эмульсий описываются в US 7371395.

Иммунологические композиции и вакцины по изобретению могут включать или состоять по существу из одного или нескольких фармацевтически или ветеринарно приемлемых носителей, эксципиентов, сред или адъювантов. Подходящими адъювантами для применения в практике настоящего изобретения являются (1) полимеры акриловой или метакриловой кислоты, малеинового ангидрида и полимеры алкенилпроизводных, (2) иммуностимулирующие последовательности (ISS), такие как олигооксирибонуклеотидные последовательности, имеющие одну или несколько неметилированных единиц CpG (Kinmann et al., 1996; WO 98/16247), (3) эмульсия «масло в воде», такая как эмульсия SPT, описанная на странице 147 «Vaccine Design, The Subunit and Adjuvant Approach», published by M. Powell, M. Newman, Plenum Press 1995, и эмульсия MF59, описанная на странице 183 той же работы, (4) катионные липиды, содержащие соль четвертичного аммония, например, DDA, (5) цитокины, (6) гидроксид алюминия или фосфат алюминия, (7) сапонин или (8) другие адъюванты, обсуждаемые в любом документе, цитированном в данном описании и включенном в него в качестве ссылки, или (9) их любые комбинации или смеси.

Эмульсия «масло в воде» (3), которая особенно подходит для вирусных векторов, может иметь в основе светлый жидкий парафин (типа указанного в Европейской фармакопеи), изопреноидное масло, такое как сквалан, сквален, масло, полученное при олигомеризации алкенов, например, изобутен или децен, эфиры кислот или спиртов с линейной алкильной группой, такие как растительные масла, этилолеат, пропиленгликоль, ди(каприлат/капрат), три(каприлат/капрат) глицерина и диолеат пропиленгликоля, или эфиры разветвленных жирных спиртов или кислот, в особенности, эфиры изостеариновой кислоты.

Масло для образования эмульсии используют в сочетании с эмульгаторами. Эмульгаторы могут представлять собой неионогенные поверхностно-активные вещества, такие как эфиры, с одной стороны, сорбитана, маннида (например, ангидроманнитолеат), глицерина, полиглицерина или пропиленгликоля, и с другой стороны, олеиновой, изостеариновой, рицинолеиновой или гидроксистеариновой кислот, причем указанные эфиры необязательно этоксилированы, или блоксополимеры оксипропилена и оксиэтилена, такие как плюроник, например, L121.

Среди полимерных адъювантов типа (1) предпочтение отдается сшитьм полимерам акриловой или метакриловой кислоты, в особенности, сшитым простыми полиалкиленэфирами Сахаров или многоатомных спиртов. Такие соединения известны под названием «карбомеры» (Pharmeuropa, vol.8, no.2, June 1996). Специалист в данной области техники также может обратиться к U.S. 2909462, в котором описываются такие акриловые полимеры, сшитые полигидроксисоединением, имеющим по меньшей мере три гидроксильные группы, предпочтительно не более восьми таких групп, причем атомы водорода по меньшей мере трех гидроксильных групп заменены ненасыщенными алифатическими радикалами, имющими по меньшей мере два атома углерода. Предпочтительными радикалами являются радикалы, содержащие 2-4 атома углерода, например, винилы, аллилы и другие этиленненасыщенные группы. Ненасыщенные радикалы также могут содержать другие заместители, такие как метил. Продукты, продаваемые под названием карбопол (BF Goodrich, Ohio, USA), являются особенно подходящими. Они сшиты аллилсахарозой или аллилпентаэритритом. Среди них предпочтение отдается карбополу 974Р, 934Р и 971P.

Что касается сополимеров малеиновых ангидридов-алкенилпроизводных, то предпочтение отдается EMA (Monsanto), которые представляют собой линейные или сшитые сополимеры этилена и малеинового ангидрида, и они сшиты, например, дивиниловым эфиром.

Что касается структуры, то полимеры акриловой или метакриловой кислоты и EMA предпочтительно формируются основными звеньями следующей формулы:

,

в которой

- R1 и R2, которые могут быть одинаковыми или различными, представляют собой Н или СН3;

- х=0 или 1, предпочтительно, х=1;

- y=1 или 2, при х+y=2.

Для ЕМА х=0, и y=2, и для карбомеров х=y=1.

Указанные полимеры растворяются в воде или физиологическом растворе (20 г/л NaCl), и рН можно отрегулировать до 7,3-7,4, например, едким натром (NaOH), и получить раствор адъюванта, в который можно ввести экспрессирующий(е) вектор(ы). Концентрация полимера в конечной иммунологической или вакцинной композиции может колебаться от примерно 0,01 до примерно 1,5%, мас./об., от примерно 0,05 до примерно 1%, мас./об., и от примерно 0,1 до примерно 0,4%, мас./об..

Цитокин или цитокины (5) в иммунологической или вакцинной композиции могут находиться в форме белка или могут быть эксперссированы в хозяине совместно с иммуногеном или иммуногенами или его(их) эпитопом(ами). Предпочтение отдается коэкспрессии цитокина или цитокинов или с помощью того же вектора, который экспрессирует иммуноген или иммуногены или его(их) эпитоп(ы), или с помощью их отдельного вектора.

Изобретение включает получение таких комбинированных композиций, например, путем смешивания активных компонентов, предпочтительно, вместе с адъювантом, носителем, цитокином и/или разбавителем.

