Кормовая добавка с фитобиотической активностью на минеральной основе

Изобретение относится к кормопроизводству, а именно к кормовой добавке с фитобиотической активностью на минеральной основе, которая может использоваться в составе кормов для сельскохозяйственных животных и птицы. Кормовая добавка содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона при соотношении 1:2:1:2, соответственно, нанесенную на диатомит в виде обожженной крошки при соотношении 1:10 и высушенную с получением сухого концентрата смеси эфирных масел в виде порошка, а также наполнитель, в качестве которого использован диатомит в виде обожженной крошки. Все компоненты кормовой добавки взяты в определённых количествах. Кормовая добавка вводится в состав корма при соотношении 0,001:1. Кормовая добавка обеспечивает иммуномодулирующее и антиоксидантное действие, обладает антимикробной активностью и противовоспалительным эффектом. Скармливание кормовой добавки обеспечивает нормализацию процессов пищеварения. 4 табл., 3 пр.


Изобретение относится к сельскохозяйственной биотехнологии, а именно к кормовой добавке с фитобиотической активностью на минеральной основе, и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы.

Известна органоминеральная кормовая добавка, содержащая наполнитель и кремнесодержащий материал, в качестве которого добавка содержит диатомит Инзенского месторождения Ульяновской области с содержанием кремнезема 81,30-85,60% или опоку Дубинского месторождения Ульяновской области с содержанием кремнезема 84,10-89,62%, имеющие высокую пористость и гигроскопичность с возможностями накапливания физиологически активных веществ из наполнителя, RU №2199883 C1, А23К 1/16, А23К 1/175, 10.03.2003.

Известна кормовая добавка для крупного рогатого скота, включающая растительные и зерновые компоненты и минеральную добавку в виде голубой глины, являющейся природным сорбентом и дешевым источником жизненно необходимых макро- и микроэлементов и обладающей высокими адсорбционными и ионообменными свойствами, RU №2238659 С2, А23К 1/16, А23К 1/175, 27.10.2004.

Известна кормовая добавка для животных и птицы, включающая природный цеолит, RU №2484640 C1, А23К 1/00, 20.06.2013; RU №2467591 C1, А23К 1/16, А23К 1/00, 27.11.2012; RU №2448472 C2, A23K 1/175, 27.04.2012; RU №2390254 C1, A23K 1/00, A23K 1/16, A23K 1/175, 27.05.2010; RU №2385623 C2, A23K 1/16, A23K 1/175, 10.04.2010; RU №2374896 C1, A23K 1/00, A23K 1/175, 10.12.2009; RU №2262863 C2, A23K 1/16, A23K 1/175, 27.10.2005.

Известна кормовая добавка для стимулирования роста свиней, содержащая наполнитель и антибиотики, при этом в качестве наполнителя она содержит адсорбент «Бажедин», RU №2386343 С2, А23К 1/00, А23К 1/17, А23К 1/175, 20.04.2010.

Известна лечебно-кормовая добавка из торфа Бастьяновского торфопредприятия Свердловской области с добавлением щелочного компонента, RU №2475038 С2, А23К 1/00, 20.02.2013.

Известна кормовая добавка для свиней, представляющая собой природный минерал Водинского месторождения Красноярского района Самарской области, содержащий в своем составе 47,37% серы и 21,4% кальция, RU №2480025 С2, А23К 1/175, 27.04.2013.

Известна кормовая добавка для молодняка крупного рогатого скота, включающая бентонит Донгузского месторождения, подсолнечный фуз и неорганический селенит натрия, а в качестве наполнителя - отруби пшеничные, RU №2497382 С2, А23К 1/16, А23К 1/175, 10.11.2013.

Известна активная угольная кормовая добавка для повышения продуктивности кур-несушек, включающая сорбент, в качестве которого используют активированный уголь, полученный из мягколиственных пород древесины, имеющий размер частиц от 0,1 до 2 мм, в количестве 400 г на 1 т корма, RU №2505069 C1, А23К 1/00, 27.01.2014.

Известные кормовые добавки содержат в своем составе кремнесодержащий природный материал, или минеральные добавки в виде глины или торфа, или сорбирующие наполнители в виде активированного угля или природного цеолита (наиболее распространенного), которые при каждом конкретном использовании требуют специальной обработки.

Известна кормовая добавка для сельскохозяйственной птицы, содержащая биологически активные вещества, в качестве которых используется вытяжка из растений: женьшеня, крапивы двудомной и других подобных растений, способствующих восстановлению репродуктивной функции организма сельскохозяйственных птиц, RU №2202223 С2, А23К 1/16, А23К 1/175, 20.04.2003.

Известна кормовая добавка, содержащая биологически активное вещество - экстракты хвойной зелени, RU №2304397 C1, А23К 1/00, А23К 1/12, А23К 1/14, А23К 1/16, 20.08.2007.

Известна кормовая добавка для сельскохозяйственной птицы и животных, содержащая сорбент и растительный стимулятор организма, включающий душицу, зверобой, мать-и-мачеху, подорожник, пижму, чистотел, донник, полынь горькую, тысячелистник, ромашку аптечную, крапиву двудомную, RU №2355187 C1, А23К 1/14, А23К 1/16, 20.05.2009.

Известно средство для профилактики колибактериоза птиц, содержащее биологически активное вещество, включающее растительные экстракты из листьев облепихи крушиновидной (Hippophae rhamnoides L.), и/или экстракт травы маклейи сердцевидной (Macleaya cordata Will L.) или маклейи мелкоплодной (M. microcarpas), и/или экстракт расторопши пятнистой (Silybum marianum (L.) Gaertn), и/или экстракт корней и травы эхинацеи пурпурной (Echinacea purpurea L.), RU №2355410 C2, A61K 36/00, 20.05.2009.

Известно средство для предупреждения развития и лечения воспалительных процессов у животных, характеризующееся тем, что представляет собой смесь лекарственных растений: сухие стебли, листья, цветы мяты перечной, сухие цветы ромашки аптечной, сухие листья подорожника большого, сухие цветочные корзинки пижмы обыкновенной, сухие стебли, листья, цветы, плоды донника лекарственного, сухая трава зверобоя продырявленного, сухие цветы ноготков лекарственных (календулы), сухая трава тысячелистника, сухая трава чабреца, сухие стебли, листья, цветы, плоды чистотела большого, сухие листья эвкалипта, сухие листья и цветочные корзинки мать-и-мачехи, сухие листья шалфея лекарственного, сухие листья крапивы двудомной, сухая трава горца почечуйного, сухие цветы венчика коровяка густоцветного (скипетровидного), измельченные плоды аниса и шиповника коричневого, измельченные ядра плодов ореха грецкого, мякоть без косточек плодов облепихи, RU №2395290 C1, А61К 36/00, 27.07.2010.

Известен препарат для повышения жизнеспособности цыплят, представляющий собой водно-аммиачную вытяжку из смеси растительных компонентов, содержащую почки березовые, цветки бессмертника, лепестки календулы, траву золототысячника зонтичного, крапиву двудомную, зверобой продырявленный, цветки липы мелколистной, листья мать-и-мачехи, одуванчик лекарственный, подорожник большой, пустырник сердечный, почки сосновые, плоды фенхеля, чабрец обыкновенный, череду трехраздельную, сушеницу лесную и ламинарию, корень элеутерококка колючего, расторопшу, цветки пижмы, кукурузные рыльца и плоды кориандра, RU №2428998 C1, А61К 36/00, 20.09.2011.

Известна фитоминеральная композиция для повышения иммунитета птиц в промышленном птицеводстве, состоящая из раствора морской соли, в который добавлены высушенные и измельченные бессмертник, календула, крапива, почки березы, почки сосны, тысячелистник, морская капуста, RU №2462257 C1, А61К 36/00, 27.09.2012.

Известна кремнийсодержащая кормовая добавка, включающая растительное сырье, содержащее рисовую шелуху, RU №2473244 C1, А23К 1/14, 27.01.2013.

Известна кормовая добавка для сельскохозяйственных животных и птицы на основе растительного сырья, полученного после промышленной переработки злаковых культур, RU №2491832 С2, А23К 1/14, А23К 1/16, 10.09.2013.