Цитокины, которые можно использовать в настоящем изобретении, включают, но не ограничиваются указанным, гранулоцитарный колониестимулирующий фактор (G-CSF), гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), интерферон α (IFNα), интерферон β (IFNβ), интерферон γ (IFNγ), интерлейкин-1α (IL-1α), интерлейкин-1β (IL-1β), интерлейкин-2 (IL-2), интерлейкин-3 (IL-3), интерлейкин-4 (IL-4), интерлейкин-5 (IL-5), интерлейкин-6 (IL-6), интерлейкин-7 (IL-7), интерлейкин-8 (IL-8), интерлейкин-9 (IL-9), интерлейкин-10 (IL-10), интерлейкин-11 (IL-11), интерлейкин-12 (IL-12), фактор некроза опухоли α (TNFα), фактор некроза опухоли β (TNFβ) и трансформирующий фактор роста β (TGFβ). Предполагается, что цитокины можно вводить совместно и/или вводить последовательно с иммунологической или вакцинной композицией по настоящему изобретению. Так, например, вакцина по настоящему изобретению также может содержать молекулу экзогенной нуклеиновой кислоты, которая экспрессирует in vivo подходящий цитокин, например, цитокин, соответствующий данному реципиенту, которого вакцинируют, или у которого вызывают иммунологическую реакцию (например, цитокин собачьих для препаратов, вводимых собакам).

Теперь изобретение будет описываться с помощью приведенных далее неограничительных примеров.

Примеры

Без дополнительного уточнения предполагается, что специалист в данной области техники может с использованием предшествующего описания осуществить настоящее изобретение на практике в самой широкой степени. Следующие далее подробные примеры должны рассматриваться только как пояснительные и не ограничивают предшествующее описание никоим образом. Специалисты в данной области техники смогут быстро установить соответствующие вариации процедур как в отношении реагентов, так и условий реакций и методов.

Конструирование вставок ДНК, плазмид и рекомбинантных вирусных или растительных векторов осуществляют с использованием стандартных методов молекулярной биологии, описанных в J. Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).

Пример 1. Конструирование плазмиды pCXL1557.1, содержащей CDV НА - рС5 Н6 CDV НА,

Плазмиду, содержащую кодон-оптимизированный ген CDV НА (SEQ ID NO:1) (из штамма CDV Danish) гидролизуют с EcoRV и XhoI. Фрагмент в 1849 п.о., содержащий последовательность 3' осповакцинного промотора Н6 и полноразмерный кодон-оптимизированный ген CDV НА, очищают в геле. Плазмиду pCXL148.2 (донорная плазмида рС5, Merial proprietary material) гидролизуют с EcoRV и XhoI для получения вектора в 49851 п.о., содержащего последовательность 5' промотора Н6. Вставку в 1849 п.о. лигируют с вектором в 49851 п.о., и получают рС5 Н6 CDV НА (pCXL1557.1). Конструкцию секвенируют для подтверждения правильной последовательности. Фигура 3 отображает карту плазмиды pCXL1557.1.

Пример 2. Конструирование плазмиды pJSY2218.1, содержащей GM-CSF собачьих - рС3 Н6р GM-CSF собачьих

Плазмиду, содержащую кодон-оптимизированный ген GM-CSF собачьих, гидролизуют с NruI/XhoI. Полученный фрагмент ДНК GM-CSF собачьих изолируют и лигируют с pJY 19131.1, гидролизованной NruI/XhoI (Merial proprietary material), и создают донорную плазмиду СЗ pJSY2218.1, которая содержит экспрессирующую кассету Н6р (осповакцинный промотор H6)-GM-CSF собачьих в ориентации, противоположной плечам С3. Плазмиду pJSY2218.1 секвенируют и подтверждают наличие правильной последовательности. Фигура 3 отображает карту плазмиды pJSY2218.1.

Пример 3. Получение и характеризация рекомбинанта ALVAC, содержащего ген синтетического НА CDV в локусах С5 ALVAC (vCP2263)

А. Получение vCP2263

Донорная плазмида pCXL1557.1 содержит кодон-оптимизированный ген CDV НА собачьих (SEQ ID NO:1). Первичные фибробласты куриного эмбриона (1°CEF) используют для рекомбинации in vitro. Клетки 1°CEF выращивают в 10% FBS (JRH: γ-облученный # 12107-500М), DMEM (BRL/Gibco#11960-051 или 11960-044) с добавлением 4 мМ глутамина (BRL/Gibco#25030-081) и 1 мМ пирувата натрия (BRL/Gibco# 11360-070) в присутствии 1х антибиотиков/противогрибковых средств (P/S/A/A, BRL/Gibco#15240-062). Для отбора рекомбинанов используют гибридизацию бляшек с зондом, специфическим для синтетического НА CDV, меченным пероксидазой из хрена (HRP).

IVR (рекомбинация in vitro) выполняют трансфекцией клеток 1°CEF 12 мкг линеаризованной Not I донорной плазмиды pCXL1557.1 с использованием реагента FuGENE-6® (Roche). Затем трансфицированные клетки инфицируют ALVAC как вирусом спасателем при MOI (мультиплетность заражения) 10 (штамм ALVAC, 6,3×109 бое/мл). Через 24 часа трансфицированные-инфицированные клетки собирают, обрабатывают ультразвуком и используют для скрининга на рекомбинантный вирус. Рекомбинантные бляшки скринируют на основе метода гибридизации plaque lift с использованием специфического к синтетическому НА зонда в 1232 п.о., меченного пероксидазой из хрена (HRP), согласно протоколу изготовителя (Amercham, кат. № RPN3001). После четырех последовательных циклов очистки бляшек получают рекомбинанты, обозначенные как vCP2263.1.2.1.1 и vCP2263.6.1.1.1, и подтверждают гибридизацией как 100% положительные для вставки НА и 100% отрицательные для пустого сайта С5. В 4-ом цикле очистки бляшек отбирают и размножают отдельные бляшки, и получают штаммы Р1 (1х флакон Т25 per sister), P2 (1х флакон Т75 per sister) и Р3 (4х роллер-флакона для vCP2263.1.2.1.1) для амплификации vCP2263. Жидкую культуру инфицированных клеток из роллер-флаконов собирают и концентрируют, и получают вирусный штамм.

В. Геномный анализ

Геномную ДНК из vCP2263.1.2.1.1 и vCP2263.6.1.1.1 экстрагируют, гидролизуют с BamHI, HindIII или PstI и помещают в 0,8% агарозный гель. Результаты показывают правильное встраивание последовательности синтетического НА CDV.

Саузерн-блоттинг. Гель с гидролизованной BamHI, HindIII или PstI геномной ДНК переносят на нейлоновую мембрану, и выполняют анализ методом саузерн-блоттинга путем гибридизации с зондом, специфическим к синтетическому НА CDV. При ожидаемых размерах наблюдают одинарные или двойные полосы от всех трех гидролизатов: 1984 п.о. BamHI, 12294 п.о. HindIII и 6465 и 12119 п.о. PstI (см. фигуру 4), указывающие на правильное встраивание синтетического НА CDV в локусы С5.

Праймеры для амплификации зонда синтетического НА CDV:

13220CXL: 5' AGGTGTCCACCTCCAACATGGAGT 3' (SEQ ID NO:10);

13225CXL: 5' GAACTGGTCGCCCCTGGAGGCCTT 3' (SEQ ID NO:11).

С. Анализ экспрессии

Вестерн-блоттинг. Клетки 1°CEF инфицируют штаммом Р2 при MOI 10 и инкубируют при 37°С в течение 25 час. Затем клетки и супернатант собирают. Белки образца разделяют в геле 10% SDS-PAGE, переносят на нейлоновую мембрану Immobilon и зондируют кроличьми поликлональными антителами против CDV (объединенные сыворотки от кролика А151 и 152 при разведении 1 в 100). Антикроличью ослиную антисыворотку, конъюгированную с пероксидазой, используют в качестве вторичных антител, и полосы визуализируют с использованием реагентов с люминолом. vCP2263.1211 показывает очень слабую полосу при 73 кД во фракции клеточного супернатанта, но во фракции клеточного осадка CDV-специфическая полоса не детектируется (см. фигуру 5).

Иммунобляшковый анализ. Гомогенность популяции для vCP2263.1.2.1.1 составляет 100%, как показывает иммунобляшковый анализ с использованием кроличьих антител против CDV (см. фигуру 6).

D. Анализ последовательностей

Более подробный анализ геномной ДНК штамма Р3 выполняют ПЦР-амплификацией и анализом последовательностей фланкирующих плечей локуса С5 и вставки синтетического НА CDV. Праймеры 7931 DC и 7932 DC, расположенные за пределами плечей локуса С5 в геноме ALVAC, используют для амплификации полного фрагмента синтетического HA-C5R C5L-CDV. Результаты показывают, что последовательности синтетического НА CDV и C5R и C5L ALVAC являются правильными.

Праймеры для ПЦР-амплификации:

7931DC: 5' GAATCTGTTAGTTAGTTACTTGGAT 3' (SEQ ID NO:12);

7932DC: 5' TGATTATAGCTATTATCACAGACTC 3' (SEQ ID NO:13).

Последовательность ДНК, фланкированную праймерами 7931DC и 7932 DC, содержащими плечи С5, промотор Н6 и синтетический НА CDV, называют SEQ ID NO:14.

Пример 4. Получение и характеризация рекомбинанта ALVAC ALVAC - vCP2391, содержащего Н6р-синтетический кодон-оптимизированный ген GM-CSF собачьих, встроенный в локус С3

А. Получение vCP2391

Донорная плазмида pJSY2218.1 содержит кодон-оптимизированный ген GM-CSF собачьих (SEQ ID NO:3). Первичные фибробласты куриного эмбриона (1°CEF) используют для рекомбинации in vitro. Для отбора рекомбинанов используют гибридизацию бляшек с зондом, специфическим для GM-CSF собачьих, меченным пероксидазой из хрена (HRP).

IVR выполняют трансфекцией клеток 1°CEF 10 мкг линеаризованной Not I донорной плазмиды pJSY2218.1 с использованием реагента FuGENE-6® (Roche). Затем трансфицированные клетки инфицируют ALVAC как вирусом спасателем при MOI 10. Через 24 часа трансфицированные-инфицированные клетки собирают, обрабатывают ультразвуком и используют для скрининга на рекомбинантный вирус. Рекомбинантные бляшки скринируют на основе метода гибридизации plaque lift с использованием зонда в 382 основания, специфического к GM-CSF собачьих, меченного пероксидазой из хрена (HRP), согласно протоколу изготовителя (Amercham, кат. № RPN3001). После двух последовательных циклов очистки бляшек получают рекомбинант, обозначенный как vCP2391.4.4, и подтверждают гибридизацией как 100% положительный для вставки GM-CSF собачьих и 100% отрицательный для ORF С3. Во 2-ом цикле очистки бляшек отбирают и размножают отдельную бляшку, и получают Р1 (1х флакон Т25), Р2 (1х флакон Т75) и Р3 (6х роллер-флаконов).