Использование растительного сырья в известных кормовых добавках очень разнообразно и требует индивидуального подбора введения его в состав кормовой добавки для лечебных и профилактических целей.

Известен способ получения биопрепарата с пробиотическими свойствами для кормления сельскохозяйственных животных и птицы, содержащего в своем составе смесь эфирных масел чеснока, эвкалипта, розмарина и тимьяна, RU №2458527 C1, А23К 1/165, 20.08.2012.

Известный способ получения биопрепарата с пробиотическими свойствами предусматривает получение маточной культуры путем селекции бактерий на устойчивость к смеси эфирных масел чеснока, эвкалипта, розмарина, тимьяна, для чего бактерии высевают на агаризованные среды, содержащие смесь эфирных масел указанных растений, и засевают в питательную среду, состоящую из подсолнечникового (соевого) шрота и 98-93% водопроводной воды, культивируют и смешивают с пшеничными отрубями с последующим нанесением смеси эфирных масел чеснока, эвкалипта, розмарина, тимьяна.

В известном способе использование смеси эфирных масел чеснока, эвкалипта, розмарина, тимьяна близко по направленности и составу к заявляемой кормовой добавке, однако использованы они для получения биопрепарата с пробиотическими свойствами.

Известна кормовая добавка для повышения резистентности и продуктивности сельскохозяйственных животных и птицы, содержащая эфирное масло растительного сырья и наполнитель, RU №2297775 C1, А23К 1/16, А23К 1/14, 27.04.2007.

Данное техническое решение принято в качестве ближайшего аналога настоящего изобретения.

Кормовая добавка ближайшего аналога имеет простой состав и состоит из эфирного масла душицы, органического растворителя (1,2 пропандиол) и дистиллированной воды. В органическом растворителе молекулы эфирного масла душицы равномерно распределяются и способствуют равномерному распределению масла душицы в объеме воды и в организме животных и птицы.

Эфирное масло душицы улучшает аппетит, активизирует ферменты, борется с большим количеством болезнетворных организмов, его использование в составе кормовой добавки обусловлено улучшением аппетита и активизацией ферментов.

Однако в ближайшем аналоге использование эфирных масел иного растительного сырья и носителя на минеральной основе для получения кормовых добавок в ближайшем аналоге не предусмотрено.

В основу настоящего изобретения положено решение задачи, позволяющей выявить новую кормовую добавку с высокой фитобиотической активностью на минеральной основе для использования в составе корма для сельскохозяйственных животных и птицы.

Технический результат настоящего изобретения заключается в обеспечении иммуномодулирующего и антиоксидантного действия, антимикробной активности и противовоспалительного эффекта за счет введения смеси эфирных масел эвкалипта, чабреца, чеснока и лимона и в нормализации процессов пищеварения за счет использования в качестве носителя диатомита в виде обожженной крошки при взаимодополняющем взаимодействии с сухим концентратом смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка в составе кормовой добавки.

Согласно изобретению эта задача решается за счет того, что кормовая добавка с фитобиотической активностью на минеральной основе используется в составе корма для сельскохозяйственных животных и птицы.

Кормовая добавка содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона при соотношении 1:2:1:2, соответственно, нанесенную на диатомит в виде обожженной крошки при соотношении 1:10 и высушенную с получением сухого концентрата смеси эфирных масел в виде порошка.

Кормовая добавка содержит наполнитель, в качестве которого использован диатомит в виде обожженной крошки.

Компоненты кормовой добавки взяты в следующих количествах, г:

сухой концентрат смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка - 40-180; наполнитель - 960-820, кормовая добавка в составе корма взята при соотношении 0,001:1.

Заявителем не выявлены источники, содержащие информацию о технических решениях, идентичных настоящему изобретению, что позволяет сделать вывод о его соответствии критерию «новизна».

За счет реализации отличительных признаков изобретения (в совокупности с признаками, указанными в ограничительной части формулы) достигаются важные новые свойства объекта.

Выявление смеси эфирных масел эвкалипта, чабреца, чеснока и лимона, обладающих иммуномодулирующим действием, и использование сухого концентрата этой смеси в виде порошка с диатомитом в виде обожженной крошки позволяет получить новую кормовую добавку с высокой фитобиотической активностью.