В. Геномный анализ - саузерн-блоттинг

Геномную ДНК из СР2391 экстрагируют, гидролизуют с BamHI, HindIII или PstI и помещают в 0,8% агарозный гель. Гель с гидролизованной BamHI, HindIII или PstI геномной ДНК переносят на нейлоновую мембрану, и выполняют анализ методом саузерн-блоттинга путем гибридизации с зондом caGM-CSF в 382 основания. При ожидаемых размерах наблюдают несколько полос, указывающих на правильное встраивание синтетического гена caGM-CSF в локус С3.

Рестрикционный фермент Фрагмент (п.о.)
Bam HI 7598 16674
Hind III 16344
Pst I 219 1696 11293

Праймеры для амплификации зонда GM-CSF собачьих:

18071 ВК: 5' GATGTTGAACAGGAAGTCCTTCAGGT 3' (SEQ ID NO:15);

18073BK: 5' GTTCCTGGGCACCGTGGTGTGCAGCA 3' (SEQ ID NO:16).

С. Анализ экспрессии

Вестерн-блоттинг. Первичные клетки CEF инфицируют штаммом Р3 vCP2391.4.4 при MOI 10 и инкубируют при 37°С в течение 24 час. Затем собирают весь культуральный супернатант и клетки. Клеточный осадок лизируют буфером для лизиса Reporter Gene Assay, изготовляемьм Roche (кат. №1897675). Как супернатант, так и лизат клеток получают с системой NuPage® с добавлением антиоксиданта. Белки разделяют в геле 10% Bis-Tris Pre-cast, NuPage® и затем переносят на нейлоновую мембрану PVDF. Очищенный козий IgG против GM-CSF собачьих (R&D Systems, кат. AF1546) используют в качестве первичных антител. Вестерн-блоттинг детектирует основной белок в ~20 кД и минорный белок в ~17 кД, секретированные из супернатанта vCP2391.4.4 (см. фигуры 7 и 9). Фигура 9 показывает хорошую экспрессию GM-CSF в неочищенном материале и супернатанте.

D. Анализ последовательностей

Более подробный анализ геномной ДНК vCP2391.4.4 штамма Р3 выполняют ПЦР-амплификацией и анализом последовательностей фланкирующих плечей локуса С3 и вставки GM-CSF собачьих. Праймеры 8103JY и 8104JY, расположенные за пределами плечей локуса С3 в геноме ALVAC, используют для амплификации полного фрагмента C3L-caGM-CSF-C3R. Результаты показывают, что последовательности вставки GM-CSF собачьих и C3L и C3R ALVAC являются правильными (SEQ ID NO:19).

Праймеры для ПЦР-амплификации кассеты C3L-GM-CSF собачьих-C3R:

8103JY: 5' GAGGCATCCAACATATAAAGAAGACTAAAG 3' (SEQ ID NO:17);

8104JY: 5' TAGTTAAATACTCATAACTCATATCTG 3' (SEQ ID NO:18).

Пример 5. Получение и характеризация рекомбинанта ALVAC vCP2263 - vCP2392, содержащего Н6р-синтетический кодон-оптимизированный ген GM-CSF собачьих, встроенный в локус С3

ALVAC С5 Н6р CDV (vCP2263.1.2.1.1) используют в качестве исходного вируса. В качестве донорной плазмиды используют pJSY2218.1, содержащую кодон-оптимизированный ген GM-CSF собачьих. Первичные фибробласты куриного эмбриона (1°CEF) используют для рекомбинации in vitro. Для отбора рекомбинантов используют гибридизацию бляшек с зондом, специфическим для GM-CSF собачьих, меченным пероксидазой из хрена (HRP).

IVR выполняют трансфекцией клеток 1°CEF 10 мкг линеаризованной Not I донорной плазмиды pJSY2218.1 с использованием реагента FuGENE-6® (Roche). Затем трансфицированные клетки инфицируют vCP2263.1.2.1.1 как спасенным вирусом при MOI 10. Через 24 часа трансфицированные-инфицированные клетки собирают, обрабатывают ультразвуком и используют для скрининга на рекомбинантный вирус.Рекомбинантные бляшки скринируют на основе метода гибридизации plaque lift с использованием зонда в 382 основания (пример 4), специфического к GM-CSF собачьих, меченного пероксидазой из хрена (HRP), согласно протоколу изготовителя (Amercham, кат. № RPN3001). После четырех последовательных циклов очистки бляшек получают рекомбинант, обозначенный как vCP2392.5.3,1.1, и подтверждают гибридизацией как 100% положительный для вставки GM-CSF собачьих и 100% отрицательный для ORF С3. Во 4-ом цикле очистки бляшек отбирают и размножают отдельную бляшку, и получают Р1 (1х флакон Т25), Р2 (1х флакон Т75) и Р3 (6х роллер-флаконов).

А. Геномный анализ - саузерн-блоттинг

Геномную ДНК из vCP2392 экстрагируют, гидролизуют с BamHI, HindIII или PstI и помещают в 0,8% агарозный гель. Гель с гидролизованной BamHI, HindIII или PstI геномной ДНК переносят на нейлоновую мембрану, и выполняют анализ методом саузерн-блоттинга путем гибридизации с зондом caGM-CSF в 382 основания (пример 4). При ожидаемых размерах наблюдают несколько полос, указывающих на правильное встраивание гена GM-CSF собачьих в локус С3.

Рестрикционный фермент Фрагмент (п.о.)
Bam HI 7598 16674
Hind III 16344
Pst I 219 1696 11293

В. Анализ экспрессии

Вестерн-блоттинг. Первичные клетки CEF инфицируют штаммом Р3 vCP2392.5.3.1.1 при MOI 10 и инкубируют при 37°С в течение 24 час. Затем собирают весь культуральный супернатант и клетки. Клеточный осадок лизируют буфером для лизиса Reporter Gene Assay, изготовляемым Roche (кат. №1897675). Как супернатант, так и лизат клеток получают с системой NuPage® с добавлением антиоксиданта. Белки разделяют в геле 10% Bis-Tris Pre-cast, NuPage®, и затем переносят на нейлоновую мембрану PVDF. Очищенный козий IgG против GM-CSF собачьих (R&D Systems, кат. AF1546) используют в качестве первичных антител. Вестерн-блоттинг детектирует основной белок в ~20 кД и минорный белок в ~17 кД, секретированные из супернатанта vCP2392.5.3.1.1 (см. фигуры 8 и 9). Результат экспрессии CDV НА показан на фигуре 10. Результат показывает хорошую экспрессию белка CDV НА с помощью vCP2392.

D. Анализ последовательностей

Более подробный анализ геномной ДНК vCP2392.5.3.1.1 штамма Р3 выполняют ПЦР-амплификацией и анализом последовательностей фланкирующих плечей локуса С3 и вставки GM-CSF собачьих. Праймеры 8103JY и 8104JY (см. пример 4), расположенные за пределами плечей локуса С3 в геноме ALVAC, используют для амплификации полного фрагмента C3L-caGM-CSF-C3R. Результаты показывают, что последовательности вставки GM-CSF собачьих и C3L и C3R ALVAC являются правильными.

Пример 6. Сравнение на собаках эффективности рекомбинанта оспа канареек - CDV НА собачьих и GM-CSF собачьих (vCP2392) и рекомбинанта оспа канареек - CDV НА собачьих (vCP2263) путем проверочного заражения

Используют восемнадцать собак без специфического патогена CDV. Самцов и самок 4-х месячных собак группируют в три группы и вакцинируют, и берут образцы, как показано ниже в таблице 1.

Таблица 1
Группа (n=6) Антиген (титр в log10 TCID50/Mn) Вакцинация Клиническая проверка после вакцинации Мониторинг серологических и CMI реакций
А vCP2392 CDV+GM-CSF (6.21) D0 и D28,1 мл SQ путем Общие и местные клинические признаки Серология:
- CDVSN
В vCP2263 CDV (6.38) -CDV SN на клетках Vero SLAM
- GM-CSF ELISA
С Не вакцинированы - CMI:
- Т-клеточные реакции
- SN: тест на серонейтрализацию;
- SLAM: передача сигнала молекулы активации лимфоцитов;
- CMI: клеточноопосредованный иммунитет.

Клинические проверки выполняют в дни (VI) 0, 0+4/5 час, 1, 2, (V2) 28, 28+4/5 час, 29, 30 или до тех пор, пока не исчезнут все симптомы. Клинический мониторинг включает мониторинг общего состояния собак, например, ректальной температуры, боли при пальпации места инъекции, местного опухания, местного нагрева, зуда и местной потери волосяного покрова.

Отбор образцов в обычные пробирки для серологии выполняют в дни 0, 13, 27, 35, 42, 56 и 70. Выполняют два типа SN. Используют штамм CDV, который является гетерологичным вставке CDV НА в vCP2392 и vCP2263. Результат показан на фигуре 11. Результат показывает, что титр в группе А выше, чем в группе В (log 10 1), р=0,009, р=0,019 и р=0,03 в D35, D42 и D70, соответственно. В группе B в D42 имеется 3 собаки с титром log10<0,8 PD50. Выполняют второй тип SN с использованием клеток vero SLAM и штамма CDV 5804-GFP, который гомологичен вставке CDV НА в vCP2392 и vCP2263. Результат показан на фигуре 12. Результат показывает, что титры в группе А выше, чем в группе В. Результат также показывает, что в группе В имеется две собаки с титром 0,48 в D70, в то время как в группе А все собаки имеют серологические титры 0,72 или выше.

Отбор образцов в гепаринизированные пробирки для мониторинга CMI выполняют в дни 13, 42 и 70. Продуцирование IFNγ контролируют с использованием анализа ELISpot после рестимуляции РВМС (мононуклеарные клетки периферической крови) нуклеофицированными РВМС. Вычисляют концентрацию антигенспецифических клеток, продуцирующих IFNγ. Данные приводятся на фигуре 16.