Заявителю не известны какие-либо публикации, которые содержали бы сведения о влиянии отличительных признаков изобретения на достигаемый технический результат. В связи с этим, по мнению заявителя, можно сделать вывод о соответствии заявляемого технического решения критерию «изобретательский уровень».

Настоящее изобретение осуществляют следующим образом.

Кормовую добавку с фитобиотической активностью используют в составе корма для сельскохозяйственных животных и птицы.

В кормовой добавке в качестве наполнителя использован диатомит Инзенского месторождения Ульяновской области.

Диатомит - осадочная горная порода, рыхлая или слабосцементированная, состоящая из останков диатомовых водорослей и имеющая серый или желтый цвет слабых тонов.

Химически диатомит более чем на 80% состоит из водного кремнезема.

Диатомит в виде обожженной крошки поставляет "Диатомовый Комбинат", г. Инза Ульяновской области.

В кормовой добавке использован диатомит в виде обожженной крошки фракций 0,3-0,7 мм с влажностью не больше 9%.

Кормовая добавка содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона.

Эвкалиптовое масло обладает противовоспалительными, антисептическими, противоинфекционными свойствами. Укрепляя иммунную систему, эфирное масло эвкалипта активно борется с вирусными инфекциями и воспалительными процессами. Благотворно эвкалиптовое масло влияет и на работу желудочно-кишечного тракта.

Эфирное масло чабреца повышает иммунитет, обладает противовоспалительным свойством, нормализует ферментацию желудка, является антисептическим средством.

Чесночное масло обладает мощным антисептическим действием, а также противомикробным, антитоксическим, противовирусным, бактерицидным и тонизирующим. Антисептические, бактерицидные и антитоксические свойства чеснока делают его ценным средством в борьбе с инфекцией.

Лимонное масло имеет выраженную противовирусную активность, помогает бороться с инфекциями и укрепляет иммунную систему. Основные свойства, которыми обладает лимонное масло: антисептическое, бактерицидное, дезинфицирующее и иммуностимулирующее.

Смесь эфирных масел эвкалипта, чабреца, чеснока и лимона взята при соотношении 1:2:1:2, соответственно.

Эфирные масла чабреца и лимона взяты в увеличенном в два раза количестве для повышения антисептических свойств кормовой добавки, что было подтверждено экспериментальными исследованиями.

Из смеси эфирных масел эвкалипта, чабреца, чеснока и лимона готовят сухой концентрат в виде порошка.

Приготовление сухого концентрата смеси эфирных масел

Смесь эфирных масел эвкалипта, чабреца, чеснока и лимона наносят на диатомит в виде обожженной крошки, помещенный в смеситель СМ-150, при соотношении 1:10. Влажный препарат раскладывают на лотки.

Высушивание препарата проводят в шкафах сушильных РТ-ШС. В шкафы завозят лотки с разложенным на них препаратом.

Высушивание препарата проводят воздушно-тепловым способом при температуре от 55°C до 60°C в течение 9 часов до конечной влажности 7,0-7,2%.

После сушки препарат направляют на размол на дробилку кормов ДКР-3. Препарат размалывают до состояния порошка.

Приготовление кормовой добавки

Сухой концентрат смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка в количестве 40 г смешивают с диатомитом в виде обожженной крошки в количестве 960 г в смесителе СМ - 150.

Сухой концентрат смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка в количестве 180 г смешивают с диатомитом в виде обожженной крошки в количестве 820 г в смесителе СМ - 150.

Количество смеси эфирных масел в интервале 40-180 г и диатомита в интервале 960-820 г является оптимальным и определено экспериментально при проведении исследований на стадии приготовления кормовой добавки.

Кормовую добавку в составе корма берут при соотношении 0,001:1.

Количество кормовой добавки в составе корма сбалансировано и подтверждено экспериментально.

Исследования по использованию кормовой добавки в предложенных соотношениях представлены в примерах 1-3.

Пример 1

Использование кормовой добавки с фитобиотической активностью в птицеводстве

Опыт проводили на базе ФГУП Загорское ЭПХ ВНИТИП Россельхозакадемии на цыплятах-бройлерах кросса «Кобб авиан-48».

Выращивание цыплят-бройлеров проведено в клеточной батарее типа Р-15.

Было сформировано 2 группы цыплят-бройлеров по 35 голов в каждой.

Первая и вторая группы цыплят-бройлеров получали рассыпные комбикорма вволю.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) комбикормов с кормовой добавкой с фитобиотической активностью (1000 г/т).

Питательность комбикормов соответствовала рекомендуемым нормам для кросса, в структуру комбикормов был включен подсолнечный жмых (12,5% по массе комбикорма) и отруби пшеничные (5% по массе комбикорма) в ростовой и финишный периоды выращивания.

Основные зоотехнические показатели опыта на цыплятах-бройлерах при использовании кормовой добавки с фитобиотической активностью представлены в таблице 1.

Из таблицы 1 видно, что эффективность введения кормовой добавки с фитобиотической активностью в ОР в опытной группе 2 очевидна: среднесуточный прирост живой массы на 1,9% выше в сравнении с контрольной группой 1, а затраты корма в опытной группе 2 ниже на 1,6%.

Результаты балансового опыта представлены в таблице 2 (Переваримость и использование питательных веществ корма у цыплят-бройлеров при использовании кормовой добавки с фитобиотической активностью).

Результаты балансового опыта подтвердили эффективность кормовой добавки с фитобиотической активностью при включении в комбикорм цыплятам-бройлерам.

Пример 2

Использование кормовой добавки с фитобиотической активностью в свиноводстве.

Опыт проводили на свиноферме ОАО ПЗ «Пламя» Ленинградской области. Продолжительность опыта составляла 60 дней.

Было сформировано 2 группы поросят-отъемышей по 50 голов в каждой.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) комбикормов с кормовой добавкой с фитобиотической активностью.

Комбикорм был приготовлен на Гатчинском комбикормовом заводе, из расчета 120 г кормовой добавки с фитобиотической активностью на 1 тонну комбикорма.

Результаты проведенных исследований приведены в таблице 3 (Зоотехнические показатели выращивания поросят-отъемышей при использовании кормовой добавки с фитобиотической активностью).

Применение кормовой добавки с фитобиотической активностью способствовало повышению иммунитета у животных, нормализации процессов пищеварения, повышению переваримости и усвояемости питательных веществ рациона, что положительно повлияло на рост и развитие поросят-отъемышей.

Из таблицы 3 видно, что во 2 опытной группе среднесуточные привесы у поросят-отъемышей были выше на 4,7%, а затраты корма на 1 кг ниже на 0,28 к. ед.

Кормовая добавка с фитобиотической активностью в составе комбикорма стабилизирует микрофлору, препятствует попаданию инфекции в желудочно-кишечный тракт, помогает животному переживать стрессы, вызванные кормлением и сердечно-сосудистыми заболеваниями.

Кормовая добавка с фитобиотической активностью в составе комбикорма благотворно влияет на воспроизводительную функцию свиноматок, увеличивает иммунитет и выживаемость поросят-отъемышей.

Пример 3

Использование кормовой добавки с фитобиотической активностью в составе корма крупного рогатого скота

Опыт проводили в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области. Продолжительность опыта составила 92 дня.

Было сформировано 2 группы дойных коров черно-пестрой породы второй и третьей лактации. Животные находились на привязном содержании.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) с кормовой добавкой с фитобиотической активностью.

Основной рацион содержал: комбикорм - 7 кг, силос - 30 кг, сено - 1,5 кг, пивная дробина - 5 кг, жмых подсолнечный - 1,2 кг, патока - 0,2-1,0 кг.

Кормовую добавку с фитобиотической активностью вводили в ОР из расчета 100 г на 1 тонну комбикорма.

Результаты проведенных исследований приведены в таблице 4 (Продуктивность коров и качество молока дойных коров черно-пестрой породы при использовании кормовой добавки с фитобиотической активностью).