Суммируя вышеизложенное, vCP2392 (CDV HA+GM-CSF собачьих) индуцирует значитель более высокий серологический ответ по сравнению с vCP2263 (CDFV НА)

Пример 7. Влияние vCP2392 на иммуногенность других антигенов вакцин

Данное исследование проводят для изучения того, оказывает ли vCP2392 (коэкспрессирующий CDV НА и GM-CSF собачьих) положительное воздействие на иммуногенность других антигенов вакцин.

Модифицированную живую парвовирусную вакцину для собак используют в дозе (2,6 log10 TCID50), которая значительно ниже обычной коммерческой дозы. Двенадцать SPF (без специфического патогена) щенков бигля самцов и самок (в возрасте 2-3 месяца) произвольно распределяют на две группы и вакцинируют как показано ниже в таблице 2.

Таблица 2
*Вакцинация в D0 и D28
Группа Антиген CDV Антиген CPV2 Серология CDV и CPV2 Клинический мониторинг
N=6 vCP Доза (log10 TCID50/мл) MLV** Доза (log10 TCID50/мл)
А 2392 (CDV НА + GM-CSF) 6,75 CPV2 2,6 D0, D7, D14, D28, D35, D42, D56 D0, D0+4 - 5 час, D1 и D2 D28, D28+4 - 5 час, D29 и D30
В 2263 (CDV НА) 6,91 CPV2 2,6
* 2 мл (vCP + MLV-CPV2 в PBS) SC путем в правое плечо (D0), затем в левое плечо (D28);
** модифицированный живой вирус - парвовирус собачьих типа 2 (MLV-CPV2).

Клинический мониторинг включает общее состояние, ректальную температуру, боль при пальпации места инъекции, локальное опухание, локальный нагрев и зуд. Полученные вакцины хорошо переносятся собаками в обеих группах А и В. На основании результата клинического исследования vCP2392 (CDV НА + GM-CSF) и vCP2263 (CDV НА) в комбинации с MLV-CPV2 считаются безопасными.

Сыворотки титруют на антитела против CPV2 и CDV (с использованием в серологическом тесте гомологичного и гетерологичного CDV).

Фигура 17 показывает результат ELISA CPV2. Ни одно из животных в группах А и B в начале испытания не имеет антител против CPV2. В группе В только одна собака показывает образование антител после вакцинации. Такая реакция детектируется, начиная с D28. В группе А 4 собаки из 8 показывают высокое образование антител, и у некоторых собак реакции детектируются уже в D7. Ни одна из собак не показывает бустерной реакции после второй инъекции в D28. Статистический анализ числа респондеров показывает, что группы существенно различаются (р=0,046). Результат показывает, что вставка GM-CSF, включенная в vCP2392, оказывает положительное влияние на серологию CPV2.

Фигура 18 показывает результат испытания SN (серонейтрализация) с гомологичным CDV. До вакцинации ни одно из животных не имеет антител против CDV. Титры в группах А и B в D35 и D56 схожи. Однако 5/6 собак из группы А имеют антитела на D28, в то время как ни одна из собак в группе B в D28 антител не имеет. В D42 серологические титры существенно выше в группе А (t-критерий Стъюдента р=0,01).

Фигура 19 показывает результат испытания SN с гетерологичным CDV. До вакцинации ни одно из животных не имеет антител против CDV. Титры антител в группе А имеют тенденцию быть выше, чем в группе B в дни 35, 42 и 56. В D56 титры антител в группе А существенно выше, чем в группе В (Уилкоксон, р=0,016).

Результаты исследования показывают, что доза 2,6 log10 TCID50 MLV-CPV2 на собаку находится ниже минимальной дозы, которая может придать сероконверсию, как видно из результата в группе В. Представляет интерес и неожиданно то, что включение GM-CSF в вектор оспы канареек (vCP2392) вызывает различное образование антител, как видно из результата в группе А. Результаты показывают, что присутствие caGM-CSF в векторе оспы канареек может оказывать влияние на иммуногенность другого компонента вакцины, инъецированного в то же место.

Имея, таким образом, подробное описание предпочтительных воплощений настоящего изобретения, следует представлять, что изобретение, определенное в разделах выше, не ограничивается конкретными деталями, приведенными выше в описании, так как возможны их многочисленные явные вариации без отхода от сущности или объема настоящего изобретения.

Все документы, цитированные или указанные в качестве ссылок в цитированных документах заявки, и все документы, цитированные или указанные в качестве ссылок в данном описании («документы, цитированные в данном описании»), и все документы, цитированные или указанные в качестве ссылок в документах, цитированных в данном описании, вместе с рекомендациями изготовителей, описаниями, характеризациями продуктов и протоколами для любых продуктов, указанных в данном описании или в любом документе, включенном в данное описание в качестве ссылки, таким образом включены в данное описание в качестве ссылок и могут использоваться в практике изобретения.

1. Композиция для борьбы с, профилактики, защиты или вызова иммунного ответа у животного против инфекции вирусом чумы плотоядных (CDV), содержащая вирусный вектор в эффективном количестве, при этом вектор содержит первый полинуклеотид, кодирующий полипептид CDV НА, и второй полинуклеотид, кодирующий полипептид GM-CSF псовых.

2. Композиция по п. 1, также содержащая один или несколько дополнительных антигенов.

3. Композиция по п. 2, при этом дополнительный антиген ассоциирован с парвовирусом псовых.