Из таблицы 4 видно, что за период опыта количество соматических клеток в молоке коров во 2 опытной группе снизилось на 20% по сравнению с животными в 1 контрольной группе. Среднесуточный удой молока натуральной жирности во 2 опытной группе был выше на 3,0 кг. Содержание жира в молоке у животных во 2 опытной группе было выше на 0,19%, что позволило дополнительно получить 4,1 кг молока 4%-ной жирности на 1 голову в сутки.

Полученная разница по сумме молочного жира и белка у коров во 2 опытной группе (96,2 кг и 79,46 кг соответственно) по сравнению с животными в 1 контрольной группе (81,1 кг и 67,82 кг соответственно) может быть обусловлена изменением направленности межуточного обмена. Сопоставимый анализ между группами показывает, что более высокий показатель жирномолочности у животных во 2 опытной группе получили как за счет увеличения надоя, так и увеличения процентного содержания жира и белка в молоке.

Кормовая добавка с фитобиотической активностью в составе комбикорма при кормлении крупного рогатого скота способствует нормализации рубцового пищеварения, улучшает синтез летучих жирных кислот. У лактирующих коров кормовая добавка с фитобиотической активностью снижает содержание соматических клеток в молоке, повышает молочную продуктивность и улучшает качество молока. Использование кормовой добавки с фитобиотической активностью для профилактики маститов позволяет получать товарное молоко.

Смесь эфирных масел в кормовой добавке с фитобиотической активностью обладает антимикробной активностью, антиоксидантным действием и противовоспалительным эффектом.

Полученные результаты на основании Примеров 1-3 подтверждают целесообразность использования новой кормовой добавки с фитобиотической активностью.

Фитобиотическая активность - стимулирование полезной микрофлоры кишечника и подавление условно-патогенной микрофлоры.

Фитобиотическую активность кормовой добавки определяли с использованием молекулярно-генетического метода на основе T-RFLP-анализа.

ДНК из содержимого кишечника экстрагировали с использованием коммерческого набора DNA Purification Kit (Fermentas, Литва).

ПЦР-амплификацию генов 16S рРНК бактерий проводили с использованием праймеров: 63F (CAGGCCTAACACATGCAAGTC) - с меткой на 5′-конце (флуорофор D4 - WellRed); 1492R (TACGGHTACCTTGTTACGACTT).

Амплифицированный фрагмент выделяли из агарозного геля помощью 3 М раствора гуанидина тиоционата.

Рестрикцию ампликонов проводили с использованием рестриктаз НаеIII, HhaI и MspI (Fermentas) в течение 2 ч при 37°C. После окончания рестрикции ДНК из реакционной смеси осаждали этанолом, растворяли в SLS (Beckman Coulter) с последующим добавлением маркера молекулярного веса - 600 п. н. (Beckman Coulter). Следующим этапом анализа являлась флуоресцентная детекция целевой ДНК на автоматическом секвенаторе CEQ8000 (Beckman Coulter).

Вычисление размеров пиков и их площади проводили с использованием программного блока Fragment Analysis (Beckman Coulter). Для идентификации пиков T-RFLP-граммы для трех эндонуклеаз (НаеIII, HhaI и MspI) обрабатывали с помощью программы Fragment Sorter (http://www.oardc.ohio-state.edu/trflpfragsort/index.php).

Предложенная кормовая добавка с фитобиотической активностью получена по известным биотехнологиям, имеющим широкое применение в сельском хозяйстве, и проведенные опытные работы на базе ФГУП Загорское ЭПХ ВНИТИП Россельхозакадемии, на свиноферме ОАО ПЗ «Пламя» Ленинградской области и в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области обусловливают, по мнению заявителя, ее соответствие критерию «промышленная применимость».

Предложенная кормовая добавка с фитобиотической активностью позволяет:

- повысить иммунитет у сельскохозяйственных животных и птицы;

- нормализовать процессы пищеварения;

- повысить усвояемость питательных веществ корма.

Кормовая добавка с фитобиотической активностью на минеральной основе, используемая в составе корма для сельскохозяйственных животных и птицы, характеризующаяся тем, что она содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона при соотношении 1:2:1:2, соответственно, нанесенную на диатомит в виде обожженной крошки при соотношении 1:10 и высушенную с получением сухого концентрата смеси эфирных масел в виде порошка, а также наполнитель, в качестве которого использован диатомит в виде обожженной крошки, при этом компоненты кормовой добавки взяты в следующих количествах, г:
сухой концентрат смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка - 40-180; наполнитель - 960-820, а кормовая добавка в составе корма взята при соотношении 0,001:1.


Похожие патенты:

Изобретение относится к сельскому хозяйству и биотехнологии, а именно к составу кормовой добавки с пробиотической активностью и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы.
Изобретение относится к ветеринарии, в частности к способам лечения щенков, склонных к запорам или страдающих от него. Способ включает регулирование баланса метаболизируемых катионов по отношению к метаболизируемым анионам в композиции корма, потребляемой щенком, с помощью количества, достаточного для улучшения качества стула, посредством уменьшения баланса метаболизируемых катионов по отношению к метаболизируемым анионам, потребляемым щенком, для получения более жидкого стула.

Изобретение относится к области сельского хозяйства, в частности к птицеводству. Способ предусматривает с момента посадки племенных цыплят до момента перевозки их в корпуса для взрослого поголовья, а в дальнейшем в начале яйцекладки и на пике яйценоскости выпаивать птице с водой антистрессовый водорастворимый препарат «Magic Аntistress Мix» в дозе 100 г на 100 л воды, причем препарат выпаивают птице в периоды стрессов и пиков в 10 курсов по 5-10 дней: с 1 по 5 сутки жизни (при посадке), далее 9-13 (дебикирование), 21-25 (вакцинация), 27-31 (вакцинация), 45-49 (сортировка), 63-67 (вакцинация), 75-79 (перевозка), 105-110 (вакцинация, начало яйцекладки), 148-157 (выход на пик) и 238-246 суток жизни (поддержка в пик).

Изобретение относится к кормопроизводству, в частности к способу приготовления корма на основе соевого белкового компонента. Способ включает использование предварительно подготовленного соевого белкового и минерального компонентов с последующим их смешиванием в определенном соотношении, получением гранул и их сушкой.
Изобретение относится к ветеринарной медицине. Для выращивания телят вводят в рацион стимулирующую минеральную кормовую добавку, в качестве которой используют препарат мицеллат углекислого кальция «Алексанат Зоо».

Изобретение относится к органическим хелатированным минеральным композициям и способам их получения. Способ получения минерального продукта включает контактирование карбоновой кислоты и неорганического минерального соединения, достаточное для образования раствора, реагирование раствора в течение периода времени, достаточного для получения минерального хелатированного соединения и одного или нескольких газов и/или паров, пассивное удаление одного или нескольких газов и/или паров с образованием быстрорастворимого минерального хелатированного продукта.

Способ приготовления белково-минерального продукта для птицы относится к кормопроизводству и, в частности, к способам приготовления кормов для сельскохозяйственной птицы.

Изобретение относится к области ветеринарии. Способ предусматривает введение в основной рацион средства активизации воспроизводительной функции свиней, в 100 г которого содержатся: витамин А (ретинола ацетат) - 100 тыс.
Изобретение относится к кормлению сельскохозяйственных жвачных животных, в частности молочных коров. Способ повышения биосинтеза молочного жира у высокопродуктивных коров предусматривает введение в состав рациона буферной смеси в количестве 100 г/гол./сутки.
Изобретение относится к ветеринарии. Лечебно-профилактическое средство для сельскохозяйственных животных содержит соли натрия, соли калия, калия хлорид и вспомогательное вещество.

Изобретение относится к сельскому хозяйству и биотехнологии, а именно к составу кормовой добавки с пробиотической активностью и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы.

Группа изобретений относится к стабильной сухой композиции, способу ее изготовления. Композиция содержит биоактивный микроорганизм или материал, два стабилизирующих агента - альгинат натрия и инулин, и два защитных агента - дисахарид и белковый гидролизат.