4. Композиция по п. 1, при этом первый полинуклеотид кодирует полипептид CDV НА, имеющий по меньшей мере 80% идентичность последовательностей с последовательностью, представленной в SEQ ID NO: 2, при этом второй полинуклеотид кодирует полипептид GM-CSF псовых, имеющий по меньшей мере 80% идентичность последовательностей с последовательностью, представленной в SEQ ID NO: 4.

5. Композиция по п. 1, при этом первый полинуклеотид кодирует полипептид CDV НА, имеющий последовательность, приведенную в SED ID NO: 2, и где второй полинуклеотид кодирует полипептид GM-CSF псовых, имеющий последовательность, приведенную в SEQ ID NO: 4.

6. Композиция по п. 1, при этом первый полинуклеотид кодирует полипептид CDV НА и имеет по меньшей мере 70% идентичность последовательности с SED ID NO: 1 или 35 и где второй полинуклеотид кодирует полипептид GM-CSF псовых и имеет по меньшей мере 70% идентичность последовательности с SEQ ID NO: 3.

7. Композиция по п. 6, при этом первый полинуклеотид имеет последовательность, приведенную в SED ID NO: 1 или 35, и где второй полинуклеотид имеет последовательность, приведенную в SEQ ID NO: 3.

8. Композиция по п. 6, при этом композиция дополнительно содержит один или несколько антигенов.

9. Композиция по п. 8, где антиген ассоциирован с парвовирусом псовых.

10. Композиция по п. 1, где вирусный вектор является поксвирусом.

11. Композиция по любому из пп. 1-10, где композиция дополнительно содержит фармацевтически или ветиринарно приемлемый носитель, адъювант, разбавитель или эксципиент.

12. Экспрессионный вектор, представляющий собой вирусный вектор, содержащий первый полинуклеотид, кодирующий полипептид CDV НА, и второй полинуклеотид, кодирующий полипептид GM-CSF псовых.

13. Вектор по п. 12, где первый полинуклеотид кодирует полипептид CDV НА, имеющий по меньшей мере 80% идентичность последовательностей с последовательностью, представленной в SEQ ID NO: 2, при этом второй полинуклеотид кодирует полипептид GM-CSF псовых, имеющий по меньшей мере 80% идентичность последовательностей с последовательностью, представленной в SEQ ID NO: 4.

14. Вектор по п. 12, где первый полинуклеотид кодирует полипептид CDV НА, имеющий последовательность, приведенную в SED ID NO: 2, и где второй полинуклеотид кодирует полипептид GM-CSF псовых, имеющий последовательность, приведенную в SEQ ID NO: 4.

15. Вектор по п. 12, где первый полинуклеотид кодирует полипептид CDV НА и имеет по меньшей мере 70% идентичность последовательности с SED ID NO: 1 или 35 и где второй полинуклеотид кодирует полипептид GM-CSF псовых и имеет по меньшей мере 70% идентичность последовательности с SEQ ID NO: 3.

16. Вектор по п. 12, где первый полинуклеотид имеет последовательность, приведенную в SED ID NO: 1 или 35, и где второй полинуклеотид имеет последовательность, приведенную в SEQ ID NO: 3.

17. Способ вакцинации животного от инфекции CDV, содержащий по меньшей мере одно введение композиции или вектора по любому из пп. 1-16.

18. Способ по п. 17, содержащий введение по прайм-бустерной схеме.



 

Похожие патенты:

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Описан вирусный самоинактивирующийся (SIN) вектор на основе вируса саркомы и лейкоза птиц (ASLV) и расщепляющая-пакующая система.

Изобретение относится к области биотехнологии, конкретно к лентивирусной доставке апоптина в опухолевые ткани, и может быть использовано в медицине. Способ включает получение лентивирусного конструкта, экспрессирующего модифицированный апоптин, слитый с секреторным сигналом лактотрансферрина и трансдукторным сигналом (ST-CTP-апоптин), с последующим получением рекомбинантных лентивирусных частиц, дефектных по репликации и несущих модифицированный апоптин, которые затем вводятся в Т-лимфоциты (TILs), полученные при хирургическом удалении опухоли или в процессе получения биопсии, которые обладают способностью проникать в опухолевые ткани.

Группа изобретений относится к области биотехнологии. Применение рекомбинантного парапоксвируса, несущего в своем геноме G белок, взятый из вируса бешенства, позволяет создать иммуногенные композиции и вакцины с высокой эффективностью.

Изобретение относится к биотехнологии, в частности к опухолеспецифичным промоторам, и может быть использовано в противоопухолевой терапии. Сконструированы опухолеспецифичные промоторы широкого спектра действия, обеспечивающие экспрессию терапевтического гена внутри раковой клетки.

Представленные изобретения относятся к области биотехнологии и, в частности, онкологии и касаются онколитического аденовируса, его применения и фармацевтической композиции, содержащей такой аденовирус.

Изобретение относится к медицинской и молекулярной генетике. Описаны генетические конструкции, экспрессирующие РНК-последовательности и гены, кодирующие белки, обладающие антивирусной активностью в отношении вируса иммунодефицита человека.

Изобретение относится к биотехнологии. Заявлен иммуноадъювант, представляющий собой наночастицы гидроксиапатита с адсорбированным синтетическим пептидом - лигандом CXCR 1 и 2 рецепторов.

Изобретение относится к области биотехнологии и касается кДНК, кодирующей дисферлин человека, генно-инженерной конструкции, в которую клонирована такая кДНК, рекомбинантного аденовируса и фармацевтической композиции.
Настоящее изобретение относится к области биотехнологии и вирусологии. Описан химерный пестивирус, где указанный химерный пестивирус включает вирус диареи крупного рогатого скота, который не экспрессирует его гомологичный Erns белок.

Изобретение относится к биотехнологии и представляет собой онколитический аденовирусный вектор, клетку и фармацевтическую композицию, содержащую указанный вектор, а также применение указанных векторов в производстве лекарственного средства для лечения рака у субъекта и к способу лечения рака у субъекта.

Изобретение относится к медицине и касается композиции для подавления экспрессии гена цитокина интерлейкина-4 посредством механизма интерференции РНК, состоящей из катионного дендримерного пептида LTP с формулой (Arg)8(Lys)4(Lys)2Lys-Ala-Cys-NH2, выступающего в качестве носителя, и двух молекул siRNA с формулами 5-UUGAUGAUCUCCUGUAAGGtt-3 и 5-AAAGAUGUCUGUUACGGUCtt-3.
Изобретение относится к области инкапсуляции, в частности к способу получения микрокапсул препаратов группы цефалоспоринов в оболочке из интерферона человеческого лейкоцитарного (β- или α-интерферона).
Изобретение относится к области микрокапсулирования, в частности к способу получения микрокапсул лекарственных препаратов группы цефалоспоринов. Способ характеризуется тем, что в качестве оболочки микрокапсул используется альбумин сывороточный человеческий, при этом к водному раствору альбумина добавляют порошок препарата группы цефалоспоринов в присутствии поверхностно-активного вещества Е472с, соотношение количества препарата группы цефалоспоринов к альбумину при пересчете на сухое вещество составляет от 1:1 до 3:1, полученную смесь перемешивают до полного растворения компонентов и медленно по каплям приливают бутанол в качестве первого осадителя, а затем ацетон в качестве второго осадителя, полученную суспензию микрокапсул фильтруют, промывают ацетоном, сушат в эксикаторе, процесс получения микрокапсул осуществляется при 25°C.
Изобретение относится к медицине, а именно к стоматологии, и может быть использовано для хирургического лечения тяжелого пародонтита. Для этого проводят предварительную профессиональную гигиену полости рта, заключающуюся в удалении над- и поддесневых зубных отложений с помощью ультразвука, полировке наддесневой части зубов.

Изобретение относится к химической энзимологии, в частности к созданию наночастиц антиоксидантного фермента супероксиддисмутазы для медицинского применения в виде полиэлектролитного комплекса типа фермент/поликатион/полианион, характеризующихся тем, что фермент покрыт внутренней оболочкой из поликатиона и внешней оболочкой из полианиона, где в качестве поликатиона использован протамин или полиаргинин, в качестве полианиона использован блок-сополимер поли(глутаминовой кислоты) и полиэтиленгликоля (ПГ-ПЭГ), при этом наночастица имеет гидродинамический диаметр в диапазоне 40-70 нм.
Изобретение относится к области инкапсуляции, в частности способу получения микрокапсул Биопага-Д в оболочке из интерферона человеческого лейкоцитарного (β- или α-интерферона).

Группа изобретений относится к медицине и касается восстановления барабанной перепонки или наружного слухового прохода. Для этого предложено средство, включающее комбинацию желатиновой губки, основного фактора роста фибробластов и фибринового клея, а также применение этих компонентов для производства средства.
Изобретение относится к области микрокапсулирования, в частности к способу получения микрокапсул лекарственных препаратов группы цефалоспоринов. Способ характеризуется тем, что в качестве оболочки микрокапсул используется альбумин сывороточный человеческий, при этом к водному раствору альбумина добавляют порошок препарата группы цефалоспоринов в присутствии поверхностно-активного вещества, соотношение количества препарата группы цефалоспоринов к альбумину при пересчете на сухое вещество составляет от 1:1 до 3:1, полученную смесь перемешивают и приливают изопропанол в качестве первого осадителя, а затем ацетон в качестве второго осадителя, полученную суспензию микрокапсул фильтруют, промывают ацетоном, сушат в эксикаторе, процесс получения микрокапсул осуществляется при 25°C.
Изобретение относится к области микрокапсулирования, в частности к способу получения микрокапсул лекарственных препаратов группы цефалоспоринов. Способ характеризуется тем, что в качестве оболочки микрокапсул используется альбумин сывороточный человеческий, при этом к водному раствору альбумина добавляют порошок препарата группы цефалоспоринов в присутствии поверхностно-активного вещества, соотношение количества препарата группы цефалоспоринов к альбумину при пересчете на сухое вещество составляет от 1:1 до 3:1, полученную смесь перемешивают и приливают метилкарбинол в качестве первого осадителя, а затем изопропанол в качестве второго осадителя, полученную суспензию микрокапсул фильтруют, промывают изопропанолом, сушат в эксикаторе, процесс получения микрокапсул осуществляется при 25°C.
Изобретение относится к области биоинкапсуляции, в частности к способу биоинкапсуляции лекарственных препаратов группы цефалоспоринов, при котором в качестве оболочки микрокапсул используется интерферон человеческий лейкоцитарный в α- или β-форме.

Изобретение относится к генетической инженерии, вирусологии и ветеринарии. .
Наверх