Изобретение относится к биотехнологии и представляет собой новую фитазу с повышенной термостабильностью. Изобретение касается также применения фитазы в корме для животных для снижения содержания фосфата в навозе, а также в кормовых добавках и кормах для животных.
Изобретение относится к кормлению сельскохозяйственной птицы. Кормовая добавка для цыплят-бройлеров включает минеральные вещества в виде природного бишофита Волгоградского месторождения, при этом кормовая добавка дополнительно содержит препарат незаменимой аминокислоты в виде «L-треонин» при следующем соотношении компонентов, мас.%: природный бишофит Волгоградского месторождения - 90,0-91,0, препарат незаменимой аминокислоты «L-треонин» - 9,0-10,0.
Изобретение относится к производству продуктов кормового назначения, используемых в кормлении сельскохозяйственных животных. Кормовая добавка для сельскохозяйственных животных содержит маточную культуру бактерий, питательную среду и воду.

Изобретение относится к области сельского хозяйства, в частности к птицеводству. Способ предусматривает с момента посадки племенных цыплят до момента перевозки их в корпуса для взрослого поголовья, а в дальнейшем в начале яйцекладки и на пике яйценоскости выпаивать птице с водой антистрессовый водорастворимый препарат «Magic Аntistress Мix» в дозе 100 г на 100 л воды, причем препарат выпаивают птице в периоды стрессов и пиков в 10 курсов по 5-10 дней: с 1 по 5 сутки жизни (при посадке), далее 9-13 (дебикирование), 21-25 (вакцинация), 27-31 (вакцинация), 45-49 (сортировка), 63-67 (вакцинация), 75-79 (перевозка), 105-110 (вакцинация, начало яйцекладки), 148-157 (выход на пик) и 238-246 суток жизни (поддержка в пик).

Изобретение относится к кормопроизводству, в частности к способу приготовления комбикормов. Способ включает смешивание соевого и витаминного компонентов в соответствующих соотношениях.
Изобретение относится к сельскому хозяйству, а именно к кормлению растущего молодняка цыплят. Кормовая добавка для цыплят включает углеводно-протеиновую добавку, состоящую из кормового сахара и дрожжевой суспензии, витамины А, Е и С, фолиевую кислоту и холин.

Изобретение относится к сельскому хозяйству и может быть использовано при производстве кормов. Способ деконтаминации кормов, загрязненных микотоксинами, заключается в их предварительной обработке активированным средством.

Изобретение относится к кормопроизводству, а именно к кормам для домашних животных. Композиция корма для домашних животных содержит от 0,0001 г/кг массы тела животного до 1 г/кг массы тела животного антиметаболита глюкозы и от 2 мг/кг до 140 мг/кг бутилированного гидроксианизола (ВНА) или бутилированного гидрокситолуола (ВНТ) или от 2 мг/кг до 140 мг/кг бутилированного гидроксианизола (ВНА) и бутилированного гидрокситолуола (ВНТ) в суммарном количестве.

Изобретение относится к ветеринарии, в частности к способу профилактики послеродовых заболеваний у свиноматок и повышения жизнеспособности поросят. Способ включает использование жидкой кормовой добавки Вэрва по следующей схеме: свиноматкам с 80-го дня беременности в течение 30 суток вводят с основным рационом жидкую кормовую добавку в дозе 1,0-5,0 мл на животное. Перед смешиванием с кормом препарат предварительно разводят водой в соотношении 1:10. Использование изобретения позволит повысить выживаемость поросят и снизить количество послеродовых осложнений у свиноматок. 4 табл., 2 пр.

Изобретение относится к кормопроизводству, а именно к кормовой добавке с фитобиотической активностью на минеральной основе, которая может использоваться в составе кормов для сельскохозяйственных животных и птицы. Кормовая добавка содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона при соотношении 1:2:1:2, соответственно, нанесенную на диатомит в виде обожженной крошки при соотношении 1:10 и высушенную с получением сухого концентрата смеси эфирных масел в виде порошка, а также наполнитель, в качестве которого использован диатомит в виде обожженной крошки. Все компоненты кормовой добавки взяты в определённых количествах. Кормовая добавка вводится в состав корма при соотношении 0,001:1. Кормовая добавка обеспечивает иммуномодулирующее и антиоксидантное действие, обладает антимикробной активностью и противовоспалительным эффектом. Скармливание кормовой добавки обеспечивает нормализацию процессов пищеварения. 4 табл., 3 пр.
